- THIS ARTICLE
-
Abstract
- Full Text (PDF)
-
All Versions of this Article:
genetics.108.092494v1
180/2/845 most recent - Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Ma, C.
- Articles by Morrissette, N.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Ma, C.
- Articles by Morrissette, N.
Originally published as Genetics Published Articles Ahead of Print on September 9, 2008.
Genetics, Vol. 180, 845-856, October 2008, Copyright © 2008
doi:10.1534/genetics.108.092494
Secondary Mutations Correct Fitness Defects in Toxoplasma gondii With Dinitroaniline Resistance Mutations
Christopher Ma, Johnson Tran, Catherine Li, Lakshmi Ganesan, David Wood and Naomi Morrissette1
Department of Molecular Biology and Biochemistry, University of California, Irvine, California 92697
1 Corresponding author: Department of Molecular Biology and Biochemistry, University of California, Irvine, CA 92697-3900.
E-mail: nmorriss{at}uci.edu
Dinitroanilines (oryzalin, trifluralin, ethafluralin) disrupt microtubules in protozoa but not in vertebrate cells, causing selective death of intracellular Toxoplasma gondii parasites without affecting host cells. Parasites containing
1-tubulin point mutations are dinitroaniline resistant but show increased rates of aberrant replication relative to wild-type parasites. T. gondii parasites bearing the F52Y mutation were previously demonstrated to spontaneously acquire two intragenic mutations that decrease both resistance levels and replication defects. Parasites bearing the G142S mutation are largely dependent on oryzalin for viable growth in culture. We isolated 46 T. gondii lines that have suppressed microtubule defects associated with the G142S or the F52Y mutations by acquiring secondary mutations. These compensatory mutations were
1-tubulin pseudorevertants or extragenic suppressors (the majority alter the β1-tubulin gene). Many secondary mutations were located in tubulin domains that suggest that they function by destabilizing microtubules. Most strikingly, we identified seven novel mutations that localize to an eight-amino-acid insert that stabilizes the
1-tubulin M loop, including one (P364R) that acts as a compensatory mutation in both F52Y and G142S lines. These lines have reduced dinitroaniline resistance but most perform better than parental lines in competition assays, indicating that there is a trade-off between resistance and replication fitness.
TOXOPLASMA gondii is a human pathogen grouped within the Apicomplexa, a phylum of protozoa that comprises all obligate intracellular parasites (LEVENE 1988). Infection with this parasite can be life threatening in immunocompromised individuals and cause birth defects or miscarriage during fetal infection (BLACK and BOOTHROYD 2000). Other apicomplexans such as Plasmodium spp. and Cryptosporidium spp. have considerable medical importance or are animal pathogens that affect livestock. Apicomplexans have a specialized apex that contains unique organelles that coordinate invasion of host cells (MORRISSETTE and SIBLEY 2002a). These parasites are delimited by a pellicle, a composite structure formed by the association of the plasma membrane with the inner membrane complex, an assemblage of flattened vesicles. The invasive stages of apicomplexan parasites have two microtubule populations: subpellicular microtubules and spindle microtubules. Subpellicular microtubules are nondynamic; they maintain both apical polarity and the characteristic crescent shape of the parasite by interacting with the cytoplasmic face of the pellicle. Spindle microtubules form an intranuclear spindle to coordinate chromosome segregation. Both populations are critically important to parasite survival and replication.
Microtubules are built by the polymerization of
-β-tubulin heterodimers and typically contain 13 protofilaments. Protofilaments are formed by longitudinal head-to-tail association of heterodimers and laterally associate to assemble the microtubule lattice (DOWNING and NOGALES 1998). Biochemical and structural studies have elucidated the roles of tubulin domains, which are important to the regulation of microtubule polymerization and depolymerization. Both
- and β-tubulins have H1-S2 (N) and M loops, which coordinate contacts between adjacent protofilaments (NOGALES et al. 1997, 1999; DOWNING and NOGALES 1998; LOWE et al. 2001; LI et al. 2002).
-Tubulin contains an eight-amino-acid insert missing from the analogous region of β-tubulin, which stabilizes the
-tubulin M loop to promote protofilament lateral association. Both
- and β-tubulins bind to GTP; however, only β-tubulin GTP can be exchanged or hydrolyzed while
-tubulin GTP plays a structural role in this subunit (DAVID-PFEUTY et al. 1977; SAGE et al. 1995a,b; NOGALES et al. 1998; ANDERS and BOTSTEIN 2001). The β-tubulin subunits are stimulated to hydrolyze GTP in a polymerization-dependent fashion by association of a GTPase-activating domain from the
-tubulin subunit of the adjacent dimer within the protofilament. Structural evidence indicates that GTP-bound dimers have a conformation that facilitates protofilament contacts by both
- and β-subunits. After hydrolysis, GDP-tubulin dimers have a kinked conformation that is believed to weaken lateral contacts to promote microtubule disassembly (NOGALES et al. 2003; WANG et al. 2005; WANG and NOGALES 2005; NOGALES and WANG 2006a,b).
Protozoan parasites are sensitive to dinitroaniline compounds, which disrupt microtubules to inhibit replication (STOKKERMANS et al. 1996; BOGITSH et al. 1999; MAKIOKA et al. 2000; TRAUB-CSEKO et al. 2001; BHATTACHARYA et al. 2002). Given that these compounds are inactive against vertebrate or fungal tubulins, the mechanism of dinitroaniline action is of particular interest for development of new antimicrobial therapies. Our assays, as well as data from others, indicate that wild-type T. gondii parasites have an IC50 value of 0.25 µM for the dinitroaniline oryzalin and display aberrant phenotypes in culture at 0.5 µM oryzalin (STOKKERMANS et al. 1996; MORRISSETTE and SIBLEY 2002b). Although extracellular parasites are refractory to the effects of microtubule-disrupting drugs, during intracellular growth, parasite microtubules are dynamic and sensitive to disruption by submicromolar concentrations of oryzalin or other dinitroanilines.
Dinitroaniline selectivity is associated with restricted binding to sensitive (plants and protozoa) but not to resistant (vertebrates and fungi) tubulin (HESS and BAYER 1977; MOREJOHN et al. 1987; CHAN and FONG 1990; HUGDAHL and MOREJOHN 1993). Studies using molecular dynamics analysis and compound docking indicate that dinitroanilines interact with a consistent site on multiple conformations of
-tubulin derived from independent molecular dynamics models of T. gondii, Leishmania spp., and Plasmodium spp. tubulins (MORRISSETTE et al. 2004; MITRA and SEPT 2006). Parallel analysis of vertebrate (bovine)
-tubulin reveals that dinitroanilines have nonspecific, low-affinity interactions and no consensus binding site, consistent with in vivo and in vitro observations that these compounds do not bind to vertebrate tubulin or disrupt vertebrate microtubules. This work predicts a binding site on parasite
-tubulin that is located beneath the H1-S2 (N) loop. Since this loop participates in protofilament interactions, the binding site location suggests that dinitroanilines disrupt lateral contacts in the microtubule lattice. Consistent with this notion, a comparison of
-tubulin molecular dynamics simulations in the presence and absence of a bound drug suggests that dinitroaniline binding profoundly limits flexibility of the
-tubulin H1-S2 loop, which is drawn in toward the core of the tubulin dimer (MITRA and SEPT 2006).
T. gondii is a haploid organism for most of its life cycle, although it is capable of sexual recombination during a transient diploid zygote stage. There are three
- and three β-tubulin genes in the genome: the
2 gene appears to be gamete stage specific and the divergent
3 gene may be used to construct the conoid, an unusual structure built of tubulin sheets rather than microtubules (HU et al. 2002). The
1- and β1-tubulin genes are the dominantly expressed forms in the proliferative (tachyzoite) stage of the parasite studied here. We have previously identified a number of
1-tubulin point mutations associated with oryzalin resistance in T. gondii (MORRISSETTE et al. 2004; MA et al. 2007). The mutations are distributed throughout the linear sequence of
1-tubulin. However, when mapped onto a model of T. gondii
1-tubulin based on the structure of the vertebrate tubulin dimer, many of the mutations cluster in specific domains of the protein. For example, many mutations are located in or near domains that are associated with microtubule stability or in the core of
-tubulin, adjacent to or within the dinitroaniline-binding site identified by computational methods. Our working model suggests that most tubulin mutations confer dinitroaniline resistance by one of two possible mechanisms: (1) by increasing subunit affinity within the microtubule to compensate for the action of a bound drug and (2) by reducing the affinity of the tubulin for dinitroanilines by changes to the compound binding site.
Our previous observations that diverse mutations to
1-tubulin are sufficient for conferring resistance to dinitroanilines such as oryzalin in the protozoan parasite T. gondii might suggest that dinitroaniline-binding site ligands are not appropriate for development of antiparasitic agents. However, in many cases, drug resistance mutations isolated under laboratory conditions are not observed in clinical settings since parasites are incapable of robust growth in natural reservoirs. For example, a subset of laboratory-selected dihydrofolate reductase (DHFR) mutations that confer pyrimethamine resistance in Plasmodium falciparum are either rare or not observed in the field (HANKINS et al. 2001; HASTINGS et al. 2002; BATES et al. 2004). Moreover, studies that have exploited growth competition assays to assess the fitness of T. gondii strains bearing wild-type or pyrimethamine-resistant DHFR genes have concluded that even mutant strains that behave similarly to wild-type parasites in vitro can display growth defects in vivo (FOHL and ROOS 2003). We show here that dinitroaniline-resistant parasites have reduced fitness reflected by increased rates of replication defects and poor performance in growth competition assays. These lines rapidly and spontaneously acquire compensatory mutations that correct the fitness defects and reduce resistance to dinitroanilines. We conclude that drugs that selectively target parasite microtubules remain a realistic option for the development of new antiparasitic therapies.
Culture of Toxoplasma lines:
T. gondii tachyzoites (the standard RH strain and mutants derived from the RH strain) were propagated in human foreskin fibroblast (HFF) cells in DMEM with 10% FBS as previously described (ROOS et al. 1994). Oryzalin (Riedel-deHaen, Germany) stock solutions were made up in DMSO. Lines bearing oryzalin-resistance mutations were propagated in 0.5 µM oryzalin to suppress selection of secondary mutations.
Selection of suppressors:
T. gondii lines bearing allelic replacements of the F52Y or G142S mutations to the
1-tubulin gene were generated as previously described (MORRISSETTE et al. 2004; MA et al. 2007). These lines were serially passed for 3–4 weeks in the absence of oryzalin to select for spontaneous mutants with improved growth. After single-cell cloning, the clones displayed robust growth and each of the lines analyzed represents an independently derived (nonsibling) lineage. Clonal lines were analyzed for changes to the
1- or β1-tubulin genes.
Analysis of tubulin point mutations:
The
1- and β1-tubulin genes were amplified from genomic DNA isolated from individual parasite lines as previously described (MORRISSETTE et al. 2004; MA et al. 2007). The
1-tubulin gene was amplified using thermal cycling with primers GAGTCTCGTAGAGAACAAGC (5' UTRA) and CGTTTATACCTTCACCTTTTC (3' UTRA), and the purified fragment was sequenced as previously described. The β1-tubulin gene was amplified with primers GTGGTGTTGCGCCTTC (5' UTRB) and CGAGTGTTTAGGACAGTGAC (3' UTRB) and was sequenced with the following primers: (BT3E1) CATTCTCCGCGATTCTC; (BT5E2) GTCCGGGTGTTCCTAC; (BTF2a) CATCATGGAGACTTTCTCC; (BTR2a) GGAGAAAGTCTCCATGATG; (BTF2b) CAAAGAACATGATGTGCG; (BTR2b) CGCACATCATGTTCTTTG; (BT3E2) CTCGTCCATACC TTCACC; (BT5E3) GAGATGGCACATTTAGTGTG; (BT3E3) CTCCCTCTTCCTCTGC; and (BT5E4) CCGAGTATCAGCAGTACC. DNA sequences were analyzed using Sequencher software (GeneCodes) to identify point mutations in the coding sequence of the
1-tubulin or β1-tubulin genes. We also checked lines for
2-,
3-, β2-, and β3-tubulin mutations but did not identify any changes to these genes.
Structural models of T. gondii tubulin:
Point mutations were mapped onto models of T. gondii tubulin using PyMol (DELANO 2002). The models (containing a rebuilt H1-S2 loop) were previously generated for computational studies (MORRISSETTE et al. 2004; MITRA and SEPT 2006).
Immunofluorescence staining:
Extracellular parasites were fixed, permeablized, and stained in suspension as previously described (MORRISSETTE and SIBLEY 2002b). The T. gondii plasma membrane was labeled with DG52 antibody (BURG et al. 1988) and detected with an Alexa 594 secondary antibody (Invitrogen). DNA was visualized with DAPI. Suspension samples were allowed to settle onto 35-mm dishes with glass coverslip insets (MatTek). Images were collected on a Zeiss Axioskop using the Axiovision camera and software. Images were exported and manipulated in Photoshop 8.0.
Quantification of replication defects:
T. gondii were passed into HFF cells without oryzalin selection and allowed to grow until complete host cell lysis. Extracellular parasites were viewed in suspension in MatTek dishes with a coverslip inset using a x63 phase-contrast lens on a Zeiss Axioskop microscope. Images were captured as tif files and scored by counting as previously described (MA et al. 2007). To avoid underrepresenting aberrant forms, we counted the number of apical regions to establish total parasites lost from the parasite population through replication defects.
Competition assays:
T25 flasks with confluent HFF cells were inoculated with a 1:1 ratio of RH-strain-derived lines described here and wild-type (RH strain) parasites expressing cytosolic GFP (1 x 107 parasites from each line) (KIM et al. 2001). After host monolayer lysis, a new T25 flask with confluent HFF cells was inoculated with 1.0 ml of the lysed culture and the remaining material (5 ml) was used for flow cytometry analysis. Extracellular parasites were purified away from host cell debris by passing lysate through a 3-µm filter. After parasites were collected by centrifugation (all spins performed at 6000 rpm for 6 min), they were fixed in 1.0% formalin (Sigma) for 1 min at RT. After a PBS wash, parasites were blocked in 10% (w/v) BSA/PBS (Fisher Scientific) for 30 min at 4° and surface labeled with DG52 anti-P30/SAG1 mouse antibody [30 min at 4°, 1:1000 in 10% (w/v) BSA/PBS] and a PE-Cy5.5-conjugated goat anti-mouse secondary antibody (Invitrogen) for 30 min at 4°, 1:1000 in 10% (w/v) BSA/PBS. The total number of parasites (PE-Cy5.5 labeling) and the number of parasites with GFP fluorescence were enumerated by flow cytometry using a FACSCalibur flow cytometer (Becton Dickinson) and analyzed with Flowjo software (Tree Star). The trend lines represent the percentage of total mutant parasites at each time point, and the analysis was carried out for 7 and 15 serial parasite passages.Toxoplasma
1-tubulin mutations are associated with oryzalin resistance but have fitness defects:
We previously isolated a number of T. gondii lines that have mutations to
1-tubulin that are sufficient for conferring resistance to dinitroanilines such as oryzalin (MORRISSETTE et al. 2004; MA et al. 2007). Among the lines isolated in our work are two that are oryzalin resistant due to point mutations F52Y or G142S in the
1-tubulin gene (Figure 1). Parasites bearing the G142S mutation are resistant to 1.0 µM oryzalin. G142 participates in binding the
-phosphate portion of GTP (GIGANT et al. 2000; LOWE et al. 2001), and parasites with the G142S mutation are largely dependent on the presence of oryzalin for viable growth in culture. F52 is located in the H1-S2 loop, a domain that is critically important for protofilament–protofilament associations in the microtubule lattice (LI et al. 2002). Parasites bearing the F52Y mutation have high rates of defective replication and have been shown to spontaneously acquire compensatory mutations. We previously reported that parasites with the F52Y mutation were resistant to 7 µM oryzalin (MA et al. 2007). In the course of carrying out the experiments reported here, we discovered that parasites bearing this mutation rapidly acquire secondary mutations (even when under 0.5 µM oryzalin selection) and that the true resistance of the parental line is 13 µM. Relative to wild-type T. gondii, both F52Y and G142S parasite lines have high rates of overt replication defects (Figure 1B). We previously quantified the total percentage of aberrant extracellular parasites for wild type (
4%) and the F52Y (
13%) line (MA et al. 2007). Using a similar analysis, the G142S line has
19% replication defects when grown in the absence of oryzalin (not shown).
|
Defects are corrected by compensatory mutations in lines derived from the two parental parasite strains:
When T. gondii parasites bearing an allelic integration of the F52Y or G142S mutation are passed for several generations in the absence of oryzalin selection, they spontaneously acquire mutations that allow them to grow with increased robustness. After single-cell cloning independently selected lines with improved growth, we analyzed the sequences of T. gondii
1- and β1-tubulin genes for mutations associated with suppression of defects. We identified both
1-tubulin pseudorevertants and extragenic mutations in β1-tubulin and other (unidentified) genes. We isolated 27 independent lines from the F52Y line and identified mutations that localize to
1-tubulin or β1-tubulin in 22 of these lines (Figure 2 and Table 1). Two of the
1-tubulin mutations are located in the M or H1-S2 (N) loops and seven mutations are located in the eight-amino-acid
-tubulin-specific insert. Six of the lines have mutations to the β1-tubulin gene; two of these are in the M or H1-S2 (N) loops. The G142S resistance mutation alters the GGGTGSG tubulin motif, which is associated with binding the phosphate portion of GTP. Of the 24 G142S-derived lines characterized here, 13 acquired a secondary mutation in the
1-tubulin gene (Figure 3 and Table 2). One of these mutations is associated with GTP binding (S171A), two localized in the eight-amino-acid
-tubulin-specific insert, and one is in the M loop. We also isolated 13 lines with extragenic suppressors, with 11 of these occurring in the β1-tubulin gene and 2 being in other, unidentified loci. During the course of these studies we did not identify any true revertants of F52Y or G142S parasites.
|
|
|
|
Growth competition assays indicate that the derived lines have increased fitness relative to the parental strains:
We have exploited an established GFP-expressing T. gondii line to assess the relative fitness of the F52Y and G142S parasite lines and the derived progeny (KIM et al. 2001). Both the GFP-expressing line and the tubulin mutant lines are derived from RH strain T. gondii. We co-infected HFF cells with an equivalent number of GFP-expressing parasites and parasites of each tubulin mutant line and exploited green fluorescence to follow the relative rates of replication and growth over serial passage (Figure 4). Parasites from lysed flasks were used to inoculate new flasks such that they would lyse the host cell monolayer in 2 days. The remainder of each sample was analyzed by flow cytometry. In initial experiments, the parasites were labeled with the DG52 (anti-SAG1) antibody to ensure that the entire parasite population was visualized for analysis (Figure 4 inset). Once we were confident that our gating had captured the parasite population, we omitted the DG52 labeling, with consistent results. At each time point, the total number of parasites and the number of GFP-labeled parasites were determined. Nonfluorescing parasites represent the fraction of the population expressing the specific tubulin mutation(s). These growth competition assays indicate that the F52Y and G142S lines compete poorly with wild-type GFP parasites (Figure 4). After 6 days, the G142S line is not detectable and at 8 days the F52Y line cannot be detected. In contrast, the β1-P61A and
1-P364R lines that are derived from the G142S and F52Y parasites are still present at this time, although their declining percentage in the population indicates that they are less fit than the GFP-RH line. As a control, we also carried out growth competition for wild-type RH parasites vs. the GFP-expressing parasites. Over time, we reproducibly observed that the GFP-expressing parasites were at a disadvantage relative to the wild-type RH T. gondii. Therefore, the growth competition using GFP-RH parasites underestimates the fitness defects associated with the dinitroaniline resistance mutations and the associated suppressed lines. We analyzed all of the F52Y- and G142S-derived lines after 2 weeks in serial passage with GFP-RH parasites to assess relative fitness relationships in competition with wild-type parasites (Figures 5 and 6). In most cases, lines with compensatory mutations do not fully recover robust growth. The most effective F52Y-derived lines with respect to fitness are point mutations at T51A (the
-tubulin H1-S2 loop), P364A (the
-tubulin insert), and G34S (the β-tubulin H1-S2 loop), which were still all <50% of the culture after 2 weeks (Figure 5 and Table 3). The most effective G142S-derived lines are S171A (an
-tubulin GTP-binding site residue), L230V (located in helix 7 of
-tubulin), and V363A (in the
-tubulin insert). The L230V line is present in
50% of the culture after 2 weeks (Figure 6 and Table 3). However, since the GFP-RH parasites have a fitness defect relative to unlabeled RH strain wild-type parasites, it is still likely that the L230V line would compete unfavorably with wild-type T. gondii.
|
|
|
|
The derived lines have diminished oryzalin resistance relative to the parental strains:
The F52Y and G142S parasite lines display 13 and 1.0 µM oryzalin resistance, respectively. Lines derived from these parental strains display reduced oryzalin resistance (Figures 5 and 6 and Table 3). With respect to the F52Y-derived lines, the P364R line retains the highest level of oryzalin resistance (7 µM) and competes relatively well with the GFP-RH parasites. Since the G142S line parasites have 1 µM oryzalin resistance, the range of resistance observed in the derived lines is substantially lower. A number of the lines (the Q256H, S287P, and V363A mutations in
-tubulin and the P358R and A393V mutations in β-tubulin) do not have greater resistance to oryzalin than that observed for wild-type parasites (<0.5 µM by morphological criteria). Lines with secondary mutations at S171A and L230V retain the highest levels of oryzalin resistance in the context of the greatest degree of overall fitness in the competition assay. All 46 lines bearing compensatory mutations are associated with diminished oryzalin resistance.
-tubulin insert domain, which are predicted to decrease microtubule stability. We attempted to express GFP-tagged vertebrate tubulin with analogous mutations in COS-7 cells to visualize differential assembly of these tubulins. Unfortunately, expression appeared to be somewhat toxic and the patterns were too variable to be used to assess the relative stability of tubulins with these mutations (J. TRAN and N. MORRISSETTE, data not shown).
Many of the secondary mutations are identical or quite similar to previously identified mutations that decrease microtubule stability in Caenorhabditis elegans and Arabidopsis thaliana. C. elegans sensory neuron function requires unusual 15-protofilament microtubules (CHALFIE and THOMSON 1979, 1982; CHALFIE 1982; CHALFIE et al. 1986; SAVAGE et al. 1989, 1994). These microtubules are built from dimers encoded by distinct
- (mec-12+) and β- (mec-7+) tubulin genes (SAVAGE et al. 1989, 1994; GU et al. 1996; FUKUSHIGE et al. 1999). A number of mec-7 and mec-12 alleles have been identified in screens for sensory neuron defects. In addition, mutations in Arabidopsis that convert linear growth of plant parts (such as roots and stems) to a twisted phenotype have altered cortical microtubule arrays. This twisting morphology can be phenocopied by treatment of wild-type plants with the microtubule inhibitor propyzamide. Many of the twisting mutants have mutations to
- and β-tubulin that decrease microtubule stability and increase plant sensitivity to microtubule-disrupting drugs (THITAMADEE et al. 2002; ABE et al. 2004; NAKAJIMA et al. 2004, 2006; SHOJI et al. 2004; ABE and HASHIMOTO 2005; ISHIDA and HASHIMOTO 2007; ISHIDA et al. 2007a,b). The β-tubulin mutation G34S (a F52Y suppressor) was previously identified as a mild, recessive mec-7 allele (SAVAGE et al. 1989). Other mec-7 alleles (P61L/S, G269D, R318G, and A393T) alter equivalent residues to different substitutions in T. gondii β-tubulin (the F52Y suppressor G269V and the G142S suppressors P61A, R318C, and A393V). The G142S secondary mutation I355E in
-tubulin is adjacent to the location of the mec-12 allele G354E. Moreover, the A393 residue is also identified as a threonine substitution causing twisting in Arabidopsis β-tubulin (A394T). The F52Y compensatory mutations V181I and K280N in
-tubulin and H396Q in β-tubulin and the G142S mutation P348L (
-tubulin) are near the twisting mutations S180P, A180T, A281T, and T349I (
-tubulin) and A394T (β-tubulin). Finally, the G142S suppressor Q291E is adjacent to a second glutamine at 292 that is a mec-7 allele (Q292P). This residue also influences microtubule stability in the context of epothilone resistance (Q292G) and suppresses hyperstabilized microtubules (Q292H) in D45Y colchicine-resistant cells (HE et al. 2001; WANG et al. 2004).
One of the novel findings presented in this work is the identification of a set of seven mutations that localize to the
-tubulin-specific insert (TVVPGGDL). The compensatory mutations in the F52Y line that localize to the insert are T361P, P364A, P364R, G366R, D367V, and L368F and in the G142S line mutations are V363A and P364R. To our knowledge, the insert substitutions represent the first description of mutations located in this highly conserved domain. We hypothesize that these substitutions impair the ability of the insert to promote M-loop lateral contacts with the adjacent protofilament. Indeed, the D367V mutation eliminates a salt bridge that occurs with R229 (MA et al. 2007). Strikingly, the P364R mutation functions as a compensatory mutation in both lines, albeit more successfully in the F52Y line (compare competition results in Figures 5 and 6 and Table 3). Although the G142S/P364R line does not compete effectively enough with wild-type parasites to remain in the culture at 14 days, it was isolated as a line with improved growth over the G142S line and at some subtle level is likely to improve fitness of the parental line. This is also likely to be the explanation for the F52Y suppressor A295G in competition at 14 days (Table 3).
The studies presented here show a correlation between acquisition of increased fitness and the appearance of mutations in the
1- or β1-tubulin genes. While the improved fitness observed in parasite lines derived from the F52Y and G142S parental strains is likely due to secondary tubulin mutations, other (nontubulin) mutations may also contribute to the observed phenotypes of decreased resistance and enhanced growth. Indeed, five of the lines derived from the F52Y suppressor screen and two lines derived from the G142S suppressor screen have improved growth but do not have altered
1-,
3-, β1-, or β3-tubulin genes, suggesting that nontubulin compensatory mutations do arise. Moreover, although we have created allelic replacements for two
-tubulin pseudorevertants in wild-type parasites (MA et al. 2007), we cannot create allelic replacements for the β-tubulin suppressors since we cannot select for these in the absence of dinitroaniline selection. When we analyzed the allelic replacements for the
-tubulin pseudorevertants (F52Y/A273V and F52Y/D367V) in the competition assay, they performed differently from the equivalent lines with these spontaneous mutations. Surprisingly, in both cases the transgene versions of the lines had greater fitness levels than the spontaneous mutant lines (data not shown). The suppressed lines described here were isolated after 4–6 weeks of growth in media without oryzalin. This represents the shortest time in which we could observe parasites with new mutations. In contrast, it takes at least 6 weeks to isolate transgene-bearing lines. We predict that further growth of lines with impaired fitness in the absence of oryzalin selection would select for additional mutations that collectively contribute to increased fitness.
Previous studies have established that there is a tradeoff between carrying genes that confer drug resistance and the fitness cost of these altered alleles, particularly in the absence of drug selection. Recent field studies from Malawi indicate that P. falciparum parasites in this region lost resistance to chloroquine in <10 years after sulfadoxine–pyrimethamine treatment replaced chloroquine treatment for individuals suffering from malaria (LAUFER et al. 2006; VOGEL 2006). These field observations, as well as the controlled laboratory studies of DHFR mutations in P. falciparum and T. gondii described in the Introduction, indicate that the existence of mutant lines that express resistant forms of target proteins does not rule out the development and use of agents that inhibit these proteins. With respect to the studies presented here, we believe that although dinitroanilines or other microtubule-disrupting compounds do not yet exist in an appropriate form for treatment of parasite infections, selectively targeting protozoan tubulin remains a viable strategy for eliminating parasite infections.
ABE, T., and T. HASHIMOTO, 2005 Altered microtubule dynamics by expression of modified alpha-tubulin protein causes right-handed helical growth in transgenic Arabidopsis plants. Plant J. 43: 191–204.[CrossRef][Medline]
ABE, T., S. THITAMADEE and T. HASHIMOTO, 2004 Microtubule defects and cell morphogenesis in the lefty1lefty2 tubulin mutant of Arabidopsis thaliana. Plant Cell Physiol. 45: 211–220.
ANDERS, K. R., and D. BOTSTEIN, 2001 Dominant-lethal alpha-tubulin mutants defective in microtubule depolymerization in yeast. Mol. Biol. Cell 12: 3973–3986.
BATES, S. J., P. A. WINSTANLEY, W. M. WATKINS, A. ALLOUECHE, J. BWIKA et al., 2004 Rare, highly pyrimethamine-resistant alleles of the Plasmodium falciparum dihydrofolate reductase gene from 5 African sites. J. Infect. Dis. 190: 1783–1792.[CrossRef][Medline]
BHATTACHARYA, G., M. M. SALEM and K. A. WERBOVETZ, 2002 Antileishmanial dinitroaniline sulfonamides with activity against parasite tubulin. Bioorg. Med. Chem. Lett. 12: 2395–2398.[CrossRef][Medline]
BLACK, M. W., and J. C. BOOTHROYD, 2000 Lytic cycle of Toxoplasma gondii. Microbiol. Mol. Biol. Rev. 64: 607–623.
BOGITSH, B. J., O. L. MIDDLETON and R. RIBEIRO-RODRIGUES, 1999 Effects of the antitubulin drug trifluralin on the proliferation and metacyclogenesis of Trypanosoma cruzi epimastigotes. Parasitol. Res. 85: 475–480.[CrossRef][Medline]
BURG, J. L., D. PERELMAN, L. H. KASPER, P. L. WARE and J. C. BOOTHROYD, 1988 Molecular analysis of the gene encoding the major surface antigen of Toxoplasma gondii. J. Immunol. 141: 3584–3591.[Abstract]
CHALFIE, M., 1982 Microtubule structure in Caenorhabditis elegans neurons. Cold Spring Harb. Symp. Quant. Biol. 46(Pt 1): 255–261.
CHALFIE, M., and J. N. THOMSON, 1979 Organization of neuronal microtubules in the nematode Caenorhabditis elegans. J. Cell Biol. 82: 278–289.
CHALFIE, M., and J. N. THOMSON, 1982 Structural and functional diversity in the neuronal microtubules of Caenorhabditis elegans. J. Cell Biol. 93: 15–23.
CHALFIE, M., E. DEAN, E. REILLY, K. BUCK and J. N. THOMSON, 1986 Mutations affecting microtubule structure in Caenorhabditis elegans. J. Cell Sci. Suppl. 5: 257–271.[Medline]
CHAN, M. M., and D. FONG, 1990 Inhibition of leishmanias but not host macrophages by the antitubulin herbicide trifluralin. Science 249: 924–926.
DAVID-PFEUTY, T., H. P. ERICKSON and D. PANTALONI, 1977 Guanosinetriphosphatase activity of tubulin associated with microtubule assembly. Proc. Natl. Acad. Sci. USA 74: 5372–5376.
DELANO, W. L., 2002 The PyMOL Molecular Graphics System. http://www.pymol.org.
DETRICH, H. W., III, S. K. PARKER, R. C. WILLIAMS, JR., E. NOGALES and K. H. DOWNING, 2000 Cold adaptation of microtubule assembly and dynamics. Structural interpretation of primary sequence changes present in the alpha- and beta-tubulins of Antarctic fishes. J. Biol. Chem. 275: 37038–37047.
DOWNING, K. H., and E. NOGALES, 1998 Tubulin and microtubule structure. Curr. Opin. Cell Biol. 10: 16–22.[CrossRef][Medline]
FACKENTHAL, J. D., J. A. HUTCHENS, F. R. TURNER and E. C. RAFF, 1995 Structural analysis of mutations in the Drosophila β2-tubulin isoform reveals regions in the β-tubulin molecular required for general and for tissue-specific microtubule functions. Genetics 139: 267–286.[Abstract]
FOHL, L. M., and D. S. ROOS, 2003 Fitness effects of DHFR-TS mutations associated with pyrimethamine resistance in apicomplexan parasites. Mol. Microbiol. 50: 1319–1327.[CrossRef][Medline]
FUKUSHIGE, T., Z. K. SIDDIQUI, M. CHOU, J. G. CULOTTI, C. B. GOGONEA et al., 1999 MEC-12, an alpha-tubulin required for touch sensitivity in C. elegans. J. Cell Sci. 112(Pt 3): 395–403.[Abstract]
GIANNAKAKOU, P., R. GUSSIO, E. NOGALES, K. H. DOWNING, D. ZAHAREVITZ et al., 2000 A common pharmacophore for epothilone and taxanes: molecular basis for drug resistance conferred by tubulin mutations in human cancer cells. Proc. Natl. Acad. Sci. USA 97: 2904–2909.
GIGANT, B., P. A. CURMI, C. MARTIN-BARBEY, E. CHARBAUT, S. LACHKAR et al., 2000 The 4 A X-ray structure of a tubulin:stathmin-like domain complex. Cell 102: 809–816.[CrossRef][Medline]
GU, G., G. A. CALDWELL and M. CHALFIE, 1996 Genetic interactions affecting touch sensitivity in Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 93: 6577–6582.
GUPTA, M. L., JR., C. J. BODE, G. I. GEORG and R. H. HIMES, 2003 Understanding tubulin-Taxol interactions: mutations that impart Taxol binding to yeast tubulin. Proc. Natl. Acad. Sci. USA 100: 6394–6397.
HANKINS, E. G., D. C. WARHURST and C. H. SIBLEY, 2001 Novel alleles of the Plasmodium falciparum dhfr highly resistant to pyrimethamine and chlorcycloguanil, but not WR99210. Mol. Biochem. Parasitol. 117: 91–102.[CrossRef][Medline]
HASTINGS, M. D., S. J. BATES, E. A. BLACKSTONE, S. M. MONKS, T. K. MUTABINGWA et al., 2002 Highly pyrimethamine-resistant alleles of dihydrofolate reductase in isolates of Plasmodium falciparum from Tanzania. Trans. R. Soc. Trop. Med. Hyg. 96: 674–676.[CrossRef][Medline]
HE, L., C.-P. HUANG YANG and S. B. HORWITZ, 2001 Mutations in {beta}-tubulin map to domains involved in regulation of microtubule stability in epothilone-resistant cell lines. Mol. Cancer Ther. 1: 3–10.
HESS, F. D., and D. E. BAYER, 1977 Binding of the herbicide trifluralin to Chlamydomonas flagellar tubulin. J. Cell Sci. 24: 351–360.[Abstract]
HU, K., D. S. ROOS and J. M. MURRAY, 2002 A novel polymer of tubulin forms the conoid of Toxoplasma gondii. J. Cell Biol. 156: 1039–1050.
HUGDAHL, J. D., and L. C. MOREJOHN, 1993 Rapid and reversible high-affinity binding of the dinitroaniline herbicide oryzalin to tubulin from Zea mays L. Plant Physiol. 102: 725–740.[Abstract]
ISHIDA, T., and T. HASHIMOTO, 2007 An Arabidopsis thaliana tubulin mutant with conditional root-skewing phenotype. J. Plant Res. 120: 635–640.[CrossRef][Medline]
ISHIDA, T., Y. KANEKO, M. IWANO and T. HASHIMOTO, 2007a Helical microtubule arrays in a collection of twisting tubulin mutants of Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA 104: 8544–8549.
ISHIDA, T., S. THITAMADEE and T. HASHIMOTO, 2007b Twisted growth and organization of cortical microtubules. J. Plant Res. 120: 61–70.[CrossRef][Medline]
KIM, K., M. S. EATON, W. SCHUBERT, S. WU and J. TANG, 2001 Optimized expression of green fluorescent protein in Toxoplasma gondii using thermostable green fluorescent protein mutants. Mol. Biochem. Parasitol. 113: 309–313.[CrossRef][Medline]
LAUFER, M. K., P. C. THESING, N. D. EDDINGTON, R. MASONGA, F. K. DZINJALAMALA et al., 2006 Return of chloroquine antimalarial efficacy in Malawi. N. Engl. J. Med. 355: 1959–1966.
LEVENE, N. D., 1988 The Protozoan Phylum Apicomplexa. CRC Press, Boca Raton, FL.
LI, H., D. DEROSIER, W. NICHOLSON, E. NOGALES and K. DOWNING, 2002 Microtubule structure at 8 a resolution. Structure 10: 1317.[Medline]
LOWE, J., H. LI, K. H. DOWNING and E. NOGALES, 2001 Refined structure of alpha beta-tubulin at 3.5 A resolution. J. Mol. Biol. 313: 1045–1057.[CrossRef][Medline]
MA, C., C. LI, L. GANESAN, J. OAK, S. TSAI et al., 2007 Mutations in {alpha}-tubulin confer dinitroaniline resistance at a cost to microtubule function. Mol. Biol. Cell 18: 4711–4720.
MAKIOKA, A., M. KUMAGAI, H. OHTOMO, S. KOBAYASHI and T. TAKEUCHI, 2000 Effect of dinitroaniline herbicides on the growth of Entamoeba histolytica. J. Parasitol. 86: 607–610.[CrossRef][Medline]
MITRA, A., and D. SEPT, 2006 Binding and interaction of dinitroanilines with apicomplexan and kinetoplastid alpha-tubulin. J. Med. Chem. 49: 5226–5231.[CrossRef][Medline]
MONZO, M., R. ROSELL, J. J. SANCHEZ, J. S. LEE, A. O'BRATE et al., 1999 Paclitaxel resistance in non-small-cell lung cancer associated with beta-tubulin gene mutations. J. Clin. Oncol. 17: 1786–1793.
MOREJOHN, L. C., T. E. BUREAU, J. MOLE-BAJER, A. S. BAJER and D. E. FOSKET, 1987 Oryzalin, a dinitroaniline herbicide, binds to plant tubulin and inhibits microtubule polymerization in vitro. Planta 172: 252–264.[CrossRef]
MORRISSETTE, N. S., and L. D. SIBLEY, 2002a Cytoskeleton of apicomplexan parasites. Microbiol. Mol. Biol. Rev. 66: 21–38.
MORRISSETTE, N. S., and L. D. SIBLEY, 2002b Disruption of microtubules uncouples budding and nuclear division in Toxoplasma gondii. J. Cell Sci. 115: 1017–1025.
MORRISSETTE, N. S., A. MITRA, D. SEPT and L. D. SIBLEY, 2004 Dinitroanilines bind alpha-tubulin to disrupt microtubules. Mol. Biol. Cell 15: 1960–1968.
NAKAJIMA, K., I. FURUTANI, H. TACHIMOTO, H. MATSUBARA and T. HASHIMOTO, 2004 SPIRAL1 encodes a plant-specific microtubule-localized protein required for directional control of rapidly expanding Arabidopsis cells. Plant Cell 16: 1178–1190.
NAKAJIMA, K., T. KAWAMURA and T. HASHIMOTO, 2006 Role of the SPIRAL1 gene family in anisotropic growth of Arabidopsis thaliana. Plant Cell Physiol. 47: 513–522.
NOGALES, E., and H. W. WANG, 2006a Structural intermediates in microtubule assembly and disassembly: How and why? Curr. Opin. Cell Biol. 18: 179–184.[CrossRef][Medline]
NOGALES, E., and H. W. WANG, 2006b Structural mechanisms underlying nucleotide-dependent self-assembly of tubulin and its relatives. Curr. Opin. Struct. Biol. 16: 221–229.[CrossRef][Medline]
NOGALES, E., S. G. WOLF and K. H. DOWNING, 1997 Visualizing the secondary structure of tubulin: three-dimensional map at 4 A. J. Struct. Biol. 118: 119–127.[CrossRef][Medline]
NOGALES, E., K. H. DOWNING, L. A. AMOS and J. LOWE, 1998 Tubulin and FtsZ form a distinct family of GTPases. Nat. Struct. Biol. 5: 451–458.[CrossRef][Medline]
NOGALES, E., M. WHITTAKER, R. A. MILLIGAN and K. H. DOWNING, 1999 High-resolution model of the microtubule. Cell 96: 79–88.[CrossRef][Medline]
NOGALES, E., H. W. WANG and H. NIEDERSTRASSER, 2003 Tubulin rings: Which way do they curve? Curr. Opin. Struct. Biol. 13: 256–261.[CrossRef][Medline]
RADCLIFFE, P., D. HIRATA, D. CHILDS, L. VARDY and T. TODA, 1998 Identification of novel temperature-sensitive lethal alleles in essential beta-tubulin and nonessential alpha 2-tubulin genes as fission yeast polarity mutants. Mol. Biol. Cell 9: 1757–1771.
REIJO, R. A., E. M. COOPER, G. J. BEAGLE and T. C. HUFFAKER, 1994 Systematic mutational analysis of the yeast beta-tubulin gene. Mol. Biol. Cell 5: 29–43.[Abstract]
RICHARDS, K. L., K. R. ANDERS, E. NOGALES, K. SCHWARTZ, K. H. DOWNING et al., 2000 Structure-function relationships in yeast tubulins. Mol. Biol. Cell 11: 1887–1903.
ROOS, D. S., R. G. DONALD, N. S. MORRISSETTE and A. L. MOULTON, 1994 Molecular tools for genetic dissection of the protozoan parasite Toxoplasma gondii. Methods Cell Biol. 45: 27–63.[Medline]
SAGE, C. R., A. S. DAVIS, C. A. DOUGHERTY, K. SULLIVAN and K. W. FARRELL, 1995a beta-Tubulin mutation suppresses microtubule dynamics in vitro and slows mitosis in vivo. Cell Motil. Cytoskeleton 30: 285–300.[CrossRef][Medline]
SAGE, C. R., C. A. DOUGHERTY, A. S. DAVIS, R. G. BURNS, L. WILSON et al., 1995b Site-directed mutagenesis of putative GTP-binding sites of yeast beta-tubulin: evidence that alpha-, beta-, and gamma-tubulins are atypical GTPases. Biochemistry 34: 7409–7419.[CrossRef][Medline]
SAVAGE, C., M. HAMELIN, J. G. CULOTTI, A. COULSON, D. G. ALBERTSON et al., 1989 mec-7 is a beta-tubulin gene required for the production of 15-protofilament microtubules in Caenorhabditis elegans. Genes Dev. 3: 870–881.
SAVAGE, C., Y. XUE, S. MITANI, D. HALL, R. ZAKHARY et al., 1994 Mutations in the Caenorhabditis elegans beta-tubulin gene mec-7: effects on microtubule assembly and stability and on tubulin autoregulation. J. Cell Sci. 107(Pt 8): 2165–2175.[Abstract]
SHOJI, T., N. N. NARITA, K. HAYASHI, J. ASADA, T. HAMADA et al., 2004 Plant-specific microtubule-associated protein SPIRAL2 is required for anisotropic growth in Arabidopsis. Plant Physiol. 136: 3933–3944.
STOKKERMANS, T. J., J. D. SCHWARTZMAN, K. KEENAN, N. S. MORRISSETTE, L. G. TILNEY et al., 1996 Inhibition of Toxoplasma gondii replication by dinitroaniline herbicides. Exp. Parasitol. 84: 355–370.[CrossRef][Medline]
THITAMADEE, S., K. TUCHIHARA and T. HASHIMOTO, 2002 Microtubule basis for left-handed helical growth in Arabidopsis. Nature 417: 193–196.[CrossRef][Medline]
TRAUB-CSEKO, Y. M., J. M. RAMALHO-ORTIGAO, A. P. DANTAS, S. L. DE CASTRO, H. S. BARBOSA et al., 2001 Dinitroaniline herbicides against protozoan parasites: the case of Trypanosoma cruzi. Trends Parasitol. 17: 136–141.[CrossRef][Medline]
VOGEL, G., 2006 Malaria. Chloroquine makes a comeback. Science 314: 904.[Medline]
WANG, H. W., and E. NOGALES, 2005 Nucleotide-dependent bending flexibility of tubulin regulates microtubule assembly. Nature 435: 911–915.[CrossRef][Medline]
WANG, H. W., S. LONG, K. R. FINLEY and E. NOGALES, 2005 Assembly of GMPCPP-bound tubulin into helical ribbons and tubes and effect of colchicine. Cell Cycle 4: 1157–1160.[Medline]
WANG, Y., S. VEERARAGHAVAN and F. CABRAL, 2004 Intra-allelic suppression of a mutation that stabilizes microtubules and confers resistance to colcemid. Biochemistry 43: 8965–8973.[CrossRef][Medline]
Communicating editor: S. DUTCHER
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
-
All Versions of this Article:
genetics.108.092494v1
180/2/845 most recent - Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Ma, C.
- Articles by Morrissette, N.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Ma, C.
- Articles by Morrissette, N.





