Sir1 establishes transcriptional silencing at the cryptic mating-type loci HMR and HML (HM loci) by recruiting the three other Sir proteins, Sir2, -3, and -4, that function directly in silenced chromatin. However, SIR1-independent mechanisms also contribute to recruiting the Sir2–4 proteins to the HM loci. A screen to elucidate SIR1-independent mechanisms that establish HMR silencing identified a mutation in YKU80. The role for Ku in silencing both HMR and HML was masked by SIR1. Ku's role in silencing the HM loci was distinct from its shared role with the nuclear architecture protein Esc1 in tethering the HM loci and telomeres to the nuclear periphery. The ability of high-copy SIR4 to rescue HMR silencing defects in sir1 cells required Ku, and chromatin immunoprecipitation (ChIP) experiments provided evidence that Ku contributed to Sir4's physical association with the HM loci in vivo. Additional ChIP experiments provided evidence that Ku functioned directly at the HM loci. Thus Ku and Sir1 had overlapping roles in silencing the HM loci.

---

TRANSCRIPTIONAL repression of the cryptic mating-type loci HMR and HML (the HM loci) in the yeast Saccharomyces cerevisiae occurs through a mechanism called transcriptional silencing. Silencing describes the formation of a specialized "silent" chromatin structure that is analogous on many levels to metazoan heterochromatin (reviewed in RUSCHE et al. 2003). Specifically, silencing causes heritable, position-dependent, long-range transcriptional repression that relies on interactions between nucleosomes, chromatin-modifying enzymes, and nonhistone chromatin-binding proteins. In addition, several proteins and chromatin modifications involved in silencing are conserved in metazoans and have roles in heterochromatin (reviewed in PERROD and GASSER 2003). An understanding of silencing requires identification of the proteins and protein–protein and protein–DNA interactions required to target silent chromatin formation to the appropriate domains in the genome. A challenge to obtaining a comprehensive description of silencing at the HM loci using genetic approaches is that several overlapping mechanisms contribute to a robustness in silent chromatin structure such that the functions of key proteins and molecular interactions can be masked. In this study we analyzed silencing compromised by a deletion of SIR1 (silent information regulator; sir1) and discovered that the yeast Ku complex had a redundant role with Sir1 in silencing the HM loci.

Silencing is targeted and stabilized at the HM loci by small (150-bp) DNA elements called silencers (LOO and RINE 1995). HMR and HML are each flanked by two silencers that contain different combinations of binding sites for the nuclear proteins ORC (origin recognition complex), Rap1, and Abf1. The role of the silencer-binding proteins is to recruit the four Sir proteins, Sir1, -2, -3, and -4, through a number of distinct protein–protein interactions to silencers and "nucleate" silencing (reviewed in RUSCHE et al. 2003; MOAZED et al. 2004; FOX and MCCONNELL 2005). In current models, once the Sir2–4 proteins, which form a stable complex (RUDNER et al. 2005), are positioned at a silencer, the enzymatic activity of Sir2 deacetylates nucleosomes that neighbor the silencer, which in turn promotes binding of an additional Sir2–4 complex. The process repeats until Sir2–4 protein complexes bind and modify the nucleosomes that compose the silent loci (reviewed in RUSCHE et al. 2003; MOAZED et al. 2004). The binding of the Sir2–4 protein complexes may directly repress transcription and/or lead to higher-order looping and compaction that renders the underlying DNA less accessible (VAZQUEZ and SCHEDL 1994; CHEUNG et al. 2000; SEKINGER and GROSS 2001; VALENZUELA et al. 2008).

In this model, the Sir2–4 protein complexes are essential structural components of silent chromatin, whereas Sir1 has a different role. In particular, Sir1's role is confined to silencers where it enhances the establishment (i.e., the initial recruitment of a Sir2–4 protein complex to the silencer) and/or reduces the disassembly of silent chromatin (stabilizes a preassembled but meta-stable silent chromatin structure) (PILLUS and RINE 1989, 2004; XU et al. 2006). However, at natural HMR and HML a substantial level of silencing is retained even in the complete absence of Sir1 (i.e., in sir1 cells) (IVY et al. 1986; PILLUS and RINE 1989), indicating that the Sir2–4 protein complex can nucleate at the silencers and establish silencing fairly efficiently without the help of Sir1. In addition, defects in silencing caused by mutations in silencer-binding sites or SIR1 can be suppressed by many different mutations that modulate progress through the cell cycle (AXELROD and RINE 1991; LAMAN et al. 1995; EHRENHOFER-MURRAY et al. 1999), suggesting that a cell-cycle-regulated target(s) can modulate Sir2–4 protein interactions with silencers. In a recent study, we presented evidence for a pathway shared by the cell-cycle transcription factor Fkh1 and the S-phase cyclin Clb5 that modulates the establishment of Sir2–4 chromatin at HMRa in sir1 cells (CASEY et al. 2008). Specifically, high-copy expression of FKH1 or a deletion of CLB5 (clb5) partially bypasses the requirement for SIR1 in silencing HMR. Furthermore, genetic epistasis and molecular experiments reveal that FKH1 and CLB5 exert their effects on silencing through a common pathway yet do so without regulating each other's expression. The simplest model to explain these data posits that FKH1 is a positive regulator while CLB5 is a negative regulator of a common target or pathway that in turn contributes to silencing via a SIR1-independent mechanism (Figure 1). Identification of such a target should provide insights into the connection between the cell cycle and silencing. However, regardless of the specific mechanisms involved, this and other studies establish clearly that Sir1-independent mechanisms involving the Sir2–4 proteins contribute substantially to silencing of the HM loci.

View larger version (9K): In this window In a new window Download PPT slide   FIGURE 1.— A model of SIR1-dependent and -independent contributions to silencing. The dominant pathway for assembling Sir2–4 chromatin at the HM loci is SIR1 dependent (symbolized by thick arrow from SIR1 to Sir2–4 chromatin). This pathway involves direct protein–protein interactions between Sir1 and silencer-bound proteins, such as ORC, and Sir proteins, such as Sir4. However, it is clear that other SIR1-independent pathway(s) contribute to HM silencing and the ability of Sir2–4 proteins to bind to silencers. These pathways can be revealed only in sir1 cells. In a previous study (CASEY et al. 2008), we acquired evidence that one such pathway is associated with the cell-cycle regulatory genes FKH1 and CLB5. Genetic analyses described in this previous study provide evidence that FKH1 functions as a positive regulator of this pathway ("?" below FKH1 and CLB5) whereas CLB5 functions as a negative regulator of this pathway. The molecular nature of this pathway is unknown, but we speculate that it might involve mechanisms that control the association of the HM loci with a region of the nuclear periphery where pools of Sir2–4 proteins are concentrated. We propose that this SIR1-independent pathway is the pathway most sensitive to cell-cycle perturbations because, for example, the activities of specific proteins that define this pathway are regulated during the cell cycle. In this study, a genetic screen was performed to identify genes encoding proteins regulated by FKH1 and CLB5 or any additional genes that might contribute to SIR1-independent modes of HM silencing.

 
In this study, a genetic screen was performed to identify genes that contributed to SIR1-independent pathways involved in HMRa silencing. This screen identified YKU80 that encodes one subunit of the evolutionarily conserved Ku70/Ku80 heterodimer, referred to as the Ku complex or Ku. Ku has a well-characterized role in silencing telomeres, but its role in silencing the HMR and HML loci has been unclear. In particular, although Ku and another protein, Esc1, work redundantly to maintain HMR's localization near the nuclear periphery (GARTENBERG et al. 2004), genetic evidence has failed to establish that these proteins have a functional role in silencing HMR. Genetic and chromatin immunoprecipitation (ChIP) experiments described in this report provided evidence that the inability to detect a role for Ku in HM silencing was because Ku and Sir1 shared overlapping functions in recruiting Sir4. Additional ChIP experiments provided evidence that Ku functioned directly at the HM loci. Ku's role in silencing the HM loci was distinct from its overlapping role(s) with Esc1 since ESC1 did not contribute to silencing the HM loci even in sir1 cells. In addition, Ku's role in HMRa silencing in sir1 cells worked independently of and functioned additively with the FKH1/CLB5 pathway. Thus Ku acted in a previously uncharacterized SIR1-independent pathway for targeting Sir2–4 chromatin to the HM loci.

Strains and plasmids:

Yeast strains and plasmids used in this study are listed in Tables 1 and 2, respectively. The strains used in this study were constructed using standard yeast molecular genetics and recombinant DNA techniques (SAMBROOK et al. 1989; GUTHRIE and FINK 1991). Cells were grown at 30° in standard rich medium (YPD), minimal medium supplemented with casamino acids (CAS) (to select for URA3-containing plasmids), or synthetic media (SC) lacking defined supplements to select for diploids and/or plasmids as appropriate. All cells were isogenic to W303-1A except the MATa (JRY19) and MAT cells (CFY617) used for mating lawns.

View this table: In this window In a new window   TABLE 1 Strains used in this study

 

View this table: In this window In a new window   TABLE 2 Plasmids used in this study

 

Genetic screen:

MAT sir1 HMR-SSa (CFY1649) cells harboring a 2µ plasmid that contained FKH1 (pCF480) were transformed with a mTn3-lacZ/LEU2 library that had been digested with NotI as described previously (BURNS et al. 1994). Individual Leu+ colonies were picked and transferred to 96-well plates (U-bottom assay plates, Falcon) in a total volume of 100 µl of liquid CAS media, covered (Airpore tape sheets, Qiagen) and grown with agitation at 30° for three to four doublings (8 hr). Cells were precipitated by brief centrifugation at 3000 rpm and the cell pellets were resuspended in 50 µl of CAS. Five microliters of each cell suspension were plated on solid agar CAS medium (in rectangular plates, OmniTray, Nunc) using a multichannel pipetteman. An excess of MATa tester cells (CFY616) was added (15 µl of log-phase cells concentrated to 2 x 10⁸ cells/ml) to the remaining cells in suspension. The cells were mixed, and 10 µl of this mixture was spotted onto diploid selective SC solid agar medium in rectangular plates. Cells were incubated at 30° for 2 days and then scored for mating and growth efficiencies. A total of 6006 Leu+ transformants, representing 2000 transformants each from three of the mTn3 pools (BURNS et al. 1994), were screened in this manner. Isolates that grew efficiently on CAS but not on diploid selective media were subjected to further analysis.

A total of 209 nonmating Leu+ mutants were transferred from CAS agar to solid agar SC medium containing 5-fluoroorotic acid (5-FOA) to select for cells that lost the URA3-containing FKH1 plasmid. 5-FOA-resistant cells were subsequently transformed with URA3-containing CEN SIR1 (pCF99) or 2µ FKH1 (pCF480) using standard methods. Ura+ transformants were tested for mating efficiency. Only those isolates that were mating competent in the presence of SIR1 and mating defective in the presence of 2µ FKH1 were analyzed further. Fifty-three mutants met these criteria and were crossed to the parental strain to test for 2:2 segregation of LEU2. To determine that the LEU2 gene disruption was the cause of the desired mating phenotype, several MAT sir1 HMR-SSa Leu+ isolates from the cross were transformed with 2µ FKH1 (pCF480) and then retested for their ability to mate with MATa cells. If each of the the transformants tested failed to mate, then we concluded that the LEU2 insertion and desired phenotype were cosegregating.

Three Leu+ mutants met the above criteria, and the site of mTn3 insertion was amplified using vectorette PCR (C. Friddle, http://genomics.princeton.edu/botstein/protocols/vectorette.html) and identified by sequencing. Briefly, yeast total DNA isolated from mutant strains was digested with AluI and ligated to annealed anchor bubbles. The ligation reaction was used as the template for PCR amplification of the mTn3-yeast genomic DNA junction. Products of this reaction were sequenced using the M13/pUC sequencing primer (–40, New England Biolabs) that anneals to proximal lacZ sequences. The sequence obtained was compared to the S. cerevisiae sequence using BLASTn search on the Saccharomyces Genome Database (http://www.yeastgenome.org) to identify the genomic site of insertion.

Semiquantitative mating assay:

The MAT or MATa cells examined were grown in log phase for at least 24 hr before analysis. The most concentrated samples analyzed were 5 x 10⁶ cells/ml in a total volume of 50 µl. Ten-fold serial dilutions of this concentration were generated in 50-µl final volumes. Five microliters of each dilution were analyzed per drop on either YPD or CAS solid agar medium, as appropriate, to determine cell plating efficiency. To the remainder of the cells, excess cells of the opposite mating type, either MATa (JRY19) or MAT (CFY617), were added (15 µl of log-phase cells concentrated to 2 x 10⁸ cells/ml). Ten microliters of this mixture were plated to synthetic solid agar medium appropriately supplemented to select for diploids (and the retention of a URA3 plasmid, if appropriate).

Quantitative mating assay:

Cells were grown in log phase for at least 24 hr in YPD or CAS to select for plasmids when necessary. Cells were then diluted to obtain 100 colonies/plate and plated on the same medium to determine the total number of cells. Appropriate dilutions for testing mating were mixed with MATa cells (JRY19) and plated onto minimal medium supplemented appropriately for diploid selection to quantify the number of mating-competent cells. Mating efficiency was defined as the number of cells that mated per total number of cells.

Antibodies and protein immunoblots:

Anti-Fkh1 and anti-Orc2 polyclonal antibodies were described previously (BOSE et al. 2004; CASEY et al. 2008) . Anti-Ku antibodies were a gift from the laboratories of A. Tomkinson (Baltimore) and S. E. Lee (San Antonio, TX). Anti-Sir4 antibodies were a gift from the laboratory of D. Moazed (Boston).

To compare levels of Fkh1 expressed from a chromosomal copy of FKH1 and from a 2µ plasmid (FKH1^hc) quantitatively (Figure 2), crude yeast extracts were prepared as described previously (GARDNER et al. 1999) from wild-type cells transformed with either empty vector (pRS426) or a 2µ plasmid expressing FKH1 (FKH1^hc; pCF480) and from fkh1 cells transformed with vector (pRS426). Ten microliters of crude cell extracts were analyzed per lane by SDS–PAGE and standard protein blotting methods. The blot was prestained with Poncea S prior to incubation with antibody to ensure that protein transfer to the blot was equivalent for all lanes. The blot was simultaneously incubated with the primary antibodies, anti-Fkh1 and anti-Orc2. Rabbit IgG was visualized using an HRP-conjugated secondary antibody and SuperSignal West Chemiluminescent HRP detection reagent (Pierce).

View larger version (45K): In this window In a new window Download PPT slide   FIGURE 2.— A screen to examine SIR1-independent pathways required for silencing HMR-SSa. Yeast cells with the genotype MAT sir1 HMR-SSa (CFY1649) and containing FKH1 on a 2µ plasmid (FKH1hc, pCF480) were mutagenized with a transposon insertion library (mTn3-lacZ/LEU2). Homologous recombination resulted in the replacement of a specific segment of yeast chromosome (yDNA) with the DNA fragment disrupted with the transposon and was selected for by growth on medium lacking leucine. Mating phenotypes of the Leu+ insertion mutants were assessed in a 96-well format by mixing logarithmically growing cells with excess MATa cells (CFY616) and plating 10 µl on medium to select for growth of a/ diploids (plate 2). A corresponding growth control was used to confirm that an equal number of cells were being compared between mutants (plate 1). Internal controls were present on every plate for comparison (boxed); column 5, rows a–c, contained MAT sir1 HMR-SSa (CFY1649) harboring an empty 2µ vector (pRS426), a CEN plasmid with SIR1 (pCF99), or a 2µ plasmid with FKH1 (pCF480). The Leu+ mutants in column 2, c and f, and column 4, a (boxed), were classified as non-maters in this primary screen.

 

Reverse transcriptase–PCR analysis of a1 mRNA:

To determine the levels of a1, mRNA transcribed from HMRa total RNA was prepared from MAT cells grown to an OD of 0.6–0.8 using standard hot phenol extraction methods. Total RNA concentration was determined by spectroscopic analysis. For reverse transcription (RT), 5 µg of total RNA was used in a 20-µl reaction mixture using oligo(dT)_12–18 primers (Invitrogen) and Superscript III (Invitrogen) following the manufacturer's protocol. cDNA was purified from each RT mixture using a QIAquick PCR purification kit (Qiagen) and eluted in 50 µl TE. Twofold serial dilutions were used in 25-cycle PCR reactions as follows: for measuring ACT1 expression, 1 and 2 µl of 1:10 diluted cDNA were used with ACT1-specific primers (caagaaatgcaaaccgctgc and ggtcaataccggcagattcc) or, for a1 mRNA, with a1-specific primers (ggcggaaaacataaacagaactctg and ccgactatgctattttaatcattgaaaacg). The PCR products were resolved on a 1% agarose gel stained with GelRed dye (Biotium). The bands were quantified using video densitometry analysis and Labworks analysis software (UVP).

ChIPs:

ChIPs were performed as described (STRAHL-BOLSINGER et al. 1997) using anti-Ku or anti-Sir4 antibodies. IP and total DNAs were purified using a QIAquick PCR purification kit (Qiagen) and eluted in 50 µl TE. For PCR, twofold dilutions were used: 1 and 2 µl of undiluted IP DNA and 1 and 2 µl of 1:50 diluted total DNA (which represented 3.5% of the starting material). DNA was subjected to 26 or 27 cycles of PCR using primers specific for HMR-E (forward: ggtagagttccttgttgaacgtgataaccc and reverse: gctttggggacatcatgtataacagcg), X/Ya (RUSCHE et al. 2002), HMR-I (RUSCHE et al. 2002), HML-E [forward (RUSCHE et al. 2002) and reverse: gttagatttggcccccgaaatcga] HML-I [forward (RUSCHE et al. 2002) and reverse: gaacgtacatagtgtgcccagctt], Tel VI-R 0.5, and Tel VI-R 7.5 (SHARP et al. 2003). PCR products were separated on a 1% agarose gel containing GelRed dye (Biotium) and band intensities were quantified using video densitometry analysis and Labworks analysis software (UVP).

A yku80::LEU2 insertion isolated in a screen designed to examine SIR1-independent pathways required for silencing HMR-SSa:

Although SIR1 has an established role in silencing the HM loci, a large body of evidence indicates that there exist SIR1-independent means for recruiting the Sir proteins to HMR and HML and establishing silencing (IVY et al. 1986; PILLUS and RINE 1989; AXELROD and RINE 1991; LAMAN et al. 1995; REIFSNYDER et al. 1996; EHRENHOFER-MURRAY et al. 1999; HOLLENHORST et al. 2000). In a recent study, we exploited the synthetic HMR-SSa silencer that absolutely depends on SIR1 for robust silencing (MCNALLY and RINE 1991) to identify a SIR1-independent pathway that responds to both the forkhead transcription factor Fkh1 and the S-phase cyclin Clb5 (CASEY et al. 2008). This work led to a model in which FKH1 and CLB5 have opposing regulatory roles on a common target(s) that in turn enhances silent chromatin assembly (CASEY et al. 2008; Figure 1). This study also provides evidence that distinct SIR1-independent molecular interactions at silencers can lead to efficient recruitment of the Sir2–4 protein complex to HMR-SSa. To define such interactions, a genetic screen was performed to isolate genes necessary for FKH1's ability to act as a high-copy suppressor of an HMR-SSa silencing defect caused by a sir1 mutation (HOLLENHORST et al. 2000). In theory, this screen could identify genes belonging to one of at least two SIR1-independent pathways that contributed to silencing HMR-SSa: (1) one category of genes could function as part of the SIR1-independent FKH1/CLB5 pathway previously described (CASEY et al. 2008) and (2) a second category of genes could function as part of a SIR1-independent pathway that was distinct from the FKH1/CLB5 pathway but that functioned additively with it. Genes in this second category might be equivalent functionally to previously identified eso (enhancer of sir1) genes that caused synthetic silencing defects at HML in combination with a sir1 mutation (REIFSNYDER et al. 1996; STONE et al. 2000).

MAT HMR-SSa sir1 cells, normally unable to mate because SIR1 is required to silence HMR-SSa, regain the ability to silence HMR-SSa and mate when transformed with a 2µ plasmid expressing FKH1 (FKH1^hc) (HOLLENHORST et al. 2000; CASEY et al. 2008). To better understand how this SIR1-independent silencing was achieved, we screened for genes that prevented FKH1^hc-dependent silencing. Yeast cells with the genotype MAT HMR-SSa sir1 and containing FKH1^hc were transformed with a yeast genomic library that had been randomly mutagenized mTn3-lacZ/LEU2 (BURNS et al. 1994). Individual Leu+ colonies were transferred to a 96-well plate and grown under conditions that selected for the 2µ FKH1 plasmid (Figure 2). An aliquot of cells in each well was transferred onto a growth control agar plate (Figure 2, plate 1, selected for plasmid-containing haploid cells). An excess of MATa cells was then mixed thoroughly with the remaining cells, and an aliquot of this mixture was transferred to a second plate that selected for diploids (Figure 2, plate 2, diploid selective media). Thus the MAT HMR-SSa sir1 FKH1^hc cells had to mate efficiently with the MATa cells to grow on plate 2.

The goal was to identify genes that contributed to silencing HMR-SSa through a SIR1-independent pathway. Therefore, in a secondary screen the nonmating mutants were tested for their ability to mate in the presence of a SIR1 plasmid. Mutants that were silencing defective in the presence of FKH1^hc but silencing competent in the presence of SIR1 were pursued further. One mutant contained an insertion in the YMR106C open reading frame that encodes yKu80, providing evidence that YKU80 contributed to a SIR1-independent pathway for silencing HMR-SSa.

Ku and FKH1^hc contributed independently to silence HMR-SSa in sir1 cells:

Although previous studies provide evidence that the Ku complex helps maintain HMR's association with the nuclear periphery (GARTENBERG et al. 2004), no functional role for Ku in silencing of HMR has been documented. However, isolation of a LEU2 insertion mutant in YKU80 provided evidence that Ku had a role in silencing HMRa, at least in the context of HMR-SSa, sir1, and/or FKH1^hc-dependent silencing. To test whether an independent and complete deletion of YKU80 would recapitulate the phenotype of the LEU2 insertion mutant isolated in the screen, MATa cells containing a complete unmarked deletion of YKU80 (yku80) were crossed to MAT HMR-SSa sir1 cells, and silencing of several independent YKU80 and yku80 MAT HMR-SSa sir1 segregants from this cross were analyzed by a semiquantitative mating assay (Figure 3A). These experiments recapitulated the basic results from the screen (Figure 2) and revealed that yKu80 was required to detect robust FKH1^hc-dependent silencing but not SIR1-dependent silencing.

View larger version (49K): In this window In a new window Download PPT slide   FIGURE 3.— Ku and FKH1hc contributed independently to silence HMR-SSa in sir1 cells. (A) Mating analysis was performed on MATa HMR-SSa sir1 cells containing either wild-type YKU80 (CFY1649) or a deletion of YKU80 (yku80; CFY2319) and harboring plasmids with empty 2µ vector (vector; pRS426), CEN SIR1 (SIR1; pCF99), or 2µ FKH1 (FKH1hc; pCF480). The cells were mixed with an excess of MATa cells (JRY19) and 10-fold serial dilutions were plated on medium to select for the growth of a/ diploids. The most concentrated samples contained 5 x 103 cells/µl and 10 µl were analyzed in each spot. Corresponding growth controls indicated that an equal number of cells were being compared between strains (E. E. PATTERSON and C. A. FOX, data not shown). (B) Fkh1 protein levels were assessed in MAT HMR-SSa sir1 (CFY1649), and MAT HMR-SSa sir1 yku80 (CFY2319) cells were determined by protein immunoblot with an antibody raised against Fkh1 (-Fkh1). Cells harboring an empty 2µ plasmid (V), CEN SIR1 (S), or a 2µ plasmid containing FKH1 (F), were analyzed on the same blot. fkh1 cells transformed with an empty 2µ plasmid (V, CFY583) showed no protein band corresponding to Fkh1 in the immunoblot. Simultaneous hybridization of the blot with an antibody recognizing Orc2 (-Orc2) indicated that equal amounts of protein were compared. (C) Quantitative mating analysis was used to test the silencing phenotypes of isogenic MAT HMR-SSa sir1 cells containing wild-type YKU (CFY1649) or a deletion of YKU70 (yku70; CFY2317) or YKU80 (yku80; CFY2319) and harboring plasmids with empty 2µ plasmid CEN SIR1 or 2µ FKH1. Mating efficiency was calculated for each strain by determining the ratio of the number of cells that could mate to the number of viable cells. For each strain, the mean mating efficiencies for three experiments are shown plus or minus the standard deviation on a log scale.

 
One possible explanation for these data was that the Fkh1 protein was not sufficiently expressed in yku80 cells to achieve FKH1^hc-dependent silencing. Therefore the levels of Fkh1 were determined in the YKU80 and yku80 cells by protein immunoblot analyses using Fkh1 antibodies (Figure 3B). An antibody recognizing Orc2, a subunit of the origin recognition complex, was also used to control for the amount of protein in each lane. Assuming that the levels of Fkh1 protein required for silencing do not vary with the YKU80 genotype, Fkh1 was expressed sufficiently in yku80 cells to achieve silencing of HMR-SSa.

To extend the analyses, we also tested the effect of yku70 on silencing HMR-SSa and quantified the silencing defects caused by both yku70 and yku80 by performing quantitative mating assays to measure mating efficiency. Quantitative mating assays determine the number of mating-competent cells within a population of viable cells, and hence in MAT cells can serve to determine the number of cells that have silenced HMRa. The ratio of mating-competent cells to total number of cells assessed was indicated on the y-axis, presented in log scale for each yeast genotype indicated. Consistent with the data presented in Figure 3A, yku80 substantially reduced silencing of HMR-SSa in MAT HMR-SSa sir1 cells expressing FKH1^hc, but had no effect on the same cells expressing SIR1 (Figure 3C). In addition, yku70 produced the same phenotype as yku80, as expected since the Ku complex functions as a heterodimer of Ku70 and Ku80. These data were fully consistent with the screen (Figure 2) and revealed that Ku functioned to silence HMR-SSa in sir1 cells.

If Ku was the sole or primary downstream target of the FKH1^hc-mediated silencing pathway, then FKH1^hc should fail to enhance silencing of MAT HMR-SSa sir1 yku80 cells. However, the quantitative data revealed clearly that Ku had a role in silencing HMR-SSa in the absence of FKH1^hc and, conversely, that FKH1^hc could improve silencing of HMR-SSa in the absence of Ku. FKH1^hc improved silencing of MAT HMR-SSa sir1 yku80 cells by almost 100-fold (Figure 3C; compare FKH1^hc yku80 or yku70 with vector yku80 or yku70). This magnitude of enhancement was similar to that observed in comparable cells that were wild type for Ku (Figure 3C; compare FKH1^hc and vector in cells that were wild type for Ku). Thus Ku contributed to silencing HMR-SSa at least in part through a SIR1-independent pathway that worked additively with FKH1^hc.

YKU80 and CLB5 also made independent contributions to silencing of HMR-SSa in sir1 cells:

The quantitative mating data presented above (Figure 3C) provided evidence for FKH1 and Ku contributing independently to silencing HMR-SSa in sir1 cells. Like FKH1^hc, clb5 is also established as an efficient suppressor of sir1 silencing defects (LAMAN et al. 1995), and our recent study provides evidence that FKH1 and CLB5 modulate silencing through a common pathway (CASEY et al. 2008). A prediction of this model is that CLB5 and YKU80 should also contribute independently to modulate HMR-SSa silencing. Therefore we generated an isogenic set of MAT HMR-SSa sir1 cells that varied only in terms of their YKU80 or CLB5 genotypes and measured silencing of HMR-SSa by semiquantitative mating assays (Figure 4A). These experiments revealed that yku80 reduced the level of SIR1 bypass silencing that could be detected in clb5 cells, which was similar to what was observed for FKH1^hc-mediated silencing (Figure 3A). Quantitative mating data (Figure 4B) revealed that CLB5 and YKU80 made independent contributions to silencing HMR-SSa in sir1 cells. Specifically, clb5 enhanced silencing in MAT sir1 cells regardless of whether these cells were wild type, YKU80, or yku80. Thus YKU80 contributed substantially to silencing HMR-SSa in both CLB5 and clb5 cells. These data supported the conclusion that effective SIR1 bypass silencing of HMR-SSa required both the FKH1/CLB5 and the Ku pathways.

View larger version (43K): In this window In a new window Download PPT slide   FIGURE 4.— YKU80 and CLB5 contributed independently to modulate silencing of HMR-SSa in sir1 cells. (A) Semiquantitative mating analyses were performed on cells with the genotype MAT sir1 containing either HMR-SSa or HMRE::ARS1 for silencers and various combinations of CLB5 and YKU80 genotypes as indicated. The HMR-SSa and HMRE::ARS1 silencer-containing cells were CLB5 YKU80 (CFY1649 and CFY2595), clb5 YKU80 (CFY2104 and CFY2599), CLB5 yku80 (CFY2319 and CFY2601), or clb5 yku80 (CFY2354 and CFY2597). (B) Quantitative mating assays were performed on the strains in A. The mean mating efficiencies for three experiments are shown plus or minus the standard deviation on a log scale.

 
A surprising feature of FKH1/CLB5-dependent silencing is that it can use an ordinary replication origin as a silencer (CASEY et al. 2008). Substitution of the HMR-E silencer with the early to mid-S-phase firing origin ARS1 (HMRE::ARS1) reduces SIR1-dependent silencing, but has no effect on FKH1/CLB5-dependent silencing. Since the data presented above provided evidence that Ku functioned additively with the FKH1/CLB5 pathway to contribute to silencing at HMR-SSa in sir1 cells, we asked whether it also supported silencing of HMRa when this locus was under the control of the HMRE::ARS1 silencer (Figure 4, A and B). As was observed for HMR-SSa, yKu80 contributed to silencing HMRE::ARS1 in both CLB5 and clb5 cells. Thus silencing mediated by the unusual HMRE::ARS1 silencer, although largely independent of SIR1 (CASEY et al. 2008), relied on yKu80.

Ku functioned in silencing natural HMR and HML:

The above data indicated that Ku functioned in silencing at HMR-SSa and HMRE::ARS1. These loci contain engineered versions of HMR-E designed to sensitize HMRa silencing for genetic studies. To ask whether Ku had a role in silencing either natural HMR or HML, we measured the effects of yku80 on HMRa and HML silencing in MAT and MATa strains, respectively. Consistent with previous findings, yku80 had no effect on silencing either locus in SIR1 cells (Figure 5A). Similarly, sir1 cells did not exhibit a substantial silencing defect (IVY et al. 1986; PILLUS and RINE 1989). However, yeast cells containing both mutations in SIR1 and YKU80 (sir1 yku80) showed dramatic silencing defects at HMR and HML. As an independent measure for HMRa silencing, a1 mRNA levels were measured by reverse transcriptase PCR (RT–PCR) in MAT sir1 cells that varied only in terms of their YKU80 or SIR3 genotype (Figure 5B). These experiments revealed that the ratio of a1 mRNA to the ACT1 mRNA control increased 2.3-fold in yku80 cells relative to YKU80 cells (Figure 5B). This elevated a1/ACT1 ratio was similar to that observed for sir3 cells (Figure 5B). Thus, YKU80 became critical for silencing natural HMR in sir1 cells.

View larger version (23K): In this window In a new window Download PPT slide   FIGURE 5.— Ku functioned in silencing HMR and HML. (A) Silencing of HMRa and HML in cells differing in the genotype of YKU80 and SIR1 was assayed by semiquantitative mating. The MAT cells used to analyze HMRa silencing were YKU80 SIR1 (CFY2669), YKU80 sir1 (CFY2670), yku80 SIR1 (CFY2671), and yku80 sir1 (CFY2673). The MATa strains used to analyze HML silencing were YKU80 SIR1 (CFY2684), YKU80 sir1 (CFY2677), yku80 SIR1 (CFY2679), and yku80 sir1 (CFY2681). (B) RT–PCR was used to analyze a1 mRNA levels in MAT sir1 cells that were YKU80 (CFY2670), yku80 (CFY2673), or sir3 (CFY1781). The amount of ACT1 mRNA was also assessed by RT–PCR and used as an internal control. The average a1/ACT1 mRNA ratio for two experiments is plotted.

 

ESC1 and YKU80 functioned differently in HM silencing:

Ku binds telomeres and functions directly to link telomeres to the nuclear periphery and to silence telomeric regions. The inner nuclear membrane protein Esc1 also contributes to telomeric tethering and silencing, although to a lesser degree than Ku (TADDEI et al. 2004). HMR is also tethered to the nuclear periphery (LAROCHE et al. 2000; GARTENBERG et al. 2004), but in contrast to telomeres, this tethering requires both YKU and ESC1 (GARTENBERG et al. 2004); release of HMR from the nuclear periphery into the nucleoplasm occurs only when both YKU70 and ESC1 are deleted (yku70 esc1). Thus Ku and Esc1 have redundant roles in HMR tethering. Since our data revealed that Ku had a substantial role in silencing the HM loci in sir1 cells and that Ku and Esc1 shared roles in HMR tethering, we predicted that Esc1 might also have a role in HM silencing that would be revealed in sir1 cells (Figure 6).

View larger version (25K): In this window In a new window Download PPT slide   FIGURE 6.— ESC1 and YKU80 functioned differently in HM silencing. (A) Strains differing in their ESC1 genotype were analyzed by semiquantitative mating. The influence of ESC1 on CLB5-mediated silencing was tested in MAT HMR-SSa sir1 cells by comparing ESC1 CLB5 (CFY1649), esc1 CLB5 (CFY2381), ESC1 clb5 (CFY2104), and esc1 clb5 (CFY2659) cells. The role of ESC1 in natural HMRa and HML silencing was tested in MAT sir1 and MATa sir1 cells containing ESC1, (ESC1 CLB5, CFY2670 and CFY2677), or a deletion of ESC1 (esc1 CLB5, CFY2667 and CFY2678). (B) Epistasis analysis was used to test the genetic relationship between ESC1 and YKU80. Silencing of HMRa was assessed in MAT sir1 cells differing in their ESC1 and YKU80 genotypes: ESC1 YKU80 (CFY2670), esc1 YKU80 (CFY2667), ESC1 yku80 (CFY2673), and esc1 yku80 (CFY2691).

 
However, genetic experiments revealed that ESC1 did not have a positive role in silencing the HM loci in sir1 cells (Figure 6). We first examined silencing of the sensitized HMR-SSa locus where a role for YKU80 was initially revealed (Figure 2). In contrast to cells with a yku80 (Figure 4A), cells with an esc1 exhibited no defect in silencing HMR-SSa when combined with a sir1 mutation (Figure 6A) and, in fact, exhibited enhanced silencing. The explanation for such enhancement is unknown, but perhaps in esc1 cells the Sir2–4 proteins were released from one region of the nuclear periphery into another region that was more relevant to HMR silencing. That is, perhaps ESC1 controls Sir2–4 pools within the nuclear periphery itself. To test whether ESC1 might have a role in FKH1/CLB5-dependent silencing, the effect of an esc1 on silencing of MAT HMR-SSa sir1 clb5 cells was measured. Again, esc1 did not reduce silencing of HMR-SSa, indicating that unlike YKU80, ESC1 did not function positively to silence HMR-SSa.

It was possible that ESC1-dependent elements had been removed during the construction of HMR-SSa such that a positive role for ESC1 in silencing the HM loci in sir1 cells went undetected. Therefore, silencing of natural HMR and HML was examined in sir1 cells. Unlike a yku80 (Figure 5), an esc1 did not reduce silencing of either HMRa or HML in sir1 cells (Figure 6A). Thus, although YKU80 and ESC1 have roles in tethering HMRa and telomeres to the nuclear periphery, YKU80 possessed a unique function in silencing the HM loci that was not shared with ESC1.

As stated above, Ku and ESC1 have overlapping roles in tethering HMR and telomeres to the nuclear periphery. However, although HMR, telomeres, and their associated Sir proteins are completely released from the nuclear periphery into the nucleoplasm in yku70 esc1 cells, HMR silencing remains unperturbed (GARTENBERG et al. 2004). Thus tethering of HMR is not required for silencing, at least in SIR1 cells. One explanation for HMR silencing remaining intact in yku70 esc1 cells is that any silencing defect caused by redistribution of HMR to the nucleoplasm was compensated for by the higher concentration of Sir proteins that reside in the nucleoplasm in yku70 esc1 cells.

Given the tethering roles of YKU80 and ESC1 (GARTENBERG et al. 2004), it was possible that a yku80 caused a change in Sir2–4 protein concentration at the nuclear periphery relative to the position of HMR that was insufficient for HMR silencing in sir1 cells. To test whether Sir2–4 protein distribution changes could explain the roles of ESC1 and YKU80 in HM silencing in sir1 cells, we compared HMRa silencing in sir1 cells containing an esc1, yku80 or both mutations (esc1 yku80) (Figure 6B). MAT sir1 cells that lacked both ESC1 and YKU80 (esc1 yku80) showed a slight enhancement of silencing compared to cells that lacked only YKU80 (Figure 6B; compare esc1 yku80 to ESC1 yku80). This enhancement was likely attributable to the release of HMR to the nucleoplasm, where higher levels of Sir2–4 proteins now reside, due to release of Sir2–4 proteins from telomeres. However, these esc1 yku80 cells remained substantially defective in silencing HMR compared to MAT sir1 ESC1 YKU80 cells (Figure 6B; compare esc1 yku80 to either ESC1 YKU80 or esc1 YKU80). That is, the double mutation did not rescue silencing of HMRa in MAT sir1 cells to "wild type" (i.e., ESC1 YKU80) levels. Therefore these epistatic analyses indicated that Sir redistribution relative to HMR positioning was unlikely the sole reason that Ku was required for HMR silencing in sir1 cells. Rather, these analyses were consistent with the idea that YKU80 had a distinct positive role in HMR silencing not shared with ESC1.

SIR4 modulation of HM silencing in sir1 cells was influenced by YKU genotype:

A direct interaction between Sir4 and Ku contributes to telomeric silencing (ROY et al. 2004). On the basis of our data, we hypothesized that a Sir4–Ku interaction might be important for HM silencing as well. Overexpression of Sir4 can stimulate ectopic silencing at nontelomeric sites (MAILLET et al. 1996), including HMR (ANDRULIS et al. 1998), and rescue silencing defects at telomeres. In addition, high-copy expression of SIR4 can rescue the HMR silencing defect in MAT HMR-SSa sir1 cells (HOLLENHORST et al. 2000 and Figure 7A). Therefore, we overexpressed Sir4 on a 2µ plasmid (SIR4^hc) and measured HMR silencing in MAT sir1 cells that contained HMR-SSa, HMRE::ARS1, or natural HMRa (Figure 7A). SIR4^hc was able to rescue silencing in sir1 cells containing either HMR-SSa or HMRE::ARS1 silencers. Since silencing of natural HMRa remained so efficient in sir1 cells, no obvious effect of SIR4^hc was observed. However, in yku80 cells, SIR4^hc-dependent silencing with any of these versions of HMRa, including natural HMRa, was reduced. In particular, SIR4^hc silencing of HMRE::ARS1 was quite robust in sir1 YKU80 cells but undetectable in sir1 yku80 cells.

View larger version (34K): In this window In a new window Download PPT slide   FIGURE 7.— SIR4 modulation of HM silencing in sir1 cells was influenced by YKU genotype. (A) Mating assays were performed on an isogenic series of MAT sir1 strains that differed in their YKU80 and HMRa genotypes—YKU80 HMR-SSa (CFY1649), yku80 HMR-SSa (CFY2319), YKU80 HMRE::ARS1 (CFY2595), yku80 HMRE::ARS1 (CFY2601), YKU80 HMRa (CFY2670), and yku80 HMRa (CFY2673)—and in terms of the plasmid that they harbored, either empty vector (vector, Yep24) or 2µ SIR4 (SIR4hc, pCF351). (B) Mating was used to analyze silencing at HMRa or HML, respectively, in MAT sir1 and MATa sir1 strains differing in terms of their YKU80 genotype, either wild-type YKU80 (YKU80, CFY2670 and CFY2677) or containing a deletion of YKU80 (yku80, CFY2673 and CFY2681) or a mutant allele of YKU80 that encodes a protein that cannot interact with Sir4 (yku80-4, CFY2675 and CFY2685).

 
To further address the idea that Ku shared functions with Sir1 to affect Sir4 at the HM loci, we examined the effect of the yku80-4 allele on silencing of HMRa and HML in sir1 cells (Figure 7B). The yku80-4 allele (encoding yKu80P437L) impairs the interaction between yKu80 and Sir4 (TADDEI et al. 2004) but does not abolish telomeric silencing completely or the ability of yKu80 to mediate chromosomal tethering. If the Ku–Sir4 interaction was important for HM silencing in the absence of SIR1, then the yku80-4 allele should produce a similar phenotype as yku80. We tested this idea by comparing the silencing of HMRa and HML in sir1 cells that were YKU80, yku80, or yku80-4 (Figure 7B). These experiments revealed that yku80-4 reduced silencing of HML in sir1 cells substantially (Figure 7B). The effect of this mutation on silencing of HMRa in sir1 cells was more modest, suggesting that natural HMRa has both SIR1- and Ku-independent means of supporting SIR4 function in silencing that are less effectively used (or absent) at HML. Nevertheless, these data were consistent with Ku playing a redundant role with Sir1 in enhancing Sir4 function at the HM loci.

YKU80 contributed to Sir4's association with HML and HMR in sir1 cells:

On the basis of the available evidence, the simplest explanation for Ku's role in HM silencing is that it contributed the physical recruitment of Sir4 to each of the HM loci. Therefore, we compared Sir4 binding to the HML and HMR loci in wild type, yku80, sir1, and sir1 yku80 cells by ChIPs using anti-Sir4 polyclonal antibodies (Figure 8). As reported previously (RUSCHE et al. 2002), Sir4's association with HML and HMR is reduced but not abolished by a sir1 (Figure 8; compare SIR1 YKU80 to sir1 YKU80). Although a yku80 had no effect on Sir4's association with either HM locus in SIR1 cells (Figure 8; compare SIR1 YKU80 to SIR1 yku80), this mutation abolished the level of Sir4 associated with either HM locus in sir1 cells (Figure 8; compare sir1 YKU80 to sir1 yku80). Therefore Ku, like Sir1, contributed to Sir4's physical association with the HM loci in vivo.

View larger version (15K): In this window In a new window Download PPT slide   FIGURE 8.— YKU80 contributed to Sir4's association with HML and HMR in sir1 cells. Sir4 binding to HML (left) and HMR (right) was measured by ChIP experiments with Sir4 polyclonal antibodies in isogenic MAT strains that differed only in terms of their YKU80 or SIR1 genotypes as indicated: SIR1 YKU80 (CFY2669), SIR1 yku80 (CFY2671), sir1 YKU80 (CFY2670), and sir1 yku80 (CFY2673). The Sir4 antibodies were shown to have specificity for Sir4 by performing a ChIP experiment in sir4 cells (sir4, CFY506). The data are shown as the percentage of immunoprecipitated DNA (HML or HMR) recovered from total DNA. The Tel 7.5 (locus 7.5 kb from Tel VI-R) was examined as a negative control.

 

Ku physically associated with HML and HMR:

These genetic data were consistent with Ku sharing an overlapping function with Sir1 at the HM loci. Sir1's role at the HM loci is direct. However, although Ku has been detected at telomeres and at HML during mating-type switching, there exists no evidence that Ku binds to HML or HMRa directly as part of normal silencing. Therefore, we tested whether Ku bound to the silencers of these loci by ChIP. A ChIP experiment using anti-yKu polyclonal antibodies provided evidence that Ku physically associated with the HML and HMR silencers, although the association with the HML silencers was clearly more robust (Figure 9). In these experiments, an internal site 7.5 kb from telomere VI-R (Tel 7.5) served as a negative control and a region 0.5 kb from the end of chromosome VI-R (Tel 0.5) served as a positive control (SHARP et al. 2003). We found significant enrichment of HML-I, HML-E, and HMR-I, providing evidence that the yeast Ku complex was physically associated with the HM loci (Figure 9).

View larger version (11K): In this window In a new window Download PPT slide   FIGURE 9.— Ku physically associated with HML and HMR. (A) Ku association with HMR-E, HMR-I, HML-E, HML-I, and two control loci, 0.5 and 7.5 kb from Tel VI-R, was measured by ChIP with a polyclonal antibody that recognizes yeast Ku. Two isogenic MATa strains that differed only in terms of their YKU80 genotype, YKU80 (CFY2684) or yku80 (CFY2679), were analyzed. The percentage of specific PCR fragment obtained in the immunoprecipitate was determined by video densitometry analysis. The ratio of IP/total DNA was normalized to the value obtained for the negative control locus, Tel VI-R 7.5 (given an arbitrary value of 1.0). Data and standard deviations are reported for three independent ChIP experiments.

 

The yeast Ku complex's involvement in telomeric silencing and in localizing the Sir2–4 proteins and associated telomeres to the nuclear periphery is well established (reviewed in FISHER and ZAKIAN 2005). In addition, experimental data support a role for Ku in controlling the localization of the HM loci to the nuclear periphery (GARTENBERG et al. 2004). Given these data, it is somewhat perplexing that an unambiguous functional role for Ku in silencing either HMR or HML has not been established. This study revealed that the explanation for an inability to detect a role for Ku in silencing of the HM loci was that Ku's function was completely masked by the specialized role of SIR1 at HMR and HML. Yeast cells harboring null mutations in either SIR1 or YKU80 showed little or no silencing defects at either HM locus, as expected (IVY et al. 1986; PILLUS and RINE 1989; LAROCHE et al. 2000; GARTENBERG et al. 2004). However, cells with mutations in both genes (i.e., sir1 yku80 cells) were completely defective for silencing the HM loci, and Sir4-directed ChIP experiments revealed that this defect was likely due to an inability of the HM loci to bind Sir4. Thus Ku was required for the residual but substantial Sir4 association with the HM loci in sir1 cells. Genetic analysis suggested that Ku's HM silencing function was distinct from the overlapping role that it plays with the protein Esc1 in physically tethering the HM loci, telomeres, and associated Sir2–4 proteins to the nuclear periphery. Finally, studies of the effect of SIR4 dosage and Ku localization by ChIP provided evidence that Ku physically associates with the HM loci and helps to promote Sir4 function. Thus Sir1 and Ku contributed to independent and redundant pathways in the assembly of silent chromatin at the cryptic mating-type loci through recruitment of Sir4. We conclude that Ku, like Sir1, should be viewed as an integral and direct stabilizing force for silent chromatin at the HM loci.

Ku in HMR and HML silencing:

An important mechanistic role for Sir1 in silencing the HM loci is to stabilize association of Sir4 with silencers (reviewed in FOX and MCCONNELL 2005). However, some Sir4 remains at natural HMR and HML even in the absence of SIR1 (RUSCHE et al. 2002), providing evidence that Sir4 recruitment represents a key Sir1-independent step required to nucleate silencing at HMR and HML. These observations are consistent with Sir4's pivotal role in nucleating telomeric silencing (HOPPE et al. 2002; LUO et al. 2002) that occurs completely independently of Sir1 (APARICIO et al. 1991). Taken together with the data reported here, a simple model for Ku's role at the HM loci is that it functions directly with Sir1 to recruit and/or stabilize Sir4.

Sir1 promotes Sir4 binding to the HM silencers by binding to silencer-bound ORC and directly interacting with Sir4 (BOSE et al. 2004). Interestingly, this function of Sir1, as measured by studies of the HMR-E silencer, is aided by this silencer's Rap1-binding site (CASEY et al. 2008), suggesting that stable binding of Sir4 to the HMR-E silencer requires that Sir4 interact with both Sir1 and Rap1 (MORETTI et al. 1994; COCKELL et al. 1995; MORETTI and SHORE 2001; LUO et al. 2002). Previous studies of Ku–Sir4 interactions in telomeric silencing combined with the SIR4 dosage and Sir4-directed ChIP data described in this study raise the possibility that Ku provides yet another direct molecular force that stabilizes Sir4 at the HM loci. Two possible and not exclusive mechanisms might explain how Ku performs this function. First, Ku could contribute to Sir4's stable association with silencers and subsequent nucleation of silent chromatin. This mechanism agrees with the idea that Ku's role in silencing is mechanistically redundant with Sir1's role: both proteins may help stabilize Sir4 at silencers, yet remain separated from the Sir2–4 chromatin that forms over the HM loci. A second alternative is that Ku binds with Sir4 throughout silent chromatin to stabilize Sir4 association with the HM loci. This mechanism is distinct from how Sir1 is thought to work with Sir4 in HM silencing. Additional and extensive ChIP analyses might help sort through these models. Regardless, both models describe a direct role for Ku in silencing the HM loci that extends beyond the proposed "indirect" role for Ku in HM silencing where Ku modulates HM silencing because it controls the relative localization of the HM loci and pools of Sir proteins in the nucleus (GARTENBERG et al. 2004). In addition, the data reported here provided evidence that a Sir4–Rap1 interaction was not a key factor in Ku-dependent silencing at HMR. Indeed, the HMRE::ARS1 silencer should create an HMR locus that lacks any Rap1-binding sites, yet is proficient in Ku-dependent silencing. In addition, Sir4–Rap1 interactions were insufficient for supporting robust silencing at the HM loci in the absence of SIR1 and Ku, even when SIR4 was overexpressed. This observation underscores a difference between telomeric and HM loci silencing since overexpression of SIR4 can rescue telomeric silencing in yku80 mutants (MORETTI et al. 1994; COCKELL et al. 1995; MORETTI and SHORE 2001; LUO et al. 2002). Perhaps the multiple Rap1 proteins present at telomeres provide a more robust platform for Sir4 than the few Rap1-binding sites present within the HM loci.

The Ku complex at internal chromosomal regions:

Although extensive studies of Ku in silencing have been performed, there is no report that Ku binds to either HML or HMR as part of normal silencing. In fact, a Myc-tagged Ku was not detected at HML except during mating-type switching (RUAN et al. 2005). Additionally, during the course of our experiments, we could not detect HA-tagged Ku proteins at the HM loci with anti-HA-directed ChIPs even though these ChIPs clearly demonstrated Ku association with the positive control telomere locus (E. E. PATTERSON, unpublished results). However, clearly a ChIP with a polyclonal antibody raised against the yeast Ku complex (ZHANG et al. 2007) effectively detected the Ku complex at HML and to a lesser extent at HMR. We suspect that the disparity between ChIPs with antibodies against the HA epitope and ChIPs with a polyclonal antibody raised against Ku was due to differences between how Ku associates with telomeres vs. the HM loci. Ku binds to the ends of DNA with a high affinity and thus its association with telomeres likely involves extensive direct Ku–DNA contacts. In contrast, Ku's association with internal chromosomal regions such as the HM loci probably relies more on protein–protein interactions; direct Ku–DNA contacts may be limited or even nonexistent. Perhaps the polyclonal antibody was more effective at immunoprecipitating the small amount of Ku effectively crosslinked through protein–protein bridges to HM DNA. Alternatively, in the context of the internal HM loci, the HA epitopes may be masked within a protein complex and not available for interactions with the anti-HA antibody after crosslinking.

There is precedence for protein–protein interactions contributing to Ku's localization to an internal chromosomal region. In particular, Ku binds to the recombinational enhancer and this binding depends on Mcm1 (RUAN et al. 2005). Additionally and as stated above, this same study (RUAN et al. 2005) reported that Ku could be detected at HML but only during mating-type switching. The difference between these results and those reported here might be that the former study performed ChIPs with an epitope-tagged version of Ku. However, it is also possible that during mating-type recombination the conformation of Ku changes to expose the epitope tag more effectively and/or enhance Ku's contact with DNA, thus allowing Myc-tagged Ku's association with HML to be detected.

The key question arising from the observations reported here is, what interaction(s) recruits Ku to the HM loci? Obviously, a strong candidate is Sir4 itself. Perhaps Sir4 and Ku recognize some element(s) of silencers as a protein complex. But, interestingly, neither Ku nor Sir4 appear to be relying on Rap1 for their function at the HM loci since Ku-dependent silencing was observed with the HMRE::ARS1 silencer that lacks a Rap1-binding site. Instead, Ku and Sir4 may be relying on some other silencer-recognition mechanism. In this regard, it is intriguing that the effects of yeast Ku on ORC binding in vitro have been reported (SHAKIBAI et al. 1996) and that in mammalian cells Ku associates with replication origins and has been found in a complex with known replication proteins, including ORC2 (NOVAC et al. 2001; MATHEOS et al. 2002, 2003). In addition, recent two-hybrid analyses of Orc subunits report an interaction between Orc2 and Sir4 (MATSUDA et al. 2007). Thus an intriguing possibility is that Ku and/or Sir4 may interact together with some feature of ORC.

Cell-cycle regulators in SIR1-independent silencing at HMR:

A major goal of the screen presented in this report was to identify genes that could help explain how the cell-cycle regulators Fkh1 and Clb5 contribute to silencing of HMR (CASEY et al. 2008). In particular, we propose that HMR silencing in sir1 cells allows us to detect an effect on chromosomal architecture and/or the nuclear distributions of Sir2–4 proteins that is highly regulated and dynamic during the cell cycle and that is likely to have broad significance for chromosome biology. As described in this report, this screen revealed a role for Ku in silencing the HM loci. Ku's role in chromosomal dynamics during the cell cycle (COSGROVE et al. 2002; TADDEI et al. 2004) would be an attractive candidate for explaining how cell-cycle regulators could have such a substantial impact on silencing. And although the genetic analyses provided evidence that Ku's role in SIR1-independent silencing is unlikely to be the primary target regulated by Fkh1 and Clb5, its unanticipated identification in this screen is a reminder that there are many aspects of HM silencing and its regulation that remain poorly understood.

We are especially grateful to Melissa Hefferin, Alan Tomkinson (Greenbaum Cancer Center, Baltimore), and Sang Eun Lee (University of Texas Health Science Center, San Antonio, TX) for sharing anti-Ku polyclonal antibody; Danesh Moazed (Harvard Medical School, Boston) for sharing Sir4 antibodies; and Rodney Rothstein (Columbia University, New York) for sharing unpublished yeast strains. We are also grateful to Marc Gartenberg (Robert Wood Johnson Medical School, Piscataway, NJ) and Erika Shor for comments on the manuscript and other relevant scientific interactions regarding this project. We thank Philipp Müller for help on Figure 3 and other members of the Fox lab for helpful discussions. E.E.P. was supported in part by a National Institutes of Health (NIH) Predoctoral Training Program in Genetics to the Laboratory of Genetics (5 T32 GM07133) and by an American Heart Association predoctoral fellowship (0615552Z). This work was supported primarily by a grant from the American Cancer Society (RSG-02-164-02-GMC to C.A.F.) and supplemented by a grant from the NIH (RO1 GM56890 to C.A.F.).

Note added in proof: A recent independent study also demonstrates a role for Ku in silencing of the HM mating-type loci [C. L. VANDRE, R. T. KAMAKAKA and D. H. RIVIER, 2008, The DNA end-binding protein Ku regulates silencing at the internal HML and HMR loci in Saccharomyces cerevisiae. Genetics (in press)].

ANDRULIS, E. D., A. M. NEIMAN, D. C. ZAPPULLA and R. STERNGLANZ, 1998 Perinuclear localization of chromatin facilitates transcriptional silencing. Nature 394: 592–595.[CrossRef][Medline]

APARICIO, O. M., B. L. BILLINGTON and D. E. GOTTSCHLING, 1991 Modifiers of position effect are shared between telomeric and silent mating-type loci in S. cerevisiae. Cell 66: 1279–1287.[CrossRef][Medline]

AXELROD, A., and J. RINE, 1991 A role for CDC7 in repression of transcription at the silent mating-type locus HMR in Saccharomyces cerevisiae. Mol. Cell. Biol. 11: 1080–1091.[Abstract/Free Full Text]

BOSE, M. E., K. H. MCCONNELL, K. A. GARDNER-AUKEMA, U. MULLER, M. WEINREICH et al., 2004 The origin recognition complex and Sir4 protein recruit Sir1p to yeast silent chromatin through independent interactions requiring a common Sir1p domain. Mol. Cell. Biol. 24: 774–786.[Abstract/Free Full Text]

BURNS, N., B. GRIMWADE, P. B. ROSS-MACDONALD, E. Y. CHOI, K. FINBERG et al., 1994 Large-scale analysis of gene expression, protein localization, and gene disruption in Saccharomyces cerevisiae. Genes Dev. 8: 1087–1105.[Abstract/Free Full Text]

CASEY, L., E. E. PATTERSON, U. MULLER and C. A. FOX, 2008 Conversion of a replication origin to a silencer through a pathway shared by a forkhead transcription factor and an S phase cyclin. Mol. Biol. Cell 19: 608–622.[Abstract/Free Full Text]

CHEUNG, W. L., S. D. BRIGGS and C. D. ALLIS, 2000 Acetylation and chromosomal functions. Curr. Opin. Cell Biol. 12: 326–333.[CrossRef][Medline]

COCKELL, M., F. PALLADINO, T. LAROCHE, G. KYRION, C. LIU et al., 1995 The carboxy termini of Sir4 and Rap1 affect Sir3 localization: evidence for a multicomponent complex required for yeast telomeric silencing. J. Cell Biol. 129: 909–924.[Abstract/Free Full Text]

COSGROVE, A. J., C. A. NIEDUSZYNSKI and A. D. DONALDSON, 2002 Ku complex controls the replication time of DNA in telomere regions. Genes Dev. 16: 2485–2490.[Abstract/Free Full Text]

EHRENHOFER-MURRAY, A. E., R. T. KAMAKAKA and J. RINE, 1999 A role for the replication proteins PCNA, RF-C, polymerase epsilon and Cdc45 in transcriptional silencing in Saccharomyces cerevisiae. Genetics 153: 1171–1182.[Abstract/Free Full Text]

FISHER, T. S., and V. A. ZAKIAN, 2005 Ku: a multifunctional protein involved in telomere maintenance. DNA Rep. 4: 1215–1226.[CrossRef]

FOX, C. A., and K. H. MCCONNELL, 2005 Toward biochemical understanding of a transcriptionally silenced chromosomal domain in Saccharomyces cerevisiae. J. Biol. Chem. 280: 8629–8632.[Free Full Text]

GARDNER, K. A., J. RINE and C. A. FOX, 1999 A region of the Sir1 protein dedicated to recognition of a silencer and required for interaction with the Orc1 protein in Saccharomyces cerevisiae. Genetics 151: 31–44.[Abstract/Free Full Text]

GARTENBERG, M. R., F. R. NEUMANN, T. LAROCHE, M. BLASZCZYK and S. M. GASSER, 2004 Sir-mediated repression can occur independently of chromosomal and subnuclear contexts. Cell 119: 955–967.[CrossRef][Medline]

GUTHRIE, C., and G. R. FINK, 1991 Guide to Yeast Genetics and Molecular Biology. Academic Press, San Diego.

HOLLENHORST, P. C., M. E. BOSE, M. R. MIELKE, U. MULLER and C. A. FOX, 2000 Forkhead genes in transcriptional silencing, cell morphology and the cell cycle: overlapping and distinct functions for FKH1 and FKH2 in Saccharomyces cerevisiae. Genetics 154: 1533–1548.[Abstract/Free Full Text]

HOPPE, G. J., J. C. TANNY, A. D. RUDNER, S. A. GERBER, S. DANAIE et al., 2002 Steps in assembly of silent chromatin in yeast: Sir3-independent binding of a Sir2/Sir4 complex to silencers and role for Sir2-dependent deacetylation. Mol. Cell. Biol. 22: 4167–4180.[Abstract/Free Full Text]

IVY, J. M., A. J. KLAR and J. B. HICKS, 1986 Cloning and characterization of four SIR genes of Saccharomyces cerevisiae. Mol. Cell. Biol. 6: 688–702.[Abstract/Free Full Text]

LAMAN, H., D. BALDERES and D. SHORE, 1995 Disturbance of normal cell cycle progression enhances the establishment of transcriptional silencing in Saccharomyces cerevisiae. Mol. Cell. Biol. 15: 3608–3617.[Abstract/Free Full Text]

LAROCHE, T., S. G. MARTIN, M. TSAI-PFLUGFELDER and S. M. GASSER, 2000 The dynamics of yeast telomeres and silencing proteins through the cell cycle. J. Struct. Biol. 129: 159–174.[CrossRef][Medline]

LOO, S., and J. RINE, 1995 Silencing and domains of heritable gene expression. Annu. Rev. Cell Dev. Biol. 11: 519–548.[CrossRef][Medline]

LUO, K., M. A. VEGA-PALAS and M. GRUNSTEIN, 2002 Rap1-Sir4 binding independent of other Sir, yKu, or histone interactions initiates the assembly of telomeric heterochromatin in yeast. Genes Dev. 16: 1528–1539.[Abstract/Free Full Text]

MAILLET, L., C. BOSCHERON, M. GOTTA, S. MARCAND, E. GILSON et al., 1996 Evidence for silencing compartments within the yeast nucleus: a role for telomere proximity and Sir protein concentration in silencer-mediated repression. Genes Dev. 10: 1796–1811.[Abstract/Free Full Text]

MATHEOS, D., M. T. RUIZ, G. B. PRICE and M. ZANNIS-HADJOPOULOS, 2002 Ku antigen, an origin-specific binding protein that associates with replication proteins, is required for mammalian DNA replication. Biochim. Biophys. Acta 1578: 59–72.[Medline]

MATHEOS, D., O. NOVAC, G. B. PRICE and M. ZANNIS-HADJOPOULOS, 2003 Analysis of the DNA replication competence of the xrs-5 mutant cells defective in Ku86. J. Cell Sci. 116: 111–124.[Abstract/Free Full Text]

MATSUDA, K., M. MAKISE, Y. SUEYASU, M. TAKEHARA, T. ASANO et al., 2007 Yeast two-hybrid analysis of the origin recognition complex of Saccharomyces cerevisiae: interaction between subunits and identification of binding proteins. FEMS Yeast Res. 7: 1263–1269.[Medline]

MCNALLY, F. J., and J. RINE, 1991 A synthetic silencer mediates SIR-dependent functions in Saccharomyces cerevisiae. Mol. Cell. Biol. 11: 5648–5659.[Abstract/Free Full Text]

MOAZED, D., A. D. RUDNER, J. HUANG, G. J. HOPPE and J. C. TANNY, 2004 A model for step-wise assembly of heterochromatin in yeast. Novartis Found. Symp. 259: 48–56; discussion 56–62, 163–169.[Medline]

MORETTI, P., and D. SHORE, 2001 Multiple interactions in Sir protein recruitment by Rap1p at silencers and telomeres in yeast. Mol. Cell. Biol. 21: 8082–8094.[Abstract/Free Full Text]

MORETTI, P., K. FREEMAN, L. COODLY and D. SHORE, 1994 Evidence that a complex of SIR proteins interacts with the silencer and telomere-binding protein RAP1. Genes Dev. 8: 2257–2269.[Abstract/Free Full Text]

NOVAC, O., D. MATHEOS, F. D. ARAUJO, G. B. PRICE and M. ZANNIS-HADJOPOULOS, 2001 In vivo association of Ku with mammalian origins of DNA replication. Mol. Biol. Cell 12: 3386–3401.[Abstract/Free Full Text]

PERROD, S., and S. M. GASSER, 2003 Long-range silencing and position effects at telomeres and centromeres: parallels and differences. Cell. Mol. Life Sci. 60: 2303–2318.[CrossRef][Medline]

PILLUS, L., and J. RINE, 1989 Epigenetic inheritance of transcriptional states in S. cerevisiae. Cell 59: 637–647.[CrossRef][Medline]

PILLUS, L., and J. RINE, 2004 SIR1 and the origin of epigenetic states in Saccharomyces cerevisiae. Cold Spring Harb. Symp. Quant. Biol. 69: 259–265.[Abstract/Free Full Text]

REIFSNYDER, C., J. LOWELL, A. CLARKE and L. PILLUS, 1996 Yeast silencing genes and human genes associated with AML and HIV-1 Tat interactions are homologous with acetyltransferases. Nat. Genet. 14: 42–49.[CrossRef][Medline]

ROY, R., B. MEIER, A. D. MCAINSH, H. M. FELDMANN and S. P. JACKSON, 2004 Separation-of-function mutants of yeast Ku80 reveal a Yku80p-Sir4p interaction involved in telomeric silencing. J. Biol. Chem. 279: 86–94.[Abstract/Free Full Text]

RUAN, C., J. L. WORKMAN and R. T. SIMPSON, 2005 The DNA repair protein yKu80 regulates the function of recombination enhancer during yeast mating type switching. Mol. Cell. Biol. 25: 8476–8485.[Abstract/Free Full Text]

RUDNER, A. D., B. E. HALL, T. ELLENBERGER and D. MOAZED, 2005 A nonhistone protein-protein interaction required for assembly of the SIR complex and silent chromatin. Mol. Cell. Biol. 25: 4514–4528.[Abstract/Free Full Text]

RUSCHE, L. N., A. L. KIRCHMAIER and J. RINE, 2002 Ordered nucleation and spreading of silenced chromatin in Saccharomyces cerevisiae. Mol. Biol. Cell 13: 2207–2222.[Abstract/Free Full Text]

RUSCHE, L. N., A. L. KIRCHMAIER and J. RINE, 2003 The establishment, inheritance, and function of silenced chromatin in Saccharomyces cerevisiae. Annu. Rev. Biochem. 72: 481–516.[CrossRef][Medline]

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SEKINGER, E. A., and D. S. GROSS, 2001 Silenced chromatin is permissive to activator binding and PIC recruitment. Cell 105: 403–414.[CrossRef][Medline]

SHAKIBAI, N., V. KUMAR and S. EISENBERG, 1996 The Ku-like protein from Saccharomyces cerevisiae is required in vitro for the assembly of a stable multiprotein complex at a eukaryotic origin of replication. Proc. Natl. Acad. Sci. USA 93: 11569–11574.[Abstract/Free Full Text]

SHARP, J. A., D. C. KRAWITZ, K. A. GARDNER, C. A. FOX and P. D. KAUFMAN, 2003 The budding yeast silencing protein Sir1 is a functional component of centromeric chromatin. Genes Dev. 17: 2356–2361.[Abstract/Free Full Text]

STONE, E. M., C. REIFSNYDER, M. MCVEY, B. GAZO and L. PILLUS, 2000 Two classes of sir3 mutants enhance the sir1 mutant mating defect and abolish telomeric silencing in Saccharomyces cerevisiae. Genetics 155: 509–522.[Abstract/Free Full Text]

STRAHL-BOLSINGER, S., A. HECHT, K. LUO and M. GRUNSTEIN, 1997 Sir2 and Sir4 interactions differ in core and extended telomeric heterochromatin in yeast. Genes Dev. 11: 83–93.[Abstract/Free Full Text]

TADDEI, A., F. HEDIGER, F. R. NEUMANN, C. BAUER and S. M. GASSER, 2004 Separation of silencing from perinuclear anchoring functions in yeast Ku80, Sir4 and Esc1 proteins. EMBO J. 23: 1301–1312.[CrossRef][Medline]

VALENZUELA, L., N. DHILLON, R. N. DUBEY, M. R. GARTENBERG and R. T. KAMAKAKA, 2008 Long-range communication between the silencers of HMR. Mol. Cell. Biol. 28: 1924–1935.[Abstract/Free Full Text]

VAZQUEZ, J., and P. SCHEDL, 1994 Sequences required for enhancer blocking activity of scs are located within two nuclease-hypersensitive regions. EMBO J. 13: 5984–5993.[Medline]

XU, E. Y., K. A. ZAWADZKI and J. R. BROACH, 2006 Single-cell observations reveal intermediate transcriptional silencing states. Mol. Cell 23: 219–229.[CrossRef][Medline]

ZHANG, Y., M. L. HEFFERIN, L. CHEN, E. Y. SHIM, H. M. TSENG et al., 2007 Role of Dnl4-Lif1 in nonhomologous end-joining repair complex assembly and suppression of homologous recombination. Nat. Struct. Mol. Biol. 14: 639–646.[CrossRef][Medline]

Communicating editor: F. WINSTON

Related articles in Genetics:

ISSUE HIGHLIGHTS

Genetics 2008 180: NP. [Full Text]  

This article has been cited by other articles:

				M. E. Marvin, M. M. Becker, P. Noel, S. Hardy, A. A. Bertuch, and E. J. Louis The Association of yKu With Subtelomeric Core X Sequences Prevents Recombination Involving Telomeric Sequences Genetics, October 1, 2009; 183(2): 453 - 467. [Abstract] [Full Text] [PDF]

				C. L. Vandre, R. T. Kamakaka, and D. H. Rivier The DNA End-Binding Protein Ku Regulates Silencing at the Internal HML and HMR Loci in Saccharomyces cerevisiae Genetics, November 1, 2008; 180(3): 1407 - 1418. [Abstract] [Full Text] [PDF]

International Access Link

Online ISSN: 1943-2361  Print ISSN: 0016-6731
Copyright 2009 by the Genetics Society of America
phone: 412-268-1812   fax: 412-268-1813   email: genetics-gsa{at}andrew.cmu.edu