- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Data Supplement
-
All Versions of this Article:
genetics.107.083493v1
179/3/1221 most recent - Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Related articles in Genetics
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Barton, A. B.
- Articles by Kaback, D. B.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Barton, A. B.
- Articles by Kaback, D. B.
Originally published as Genetics Published Articles Ahead of Print on June 18, 2008.
Genetics, Vol. 179, 1221-1235, July 2008, Copyright © 2008
doi:10.1534/genetics.107.083493
Meiotic Recombination at the Ends of Chromosomes in Saccharomyces cerevisiae
Arnold B. Barton, Michael R. Pekosz, Rohini S. Kurvathi and David B. Kaback1
Department of Microbiology and Molecular Genetics, University of Medicine and Dentistry of New Jersey, New Jersey Medical School, International Center for Public Health, Newark, New Jersey 07101-1709
1 Corresponding author: Department of Microbiology and Molecular Genetics, UMDNJ, New Jersey Medical School, International Center for Public Health, 225 Warren St., P.O. Box 1709, Newark, NJ 07101-1709.
E-mail: kaback{at}umdnj.edu
Meiotic reciprocal recombination (crossing over) was examined in the outermost 60–80 kb of almost all Saccharomyces cerevisiae chromosomes. These sequences included both repetitive gene-poor subtelomeric heterochromatin-like regions and their adjacent unique gene-rich euchromatin-like regions. Subtelomeric sequences underwent very little crossing over, exhibiting approximately two- to threefold fewer crossovers per kilobase of DNA than the genomic average. Surprisingly, the adjacent euchromatic regions underwent crossing over at twice the average genomic rate and contained at least nine new recombination "hot spots." These results prompted an analysis of existing genetic mapping data, which showed that meiotic reciprocal recombination rates were on average greater near chromosome ends exclusive of the subtelomeres. Thus, the distribution of crossovers in S. cerevisiae appears to resemble that found in several higher eukaryotes where the outermost chromosomal regions show increased crossing over.
DURING meiosis pairs of homologous chromosomes replicate, undergo reciprocal recombination (crossing over or chiasma formation), and then segregate during two distinct divisions, meiosis I and meiosis II. Reciprocal recombination between homologous chromosomes is essential for promoting proper segregation at meiosis I. Comparing genetic and physical maps from the yeast Saccharomyces cerevisiae showed that rates of meiotic reciprocal recombination (in centimorgans per kilobase) vary over the lengths of each chromosome (KABACK et al. 1989; CHERRY et al. 1997) and that there are specific regions that crossover at high and low rates called hot and cold spots, respectively. Recombination hot spots that can also be defined by markers that exhibit high levels of gene conversion are frequently associated with nearby DNA double-strand break (DSB) sites, preferred chromatin structures preferentially cleaved during meiotic prophase by the product of the SPO11 gene (NICOLAS et al. 1989; MALONE et al. 1994; LICHTEN and GOLDMAN 1995; BAUDAT and NICOLAS 1997; KEENEY et al. 1997). Recombination cold spots have been found on many chromosomes, near most centromeres, and in both subtelomeric regions of at least one chromosome (LAMBIE and ROEDER 1986; KABACK 1989; CHERRY et al. 1997; SU et al. 2000; BARTON et al. 2003; KIBURZ et al. 2005). While the mechanisms that prevent meiotic recombination within these regions are not known, the endmost 40 kb of most S. cerevisiae chromosomes, which includes most subtelomeric and some adjacent euchromatin-like DNA, appears devoid of prominent meiotic DSB sites detected using RAD50S mutations (KLEIN et al. 1996; BAUDAT and NICOLAS 1997; GERTON et al. 2000).
Regions near the ends of chromosomes of several higher organisms show higher recombination rates than more centric sequences (MCKIM et al. 1988; VILLENEUVE 1994; BARLOW and HULTEN 1998; LANDER et al. 2001; JENSEN-SEAMAN et al. 2004). In contrast, S. cerevisiae crossovers appear to be more evenly distributed on each chromosome (CHERRY et al. 1997). However, few markers have been genetically mapped to the endmost 10% of most S. cerevisiae chromosomes. The endmost genetic marker averaged 45 kb from its telomere and was rarely mapped with respect to another nearby locus (CHERRY et al. 1997). Thus the meiotic reciprocal recombinational behavior of most S. cerevisiae chromosome ends has not been properly investigated.
The endmost DNA in S. cerevisiae is composed of
1 kb of (C1–3A)n telomere repeats adjacent to 10–30 kb of subtelomeric sequences. S. cerevisiae subtelomeric sequences are distinctly different from most of the genomic DNA because they are mostly repetitive and contain a low density of open reading frames (ORFs) that either are not expressed or are expressed at low levels (PRYDE and LOUIS 1997; VELCULESCU et al. 1997; WYRICK et al. 1999). Subtelomeric sequences compose
5% of the genome and are largely made up of repeated sequence elements termed W', Y' or X (LOUIS 1995; PRYDE and LOUIS 1997). The number, distribution, and arrangement of these elements vary among different chromosomes and in different strains. W' and Y' sequences contain some short ORFs but they are likely to be pseudogenes (CHERRY et al. 1997; WINZELER et al. 1999; BARTON et al. 2003). Other ORFs contained within subtelomeric regions belong to repetitive gene families and appear to be nonessential for routine growth in the laboratory (KABACK et al. 1979; WINZELER et al. 1999; WYRICK et al. 1999). For the purpose of this study, subtelomeric regions were considered to be the endmost sequences that were both repetitive and had a low density of open reading frames. Subtelomeric DNA from S. cerevisiae has been compared to the telomeric heterochromatin of higher organisms, which is also repetitive and contains few active genes. Apart from subtelomeric DNA, most of the S. cerevisiae genome is euchromatin-like, "single-copy" DNA containing a high density of genes, most of which are expressed during routine growth (KABACK et al. 1979; VELCULESCU et al. 1997; WYRICK et al. 1999).
Low meiotic reciprocal recombination rates within the subtelomeres of the one chromosome investigated, chromosome I, did not appear to be dependent on relative chromosome position but were suggested to be due to sequence composition (BARTON et al. 2003). Since telomere proximal crossovers do not appear to promote efficient segregation (ROSS et al. 1996), it was suggested that one possible role of subtelomeric DNA is to prevent meiotic crossing over from occurring near chromosome ends (BARTON et al. 2003). The studies described here were designed to determine whether low rates of meiotic recombination were a property of all other S. cerevisiae subtelomeric sequences. Recombination also was examined in the endmost euchromatin-like regions where only a few genes had been genetically mapped. Almost all subtelomeric regions exhibited very low levels of reciprocal recombination while most of the regions that were immediately adjacent displayed very high recombination rates. These results prompted an investigation into the pattern of crossing over with respect to chromosome position.
Yeast strains:
All strains used in this study were derived from strain S288C. BY4741 (MATa, his3
1, leu2
0, ura3
0, met15
0) containing kanMX (G418R) replacements for the indicated open reading frames were obtained from Open BioSystems (Huntsville, AL). MAT
, ura3-52 strains containing the S. cerevisiae URA3 gene inserted adjacent to individual telomeres were generously provided by Ed Louis. Specific telomere designations are listed in Table 1 (LOUIS and BORTS 1995).
|
Growth and genetic manipulation of yeast:
Yeast were grown and genetically manipulated as previously described (BURKE et al. 2000). Diploids were sporulated 5–8 days on solid sporulation medium containing 2% (w/v) potassium acetate at 30° and asci were dissected using a Singer Instruments (Somerset, UK) MSM system. Premade media powders and G418 sulfate (final concentration 0.2 mg/ml) were from MP Biomedicals (Irvine, CA). Nourseothricin (NAT; final concentration 12.5 µg/ml) was from Werner BioAgents (Jena, Germany).
Genetic calculations:
The amount of recombination expressed in centimorgans was determined using the King formula in the Tetrads program (courtesy of J. Kans, NCBI, Bethesda, MD; MORTIMER et al. 1989). Linear regression analysis of recombination rates vs. chromosome position was carried out using Kaleidograph (Synergy Software, Reading, PA).
Molecular techniques:
DNA manipulations were performed using standard techniques (SAMBROOK et al. 1989; BURKE et al. 2000) or according to manufacturer's instructions (Applied Biosystems, Foster City, CA; New England Biolabs, Ipswich, MA). Hybridization probes were made using Multiprime 32P-labeling (GE Healthcare, Piscataway, NJ) of PCR-amplified DNA templated from diploid S288C-159 X BY4741 (
ycl056::kanMX). Primers were AGCCTACCAAACGCAACCATTT and TAAAGTATGGCAGGCCAACAAG for chromosome VL, position 8575–9175; ACGTAACAAGTGCCATAGATGC and TGGATGGAAGCTTGAGTCACAT for chromosome VL, position 28,745–29,074; ACGAGCGTCATATGTCTTTTGG and ACCAATGAAAATAGAGAACAAGG for chromosome VIIL, position 7485–8402; and CATATATGCCGACCCTAGTTTC and ATGCAGCCAGTGGTGAAACAAT for chromosome VIIL, position 27,055–27,976. The central 189-bp region of the kanMX gene was replaced with NAT1 (NAT resistance) by constructing pLF320 by ligating a HindIII–BamHI fragment containing the 5'-end of kanMX, a BamHI–SpeI fragment containing the NAT1 gene, and a SalI–SpeI fragment containing the 3'-end of kanMX (WACH et al. 1994) into HindIII–SalI-linearized pBluescript II (Stratagene, La Jolla, CA). The kanMX fragments were obtained by PCR amplification of plasmid pFA6kanMX4 (GOLDSTEIN and MCCUSKER 1999) using the 5'-end primers GGGGAAGCTTGGGTAAGGAAAAGACTCACGTT and GGGGGGATCCCGTCCAGCGCATCAAACAATATT and the 3'-end primers GGGGGACTAGTTTTGCCATTCTCACCGGATTCA and GGGGGTCGACCATCGAGCATCAAATGAAACTGC, respectively. The kanMX::NAT1 gene was released from plasmid pLF320 using HindIII and SalI and introduced into S. cerevisiae by one-step gene replacement (ROTHSTEIN 1983), selecting for NAT resistance and G418 sensitivity.
Physical localization of marked telomeres:
URA3 and kanMX were localized to representative ends using blot hybridization to pulsed-field-gel-electrophoresis-separated whole chromosomes (CHEF; Bio-Rad Laboratories, Hercules, CA) and restriction-endonuclease-digested chromosomal DNA separated by conventional agarose gel electrophoresis calibrated using the 1-kb marker ladder (Invitrogen, Carlsbad, CA). In addition, telomere-marked strains routinely exhibited a telomere position effect for URA3 expression as described by GOTTSCHLING et al. (1990).Rates of meiotic reciprocal recombination near chromosome ends:
To determine the amount of meiotic recombination in the endmost regions of all chromosomes, 32 strains marked with URA3 at a different telomere were each crossed to several strains marked with kanMX (G418R) inserted in place of a different nonessential gene located on the same chromosome. The amount of meiotic reciprocal recombination between the marker pairs was then determined by tetrad analysis (Table 1). Genetic distances in centimorgans between different kanMX markers on the same chromosome were calculated by subtracting distances between adjacent intervals as described in Figure 1. For chromosome IR, distances were analyzed using a copy of LEU2 located 2.5 kb from the telomere (BARTON et al. 2003) because the URA3 telomere marker provided was not linked to any of the chromosome I kanMX markers tested. The results were plotted for all ends (Figure 2) except chromosome XVIL, which was not investigated because the URA3 telomere marker also was unlinked to the kanMX markers for this chromosome.
|
|
Very low reciprocal recombination rates were found in 29 of the 31 chromosome ends investigated while two regions (chromosomes VIIIL and XIIR) showed rates near the genomic average. The average recombination rate for the last interval analyzed at the end of each chromosome arm was 0.13 ± 0.02 cM/kb. The average recombination rate for the entire length of each region judged subtelomeric on the basis of being repetitive and having a low gene density was slightly higher—0.15 ± 0.05 cM/kb. An identical average was found when only the endmost repetitive sequences were included as subtelomeric. The average recombination rate for the somewhat larger regions at the ends of chromosomes that had only a low ORF density was slightly but not significantly higher, 0.20 ± 0.03 cM/kb. At ends where the subtelomeric region comprised more than one analyzed genetic interval, the more internal parts of the subtelomeric sequences exhibited somewhat higher recombination rates than more distal sequences. Chromosome VIIIL appeared to undergo recombination at close to the average genomic rate in its most distal interval and at a very high rate at the internal border of its repetitive region. There were no significant differences in the mean recombination rates in subtelomeric regions that contained Y' sequences (0.19 ± 0.06 cM/kb) and those that did not (0.12 ± .03 cM/kb). The majority of any difference was due to the relatively high rate of recombination on chromosome VIIIL, which contains Y'. Excluding this chromosome end produced near equal average values (0.14 ± .03 cM/kb and 0.12 ± .03 cM/kb). Finally, large and small chromosomes appeared to behave similarly.
When recombination was examined in the
20- to 60-kb euchromatin-like regions that lie adjacent to the subtelomeric DNA, the average rates jumped to 0.85 ± 0.13 cM/kb, more than twice the genomic average of 0.37 ± 0.06 cM/kb. Twenty-six of the 31 ends investigated underwent recombination at significantly higher rates than the genomic average (>2 SDs > 0.37 ± 0.06 cM/kb); 4 (IIL, VIR, VIIR, and XIR) were equal to or slightly above average; and 1, chromosome XIIL, could not be examined due to a lack of appropriate internal markers. Recombination rates at chromosome ends IIIL and XIR remained low beyond where subtelomeric repeats appeared to end and then exhibited greatly increased recombination (1.0 and 1.2 cM/kb, respectively)
25 kb farther down the chromosome. Sequences adjacent to subtelomeres that contained Y' sequences behaved identically to those that were adjacent to subtelomeres that lacked Y' sequences. Of the 26 ends that recombined at higher-than-average rates, 10 contained intervals that underwent recombination at >1 cM/kb while another 9 contained intervals that exhibited unusually high recombination rates (1.5–3.6 cM/kb) and appear to define new hot spots (Table 2). The rates in these hot spots were equal to or greater than those observed for previously identified recombination hot spots (COLEMAN et al. 1986; KABACK et al. 1989; NICOLAS et al. 1989; MALONE et al. 1994; FAN et al. 1995; LICHTEN and GOLDMAN 1995; CHERRY et al. 1997). For four of the new hot spots—VL, VIIL, VIIIR, and XR—high recombination rates were confirmed with multiple crosses utilizing adjacent open reading frames. Seven of the nine new hot spots were on small chromosomes, a property shared with all the previously identified ones. Nevertheless, two were on large chromosomes, IV and VII. In summary, average reciprocal recombination rates appear two- to threefold lower than the genomic average in the subtelomeric regions and two- to threefold higher than the genomic average in the immediately adjacent centromere-proximal euchromatin-like regions.
|
Recombination rates are unaffected by inserted markers:
To ensure that the hemizygous inserted kanMX gene had no significant effect on recombination, NAT1 was substituted for it at several locations on chromosomes VII and VI and recombination was examined. No significant differences were observed in any of the substitutions (Figure 3). Next, kanMX was inserted at two locations between ADE1 and PHO11 on chromosome I. The total amount of recombination between the outer markers was the same in all crosses and was approximately equal to both the published values (KABACK et al. 1992; CHERRY et al. 1997) and the value obtained when the kanMX marker was substituted for ADE1 (yar015::kanMX). Likewise, kanMX inserted between the URA3-marked telomere and YGL248W (ygl248W::NAT1) or YFR039 (yfrl039::NAT1) on chromosomes VII and VI had no apparent effect on the total amount of recombination between the outer markers. Thus, insertion of a hemizygous kanMX marker appears to have little to no impact on the amount of reciprocal recombination. These results confirm previous studies using other hemizygous markers (SU et al. 2000).
|
Analysis of previously mapped genetic intervals:
Observing higher rates of crossing over near such a large number of chromosome ends suggested that S. cerevisiae chromosomes might behave similarly to those of higher organisms where the distal sequences recombine more than centric ones (JENSEN-SEAMAN et al. 2004). Data from the Saccharomyces Genome Database (SGD) where genes had been both physically and genetically mapped were examined to determine whether there was a chromosome position-dependent relationship. Recombination rates between physically mapped genes were analyzed both as a function of absolute (in kilobases) and relative (fraction of chromosome length) distance from the ends of chromosomes (Figure 4, A and B, and supplemental Tables S1 and S2). SGD data entries where <100 tetrads were analyzed and intervals <2 kb in length in which ORF center-to-center distance would not accurately reflect physical distance between allele locations were excluded to minimize sampling and positioning errors, respectively. While individual recombination rates were highly variable at any given position, regression analysis revealed a significant negative slope (P < 0.001) that shows that overall recombination rates decrease with distance from the end of the chromosome. When the included physical distance from the telomere was varied, the slope of the regression was steepest using the first 200 kb and then the steepness decreased as the included distance increased (Figure 4C). A significant negative slope (P = 0.0011) was similarly found when relative distances from the telomere were examined (Figure 4B). This analysis included all mapped intervals where sufficient asci were analyzed. None of the above results were affected by low rates of recombination found near centromeres because excluding those intervals that included or spanned centromeres had no significant effect on the magnitude of the observed negative slope. The results that utilized only previous genetic mapping data demonstrate that there is increased recombination in the distal parts of yeast chromosomes. When the nonsubtelomeric recombination mapping studies generated using the marked telomeres were combined with the previous data, slopes of each regression were somewhat steeper, which would be expected from the inclusion of the more distal sequences (Figure 4, A and B). In addition, recombination rates in previously investigated regions that overlapped with those investigated here were in agreement, supporting the overall accuracy of the new studies (data not shown).
|
Gene conversion of the inserted kanMX marker:
Gene conversion rates of the inserted kanMX sequence were examined with respect to chromosome position (Table 1). The average rate was 1.8 ± 0.2% but no position dependent pattern was evident. (Figure 5). Notably, all but one of the new recombination hot spots were defined by a kanMX marker that exhibited a significantly higher-than-average (P < 0.0005) rate of gene conversion, suggesting a nearby DSB site (Table 2). Furthermore, four of the five kanMX markers showing the most gene conversion were associated with one of the newly defined reciprocal recombination hot spots (YAR023C, YDL222C, YEL065W, and YGL254W). The high conversion rates in kanMX were 3–12%, somewhat lower than the 8–15% found for previously described hot spots (LICHTEN and GOLDMAN 1995). However, comparison is not warranted since these gene conversions involve hemizygous insertions rather than simple mutations.
|
Molecular analysis of chromosome ends:
To confirm both the location of the inserted markers and the isogenicity of the telomere-marked S288C and BY4741 kanMX haploids, DNA blot hybridizations were carried out on several representative regions, including the 40-kb regions near the left ends of chromosomes V and VII. Figure 6 shows that URA3 and kanMX are integrated at their correct locations and that there are no restriction fragment length polymorphisms other than those generated by the inserts for the four noted endonucleases. Similar analyses for the last 20–40 kb on chromosomes IIIL and R, XR, and XIVL produced analogous results (data not shown). Thus, the strains that are both S288C derived appear identical within the regions examined, making it likely that they were indeed very nearly, if not completely, isogenic.
|
Determining recombination rates on each chromosome involved measuring the amount of recombination between a fixed telomeric URA3 marker and a heterozygous kanMX insertion located at several more centric positions. The amount of recombination between each insertion marker was then calculated by subtraction. The number of asci analyzed was selected to produce relatively small standard errors except for the endmost intervals, which showed very little recombination and produced proportionately larger errors. Nevertheless, very low recombination rates were evident in 29 of the 31 endmost subtelomeric intervals investigated and no end underwent higher-than-average levels of recombination.
As all strains except one were isogenic, the level of consistency in the amount of recombination between marker pairs could be analyzed. It is evident that most recombination is occurring in the subtracted intervals that show the greatest changes in centimorgan value. Without exception, the amount of recombination on each chromosome increased with increasing physical size of the interval. Furthermore, there were 19 overlapping adjacent or nearby interval pairs where the centimorgan ±SE value between URA3 and kanMX showed no significant difference between each pair (Table 1). In all 19 pairs, the larger physical interval exhibited the marginally greater centimorgan value. If the relative values obtained for centimorgan ±SE were completely subject to random statistical fluctuation, the probability of obtaining this degree of consistency is 2–18 (10–6). Accordingly, the observed variance of these overlapping interval values cannot be viewed as independent; i.e., the marginally larger physical interval always exhibits more recombination than the smaller interval. Therefore, it is incorrect to apply the sum of the standard errors to the value obtained by subtraction. Thus, while SEs are shown for each URA3-kanMX interval, the standard method for determining the error in the sizes of the subtracted intervals has been purposely omitted as improper. Furthermore, three point crosses and marker substitution experiments on three different chromosomes confirmed the consistency of the results and validated the subtractive method used for determining recombination rates. Nevertheless, small incremental increases are certain to be subject to greater errors than large increases, but the overall patterns are certain to be an accurate representation of the recombination behavior for each chromosome.
All subtelomeric ends, with the exception of those located on chromosomes VIIIL and XIIR, exhibited very low reciprocal recombination rates. The most distal available kanMX marker on chromosome XIIR was actually in the euchromatin-like region, making it possible that its subtelomeric recombination rate was lower as well. The outermost chromosome VIIIL interval borders the unique region but appears to have a recombination hot spot that lies within its subtelomeric region. Perhaps this hot spot represents a more centric DSB site that resolves into a more distal crossover. Alternatively, these results could simply represent an anomaly for these specific subtelomeric DNA sequences.
The pattern of crossing over in almost all subtelomeric regions was similar and resembled that previously found for chromosome I (SU et al. 2000). There was very little recombination in the outermost interval and rates increased with distance from the telomere. While such a gradient might suggest a telomere position effect, translocation experiments on chromosome I suggested otherwise and that subtelomeric sequences themselves were nonrecombinogenic (BARTON et al. 2003). This pattern might reflect sequence differences between the outer and inner parts of the subtelomeric regions or that crossovers initiated within the adjacent euchromatin-like gene-rich regions are capable of resolving within the subtelomeric sequences. Either way, there was little crossing over within the endmost 10–20 kb of most chromosomes. These results are consistent with our suggestion that subtelomeric sequences prevent the occurrence of nonfunctional crossovers (BARTON et al. 2003).
Surprisingly, 26 of 31 euchromatin-like regions that were either adjacent or close to the subtelomeric sequences underwent crossing over at higher-than-average rates. On average, these sequences recombined at twofold greater rates than the genomic average and included nine new discrete recombination hot spots with rates that were equal to or greater than those found for previously reported hot spots. The new hot spots were almost all associated with high levels of kanMX gene conversion, suggesting that the inserted marker might be close to a DSB site.
When the available genomic reciprocal recombination data were analyzed for position-dependent relationships, distal parts of chromosomes exclusive of subtelomeric sequences also underwent more recombination than centric regions. These observations were not the result of centromeric inhibition of crossing over, which produces a much more localized effect. When plotting recombination rates against physical distance from the telomere, the steepness of the observed slopes diminished when the length of the included physical distance was increased. When the data for each chromosome were analyzed individually, 15 of 16 exhibited similar behaviors where linear regression produced negative slopes but available data were insufficient to produce a significant conclusion for about one-third of the chromosomes (data not shown). Similarly, the steepness of the individual chromosome slopes decreased with increased chromosome size, an effect that might be related to the chromosome size effect on recombination (KABACK et al. 1992; CHERRY et al. 1997). These results are also consistent with a proposed long-range telomere effect that produces increased meiotic DSB formation 50–100 kb from the end of a chromosome as proposed by BLITZBLAU et al. (2007). Thus, this effect might produce the overall increase in recombination rate observed in distal regions.
The final estimate of the total genetic map length was
4500 cM (MORTIMER and SCHILD 1985). The new additions extend this length by
400 to
4900 cM. This extension increases the average recombination rate based on dividing the total map length by the size of the sequenced genome (1.21 Mb) by an equivalent amount from 0.37 to 0.40 cM/kb. Additional crossing over near chromosome ends is similarly supported by genomic array data analyzing crosses between more divergent strain backgrounds (J. FUNG, personal communication).
DSB sites mapped using RAD50S mutants were not observed within 40 kb of all chromosome ends and only one of the new hot spots described here included or was located within
9 kb of one of these sites. Recent studies mapping the DSB sites in dmc1 mutant cells suggested that there were many additional DSB sites that mapped much closer to the ends of most chromosomes (BLITZBLAU et al. 2007; BUHLER et al. 2007). The results presented here suggest that these DSB sites could be used to promote some of the crossing over observed here. However, it should be pointed out that many of the new DSB sites are located within regions that did not show high rates of reciprocal recombination.
Most of the newly defined recombination hot spots are on one of the smaller S. cerevisiae chromosomes as are all the previously characterized hot spots. In addition, the kanMX marker with the highest level of gene conversion was on the second smallest chromosome (VI). This distribution is consistent with the higher overall recombination rates found on the smaller chromosomes (KABACK et al. 1989; RILES et al. 1993). Nevertheless, two of the new hot spots were on large chromosomes, including one on chromosome IV, the largest in S. cerevisiae.
The studies presented here suggest that the ends of S. cerevisiae chromosomes excluding subtelomeric sequences show higher rates of recombination than more centric regions. This relationship appears to be found in many organisms and might reflect a chromosome position-dependent effect on crossing over. The nature of such an effect is not known. However, it could be the result of telomere clustering and the bouquet arrangement at the leptotene/zygotene transition, which bring the endmost homologous sequences in closer proximity to each other than homologous sequences located elsewhere on the chromosome (TRELLES-STRICKEN et al. 1999). Such juxtaposition could enhance crossing over. Alternatively, higher crossover frequencies near chromosome ends could be the result of crossover interference, which has been suggested to spread the distribution of crossovers distally in higher eukaryotes (LAWRIE et al. 1995; BARLOW and HULTEN 1998; FROENICKE et al. 2002).
Paradoxically, chiasmata that form near the ends of both S. cerevisiae and Drosophila chromosomes do not appear to promote efficient segregation (KOEHLER et al. 1996; ROSS et al. 1996). Indeed, such crossovers that form near the ends of chromosomes have been suggested to be associated with a significant fraction of chromosome 21 trisomies in humans (Down's syndrome) (SHERMAN et al. 1994; LAMB et al. 1997). We suggested that subtelomeric sequences prevent crossovers from occurring too close to the ends of chromosomes. However, it is not known whether the newly discovered recombination hot spots are sufficiently far from the ends to produce chiasmata that promote efficient segregation. Therefore, a better understanding of the role of meiotic recombination at chromosome ends is warranted.
BARLOW, A. L., and M. A. HULTEN, 1998 Crossing over analysis at pachytene in man. Eur. J. Hum. Genet. 6: 350–358.[CrossRef][Medline]
BARTON, A. B., Y. SU, J. LAMB, D. BARBER and D. B. KABACK, 2003 A function for subtelomeric DNA in Saccharomyces cerevisiae. Genetics 165: 929–934.
BAUDAT, F., and A. NICOLAS, 1997 Clustering of meiotic double-stranded breaks on yeast chromosome III. Proc. Natl. Acad. Sci. USA 94: 5213–5218.
BLITZBLAU, H. G., G. W. BELL, J. RODRIQUEZ, S. P. BELL and A. HOCHWAGEN, 2007 Mapping of meiotic single-stranded DNA reveals double-strand break hotspots near telomeres and centromeres. Curr. Biol. 17: 2003–2012.[CrossRef][Medline]
BUHLER, C., V. BORDE and M. LICHTEN, 2007 Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae. PLoS Biol. 5: 2797–2808.
BURKE, D., D. DAWSON and T. STEARNS, 2000 Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Plainview, NY.
CHERRY, J. M., C. BALL, S. WENG, G. JUVIK, R. SCHMIDT et al., 1997 Genetic and physical maps of Saccharomyces cerevisiae. Nature 387: 67–73.[CrossRef][Medline]
COLEMAN, K. G., H. Y. STEENSMA, D. B. KABACK and J. R. PRINGLE, 1986 Molecular cloning of chromosome I DNA from Saccharomyces cerevisiae: isolation and characterization of the CDC24 gene and adjacent regions of the chromosome. Mol. Cell. Biol. 6: 4516–4525.
FAN, Q., F. XU and T. D. PETES, 1995 Meiosis-specific double-strand DNA breaks at the HIS4 recombination hot spot in the yeast Saccharomyces cerevisiae: control in cis and trans. Mol. Cell. Biol. 15: 1679–1688.
FROENICKE, L., L. K. ANDERSON, J. WEINBERG and T. ASHLEY, 2002 Male mouse recombination maps for each autosome identified by chromosome painting. Am. J. Hum. Genet. 71: 1353–1368.[CrossRef][Medline]
GERTON, J. L., J. DERISI, R. SHROFF, M. LICHTEN, P. O. BROWN et al., 2000 Global mapping of meiotic recombination hotspots and coldspots in the yeast Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 97: 11383–11390.
GOLDSTEIN, A. L., and J. H. MCCUSKER, 1999 Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast 15: 1541–1553.[CrossRef][Medline]
GOTTSCHLING, D. E., O. M. APARICIO, B. L. BILLINGTON and V. A. ZAKIAN, 1990 Position effect at S. cerevisiae telomeres: reversible repression of Pol II transcription. Cell 63: 751–762.[CrossRef][Medline]
JENSEN-SEAMAN, M. I., T. S. FUREY, B. A. PAYSEUR, Y. LU, K. M. ROSKIN et al., 2004 Comparative recombination rates in the rat, mouse, and human genomes. Genome Res. 14: 528–538.
KABACK, D. B., 1989 Meiotic segregation of circular minichromosomes from intact chromosomes in Saccharomyces cerevisiae. Curr. Genet. 15: 385–392.[CrossRef][Medline]
KABACK, D. B., L. M. ANGERER and N. DAVIDSON, 1979 Improved methods for the formation and stabilization of R-loops. Nucleic Acids Res. 6: 2499–2517.
KABACK, D. B., H. Y. STEENSMA and P. DE JONGE, 1989 Enhanced meiotic recombination on the smallest chromosome of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 86: 3694–3698.
KABACK, D. B., V. GUACCI, D. BARBER and J. W. MAHON, 1992 Chromosome size-dependent control of meiotic recombination. Science 256: 228–232.
KABACK, D. B., D. BARBER, J. MAHON, J. LAMB and J. YOU, 1999 Chromosome-size dependent control of meiotic reciprocal recombination in Saccharomyces cerevisiae: the role of crossover interference. Genetics 152: 1475–1486.
KEENEY, S., C. N. GIROUX and N. KLECKNER, 1997 Meiosis-specific DNA double-strand breaks are catalyzed by Spo11, a member of a widely conserved protein family. Cell 88: 375–384.[CrossRef][Medline]
KIBURZ, B. M., D. B. REYNOLDS, P. C. MEGEE, A. L. MARSTON, B. H. LEE et al., 2005 The core centromere and Sgo1 establish a 50-kb cohesin-protected domain around centromeres during meiosis I. Genes Dev. 19: 3017–3030.
KLEIN, S., D. ZENVIRTH, V. DROR, A. B. BARTON, D. B. KABACK et al., 1996 Patterns of meiotic double-strand breakage on native and artificial yeast chromosomes. Chromosoma 105: 276–284.[Medline]
KOEHLER, K., C. BOULTON, H. COLLINS, R. FRENCH, K. HERMAN et al., 1996 Spontaneous X chromosome MI and MII nondisjunction events in Drosophila melanogaster oocytes have different recombinational histories. Nat. Genet. 14: 406–414.[CrossRef][Medline]
LAMB, N. E., E. FEINGOLD, A. SAVAGE, D. AVRAMOPOULOS, S. FREEMAN et al., 1997 Characterization of susceptible chiasma configurations that increase the risk for maternal nondisjunction of chromosome 21. Hum. Mol. Genet. 6: 1391–1399.
LAMBIE, E. J., and G. S. ROEDER, 1986 Repression of meiotic crossing over by a centromere (CEN3) in Saccharomyces cerevisiae. Genetics 114: 769–789.
LANDER, E. S., L. M. LINTON, B. BIRREN, C. NUSBAUM, M. C. ZODY et al., 2001 Initial sequencing and analysis of the human genome. Nature 409: 860–921.[CrossRef][Medline]
LAWRIE, N. M., C. TEASE and M. A. HULTEN, 1995 Chiasma frequency, distribution and interference maps of mouse autosomes. Chromosoma 104: 308–314.[Medline]
LICHTEN, M., and A. S. GOLDMAN, 1995 Meiotic recombination hotspots. Annu. Rev. Genet. 29: 423–444.[CrossRef][Medline]
LOUIS, E. J., 1995 The chromosome ends of Saccharomyces cerevisiae. Yeast 11: 1553–1573.[CrossRef][Medline]
LOUIS, E. J., and R. H. BORTS, 1995 A complete set of marked telomeres in Saccharomyces cerevisiae for physical mapping and cloning. Genetics 139: 125–136.[Abstract]
MALONE, R. E., S. KIM, S. A. BULLARD, S. LUNDQUIST, L. HUTCHINGS-CROW et al., 1994 Analysis of a recombination hotspot for gene conversion occurring at the HIS2 gene of Saccharomyces cerevisiae. Genetics 137: 5–18.[Abstract]
MCKIM, K., A. HOWELL and A. ROSE, 1988 The effects of translocations on recombination frequency in Caenorhabditis elegans. Genetics 120: 987–1001.
MORTIMER, R. K., and D. SCHILD, 1985 Genetic map of Saccharomyces cerevisiae, edition 9. Microbiol. Rev. 49: 181–213.
MORTIMER, R. K., D. SCHILD, C. R. CONTOPOULOU and J. A. KANS, 1989 Genetic map of Saccharomyces cerevisiae, edition 10. Yeast 5: 321–403.[CrossRef][Medline]
NICOLAS, A., D. TRECO, N. P. SCHULTES and J. W. SZOSTAK, 1989 An initiation site for meiotic gene conversion in the yeast Saccharomyces cerevisiae. Nature 338: 35–39.[CrossRef][Medline]
PRYDE, F. E., and E. J. LOUIS, 1997 Saccharomyces cerevisiae telomeres: a review. Biochemistry 62: 1232–1241.[Medline]
RILES, L., J. E. DUTCHIK, A. BAKTHA, B. K. MCCAULEY, E. C. THAYER et al., 1993 Physical maps of the six smallest chromosomes of Saccharomyces cerevisiae at a resolution of 2.6 kilobase pairs. Genetics 134: 81–150.[Abstract]
ROSS, L. O., R. MAXFIELD and D. DAWSON, 1996 Exchanges are not equally able to enhance meiotic chromosome segregation in yeast. Proc. Natl. Acad. Sci. USA 93: 4979–4983.
ROTHSTEIN, R. J., 1983 One-step gene disruption in yeast. Methods Enzymol. 101: 202–211.[Medline]
SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SHERMAN, S., M. PETERSEN, S. FREEMAN, J. HERSEY, D. PETTAY et al., 1994 Non-disjunction of chromosome 21 in maternal meiosis I: evidence for a maternal age-dependent mechanism involving reduced recombination. Hum. Mol. Genet. 3: 1529–1535.
SU, Y. P., A. B. BARTON and D. B. KABACK, 2000 Decreased meiotic reciprocal recombination in subtelomeric regions in Saccharomyces cerevisiae. Chromosoma 109: 467–475.[Medline]
TRELLES-STRICKEN, E., J. LOIDL and H. SCHERTHAN, 1999 Bouquet formation in budding yeast: initiation of recombination is not required for meiotic telomere clustering. J. Cell Sci. 112: 651–658.[Abstract]
VELCULESCU, V. E., L. ZHANG, W. ZHOU, J. VOGELSTEIN, M. A. BASRAI et al., 1997 Characterization of the yeast transcriptome. Cell 88: 243–251.[CrossRef][Medline]
VILLENEUVE, A., 1994 A cis-acting locus that promotes crossing over between X chromosomes in Caenorhabditis elegans. Genetics 136: 887–902.[Abstract]
WACH, A., A. BRACHAT, R. POHLMANN and P. PHILIPPSEN, 1994 New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10: 1793–1808.[CrossRef][Medline]
WINZELER, E. A., D. D. SHOEMAKER, A. ASTOMOFF, H. LIANG, K. ANDERSON et al., 1999 Functional characterization of the Saccharomyces cerevisiae genome by gene deletion and parallel analysis. Science 285: 901–906.
WYRICK, J. J., F. C. HOLSTEGE, E. G. JENNINGS, H. C. CAUSTON, D. SHORE et al., 1999 Chromosomal landscape of nucleosome-dependent gene expression and silencing in yeast. Nature 402: 418–421.[CrossRef][Medline]
Communicating editor: F. WINSTON
Related articles in Genetics:
ISSUE HIGHLIGHTS
Genetics 2008 179: NP.
This article has been cited by other articles:
![]() |
M. E. Marvin, C. D. Griffin, D. E. Eyre, D. B. H. Barton, and E. J. Louis In Saccharomyces cerevisiae, yKu and Subtelomeric Core X Sequences Repress Homologous Recombination Near Telomeres as Part of the Same Pathway Genetics, October 1, 2009; 183(2): 441 - 451. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Data Supplement
-
All Versions of this Article:
genetics.107.083493v1
179/3/1221 most recent - Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Related articles in Genetics
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Barton, A. B.
- Articles by Kaback, D. B.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Barton, A. B.
- Articles by Kaback, D. B.






