- THIS ARTICLE
-
Abstract
- Full Text (PDF)
-
All Versions of this Article:
genetics.108.088591v1
179/3/1345 most recent - Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Favor, J.
- Articles by Zaus, I.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Favor, J.
- Articles by Zaus, I.
Originally published as Genetics Published Articles Ahead of Print on June 18, 2008.
Genetics, Vol. 179, 1345-1355, July 2008, Copyright © 2008
doi:10.1534/genetics.108.088591
Relationship of Pax6 Activity Levels to the Extent of Eye Development in the Mouse, Mus musculus
Jack Favor*,1,
Christian Johannes Gloeckner*,
Angelika Neuhäuser-Klaus*,
Walter Pretsch*,
Rodica Sandulache*,
Simon Saule
and
Irmgard Zaus*
* Institute of Human Genetics, Helmholtz Zentrum München, German Research Center for Environmental Health, D-85764 Neuherberg, Germany and
Centre National de la Recherche Scientifique, UMR 146, Institut Curie Section de Recherche, Centre Universitaire, 91405 Orsay Cedex, France
1 Corresponding author: Institute of Human Genetics, Helmholtz Zentrum München, German Research Center for Environmental Health, Ingolstaedter Landstrasse 1, D-85764 Neuherberg, Germany.
E-mail: favor{at}helmholtz-muenchen.de
In this study we extend the mouse Pax6 mutant allelic series to include a homozygous and hemizygous viable hypomorph allele. The Pax6132-14Neu allele is a Phe272Ile missense mutation within the third helix of the homeodomain. The mutant Pax6 homeodomain shows greatly reduced binding activity to the P3 DNA binding target. Glucagon-promoter activation by the entire mutant Pax6 product of a reporter gene driven by the G1 paired and homeodomain DNA binding target was slightly increased. We constructed mutant Pax6 genotypes such that Pax6 activity ranged between 100 and 0% and show that the extent of eye development is progressively reduced as Pax6 activity decreased. Two apparent thresholds identify three groups in which the extent of eye development abruptly shifted from complete eye at the highest levels of Pax6 to a rudimentary eye at intermediate levels of Pax6 to very early termination of eye development at the lowest levels of Pax6. Of the two Pax6-positive regions that participate in eye development, the surface ectoderm, which develops into the lens vesicle and the cornea, is more sensitive to reduced levels of Pax6 activity than the optic vesicle, which develops into the inner and outer retinal layers.
THE transcription factor Pax6 belongs to the family of paired-box-containing genes and is highly conserved over a wide range of phyla within the kingdom animalia. The mouse Pax6 gene encodes a protein with DNA binding paired and homeodomains separated by a linker region, and a C-terminal proline-, serine-, and threonine-rich transcriptional activation domain (WALTHER and GRUSS 1991; GLASER et al. 1994). By mutant analysis Pax6 was shown to function in the development of the eye (THEILER et al. 1978; HOGAN et al. 1986, 1988; HILL et al. 1991; BAULMANN et al. 2002), olfactory tissues (HOGAN et al. 1986; HEINZMANN et al. 1991; GRINDLEY et al. 1995; QUINN et al. 1996), craniofacial traits (KAUFMAN et al. 1995), the central nervous system (SCHMAHL et al. 1993; STOYKOVA et al. 1996, 1997, 2000; GRINDLEY et al. 1997; GÖTZ et al. 1998), the pancreas (ST-ONGE et al. 1997), the pituitary gland (BENTLEY et al. 1999; KIOUSSI et al. 1999), the pineal gland (ESTIVILL-TORRÚS et al. 2001) and adult neurogenesis (HACK et al. 2005). For correct development of the eye a critical range of Pax6 expression is required since heterozygous carriers of Pax6 deletions (HOGAN et al. 1986; TON et al. 1991) and transgenic mice with increased levels of Pax6 (SCHEDL et al. 1996) both express eye abnormalities.
Pax6 gene products control the transcriptional activity of target genes by directly or indirectly (via oligomerization with additional cofactors) binding to enhancer DNA target sequences (CHI and EPSTEIN 2002). The "level" of Pax6 gene activity cannot be considered the sum of activities of the individual domains since missense mutations confined to a single domain can affect the binding activity of the full-length gene product by the second nonmutated domain and can alter the spectrum of gene target sequences to which the mutated gene product binds (TANG et al. 1997; SINGH et al. 2000; MISHRA et al. 2002). Similarly, missense mutations in the C-terminal proline-, serine-, and threonine-rich transcription activation domain can affect the DNA binding activity of the gene product by the paired or homeodomains (SINGH et al. 2001). The situation is further complicated since Pax6 is expressed as a number of isoforms (CARRIÈRE et al. 1993, 1995; WAWERSIK et al. 2000; GORLOV and SAUNDERS 2002). Thus, although DNA binding activity of isolated Pax6 domains to specific DNA target sequences or reporter gene activation by specific Pax6 isoforms can be measured, such results do not reflect the in vivo situation of a mixture of multiple isoforms simultaneously binding to a range of alternate target sites. Previous experimental approaches to address the question of the consequences of altering the levels of Pax6 on developmental outcome have included the use of mouse null mutations (VAN RAAMSDONK and TILGHMAN 2000), Pax6–/–
Pax6+/+ chimera (QUINN et al. 1996; COLLINSON et al. 2000, 2001, 2003; TALAMILLO et al. 2003), conditional inactivation of Pax6 in a tissue- and stage-specific manner (ASHERY-PADAN et al. 2000; DAVIS-SILBERMAN et al. 2005), overexpression of Pax6 via transgenic mutant constructs (SCHEDL et al. 1996; DUNCAN et al. 2000; KIM and LAUDERDALE 2006, 2008; MANUEL et al. 2007) and retrovirally mediated Pax6 expression (HEINS et al. 2002; HACK et al. 2005). We have taken a genetic approach utilizing members of the mouse Pax6 allelic series. We identified and characterized the first homozygous viable Pax6 hypomorph allele. With this extension of the Pax6 allelic series we constructed Pax6 mutant genotypes such that the predicted Pax6 activity ranged from 100% normal to 0% and assessed the extent of eye development.
Mice, mapping, and slit lamp examination:
The original mutant, designated 132, was recovered as a heterozygote expressing anterior pyramidal opacity with corneal adhesions in the offspring of a (102/El x C3H/El)F1 male exposed to 4.55 + 4.55 Gy
-irradiation and mated to an Oak Ridge tester-stock female. Confirmation crosses indicated the mutation to be autosomal dominant (KRATOCHVILOVA and EHLING 1979). Subsequent analyses showed the mutation to be homozygous viable and fertile, with homozygotes expressing microphthalmia and closed eyes, and that the 132 mutation was allelic with three additional eye mutations. The allelism group was designated Cat4 (KRATOCHVILOVA and FAVOR 1992) and the 132 mutation was previously assigned the mutant symbol Apyc or Apcat1. The 132 mutation was incorrectly (see results below) assigned linkage to chromosome (Chr) 8 (FAVOR et al. 1997). Ophthalmological examinations were done as previously described (FAVOR 1983). Prior to mapping, a congenic C3H/HeJ 132 mutant line was established by >20 consecutive backcross generations of 132 heterozygotes to strain C3H/HeJ. Genomewide linkage analysis of the mutation relative to 42 Massachusetts Institute of Technology (MIT) microsatellite markers, which are distributed over the 19 autosomes, was carried out as previously described (FAVOR et al. 1997). Since, as will be shown below, the 132 mutation is a hypomorph mutant allele of Pax6 with a high frequency of phenotypically misclassifying heterozygous carriers as wild type, only animals classified as mutants were used in the linkage analysis. After localization of the mutation to Chr 2 the backcross mice were genotyped for additional MIT microsatellite markers within the region. Segregation data were analyzed with Map Manager version 2.6.5 (MANLY 1993) and the gene order was determined by minimizing the number of multiple crossovers. Animals were bred and maintained in our facilities according to the German law for the protection of animals. All inbred strains employed in this study (C3H/HeJ, C57BL/6El) were obtained from breeding colonies maintained by the Department of Animal Resources at Neuherberg.
Morphology and histology:
Wild type, heterozygous 132/+ and homozygous 132/132 mutants were weighed, and both eyes were classified for the degree of eye opacity and eye weight at P35 as previously described (FAVOR et al. 2001), with the addition of two eye classes to accommodate the minor eye phenotype expressed by heterozygous 132/+ mice (minor iris irregularities with no lens opacity) and the extreme phenotype expressed by homozygous 132/132 mice (extreme microphthalmia with lens/corneal opacity and iris abnormality). Homozygous wild-type, heterozygous 132/+, and homozygous 132/132 embryos were produced from intercrosses of 132/+ heterozygotes. Compound heterozygotes were produced in crosses of homozygous 132/132 mutants with heterozygous carriers of various Pax6 mutations. The recovered compound heterozygotes were fertility tested by outcrossing to homozygous wild-type and homozygous 132/132 mutant partners. Compound heterozygote embryos and animals at weaning were identified as expressing extreme microphthalmia. Embryos were collected and processed for histology, and histological sectioning, staining, and photography were all conducted as previously described (FAVOR et al. 2001, 2007).
Sequencing, DNA binding assay, and glucagon-promoter assay:
RNA and genomic DNA were extracted from the heads and bodies, respectively, of homozygous wild-type and homozygous 132/132 mutant E15 embryos. Preparation and sequencing procedures were as previously described (FAVOR et al. 2001). Two primer pairs were used to generate overlapping amplification products across the Pax6 cDNA. These amplification products were used as substrates to sequence the Pax6 transcript. The sequencing results using cDNA as substrate were confirmed by sequencing the mutation site with genomic DNA as substrate in the initial embryos analyzed as well as from additional heterozygous and homozygous mutants. The primer pair used to amplify and to sequence the mutation site from genomic DNA was 5' ACCCATTATCCAGATGTGTTTGCC and 5' GGAATGTGACTAGGAGTGTTGCTG. Numbering of the transcript and the translation products corresponds to EMSMUSG00000027168/ENUMUST00000111087 (Ensembl, release 48).The electrophoretic mobility-shift assay to ascertain homeodomain binding to the P3 DNA target was conducted as previously described (FAVOR et al. 2001). Briefly, subclones of the wild-type, Pax64Neu, and the 132 mutant Pax6 cDNAs, coding for the entire homeodomain with six additional amino acids upstream and four amino acids downstream (Pax6 amino acids 218–288), were inserted between the Pst1 and the HindIII restriction sites of the pQE-41 vector (QIAGEN, Valencia, CA). The pQE expression constructs were transformed into Escherichia coli strain M15 [pREP4]. Expression of the homeodomains in exponentially growing bacterial cultures was induced with 0.1 mM isopropyl thiogalactoside for 2 hr at 30°. Bacterial pellets were lysed, crude extracts were electrophoresed in 10% SDS–PAGE, and proteins visualized by staining with Coomassie brilliant blue. Crude extracts from the transformed bacteria were incubated with 15 fmol of the target oligonucleotide, which was 3' end labeled with digoxygenin-11-ddUTP as recommended by the supplier (Roche Diagnostics, Mannheim, Germany). The single-strand oligonucleotide target sequence (with the P3 homeodomain binding site underlined) was 5'TCGAGGGCATCAGGATGCTAATTGAATTAGCATCCGATCGGG3', to which the Pax6 homeodomain binds via cooperative dimerization (WILSON et al. 1993; CZERNY and BUSSLINGER 1995). The rabbit anti-Pax6-homeodomain antiserum used to control for the specificity of the homeodomain-DNA complex was serum 13 (CARRIÈRE et al. 1993).
To assess transcriptional activation by the Pax6 wild-type, Pax64Neu, and 132 mutant gene products we carried out glucagon-promoter assays (RITZ-LASER et al. 1999; PLANQUE et al. 2001). Pax6 is expressed in the pancreas and is required for
-cell development and expression of glucagon (ST-ONGE et al. 1997). Transcriptional activation of glucagon by Pax6 is mediated by the interaction of Pax6 with two AT-rich sequences, designated G1 and G3, of the glucagon gene (RITZ-LASER et al. 1999). The glucagon-promoter assay was carried out according to the previously described procedures (RITZ-LASER et al. 1999; PLANQUE et al. 2001). The full-length wild-type, Pax64Neu mutant, and 132 mutant Pax6 canonical transcripts (isoforms not containing the exon 5a) were amplified with the primer set 5' AGCTCCAGCATGCAGAACAGTCAC and 5' ACTGCTGTGTCCACATAGTCATTGGC using the Titan RT–PCR system (Roche Diagnostics, Mannheim, Germany). The amplification products were isolated by electrophoretic separation in 1% agarose gels and extracted with the MiniElute kit (QIAGEN). The blunt-end PCR products were modified to sticky-end 3' A overhangs with the QIAGEN PCR Cloningplus kit (QIAGEN) and ligated into the QIAGEN pDrive Cloning Vector orientated to the T7 promoter (QIAGEN). Transformed E. coli strain M15[pREP4] colonies were isolated, cultured, and plasmid DNA extracted for sequencing to identify clones containing the full-length transcript sequences correctly orientated to the T7 promoter. The KpnI–HindIII restriction fragment of each clone containing the entire Pax6 coding sequence was inserted into the pVNC vector. Pax6 was therefore expressed under the control of the CMV promoter. BHK-21 cells were co-transfected with DNA from a CAT reporter gene construct driven by the –138 glucagon promoter bearing the G1 Pax6-binding element, a Pax6 expression vector containing the full-length open reading frame of the mouse wild-type, Pax64Neu mutant, or the Pax6132-14Neu mutant cDNA sequence, and the pcDNA3-LacZ vector (for normalization of the CAT assay). The –138 glucagon promoter is a 196-bp sequence from the proximal region of the glucagon gene. The G1 sequence containing two 7-bp AT-rich sequences (underlined) within the –138 promoter was 5' CCCCATTATTTACAGATGAGAAATTTATATTGT (RITZ-LASER et al. 1999). The CAT assays were performed as previously described (PLAZA et al. 1999).
Breeding, eye morphology, and mapping:
In an attempt to increase the accuracy of our initial linkage studies (FAVOR et al. 1997) we noted that the mutation was not linked to Chr 8. We undertook another genomewide mapping study and localized the 132 mutation to Chr 2 with the following locus order (frequencies of crossovers between adjacent loci are given in parentheses): D2Mit249-(1/71)-132-(1/71)-D2Mit102-(2/71)-D2Mit258-(13/71)-Agouti. On the basis of the chromosomal region and the eye phenotype we considered Pax6 to be a candidate gene for mutation analysis. Sequencing analyses confirmed the 132 mutation to be a nucleotide substitution (c.T1099A) within the coding region of the Pax6 gene. The base-pair substitution results in an amino acid substitution (Phe272Ile) within the third helix of the homeodomain. We have assigned the mutation the allele symbol Pax6132-14Neu, which has been approved by the Mouse Genetic Nomenclature Committee (accession no. MGI: 1856585). Heterozygous Pax6132-14Neu mutant embryos expressed microphthalmia, anterior pyramidal opacity, adhesion of the lens to the cornea, and a reduced anterior chamber (Figure 3D). Homozygous Pax6132-14Neu mutant embryos expressed extreme microphthalmia with more extreme lens and corneal defects than observed in heterozygotes (Figure 3H).
|
We confirmed that the Pax6132-14Neu mutation is homozygous viable and that heterozygous and homozygous mutants are fully fertile with no significant differences (F3,145 = 1.33, P = 0.26) in average litter size among the various crosses (+/– x +/+, 5.77 ± 0.32, n = 57; +/– x +/–, 4.76 ± 0.52, n = 25; –/– x +/+, 5.80 ± 0.56, n = 20; –/– x –/–, 5.83 ± 0.30, n = 47). The frequency of presumed heterozygous carriers was less than expected on the basis of a phenotypic classification of offspring (data not shown). We carefully characterized the eye phenotypes in P35 animals of known genotype. In heterozygous Pax6132-14Neu mutants there was a high frequency of eyes with no observable defects or with only minor iris irregularities, which fall outside the range of eye phenotypes previously associated (FAVOR et al. 2001) with heterozygous Pax6 mutants (Table 1), and eye size was slightly reduced (+/+, 18.90 mg ± 0.07, n = 116; +/–, 16.68 mg ± 0.05, n = 259). This observation explains the distortion in the ratio of presumed wild-type and heterozygous mutant carriers when classified phenotypically according to our previous classification criteria for Pax6 mutants (FAVOR et al. 2001). All homozygous Pax6132-14Neu mutants expressed extreme microphthalmia with lens/corneal opacity and iris abnormality (Table 1) and eye weight was extremely reduced (–/–, 2.88 mg ± 0.12, n = 32). Body weight (+/+, 19.49 g ± 0.24, n = 58; +/–, 17.94 g ± 0.18, n = 128; –/–, 17.96 g ± 0.29, n = 16) of heterozygous and homozygous Pax6132-14Neu mutants was less than the body weight of homozygous wild types (+/+ vs. +/–, t = 4.94, Ptwo-tailed = 1.73 x 10–6, d.f. = 184; +/+ vs. –/–, t = 3.20, Ptwo-tailed = 0.002, d.f. = 72). Since mutant Pax6132-14Neu mice were associated with a significant reduction in body size, eye weights were normalized for body weight (Table 2). As compared to wild type, the normalized eye weight of heterozygous Pax6132-14Neu mutants was moderately but significantly reduced (t = 2.30, Ptwo-tailed = 0.02, d.f. = 369). The normalized eye weight of homozygous Pax6132-14Neu mutants was extremely reduced (t = 58.37, Ptwo-tailed = 4.27 x 10–103, d.f. = 146).
|
|
DNA-binding and glucagon-promoter activation associated with the Pax6132-14Neu gene product:
Given the functional significance of the third helix of the homeodomain (HANES and BRENT 1989; TREISMAN et al. 1989; WILSON et al. 1993; GEHRING et al. 1994; QIAN et al. 1994; BRUUN et al. 2005), we characterized the binding activity of the Pax6132-14Neu mutant homeodomain to the P3 target sequence and the glucagon-promoter activation of the Pax6132-14Neu gene product. Results indicated loss of binding activity of the Pax6132-14Neu mutant homeodomain to the P3 DNA binding target (Figure 1). The glucagon-promoter activation by the mutant Pax6132-14Neu was slightly higher than wild-type Pax6 (transformations with 100 ng DNA: wild type, 7.19 ± 0.19, n = 2; Pax6132-14Neu, 10.87 ± 0.31, n = 2, t = 14.31, Ptwo-tailed < 0.05; transformations with 300 ng DNA: wild type, 8.49 ± 0.64, n = 2; Pax6132-14Neu, 11.74 ± 0.23, n = 2, t = 6.75, Ptwo-tailed < 0.05) (Figure 2). In these assays we included a previously described Pax6 hypomorph mutation, Pax64Neu, also due to an amino acid substitution within the third helix of the homeodomain (Ser273Pro). We observed that the binding activity of the Pax64Neu mutant homeodomain to the P3 target sequence was ablated (Figure 1) and there was greatly reduced glucagon-promoter activation by the mutant Pax64Neu (transformations with 100 ng DNA: wild type, 7.19 ± 0.19, n = 2; Pax64Neu, 2.15 ± 0.12, n = 2, t = 31.75, Ptwo-tailed < 0.05; transformations with 300 ng DNA: wild type, 8.49 ± 0.64, n = 2; Pax64Neu, 3.29 ± 0.44, n = 2, t = 9.47, Ptwo-tailed < 0.05) (Figure 2). Cotransfection of cells with mutant Pax64Neu and wild-type Pax6 indicated that the mutant Pax64Neu did not interfere with the normal promoter activation of the wild-type Pax6. Taken together, these results indicate that the Pax6132-14Neu and Pax64Neu missense mutations in the third helix of the homeodomain both affect the binding activities of the mutant homeodomains. However, whereas the glucagon-promoter activity of the Pax6132-14Neu gene product was increased, the activity of the Pax64Neu gene product was greatly reduced. Since the reporter gene employed for this assay was driven by the G1 Pax6 paired and homeodomain binding site (PLANQUE et al. 2001) our results suggest that dysfunction due to the Pax6132-14Neu missense mutation is confined to the homeodomain and allowed transcriptional activation by the intact paired domain, while the Pax64Neu homeodomain missense mutation also affects the binding activity of the gene product to paired domain targets.
|
|
Compound heterozygotes:
We next attempted to produce compound Pax6 heterozygotes with Pax6132-14Neu and two previously described Pax6 hypomorph alleles (Pax64Neu and Pax67Neu), which are more severely affected than carriers of the Pax6132-14Neu mutation (FAVOR et al. 2001) or with the previously described null alleles Pax6Sey-Neu, Pax62Neu, and Pax63Neu (FAVOR et al. 2001; HILL et al. 1991) (Table 3). All compound heterozygote combinations expressed extreme microphthalmia and were viable, and the compound heterozygotes Pax62Neu/Pax6132-14Neu, Pax64Neu/Pax6132-14Neu, Pax67Neu/Pax6132-14Neu, and Pax6Sey-Neu/Pax6132-14Neu were fertile. The compound heterozygote Pax63Neu/Pax6132-14Neu was not fertility tested.
|
In previous characterizations of our extensive Pax6 allelic series we have concluded that most alleles (Pax6Sey-Neu, Pax62Neu, Pax63Neu, Pax65Neu, Pax66Neu, Pax68Neu, Pax69Neu, Pax610Neu, and Pax6Coop) result in premature truncation of the Pax6 translation product (HILL et al. 1991; LYON et al. 2000; FAVOR et al. 2001). The hypomorph alleles Pax64Neu and Pax67Neu express delayed perinatal lethality when compared with homozygous Pax6 null mutations (FAVOR et al. 2001), and thus they must have less Pax6 activity than the Pax6132-14Neu mutation, which is homozygous viable and fertile. The phenotype expressed by homozygous mutant Pax6132-14Neu mice was more severe than that of heterozygous Pax6 null mutants, and therefore Pax6132-14Neu homozygous mutants must express <50% Pax6 activity. Since the compound heterozygotes of Pax6132-14Neu carried over Pax6 null alleles are viable and fertile, a single copy of the Pax6132-14Neu mutation carried over a null allele must have more activity than two copies of Pax64Neu or Pax67Neu carried by the respective homozygotes. On the basis of these results we could predict the order of Pax6 activity in wild-type and mutant Pax6 genotypes as follows: Pax6 +/+ = 100% > Pax6132-14Neu/+ > Pax63Neu/+ = 50% > Pax6132-14Neu/Pax6132-14Neu > Pax64Neu/Pax6132-14Neu
Pax67Neu/Pax6132-14Neu > Pax63Neu/Pax6132-14Neu > Pax67Neu/Pax67Neu > Pax63Neu/Pax63Neu = 0%. We constructed these genotypes and assessed the degree of eye development in E15 embryos when the expected Pax6 activity in the embryos ranged from 100% normal to 0% (Figure 3). Results indicated that the degree of eye development is progressively affected as the expected Pax6 activity is reduced. Considering the degree of eye development, the various genotypes assessed can be grouped into three distinct classes. In the first class, embryos have a higher predicted Pax6 activity [Pax6 +/+ (A and B), Pax6132-14Neu/+ (C and D), Pax63Neu/+ (E and F), and Pax6132-14Neu/Pax6132-14Neu (G and H)] and the basic eye plan developed with a definite cornea, lens, and retina. However, as the predicted level of Pax6 activity was reduced there was a progressive reduction in eye size and the degree of anterior segment abnormalities increased (thickened cornea, failure of the lens to detach from the cornea, degree of development of the anterior chamber between the cornea and lens). The second class [Pax64Neu/Pax6132-14Neu (I and J) and Pax67Neu/Pax6132-14Neu (K and L)] consists of embryos with less predicted Pax6 activity than that in the first class. A rudimentary eye developed consisting of a retina and a distinct optic pit. However, there was no apparent invagination of the surface ectoderm into the optic cup nor was there development of lenticular tissue. The third class consists of embryos with the least predicted Pax6 activity [Pax63Neu/Pax6132-14Neu (M and N), Pax67Neu/Pax67Neu (O and P), and Pax63Neu/Pax63Neu (Q and R)]. In all three genotypes within this class the tissue observed had no apparent resemblance to a rudimentary eye. The progression of eye development in the genotype within this class with the higher predicted activity [Pax63Neu/Pax6132-14Neu (M and N)] was more extensive with more tissue derived from the optic vesicle in the vicinity of the surface ectoderm and an apparent rudimentary optic pit. By comparison, there was minimal progression of eye development in the genotype with zero Pax6 activity [Pax63Neu/Pax63Neu (Q and R)]. The tissue derived from the optic vesicle (arrowheads) was observed to be distant from the surface ectoderm and there was no evidence of the formation of a rudimentary optic pit. The Pax67Neu/Pax67Neu genotype (O and P) with predicted Pax6 activity between the other two genotypes in this class expressed an intermediate progression in eye development.
Hypomorph Pax6132-14Neu allele:
We show that heterozygous carriers of the Pax6132-14Neu mutation express minor eye abnormalities and homozygous mutants are viable and fertile. These results extend the mouse Pax6 allelic series to include a hypomorph mutant allele with a level of Pax6 residual activity sufficient for homozygous and hemizygous mutants to be viable and fertile. We have previously described two hypomorph alleles, Pax64Neu and Pax67Neu, in which homozygous embryos express more optic tissues than that seen in homozygous Pax6 null mutants and there was delayed time of perinatal death (FAVOR et al. 2001). The site of the Pax6132-14Neu missense mutation, Phe272Ile, is in the third helix of the homeodomain and is highly conserved across all paired-like homeodomain sequences. The aromatic sidechain is buried within the protein tertiary structure in close proximity to a second Phe site from helix 1 of the homeodomain and may participate in stabilizing the homeodomain tertiary structure. The third helix of the homeodomain makes direct contact to the DNA and our observation that the binding activity of the mutant Pax6132-14Neu homeodomain to the P3 target DNA sequence is lost is compatible with the conclusion that the Phe272Ile missense mutation alters the tertiary structure of the homeodomain and prevents proper binding to the DNA target.
The glucagon-promoter activity assays of the full-length Pax6 wild-type and mutant gene products employed the CAT expression vector driven by the –138 glucagon promoter. This promoter contains the G1 sequence, which is a target site for binding of the Pax6 paired and homeodomains and the paired domain alone is sufficient for activation when the homeodomain is deleted from the Pax6 gene product (RITZ-LASER et al. 1999; PLANQUE et al. 2001). We observed that the glucagon-promoter activity of the mutant Pax6132-14Neu gene product was slightly increased. Thus, the mutated Phe272Ile site in the homeodomain may result in an increase of the glucagon-promoter activation via the paired domain in the mutant Pax6 product. In contrast, the Ser273Pro Pax64Neu missense mutation, also within the third
-helix of the homeodomain, has reduced glucagon-promoter activation in the CAT reporter gene construct driven by the –138 glucagon promoter. This indicates that this mutation, which is predicted to interrupt the third
-helix structure (FAVOR et al. 2001), also affects the glucagon-promoter activation via the paired domain. It likely does not affect Pax6 dimerization since it did not affect the wild-type Pax6 glucagon-promoter activation in the Pax6 wild type + Pax64Neu cotransfection assays. Rather, we interpret these results to indicate that, within the Pax64Neu mutant gene product, the mutant Pax6 homeodomain interferes with the paired domain DNA binding activity to the paired domain target sites.
The third hypomorph mutant allele utilized in this study, Pax67Neu, has been shown to be a c.A-3T base-pair substitution outside the Pax6 ORF in the Kozak sequence and results in greatly reduced translation product (FAVOR et al. 2001).
Correlation of Pax6 activity and the extent of eye development:
Previous studies have shown that normal eye development requires a narrow range of Pax6 activity. Heterozygous null mutations (HILL et al. 1991) as well as transgenic mice that overexpress Pax6 (SCHEDL et al. 1996) were associated with abnormal eye development. The identification of the Pax6132-14Neu hypomorph mutation, which is homozygous viable and has a higher level of Pax6 activity than the Pax64Neu or Pax67Neu hypomorph alleles, has extended the range of the mouse Pax6 allelic series. With the availability of an extended Pax6 allelic series we were able to construct wild-type and mutant Pax6 genotypes, which provides information regarding the extent of eye development and animal viability for four new levels of predicted Pax6 activity: one genotype (Pax6132-4Neu/+) with Pax6 activity between 100 and 50% and three genotypes within the critical region between 50 and 0% Pax6 activity (Pax6132-4Neu/Pax6132-4Neu, Pax6132-14Neu/Pax64Neu
Pax6132-14Neu/Pax67Neu, Pax6132-14Neu/Pax63Neu). We observed that as the level of predicted Pax6 activity was reduced there was a progressive reduction in the extent of eye development. In the early stages of eye development two regions in the head critical for eye development show Pax6 expression: the early optic vesicle and the surface ectoderm. Studies in the chick have shown that the regional localization of the Pax6-positive cells in the surface ectoderm is independent of a neighboring Pax6-positive optic vesicle (LI et al. 1994). The early optic vesicle is an evagination of the prospective forebrain and makes contact with the Pax6-positive region of the surface ectoderm. Upon contact of the optic vesicle with the surface ectoderm, the optic vesicle invaginates to form the optic cup, consisting of the outer layer (presumptive pigmented retinal layer) and the inner layer (presumptive neural retina layer). The lens placode, which is the Pax6-positive surface ectoderm at the region of contact between the optic vesicle and the surface ectoderm, invaginates into the optic cup to form the lens vesicle. In the class of genotypes with the highest level of predicted Pax6 activity the basic eye plan developed, consisting of a cornea, lens, and retina. Thus, within this group of genotypes the levels of Pax6 activity were sufficient for the optic vesicle to make proper contact with the Pax6-positive surface ectoderm and the lens placode was competent to invaginate and form a lens. The second group of mutant genotypes had an intermediate level of predicted Pax6 activity. The optic vesicle evaginated toward and maintained contact with the surface ectoderm. A retina developed but the presumptive lens placode of the surface ectoderm did not invaginate and form the lens vesicle. Conditional inactivation of Pax6 in a stage- and cell-specific manner has shown that at later stages the developmental competency of eye tissues depends upon the endogenous Pax6 activity of the cells from which the tissues are derived. Inactivation of a single copy of Pax6 in the distal optic cup allows proper development of the lens and cornea but developmental abnormalities of the iris were observed. Similarly, inactivation of a single copy of Pax6 in the lens placode resulted in abnormal lens and cornea development. Retina development was normal and there were only mild noncell-autonomous iris abnormalities (DAVIS-SILBERMAN et al. 2005). Microsurgical removal of the Pax6-positive neural plate and thus ablation of optic vesicle development in the chick resulted in Pax6-positive surface ectoderm cells but lens development was blocked (LI et al. 1994). Inactivation of Pax6 in the early optic vesicle of the chick resulted in death of the optic vesicle cells and blocked lens development from the Pax6-positive surface epithelium (CANTO-SOLER and ADLER 2006). Thus, the maintenance of Pax6 expression in the surface ectoderm is not dependent upon optic vesicle contact, but when optic vesicle contact to the surface ectoderm is prevented lens development is blocked. Complete inactivation of Pax6 in the lens placode blocked lens development. Multiple, fully differentiated retinae were observed within the optic cup indicating that the presence of a lens was not required for the development of the retina (ASHERY-PADAN et al. 2000). Our observations for the second class of genotypes with intermediate levels of Pax6 activity are compatible with the hypothesis that the levels of Pax6 activity in the optic vesicle and the surface ectoderm were sufficient for retina development but were insufficient for development of the lens vesicle.
In the class of mutant genotypes with the lowest levels of predicted Pax6 activity, the levels of Pax6 activity were insufficient for proper eye development beyond a very early stage. Although there was an initiation of optic vesicle development, it terminated very prematurely and the resultant tissue had no resemblance to a rudimentary eye.
Taken together, these results indicate that the level of Pax6 activity is less critical for the progression of optic vesicle evagination and retina development than it is for the invagination of the lens placode to develop into the lens vesicle. Characterization of the Pax6Sey null mutation (HOGAN et al. 1986) demonstrated that in homozygous mutant embryos evagination of the optic vesicle was initiated but contact with the surface ectoderm was lost at a very early stage. Studies utilizing Pax6–/–
Pax6+/+ chimera have shown that upon contact of the optic vesicle to the surface ectoderm Pax6 activity deduced from the fraction of Pax6+/+ and Pax6–/– cells in both the optic vesicle and the surface ectoderm is critical for the maintenance of this contact and for the induction of a lens placode (COLLINSON et al. 2000). Thus, lens development requires maintenance of the contact of the optic vesicle with the surface ectoderm and proper lens development is dependent upon Pax6 activity in both structures.
Although we have assigned abstract relative Pax6 activity levels to the Pax6 mutant alleles on the basis of viability of mutant genotypes, the actual situation is more complex due to the spectrum of genes targeted for activation by the different isoforms of the mutant alleles. Despite our simplistic notion of predicted Pax6 activity, it was very convincing to observe that the extent of eye development completely followed our a priori prediction of Pax6 activity.
Mouse and human Pax6 allele databases:
PAX6/Pax6 functions as a transcription factor via DNA binding of its binding domains to different target genes and mutations affecting different specific regions of the Pax6 gene product may result in different aberrant phenotypes (TANG et al. 1997; SINGH et al. 2000; HAUBST et al. 2004). There is an extensive human PAX6 allelic variant database (http://pax6.hgu.mrc.ac.uk) last updated September 27, 2007, with 408 entries. Most PAX6 mutations result in premature termination of the translation product and there were 61 missense mutations: 43 in the paired domain, one in the linker region, 5 in the homeodomain, 12 in the P/S/T region, 4 at the Met start codon, and 15 at the stop codon. Genotype–phenotype correlations have shown that mutations resulting in premature termination of the translation of the PAX6 gene product are mostly associated with aniridia, while missense mutations are often associated with nonaniridia phenotypes (AZUMA et al. 1996, 1998, 1999; AZUMA and YAMADA 1998; TZOULAKI et al. 2005). The mouse mutant-allele database (http://www.informatics.jax.org) contains 32 entries. Twenty-four mutant alleles were recovered in phenotype screens and eight entries represent mutant knockout or conditional knockout constructs. Of the 24 mutant alleles recovered in phenotype-based screens, most result in premature truncation of the translation product or deletions of the Pax6 gene. Two Pax6 alleles are missense mutations in the paired domain, Pax6Leca2 and Pax6Leca4 (THAUNG et al. 2002) and four missense mutations have been identified in the homeodomain, Pax64Neu (FAVOR et al. 2001), Pax6Leca1 (THAUNG et al. 2002), Pax61Jrt (ROSSANT 2003), and Pax6132-14Neu (this study). It is interesting to note that all missense mutations in the mouse in the homeodomain are at amino acid sites within the third helix of the homeodomain.
General conclusions:
An extensive allelic series is useful for genetic, molecular, and development analyses of gene function. Detailed in vivo analyses are usually possible only in model laboratory organisms. This study has extended the mouse allelic series of the Pax6 gene to include a homozygous and hemizygous viable and fertile hypomorph allele. In our genotype–phenotype studies to correlate levels of Pax6 activity with the degree of aberrant development, we have focused on the eye. Obviously, similar studies with other organs in which Pax6 plays an important role in development would be interesting. For example, the mechanisms leading to lethality of Pax6 mutant neonates is still not known. The best candidates are neurologic or metabolic dysfunctions due to the brain and the pancreas developmental defects. Here, analyses of brain or pancreas development in the Pax6 mutant genotype constructs could be informative.
ASHERY-PADAN, R., T. MARQUARDT, X. ZHOU and P. GRUSS, 2000 Pax6 activity in the lens primordium is required for lens formation and for correct placement of a single retina in the eye. Genes Dev. 14: 2701–2711.
AZUMA, N., and M. YAMADA, 1998 Missense mutation at the C terminus of the PAX6 gene in ocular anterior segment anomalies. Invest. Ophthalmol. Vis. Sci. 39: 828–830.
AZUMA, N., S. NISHINA, H. YANAGISAWA, T. OKUYAMA and M. YAMADA, 1996 PAX6 missense mutation in isolated foveal hypoplasia. Nat. Genet. 13: 141–142.[CrossRef][Medline]
AZUMA, N., Y. HOTTA, H. TANAKA and M. YAMADA, 1998 Missense mutations in the PAX6 gene in aniridia. Invest. Ophthalmol. Vis. Sci. 39: 2524–2528.
AZUMA, N., Y. YAMAGUCHI, H. HANDA, M. HAYAKAWA, A. KANAI et al., 1999 Missense mutation in the alternative splice region of the PAX6 gene in eye anomalies. Am. J. Hum. Genet. 65: 656–663.[CrossRef][Medline]
BAULMANN, D. C., A. OHLMANN, C. FLÜGEL-KOCH, S. GOSWAMI, A. CVEKL et al., 2002 Pax6 heterozygous eyes show defects in chamber angle differentiation that are associated with a wide spectrum of other anterior eye segment abnormalities. Mech. Dev. 118: 3–17.[CrossRef][Medline]
BENTLEY, C. A., M. P. ZIDEHSARAI, J. C. GRINDLEY, A. F. PARLOW, S. BARTH-HALL et al., 1999 Pax6 is implicated in murine pituitary endocrine function. Endocrine 10: 171–177.[CrossRef][Medline]
BRUUN, J. A., E. I. THOMASSEN, K. KRISTIANSEN, G. TYLDEN, T. HOLM et al., 2005 The third helix of the homeodomain of paired class homeodomain proteins acts as a recognition helix both for DNA and protein interactions. Nucleic Acids Res. 33: 2661–2675.
CANTO-SOLER, M. V., and R. ADLER, 2006 Optic cup and lens development requires Pax6 expression in the early optic vesicle during a narrow time window. Dev. Biol. 294: 119–132.[CrossRef][Medline]
CARRIÈRE, C., S. PLAZA, P. MARTIN, B. QUATANNENS, M. BAILLY et al., 1993 Characterization of quail Pax-6 (Pax-QNR) proteins expressed in the neuroretina. Mol. Cell. Biol. 13: 7257–7266.
CARRIÈRE, C., S. PLAZA, J. CABOCHE, C. DOZIER, M. BAILLY et al., 1995 Nuclear localization signals, DNA binding, and transactivation properties of quail Pax-6 (Pax-QNR) isoforms. Cell Growth Differ. 6: 1531–1540.[Abstract]
CHI, N., and J. A. EPSTEIN, 2002 Getting your Pax straight: Pax proteins in development and disease. Trends Genet. 18: 41–47.[CrossRef][Medline]
COLLINSON, J. M., R. E. HILL and J. D. WEST, 2000 Different roles for Pax6 in the optic vesicle and facial epithelium mediate early morphogenesis of the murine eye. Development 127: 945–956.[Abstract]
COLLINSON, J. M., J. C. QUINN, M. A. BUCHANAN, M. H. KAUFMAN, S. E. WEDDEN et al., 2001 Primary defects in the lens underlie complex anterior segment abnormalities of the Pax6 heterozygous eye. Proc. Natl. Acad. Sci. USA 98: 9688–9693.
COLLINSON, J. M., J. C. QUINN, R. E. HILL and J. D. WEST, 2003 The roles of Pax6 in the cornea, retina, and olfactory epithelium of the developing mouse embryo. Dev. Biol. 255: 303–312.[CrossRef][Medline]
CZERNY, T., and M. BUSSLINGER, 1995 DNA-binding and transactivation properties of Pax-6: three amino acids in the paired domain are responsible for the different sequence recognition of Pax-6 and BSAP (Pax-5). Mol. Cell. Biol. 15: 2858–2871.[Abstract]
DAVIS-SILBERMAN, N., T. KALICH, V. ORON-KARNI, T. MARQUARDT, M. KROEBER et al., 2005 Genetic dissection of Pax6 dosage requirements in the developing mouse eye. Hum. Mol. Genet. 14: 2265–2276.
DUNCAN, M. K., Z. KOZMIK, K. CVEKLOVA, J. PIATIGORSKY and A. CVEKL, 2000 Overexpression of PAX6(5a) in lens fiber cells results in cataract and upregulation of
5β1 integrin expression. J. Cell Sci. 113: 3173–3185.[Abstract]
ESTIVILL-TORRÚS, G., T. VITALIS, P. FERNÁNDEZ-LLEBREZ and D. J. PRICE, 2001 The transcription factor Pax6 is required for development of the diencephalic dorsal midline secretory radial glia that form the subcommissural organ. Mech. Dev. 109: 215–224.[CrossRef][Medline]
FAVOR, J., 1983 A comparison of the dominant cataract and recessive specific-locus mutation rates induced by treatment of male mice with ethylnitrosourea. Mutat. Res. 110: 367–382.[Medline]
FAVOR, J., P. GRIMES, A. NEUHÄUSER-KLAUS, W. PRETSCH and D. STAMBOLIAN, 1997 The mouse Cat4 locus maps to chromosome 8 and mutants express lens-corneal adhesion. Mamm. Genome 8: 403–406.
FAVOR, J., H. PETERS, T. HERMANN, W. SCHMAHL, B. CHATTERJEE et al., 2001 Molecular characterization of Pax62Neu through Pax610Neu: an extension of the Pax6 allelic series and the identification of two possible hypomorph alleles in the mouse Mus musculus. Genetics 159: 1689–1700.
FAVOR, J., C. J. GLOECKNER, D. JANIK, M. KLEMPT, A. NEUHÄUSER-KLAUS et al., 2007 Type IV procollagen missense mutations associated with defects of the eye, vascular stability, the brain, kidney function and embryonic or postnatal viability in the mouse, Mus musculus: an extension of the Col4a1 allelic series and the identification of the first two Col4a2 mutant alleles. Genetics 175: 725–736.
GEHRING, W. J., Y. Q. QIAN, M. BILLETER, K. FURUKUBO-TOKUNAGA, A. F. SCHIER et al., 1994 Homeodomain-DNA recognition. Cell 78: 211–223.[CrossRef][Medline]
GLASER, T., L. JEPEAL, J. G. EDWARDS, S. R. YOUNG, J. FAVOR et al., 1994 PAX6 gene dosage effect in a family with congenital cataracts, aniridia, anophthalmia and central nervous system defects. Nat. Genet. 7: 463–471.[Medline]
GORLOV, I. P., and G. F. SAUNDERS, 2002 A method for isolating alternatively spliced isoforms: isolation of murine Pax6 isoforms. Anal. Biochem. 308: 401–404.
GÖTZ, M., A. STOYKOVA and P. GRUSS, 1998 Pax6 controls radial glia differentiation in the cerebral cortex. Neuron 21: 1031–1044.[CrossRef][Medline]
GRINDLEY, J. C., D. R. DAVIDSON and R. E. HILL, 1995 The role of Pax-6 in eye and nasal development. Development 121: 1433–1442.[Abstract]
GRINDLEY, J. C., L. K. HARGETT, R. E. HILL, A. ROSS and B. L. HOGAN, 1997 Disruption of PAX6 function in mice homozygous for the Pax6Sey-1Neu mutation produces abnormalities in the early development and regionalization of the diencephalon. Mech. Dev. 64: 111–126.[CrossRef][Medline]
HACK, M. A., A. SAGHATELYAN, A. DE CHEVIGNY, A. PFEIFER, R. ASHERY-PADAN et al., 2005 Neuronal fate determinants of adult olfactory bulb neurogenesis. Nat. Neurosci. 8: 865–872.[Medline]
HANES, S. D., and R. BRENT, 1989 DNA specificity of the bicoid activator protein is determined by homeodomain recognition helix residue 9. Cell 57: 1275–1283.[CrossRef][Medline]
HAUBST, N., J. BERGER, V. RADJENDIRANE, J. GRAW, J. FAVOR et al., 2004 Molecular dissection of Pax6 function: the specific roles of the paired domain and homeodomain in brain development. Development 131: 6131–6140.
HEINS, N., P. MALATESTA, F. CECCONI, M. NAKAFUKU, K. L. TUCKER et al., 2002 Glial cells generate neurons: the role of the transcription factor Pax6. Nat. Neurosci. 5: 308–315.[CrossRef][Medline]
HEINZMANN, U., J. FAVOR, J. PLENDL and G. GREVERS, 1991 Entwicklungsstörung des olfaktorischen Organs. Ein Beitrag zur kausalen Genese bei einer Mausmutante. Verh. Anat. Ges. 85: 511–512.
HILL, R. E., J. FAVOR, B. L. HOGAN, C. C. TON, G. F. SAUNDERS et al., 1991 Mouse Small eye results from mutations in a paired-like homeobox-containing gene. Nature 354: 522–525.[CrossRef][Medline]
HOGAN, B. L., G. HORSBURGH, J. COHEN, C. M. HETHERINGTON, G. FISHER et al., 1986 Small eyes (Sey): a homozygous lethal mutation on chromosome 2 which affects the differentiation of both lens and nasal placodes in the mouse. J. Embryol. Exp. Morphol. 97: 95–110.[Medline]
HOGAN, B. L., E. M. HIRST, G. HORSBURGH and C. M. HETHERINGTON, 1988 Small eye (Sey): a mouse model for the genetic analysis of craniofacial abnormalities. Development 103(Suppl): 115–119.
KAUFMAN, M. H., H. H. CHANG and J. P. SHAW, 1995 Craniofacial abnormalities in homozygous Small eye (Sey/Sey) embryos and newborn mice. J. Anat. 186(Pt 3): 607–617.[Medline]
KIM, J., and J. D. LAUDERDALE, 2006 Analysis of Pax6 expression using a BAC transgene reveals the presence of a paired-less isoform of Pax6 in the eye and olfactory bulb. Dev. Biol. 292: 486–505.[CrossRef][Medline]
KIM, J., and J. D. LAUDERDALE, 2008 Overexpression of pairedless Pax6 in the retina disrupts corneal development and affects lens cell survival. Dev. Biol. 313: 434–454.[CrossRef][Medline]
KIOUSSI, C., S. O'CONNELL, L. ST-ONGE, M. TREIER, A. S. GLEIBERMAN et al., 1999 Pax6 is essential for establishing ventral-dorsal cell boundaries in pituitary gland development. Proc. Natl. Acad. Sci. USA 96: 14378–14382.
KRATOCHVILOVA, J., and U. H. EHLING, 1979 Dominant cataract mutations induced by gamma-irradiation of male mice. Mutat. Res. 63: 221–223.[CrossRef][Medline]
KRATOCHVILOVA, J., and J. FAVOR, 1992 Allelism tests of 15 dominant cataract mutations in mice. Genet. Res. 59: 199–203.[Medline]
LI, H. S., J. M. YANG, R. D. JACOBSON, D. PASKO and O. SUNDIN, 1994 Pax-6 is first expressed in a region of ectoderm anterior to the early neural plate: implications for stepwise determination of the lens. Dev. Biol. 162: 181–194.[CrossRef][Medline]
LYON, M. F., D. BOGANI, Y. BOYD, P. GUILLOT and J. FAVOR, 2000 Further genetic analysis of two autosomal dominant mouse eye defects, Ccw and Pax6coop. Mol. Vis. 6: 199–203.[Medline]
MANLY, K. F., 1993 A Macintosh program for storage and analysis of experimental genetic mapping data. Mamm. Genome 4: 303–313.
MANUEL, M., P. A. GEORGALA, C. B. CARR, S. CHANAS, D. A. KLEINJAN et al., 2007 Controlled overexpression of Pax6 in vivo negatively autoregulates the Pax6 locus, causing cell-autonomous defects of late cortical progenitor proliferation with little effect on cortical arealization. Development 134: 545–555.
MISHRA, R., I. P. GORLOV, L. Y. CHAO, S. SINGH and G. F. SAUNDERS, 2002 PAX6, paired domain influences sequence recognition by the homeodomain. J. Biol. Chem. 277: 49488–49494.
PLANQUE, N., L. LECONTE, F. M. COQUELLE, S. BENKHELIFA, P. MARTIN et al., 2001 Interaction of Maf transcription factors with Pax-6 results in synergistic activation of the glucagon promoter. J. Biol. Chem. 276: 35751–35760.
PLAZA, S., S. SAULE and C. DOZIER, 1999 High conservation of cis-regulatory elements between quail and human for the Pax-6 gene. Dev. Genes Evol. 209: 165–173.[CrossRef][Medline]
QIAN, Y. Q., D. RESENDEZ-PEREZ, W. J. GEHRING and K. WÜTHRICH, 1994 The des(1-6)antennapedia homeodomain: comparison of the NMR solution structure and the DNA-binding affinity with the intact Antennapedia homeodomain. Proc. Natl. Acad. Sci. USA 91: 4091–4095.
QUINN, J. C., J. D. WEST and R. E. HILL, 1996 Multiple functions for Pax6 in mouse eye and nasal development. Genes Dev. 10: 435–446.
RITZ-LASER, B., A. ESTREICHER, N. KLAGES, S. SAULE and J. PHILIPPE, 1999 Pax-6 and Cdx-2/3 interact to activate glucagon gene expression on the G1 control element. J. Biol. Chem. 274: 4124–4132.
ROSSANT, J., 2003 A new allele at the Pax6 locus from the Center of Modelling Human Disease. Mouse Genome Database. http://www.informatics.jax.org.
SCHEDL, A., A. ROSS, M. LEE, D. ENGELKAMP, P. RASHBASS et al., 1996 Influence of PAX6 gene dosage on development: overexpression causes severe eye abnormalities. Cell 86: 71–82.[CrossRef][Medline]
SCHMAHL, W., M. KNOEDLSEDER, J. FAVOR and D. DAVIDSON, 1993 Defects of neuronal migration and the pathogenesis of cortical malformations are associated with Small eye (Sey) in the mouse, a point mutation at the Pax-6-locus. Acta Neuropathol. 86: 126–135.[CrossRef][Medline]
SINGH, S., C. M. STELLRECHT, H. K. TANG and G. F. SAUNDERS, 2000 Modulation of PAX6 homeodomain function by the paired domain. J. Biol. Chem. 275: 17306–17313.
SINGH, S., L. Y. CHAO, R. MISHRA, J. DAVIES and G. F. SAUNDERS, 2001 Missense mutation at the C-terminus of PAX6 negatively modulates homeodomain function. Hum. Mol. Genet. 10: 911–918.
ST-ONGE, L., B. SOSA-PINEDA, K. CHOWDHURY, A. MANSOURI and P. GRUSS, 1997 Pax6 is required for differentiation of glucagon-producing alpha-cells in mouse pancreas. Nature 387: 406–409.[CrossRef][Medline]
STOYKOVA, A., R. FRITSCH, C. WALTHER and P. GRUSS, 1996 Forebrain patterning defects in Small eye mutant mice. Development 122: 3453–3465.[Abstract]
STOYKOVA, A., M. GÖTZ, P. GRUSS and J. PRICE, 1997 Pax6-dependent regulation of adhesive patterning, R-cadherin expression and boundary formation in developing forebrain. Development 124: 3765–3777.[Abstract]
STOYKOVA, A., D. TREICHEL, M. HALLONET and P. GRUSS, 2000 Pax6 modulates the dorsoventral patterning of the mammalian telencephalon. J. Neurosci. 20: 8042–8050.
TALAMILLO, A., J. C. QUINN, J. M. COLLINSON, D. CARIC, D. J. PRICE et al., 2003 Pax6 regulates regional development and neuronal migration in the cerebral cortex. Dev. Biol. 255: 151–163.[CrossRef][Medline]
TANG, H. K., L. Y. CHAO and G. F. SAUNDERS, 1997 Functional analysis of paired box missense mutations in the PAX6 gene. Hum. Mol. Genet. 6: 381–386.
THAUNG, C., K. WEST, B. J. CLARK, L. MCKIE, J. E. MORGAN et al., 2002 Novel ENU-induced eye mutations in the mouse: models for human eye disease. Hum. Mol. Genet. 11: 755–767.
THEILER, K., D. S. VARNUM and L. C. STEVENS, 1978 Development of Dickie's small eye, a mutation in the house mouse. Anat. Embryol. 155: 81–86.[Medline]
TON, C. C., H. HIRVONEN, H. MIWA, M. M. WEIL, P. MONAGHAN et al., 1991 Positional cloning and characterization of a paired box- and homeobox-containing gene from the aniridia region. Cell 67: 1059–1074.[CrossRef][Medline]
TREISMAN, J., P. GÖNCZY, M. VASHISHTHA, E. HARRIS and C. DESPLAN, 1989 A single amino acid can determine the DNA binding specificity of homeodomain proteins. Cell 59: 553–562.[CrossRef][Medline]
TZOULAKI, I., I. M. WHITE and I. M. HANSON, 2005 PAX6 mutations: genotype-phenotype correlations. BMC Genet. 6: 27.[CrossRef][Medline]
VAN RAAMSDONK, C. D., and S. M. TILGHMAN, 2000 Dosage requirement and allelic expression of PAX6 during lens placode formation. Development 127: 5439–5448.[Abstract]
WALTHER, C., and P. GRUSS, 1991 Pax-6, a murine paired box gene, is expressed in the developing CNS. Development 113: 1435–1450.[Abstract]
WAWERSIK, S., P. PURCELL and R. L. MAAS, 2000 Pax6 and the genetic control of early eye development. Results Probl. Cell. Differ. 31: 15–36.[Medline]
WILSON, D., G. SHENG, T. LECUIT, N. DOSTATNI and C. DESPLAN, 1993 Cooperative dimerization of paired class homeo domains on DNA. Genes Dev. 7: 2120–2134.
Communicating editor: T. R. MAGNUSON
This article has been cited by other articles:
![]() |
M. Hingorani, K. A. Williamson, A. T. Moore, and V. van Heyningen Detailed Ophthalmologic Evaluation of 43 Individuals with PAX6 Mutations Invest. Ophthalmol. Vis. Sci., June 1, 2009; 50(6): 2581 - 2590. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
-
All Versions of this Article:
genetics.108.088591v1
179/3/1345 most recent - Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Favor, J.
- Articles by Zaus, I.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Favor, J.
- Articles by Zaus, I.



