- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Data Supplement
-
All Versions of this Article:
genetics.107.085779v1
179/2/757 most recent - Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Gómez, E. B.
- Articles by Forsburg, S. L.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Gómez, E. B.
- Articles by Forsburg, S. L.
Originally published as Genetics Published Articles Ahead of Print on May 27, 2008.
Genetics, Vol. 179, 757-771, June 2008, Copyright © 2008
doi:10.1534/genetics.107.085779
Schizosaccharomyces pombe Histone Acetyltransferase Mst1 (KAT5) Is an Essential Protein Required for Damage Response and Chromosome Segregation
Eliana B. Gómez*,
,
Rebecca L. Nugent*,
Sebastián Laria
and
Susan L. Forsburg*,
,1
* Molecular and Computational Biology Section, University of Southern California, Los Angeles, California 90089-2910 and
Molecular and Cell Biology Laboratory, Salk Institute for Biological Studies, La Jolla, California 90089-2910
1 Corresponding author: Molecular and Computational Biology Section, 1050 Childs Way, RRI 201, University of Southern California, Los Angeles, CA 90089-2910.
E-mail: forsburg{at}usc.edu
Schizosaccharomyces pombe Mst1 is a member of the MYST family of histone acetyltransferases and is the likely ortholog of Saccharomyces cerevisiae Esa1 and human Tip60 (KAT5). We have isolated a temperature-sensitive allele of this essential gene. mst1 cells show a pleiotropic phenotype at the restrictive temperature. They are sensitive to a variety of DNA-damaging agents and to the spindle poison thiabendazole. mst1 has an increased frequency of Rad22 repair foci, suggesting endogenous damage. Two-hybrid results show that Mst1 interacts with a number of proteins involved in chromosome integrity and centromere function, including the methyltransferase Skb1, the recombination mediator Rad22 (Sc Rad52), the chromatin assembly factor Hip1 (Sc Hir1), and the Msc1 protein related to a family of histone demethylases. mst1 mutant sensitivity to hydroxyurea suggests a defect in recovery following HU arrest. We conclude that Mst1 plays essential roles in maintenance of genome stability and recovery from DNA damage.
MANY events in DNA metabolism, including replication and repair, are modulated by the pattern of different histone modifications in the chromatin, leading to the speculation that a "histone code" provides epigenetic information that facilitates numerous chromatin functions (reviewed in JENUWEIN and ALLIS 2001; KOUZARIDES 2007). Histone acetylation is associated with diverse chromatin functions (reviewed in KOUZARIDES 2007; LEE and WORKMAN 2007). Histone acetylation changes association of DNA with the underlying nucleosomes (SHOGREN-KNAAK et al. 2006) and also creates specific binding sites for proteins involved in a variety of DNA transactions (reviewed in KOUZARIDES 2007; LEE and WORKMAN 2007). Histone acetyltransferase (HAT) enzymes can be separated into several sequence-specific subfamilies that differ in their substrates and in the composition of their associated complexes. The MYST family of HATs (reviewed by UTLEY and COTE 2003) has been extensively characterized in budding yeast, which has three members (reviewed in LAFON et al. 2007). We have reported two MYST family proteins in fission yeast (GÓMEZ et al. 2005): Mst2, the likely ortholog of Saccharomyces cerevisiae Sas2, is a nonessential gene required for normal telomere silencing (GÓMEZ et al. 2005). Mst1, the likely ortholog of S. cerevisiae Esa1, is an essential gene and is the subject of this report.
Work from several experimental systems shows that ScEsa1 histone acetyltransferase is a catalytic subunit of a large protein complex called NuA4 and a smaller subcomplex, Piccolo, that is part of NuA4 (ALLARD et al. 1999; BOUDREAULT et al. 2003; EBERHARTER et al. 2005; SELLECK et al. 2005). The NuA4 complex acetylates histone H4 and H2A (SMITH et al. 1998; ALLARD et al. 1999; GALARNEAU et al. 2000). It may also be associated with acetylation of the histone variant H2AZ (KEOGH et al. 2006; MILLAR et al. 2006). Esa1 family HATs contain a chromodomain, a motif associated with binding to methylated histones (reviewed in DE LA CRUZ et al. 2005). While this suggests that some aspect of Esa1 function is mediated by binding methylated histone(s), the target for such binding remains elusive. The mammalian homolog is Tip60 (reviewed in SQUATRITO et al. 2006). Under a new initiative to regularize nomenclature in the chromatin field, Mst1, Esa1, and Tip60 are defined as the KAT5 family of histone acetyltransferases (ALLIS et al. 2007).
ScESA1 is an essential gene, and loss of function results in cell-cycle-specific arrest after replication but before mitosis (SMITH et al. 1998; CLARKE et al. 1999), although a recent report suggests that it may also be required for cell cycle entry (EARLY et al. 2004). The roles of ScEsa1 are diverse, and recent studies have also linked it to the spindle assembly checkpoint (LE MASSON et al. 2003) and the morphogenesis checkpoint (LE MASSON et al. 2003; RUAULT and PILLUS 2006). Genome-level analyses in budding yeast indicate that ScEsa1 activity is associated with active gene expression (GALARNEAU et al. 2000; VOGELAUER et al. 2002). Paradoxically, however, H4 acetylation is also associated with decreased gene expression (DECKERT and STRUHL 2001). Recent studies suggest that ScEsa1 may also repress activity of specific gene regions, particularly the heterochromatic domains of the telomeres and the rDNA (CLARKE et al. 2006).
Histone acetylation by the NuA4 complex has a role in DNA double-strand break (DSB) repair (reviewed in VAN ATTIKUM and GASSER 2005b; SQUATRITO et al. 2006). Increased histone acetylation near the damage site occurs (YU et al. 2005) and acetylation of H4 is linked to activation of homologous recombination and nonhomologous end-joining (BIRD et al. 2002; TAMBURINI and TYLER 2005). ScEsa1 is recruited to DNA breaks (BIRD et al. 2002; TAMBURINI and TYLER 2005). One of the major responses to DNA double-strand breaks is phosphorylation of the histone variant H2AX by the damage checkpoint kinases ATM and ATR (reviewed in FOSTER and DOWNS 2005; MORRISON and SHEN 2005). H2AX phosphorylation and recruitment of NuA4 occur with similar timing (DOWNS et al. 2004). Interestingly, two chromatin-remodeling complexes, INO80 and SWR1, are also recruited to H2AX, at least in part through the common Arp4 subunit that they share with NuA4 (DOWNS et al. 2004; ROBERT et al. 2006). NuA4, INO80, and SWR1 are proposed to facilitate exchange of phospho-H2AX, ultimately downregulating the damage signal (MORRISON et al. 2004; TSUKUDA et al. 2005; VAN ATTIKUM and GASSER 2005b; PAPAMICHOS-CHRONAKIS et al. 2006). Recent studies have implicated the NuA4 complex in regulation and modification of an additional histone H2A variant called H2AZ (BABIARZ et al. 2006; KEOGH et al. 2006; MILLAR and GRUNSTEIN 2006). It has been suggested that the downregulation of the H2AX phosphorylation signal reflects exchange of phospho-H2AX with H2AZ (reviewed in VAN ATTIKUM and GASSER 2005a).
Tip60, the human ortholog of Mst1 and ScEsa1, acetylates nonhistone proteins independently of the NuA4 complex with substrates including Notch (KIM et al. 2007), ATM (SUN et al. 2005; JIANG et al. 2006), p53 (SYKES et al. 2006; TANG et al. 2006), and DNA-PKcs (JIANG et al. 2006). Tip60-deficient cells exposed to ionizing radiation have defects in chromosome repair and reduced apoptosis (IKURA et al. 2000). This leads to the important conclusion that HATs are not limited to histones as substrates. These data suggest that KAT5 family HATs contribute to DNA damage response in two ways: first, by affecting DNA repair and recovery (e.g., through histone modifications that recruit specific DNA damage response proteins) and, second, by affecting the checkpoint response (e.g., through direct modification of p53 or ATM).
To gain further insight into the diverse function of the KAT5 protein family in DNA metabolism, we investigated the role of Schizosaccharomyces pombe Mst1 in the tractable fission yeast system. In this report, we present initial genetic characterization of this gene. Mst1 is essential for viability, and mutants are sensitive to a variety of DNA-damaging agents, including hydroxyurea (HU), ultraviolet (UV) irradiation, methyl methanesulfonate (MMS), and bleomycin. Mutants are also sensitive to the spindle poison thiabendazole. Using a two-hybrid screen, we identify a number of potential interaction proteins involved in DNA dynamics, including chromatin proteins, transcription factors, and the recombination protein Rad22 (ScRad52). Analysis of the HU response suggests that Mst1 is required for normal recruitment of Rad22 in HU. Thus, Mst1 has multiple roles in maintenance of genome integrity in S. pombe.
Strains, media, and manipulations:
Strains used in this study are listed in Table 1. Strains were grown and maintained on yeast extract plus supplements (YES) or Edinburgh minimal media with appropriate supplements, using standard techniques (FORSBURG and RHIND 2006). Matings were performed on synthetic sporulation agar plates for 2–3 days at 25°. Temperature-sensitive (ts) cells were grown at 25° and non-ts cells at 32°. Transformations were carried out by electroporation. Double mutants were constructed by standard tetrad analysis or random spore analysis. G418 plates were YES supplemented with 100 µg/ml G418 (Sigma, St. Louis).
|
Plasmids and constructions:
Disruption and tagging of mst1+ is described in GÓMEZ et al. (2005). Site-directed mutants were constructed using the Quick-Change mutagenesis kit (Stratagene, La Jolla, CA).
Primers used were L-S/F (CATACAATTTTCTTATGAATCGACCAAGCGTGAGCACAAAC) and L-S/R GTTTGTGCTCACGCTTGGTCGATTCATAAGAAAATTGTATG and L-P/F GGTGTAGGAATATTTGTCTTCCGTCCAACCTTTTTCTGGATCAC and L-P/R GTGATCCAGAAAAAGTTTGGACGGAAGACAAATATTCCTACACC. Complementation and temperature sensitivity were assessed by transforming the expression plasmid into the heterozygous mst1+/
mst::ura4+ diploid FY1754 and by isolating haploids that contain both
mst1::ura4+ and the plasmid markers. An integrant was constructed by moving the Pnmt-mst1-L344S cassette from plasmid pEBG99 into plasmid pJK148 to create plasmid pEBG98 and integrating this construct at the leu1-32 locus in the diploid. Haploid temperature-sensitive segregants containing both
mst1::ura4+ and leu1+::nmt-mst1-L344S were isolated by random spore analysis.
Silencing was assessed by examining growth in the absence of uracil and low adenine in a strain with ura4+ integrated into the centromere and ade6+ integrated into the telomere of a minichromosome.
FACS:
Samples were collected after 5 and 10 hr, ethanol fixed, and analyzed by flow cytometry as described previously (GÓMEZ and FORSBURG 2003).
Immunoprecipitation:
Samples were prepared as described in GÓMEZ et al. (2002). For co-immunoprecipitation with MCM proteins, we used anti-HA antibody 12CA5 (Abcam) and antiV5 (Invitrogen, San Diego). For histone acetylation assays, the dried beads were treated with 20 µl of a histone acetylation mix containing 5 µM C14-Acetyl CoA (ICN), 0.7 µg of core histones, 50 mM HEPES (pH 7.9), 10% glycerol, and 1 mM DTT. The reaction was incubated 1 hr 30 min at 30°. Beads were spun down, and supernatant was recovered and boiled in SDS–Laemmli loading buffer before electrophoresis in 15% SDS–polyacrylamide gel electrophoresis (PAGE). The gel was fixed and treated with fluorography-enhancing solution (NEN Life Science) before drying and autoradiography.For co-immunoprecipitation with Rad22-YFP or Cbh1-GFP (strains 3436, 3480), we prepared soluble protein lysates from fission yeast cells in B88 buffer as in MORENO et al. (1991) A total of 1.0 mg protein was used per immunoprecipitation. Lysates were precleared with sepharose A beads (Repligen) for 1 hr. One microliter of anti-GFP (Abcam 290) was added and left to rotate overnight at 4°. Proteins were analyzed by 8% SDS–PAGE, followed by immunoblotting with anti-V5 (Invitrogen) at 1:2500 dilution and with anti-GFP (living colors, Clontech) at a 1:1000 dilution. Crosslinking immunoprecipitations were done as previously described (AUGER et al. 2008). Briefly, cells were crosslinked with 1% formaldehyde (Sigma) for 50 min on ice. Harvested cells were vortexed with glass beads in IP buffer (50 mM HEPES–KOH, pH 1.6, 500 mM NaCL, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate). Extracts were treated with DNase I to reverse crosslink. A total of 1.0 mg protein was used per immunoprecipitation. Whole-cell extracts and immunoprecipitates were incubated with SDS sample buffer for 1 hr at 90° before Western blot analysis.
Microscopy:
Whole fixed cells were stained as described for DAPI and Calofluor (GÓMEZ and FORSBURG 2003). Cells were visualized with a Leica DMR microscope. Objectives used were Leica 100X/1.30, PLFL, NA = 1.30, and Leica 63X/1.32, PLApo, NA = 1.32. Images were captured with a Hamamatsu digital camera and Improvision Openlab software (Improvision, Lexington, MA). Images were assembled using Canvas (ACD/Deneba) and adjusted for contrast. Nuclear spreads were performed as in PANKRATZ and FORSBURG (2005) with the following modifications. Rad22YFP was detected using Abcam 290-50 rabbit anti-GFP, 1:2000 in 5% BSA (Sigma), and secondary donkey anti-rabbit cy3 1:500 DNA was stained with 1x Hoechst (Invitrogen). The objective used was Leica 63X/1.32, PLApo, NA = 1.32. Images were captured and assembled as above.
Damage assays:
Cells were grown to A595 = 1, serially diluted fivefold, and spotted onto YES plates or YES plates containing 10 µg/ml thiabendazole (TBZ), 5 mM HU, or 0.005, 0.007, or 0.01% MMS, and incubated for 3–5 days at 25°, 29°, or 32°, as indicated. For UV irradiation assay, 1000 cells were plated in duplicate onto YES and immediately treated with the indicated doses of UV irradiation using a Stratalinker (Stratagene). Control plates were left untreated. Plates were incubated at 32° for 2–3 days. Colonies were counted and the percentage survival was obtained relative to the number of colonies grown on the untreated control plates.
Two-hybrid strains:
The mst1+ open reading frame was isolated by PCR from plasmid pEBG72 with primers HAT-3 forward (AGATCTCGCCAAAAACTTGCTCAATCTTCTTCC) and HAT-3 reverse (GGTACCCGACATAGACTGGCACATTACATCC) and cloned into the two-hybrid vector pDBLeu cleaved with NcoI and NotI to create plasmid pEBG91. Budding-yeast two-hybrid strain AH109 (Clontech) with HIS3, ADE2, and lacZ reporters downstream of heterologous GAL4-responsive promoter elements was transformed with an S. pombe Matchmaker cDNA library (Clontech) and screened for interactions as described in LEVERSON et al. (2002). Plasmids from positive clones were isolated and verified by retransformation, and the identity of the interacting open reading frame was determined by sequence.
mst1 cells undergo disordered mitosis:
Previously, we identified two members of the MYST family of histone acetyltransferases in fission yeast. Our analysis indicated that Mst1 is the likely ortholog of S. cerevisiae Esa1, and like ScEsa1, is a chromatin-bound protein that is essential for viability (GÓMEZ et al. 2005). Data from metazoans suggest that the Hbo1 histone acetyltransferase, which is also a MYST family protein, may function in DNA replication (IIZUKA and STILLMAN 1999; BURKE et al. 2001; IIZUKA et al. 2006). To investigate whether S. pombe Mst1 contributes to DNA replication, we examined the phenotype of cells containing the
mst1 allele. Mutant diploids heterozygous for
mst1::ura4+ and wild-type diploids heterozygous for ura4+ were induced to sporulate. We inoculated purified spores from both diploids into medium lacking uracil to carry out bulk spore germination. Only spores containing the ura4+ gene are able to germinate in these conditions, and their DNA content was determined by flow cytometry. Spores containing
mst1::ura4+ synthesized DNA to an approximately 2C DNA content, with timing similar to that of wild type (Figure 1). Half of each population contains nongerminating ura4-D18 spores, which persist as a 1C population. Upon microscopic examination, we observed that many of the
mst1::ura4+ cells showed highly disordered mitosis, including a high fraction of cut phenotypes. This suggests defects in chromosome segregation, which might result from mitotic defects or from replication defects and checkpoint disruption.
|
Isolation and characterization of a temperature-sensitive allele:
To better characterize Mst1, we constructed a temperature-sensitive allele based on temperature-sensitive alleles in S. cerevisiae ESA1 (CLARKE et al. 1999). We tested two mutations: L271P (corresponding to L254P in ScEsa1) and L344S (corresponding to L267S in ScEsa1). Constructs containing these were placed in a LEU2 plasmid under control of the nmt1 promoter and transformed into the
mst1::ura4+ diploid. Following sporulation, we assessed recovery of spores at 25° containing both the ura4+ marker (marking
mst1) and the LEU2 marker (marking the plasmid). Both mutants were able to complement the disruption at 25°. However, upon shift to 36°, only the mst1-L344S strain was temperature sensitive.
We attempted to replace the endogenous mst1+ allele with the L344S allele, without success. We reasoned that, when integrated under the native promoter, a single copy of mst1-L344S might be insufficient for viability. Therefore, we integrated mst1-L344S under control of the nmt1+ promoter into the leu1-32 locus of the heterozygous diploid and sporulated to create the haploid strain
mst1::ura4+ leu1+::Pnmt1-mst1-L344S. Upon shift to 36° and addition of thiamine to shut off the nmt1 promoter, this strain was unable to grow. However, cells were able to grow in the presence of thiamine at 25° or 32°, indicating that the protein is functional at lower temperatures. There is sufficient background expression of the nmt1+ promoter even the presence of thiamine for stable proteins to be maintained (Figure 2, A–D). An equivalent strain with a kanMX marker at
mst1 behaved similarly (data not shown).
|
We examined the phenotype of cells containing mst1-L344S by shifting asynchronous cells to the restrictive temperature. The increase of cell number was blocked within 2 hr. However, cell mass measured by A595 continued to increase for
8 hr. DNA content, measured by flow cytometry, showed no change from the 2C peak characteristic of exponentially growing wild-type fission yeast, although later time points showed a flattening of the profile and an increase of cells with higher DNA content. This is common in heterogeneous, elongated cells and is typical of most cdc mutants. We examined cells for nuclear and septum morphology by staining with DAPI and Calcofluor, respectively, and observing under fluorescence (Figure 2E, quantified in Figure 2F). Strikingly, the number of cells staining with Calcofluor significantly increased in the mst1-L344S strain at restrictive temperature, with nearly 50% of cells arrested with septa by 6 hr. Some of these were mononucleate, showing asymmetric nuclear segregation. Additionally, there was an increase in the overall number of binucleate cells relative to wild type. S. pombe has an unusual cell cycle in which cytokinesis is completed during the subsequent nuclear cell cycle. Thus, cells with a 2C DNA content by FACS may be mononucleate cells in G2 or M phase or binucleated cells in which the nuclei are in G1 or S phase and cytokinesis is not complete. Therefore, arrest as a binucleate septated cell may represent a defect entering DNA replication in the ensuing cell cycle. Alternatively, it could represent a defect in cytokinesis that delays entry into the next cell cycle.
This phenotype is different from the disordered mitosis seen in the
mst1 mutant spores. Because germinating spores arise from stationary or G1 cells, while exponentially growing S. pombe are predominantly G2 with a 2C DNA content, we reasoned that the different phenotypes could represent the effect of inactivating Mst1 at different cell cycle stages. Alternatively, they could suggest that the mst1-L344S allele creates a hypomorph rather than a complete inactivation of the gene. We attempted to resolve whether the mutation affects S phase by synchronizing the mst1-L344S cells in G1, using nitrogen starvation (supplemental Figure 1). When released from nitrogen starvation into complete medium, mst-L344S cells completed replication with similar timing to wild type, also suggesting that inactivation of mst1 by the mst1-L344S allele or by the
mst1 allele is not sufficient for cells to block DNA replication in the first cell cycle.
mst1-L344S genetically interacts with replication, recombination, and heterochromatin mutants:
We examined the phenotypes of double mutants, which contained mst1-L344S as well as mutations in genes required for DNA replication, double-strand break repair, and heterochromatin assembly (Table 2, Figure 3). We tested the double-mutant strains for their temperature sensitivity. We defined a genetic interaction as occurring when a double-mutant strain was unable to grow at temperatures where both parents were growth proficient ("reduced growth temperature"). There were modest genetic interactions with many replication initiation mutants. Additionally, we observed that the maximum growth temperature was reduced when mst1 was combined with mutations
rhp51 (ScRad51),
rad50, and
rad22, which affect homologous DNA recombination. The
rad22 mst1-L344S strain grew extremely slowly even at 25°; however, because of the high frequency of spontaneous suppressors in
rad22 backgrounds (OSMAN et al. 2005), we cannot be confident that this strain is suppressor free.
|
|
Because mst1-L344S cells show defects in chromosome segregation and are sensitive to thiabendazole (see Figure 5), we examined interactions with genes required for centromere heterochromatin assembly (Table 2, centromere). We observed that maximum-growth temperature was strikingly lower than that of the parents when mst1-L344S was combined with
swi6,
clr3, and
clr4, all of which define genes required to establish and maintain centromeric heterochromatin (reviewed in EKWALL 2007). However, we observed no defects in centromere or telomere silencing in mst1-L344S cells (data not shown). This suggests that the heterochromatin itself is intact. We examined additional chromatin-related proteins. No effect is observed when mst1-L344S is combined with mutation of histone acetyltransferase
mst2 or the telomere-binding protein
taz1.
|
Identification of potential Mst1 interaction partners by two-hybrid screening:
SpMst1 interacts with the actin-related protein SpAlp5/ScArp4, a known subunit of the NuA4 complex (MINODA et al. 2005). Because evidence suggests that Tip60 may function independently of the NuA4 complex (see Introduction), we sought to identify additional proteins that interact with Mst1, using a two-hybrid screen. We isolated a number of interacting gene products, summarized in Table 3.
|
We isolated Rad22, the S. pombe ortholog of homologous DNA recombination protein Rad52. Rad22 promotes the strand-invasion step of homologous recombination. Fission yeast has an additional Rad22 family member, called Rti1. We constructed plasmids to test whether Mst1 interacted in the two-hybrid system with Rti1 or with Rhp51. Although Rhp51 and Rad22 themselves interact in two-hybrid screens (e.g., CATLETT and FORSBURG 2003), we observed no evidence for interaction between Mst1 and Rhp51 or between Mst1 and Rti1, suggesting that this interaction is specific (Figure 4A). Immunoprecipitation of Rad22YFP using a cross-reacting anti-GFP antibody precipitates Mst1-V5 (Figure 4B); however, immunoprecipitation of Mst1-V5 does not precipitate Rad22-YFP (data not shown).
|
We isolated three chromatin-related proteins as potential Mst1 partners. The first, Hip1, is a putative histone chaperone most closely related to ScHir1 and human HIRA (BLACKWELL et al. 2004). The second, Cbh1, is one of the three CenpB homologs in fission yeast associated with centromere assembly (BAUM and CLARKE 2000; NAKAGAWA et al. 2002). We tested all three CenpB homologs for interaction with Mst1. Only Cbh1 showed a specific interaction (Figure 4). We observed no co-immunoprecipitation between Cbh1 and Mst1 from soluble or crosslinked lysates (data not shown).The third gene that we isolated was Msc1. Msc1 was identified as a high-copy suppressor of the checkpoint mutation
chk1; it has E3 ligase activity and homology to a family of demethylases, and mutation disrupts histone acetylation (AHMED et al. 2004; DUL and WALWORTH 2007). We constructed double mutants containing mst1-L344S with
hip1,
cbh1, or
msc1 and tested growth at different temperatures. There was no difference in the growth characteristics of the double mutants compared to mst1-L344S cells alone. We were unable to detect Msc1 in soluble extracts and our crosslinking protocol was unsuccessful on this protein (data not shown).
The most frequently isolated two-hybrid clone was skb1+, which encodes an arginine methyltransferase, an ortholog of S. cerevisiae Hsl7 (FUJITA et al. 1999; SHULEWITZ et al. 1999; LEE et al. 2000). We observed no obvious genetic interactions between
skb1 and mst1-L344S, in contrast to budding yeast where hsl7 and esa1 mutants have been shown to have synthetic interactions (RUAULT and PILLUS 2006). Two putative transcription factors were also isolated. The res2/pct1+ gene has been studied extensively and it is required for G1/S-specific transcription (TANAKA et al. 1992; ZHU et al. 1994). taf111+ (also known as taf1+) is a putative TFIID subunit required for induction of genes during nitrogen starvation and sexual development (UENO et al. 2001). The remaining two-hybrid isolates included bud6+, which is also associated with actin function (GLYNN et al. 2001), and a SEC18 homolog likely involved in vesicular transport (SPAC1834.11c). The only previously described fission yeast Mst1 interactor, Alp5 (MINODA et al. 2005), was not isolated in our screen, nor were any other subunits of the NuA4 complex.
We observed very little Mst1 (or Mst2) protein in the soluble fraction (supplemental Figure 2a). This may explain why our attempts to confirm the two-hybrid interactions using co-immunoprecipitation in fission yeast were for the most part unsuccessful. Upon overproduction of Mst1, it is possible to observe some interactions with other proteins; for example, we found that Mcm2 can interact with Mst1 or Mst2 but only when both partners are overproduced (supplemental Figure 2b). However, we observed no interactions with endogenous levels of MCM proteins (data not shown), even though MCMs themselves can be coprecipitated under those conditions (e.g., SHERMAN et al. 1998; GÓMEZ et al. 2002). We completed our initial characterization of Mst1 protein by showing that acetylation of the four core histones can be observed in an IP–acetylation assay (supplemental Figure 3).
mst1-L344S cells are damage sensitive:
Data suggest that the NuA4 complex in other species is recruited to double-strand breaks through association with phosphorylated histone H2AX (DOWNS et al. 2004; ROBERT et al. 2006). Our data showing an interaction both genetically and physically with Rad22 suggested that Mst1 may contribute to repair of DSBs by influencing homologous recombination. Rad22 has also been implicated in recovery from HU (MEISTER et al. 2005; BAILIS et al. 2008). Therefore, we examined mst1-L344S mutants for evidence of a role in the damage response.
We first examined growth of mst1-L344S in response to chronic exposure to low levels of DNA-damaging agents (Figure 5A). We examined MMS (alkylating agent delays replication), HU (inhibits ribonucleotide reductase and causes fork stalling), and camptothecin (CPT; blocks topoisomerase and causes DSBs). mst1-L344S cells were sensitive to HU and MMS, but not to CPT at 29°. mst1-L344S was also sensitive to UV irradiation (200 J/m2), but not to
-irradiation (400 Gy) at 25° (not shown). We observed that sensitivity to these agents increased with temperature (data not shown). The mst1-L344S mutant was extremely sensitive to bleomycin at 32° (radio-mimetic; Figure 5B). These results are consistent with known roles for Mst1 family acetyltransferases in some forms of DSB repair. We also observed substantial sensitivity to thiabendazole, a microtubule-destabilizing drug (Figure 5C). Mutations affecting centromere or kinetochore function are often TBZ sensitive; this may relate to the synthetic interactions that we observed with the heterochromatin mutants (Table 2) and to the physical interactions with Cbh1 and Msc1, which affect centromere function (Table 3).
Mst1 is required for recovery from HU arrest:
HU causes nucleotide depletion, which results in replication fork stalling early in S phase. Defects in HU response may reflect a failure to arrest the cell cycle during the acute treatment or an ability to restore replication and recover after HU is removed (reviewed in BRANZEI and FOIANI 2007). As shown in Figure 6, A, B, and D, mst1-L344S mutants arrest with a 1C DNA content and modestly elongated morphology, as do wild-type and
cds1 cells, indicating that checkpoint-mediated cell cycle arrest is intact. As seen in the time course in Figure 6, A and B, wild-type cells complete S phase within 30 min of removing HU, while
cds1 mutants are severely delayed, consistent with their recovery defect. Wild-type cells also proceed to division and enter the next cell cycle, as seen in the increase of 4C population (reflecting binucleate cells that complete S phase before completing the previous cytokinesis). This population is not seen in the
cds1 mutants, which are defective for recovery and show a broad, heterogeneous peak of DNA content at the later time points. The mst1 cells resemble wild type, suggesting that the mutants maintain and restart the replication fork normally. This suggests that the sensitivity that we observed in mst1 cells in HU reflects defects in a later stage of recovery. Similar results have been seen for
rad22 and
rhp51 (MEISTER et al. 2005; BAILIS et al. 2008). Interestingly, although mst1-L344S cells were sensitive to HU during chronic treatment (Figure 5), viability was relatively unaffected by an acute treatment in the HU block-and-release protocol (Figure 6C). This suggests that prolonged exposure to HU leads to an accumulation of growth defects, whereas transient exposure for a single generation causes relatively little problem.
|
One measure of DNA damage is provided by recruitment of recombination proteins to repair centers (CASPARI et al. 2002; DU et al. 2003; MEISTER et al. 2005). During HU treatment, Rad22 focus formation can distinguish two functions. In wild-type cells, Rad22 is recruited in a burst during the recovery phase after cells are released from HU. In contrast, in checkpoint mutants that fail to respond properly to HU, collapsed replication forks cause DNA breaks and Rad22 is recruited during HU treatment (CASPARI et al. 2002; DU et al. 2003; MEISTER et al. 2005; BAILIS et al. 2008). To determine whether reduced Mst1 function causes DNA damage, we examined Rad22YFP focus formation in wild-type and mst1-L344S cells at 32° (Figure 6, E and F). Due to background fluorescence observed in mst1-L344S mutant cells, we had to detect Rad22YFP using indirect immunofluorescence on nuclear spreads. We observed a modest increase in Rad22 focus formation in mst1-L344S cells without HU treatment, relative to wild-type cells (compare 0-hr time point of mst1 and wild type in Figure 6F). This suggests that the cells suffer some amount of endogenous damage. During acute HU treatment,
cds1 cells show a dramatic increase in Rad22YFP focus formation, consistent with replication fork collapse and double-strand breaks (MEISTER et al. 2005; BAILIS et al. 2008). There is no change in the Rad22YFP foci in mst1-L344S, again consistent with the model that replication forks are intact. S. pombe Mst1 is the ortholog of S. cerevisiae Esa1 and human Tip60, the catalytic subunit of the NuA4 family of histone acetyltransferases, which is now referred to as the KAT5 family (reviewed in SQUATRITO et al. 2006; ALLIS et al. 2007). In addition to its presumed effects in transcriptional regulation (SMITH et al. 1998; ALLARD et al. 1999; CLARKE et al. 1999, 2006; DURANT and PUGH 2006), this family is implicated in checkpoint control by direct acetylation of ATM and p53 (SUN et al. 2005; JIANG et al. 2006; SYKES et al. 2006; TANG et al. 2006), as well as in repair by direct recruitment to phosphorylated histone H2AX at double-strand breaks (BIRD et al. 2002; DOWNS et al. 2004; TAMBURINI and TYLER 2005; ROBERT et al. 2006). Data also suggest that this family of HAT proteins acetylates histone H2AZ (BABIARZ et al. 2006; KEOGH et al. 2006; MILLAR et al. 2006); this histone variant is paradoxically associated with both regions of active gene transcription, as well as with centromeres and silent heterochromatin (reviewed in GUILLEMETTE and GAUDREAU 2006).
We characterized two mutations affecting mst1+ function. As we reported previously, the
mst1 mutation causes lethality (GÓMEZ et al. 2005). In this report, we show that spores bearing the disruption are able to germinate and complete DNA replication. However, they show a highly disordered mitosis. We also constructed the temperature-sensitive mutant mst1-L344S, which contains the same lesion as a temperature-sensitive budding-yeast mutant. At the restrictive temperature, this strain is also proficient for replication, whether it is shifted asynchronously (Figure 2), released from nitrogen starvation in G1 (supplemental Figure 1), or released from hydroxyurea in S phase (Figure 6). We observed pleiotropic phenotypes, including disordered mitosis, irregular segregation, and a high fraction of cell cycle arrest with septa. Cells arrest within one to two cell cycles with this mixed phenotype.
Our genetic analysis and subsequent two-hybrid screen suggest that Mst1 impacts three pathways (Table 4): damage response, which is consistent with the physiological analysis of the mst1-L344S mutant and data from other systems; centromere function; and control of mitotic entry.
|
Even at permissive temperatures, mst1-L344S cells are sensitive to a variety of agents that disrupt the cell cycle, including bleomycin and MMS, which cause DNA damage and double-strand breaks; hydroxyurea, which causes replication fork arrest; and thiabendazole, which causes spindle depolarization. The damage sensitivity was expected because data from numerous sources link members of this family to the double-strand break response. The recruitment of KAT5 orthologs to double-strand breaks is thought to modulate the break response and perhaps downregulate the signal associated with H2AX phosphorylation by recruiting the remodelers INO80 and SWR1 and the alternative histone H2AZ (MORRISON et al. 2004; TSUKUDA et al. 2005; VAN ATTIKUM and GASSER 2005b; PAPAMICHOS-CHRONAKIS et al. 2006).
When mst1-L344S is combined with the mutations
rhp51 (Rad51),
rad50, or
rad22, cells have a severe synthetic growth phenotype in which they grow more poorly than either parent. This is particularly apparent in
rad22 mst1-L344S; however, because
rad22 alone is prone to accumulate suppressors in the fbh1+ gene (OSMAN et al. 2005), we cannot be sure that our double mutant is not also carrying a suppressor. It is possible that
rad22 mst1-L344S will be synthetically lethal but we have not been able to test this convincingly. These genetic data suggest that mst1-L344S requires a functional recombination pathway for viability. To assess whether mst1-L344S causes damage itself, we examined focus formation of Rad22YFP in mst1-L344S cells. There is an increase in foci in mst1 compared to wild type at 32°, even in the absence of any damaging treatment (Figure 6F). This suggests that attenuation of Mst1 function results in some form of damage that requires Rad22 for repair, but also suggests that Rad22-YFP can be recruited to sites of damage in the absence of Mst1.
We observed a physical association between Mst1 and Rad22 in two-hybrid analysis and in co-immunoprecipitation. This interaction is specific to Rad22, as neither the Rad22 homolog Rti1 nor the Rad51 homolog Rhp51 associate with Mst1 in two-hybrid tests (Figure 4). This could reflect a role in recruitment. Another possibility is that Mst1 acetylates Rad22 itself, as Tip60 does to ATM or p53, to modulate its behavior, and we will investigate this in the future.
Unexpectedly, mst1-L344S cells are also sensitive to hydroxyurea, which causes replication fork arrest. The mutant cells arrest properly with a 1C content without Rad22-YFP foci and appear to complete S phase following release, indicating that the checkpoint functions and the replication fork are intact; instead, they have modestly reduced viability reminiscent of
rhp51 or
rad22 mutants (MEISTER et al. 2005; BAILIS et al. 2008). We observe that HU sensitivity of mst1-L344S to HU differs if cells are exposed to low levels over a prolonged time, which causes cell death (chronic exposure, shown in Figure 5), or whether they are exposed to higher levels over a single generation (acute exposure, shown in Figure 6). Similar results have been observed for the fork protection mutant
swi1 (ScTof1), which survives acute exposure but dies during chronic exposure (SOMMARIVA et al. 2005). It is also possible that this HU sensitivity is related to the interaction between mst1 and mutations in recombination genes; however, Rad22-YFP recruitment appears largely normal in mst1 cells treated with HU.
A second broad functional area defined by our two-hybrid and genetic interactions is centromere assembly. Fission yeast centromeres are large and complex elements, with a central core surrounded by flanking repeats that form peri-centromeric heterochromatin (reviewed in EKWALL 2007; GREWAL and JIA 2007). Mutations disrupting the heterochromatin, the central core, or the kinetochore typically show sensitivity to spindle poisons such as TBZ, and a high fraction of chromosome loss and disordered mitoses, as we observed (Figures 1, 2, and 5). Our genetic analysis suggests that mutations that disrupt normal pericentromeric heterochromatin function such as
clr3 (histone deacetylase),
clr4 (methyltransferase), or
swi6 (heterochromatin protein 1) reduce the growth temperature of mst1-L344S quite substantially. The simplest interpretation of this epistasis experiment is that mst1+ affects a separate pathway from Clr4 and Swi6 in centromere function, leading to a synthetic effect in the double mutant. We see no loss of silencing at centromeres or telomeres in a mst1 mutant, which suggests that Swi6-formed heterochromatin is largely intact, and some other aspect of centromere assembly and function is disrupted. A good candidate is the central core. Three of the proteins that we identified in the two-hybrid tests are linked to central core and kinetochore function:
- We isolated Msc1, which was first identified as a high-copy suppressor of a strain lacking the checkpoint kinase Chk1 (AHMED et al. 2004). A recent study shows that overexpression of Msc1 rescues mutations of cnp1 (the specialized H3-Cen/CenpA of the centromere central core) in addition to
chk1 and that this suppression requires the H2AZ histone variant encoded by pht1+ (AHMED et al. 2007). H2AZ is linked to heterochromatin assembly and centromere function (reviewed in GUILLEMETTE and GAUDREAU 2006) and H2AZ is a known substrate of KAT5 family HATs (BABIARZ et al. 2006; KEOGH et al. 2006; MILLAR et al. 2006; AUGER et al. 2008).
- We isolated Cbh1, which is one of the three CenpB homologs in fission yeast (BAUM and CLARKE 2000; NAKAGAWA et al. 2002). The CenpB homologs are proposed to affect centromere structure (NAKAGAWA et al. 2002) and, in metazoans, CenpB is involved in recruitment of H3-Cen/CenpA (reviewed in MELLONE and ALLSHIRE 2003).
- We isolated Hip1, the HIRA/Hir1 homolog. HIR proteins are histone chaperones required for assembly of chromatin outside of S phase (reviewed in GUNJAN et al. 2005). In fission yeast, deletion of Hip1 causes chromosome loss, TBZ sensitivity, and disruption of centromere silencing (BLACKWELL et al. 2004).
HIR proteins in S. cerevisiae are implicated in normal kinetochore function (SHARP et al. 2002). In contrast to the heterochromatin mutants, we see no synthetic growth phenotypes when mst1 is combined with mutants
cbh1,
msc1, or
hip1. This would be consistent with mst1+ acting in a pathway with these genes. Together with the segregation defects of mst1-L344S, these two hybrid interactions suggest that Mst1 may affect the centromere central core. We are examining mitotic phenotypes of mst1 in more detail to determine how this may occur and the role of H2AZ in this process.
There is indirect evidence that Mst1 may affect mitotic entry. We isolated the Skb1 methyltransferase in our two-hybrid screen. Budding yeast Hsl7, the ortholog of Skb1, was identified because mutations of hsl7 are synthetically lethal with histone tail mutants (MA et al. 1996); genetic interactions between Sc
hsl7 and ScEsa1 suggest that histone tail modifications are important for normal mitosis when Swe1 kinase is activated (RUAULT and PILLUS 2006). While we observed no genetic interaction between Sp
skb1 and our temperature-sensitive allele of mst1, the physical interaction that we observed, together with the genetic data from budding yeast, suggests that there is a role for histone tail modification in the proper regulation of mitotic entry in both species. Another link to CDK activation is provided by our isolation of Hip1 as a putative interactor. The
hip1 mutation is synthetically lethality with cdc25-22, which is a temperature-sensitive mutation in the mitotic inducer Cdc25 that opposes Wee1 (ScSwe1) (BLACKWELL et al. 2004; reviewed in KARLSSON-ROSENTHAL and MILLAR 2006).
We did not isolate any of the NuA4 complex proteins in our two-hybrid screen, although the previously characterized SpAlp5/ScArp4 is known to interact with Mst1 by co-immunoprecipitation (MINODA et al. 2005). This is not surprising as the two-hybrid screen identifies binary associations, and many of the interactions in the large NuA4 complex are likely to be indirect (AUGER et al. 2008). We speculate that the structure of the two-hybrid bait construct, in which the amino-terminus of Mst1 is fused to the DNA-binding domain of Gal4, may interfere with the assembly of NuA4 subunits with Mst1. Conversely, we did not observe co-immunoprecipitation of epitope-tagged Mst1 with most of the two-hybrid clones. This could reflect chromatin association of the proteins involved, temporally or spatially limiting association, or could indicate that the C-terminal epitope tag on Mst1 is not available when the protein is in a complex with other factors. A more detailed structure–function analysis and localization studies are in progress to resolve these observations.
The interactions that we observed, in addition to the phenotypes associated with the mst1 mutants, suggest that Mst1 affects a variety of cell functions. Importantly, the recent discovery that Tip60 can acetylate nonhistone proteins in the absence of the NuA4 complex (e.g., SUN et al. 2005; SYKES et al. 2006; TANG et al. 2006; KIM et al. 2007) indicates that the identification of Mst1 as a histone acetyltransferase may be too limiting a definition. We speculate that the pleiotropic effects of mst1 mutants indicate a variety of functions that may be directly modulated by Mst1 catalytic activity, not necessarily linked to histone acetylation. Our study suggests that Mst1 may have functions in replication fork stability and in centromere assembly, and experiments are underway to determine whether these effects are mediated by histone modifications or by other aspects of Mst1 function.
AHMED, S., C. PALERMO, S. WAN and N. C. WALWORTH, 2004 A novel protein with similarities to Rb binding protein 2 compensates for loss of Chk1 function and affects histone modification in fission yeast. Mol. Cell. Biol. 24: 3660–3669.
AHMED, S., B. E. DUL, X. QIU and N. C. WALWORTH, 2007 Msc1 acts through histone H2A.Z to promote chromosome stability in Schizosaccharomyces pombe. Genetics 177: 1487–1497.
ALLARD, S., R. T. UTLEY, J. SAVARD, A. CLARKE, P. GRANT et al., 1999 NuA4, an essential transcription adaptor/histone H4 acetyltransferase complex containing Esa1p and the ATM-related cofactor Tra1p. EMBO J. 18: 5108–5119.[CrossRef][Medline]
ALLIS, C. D., S. L. BERGER, J. COTE, S. DENT, T. JENUWIEN et al., 2007 New nomenclature for chromatin modifying enzymes. Cell 131: 633–636.[CrossRef][Medline]
AUGER, A., L. GALARNEAU, M. ALTAF, A. NOURANI, Y. DOYON et al., 2008 Eaf1 is the platform for NuA4 molecular assembly that evolutionarily links chromatin acetylation to ATP-dependent exchange of histone H2A variants. Mol. Cell. Biol. 28: 2257–2270.
BABIARZ, J. E., J. E. HALLEY and J. RINE, 2006 Telomeric heterochromatin boundaries require NuA4-dependent acetylation of histone variant H2A.Z in Saccharomyces cerevisiae. Genes Dev. 20: 700–710.
BAILIS, J. M., D. D. LUCHE, T. HUNTER and S. L. FORSBURG, 2008 MCM proteins interact with checkpoint and recombination proteins to promote S phase genome stability. Mol. Cell. Biol. 28: 1724–1738.
BAUM, M., and L. CLARKE, 2000 Fission yeast homologs of human CENP-B have redundant functions affecting cell growth and chromosome segregation. Mol. Cell. Biol. 20: 2852–2864.
BIRD, A. W., D. Y. YU, M. G. PRAY-GRANT, Q. QIU, K. E. HARMON et al., 2002 Acetylation of histone H4 by Esa1 is required for DNA double-strand break repair. Nature 419: 411–415.[CrossRef][Medline]
BLACKWELL, C., K. A. MARTIN, A. GREENALL, A. PIDOUX, R. C. ALLSHIRE et al., 2004 The Schizosaccharomyces pombe HIRA-like protein Hip1 is required for the periodic expression of histone genes and contributes to the function of complex centromeres. Mol. Cell. Biol. 24: 4309–4320.
BOUDREAULT, A. A., D. CRONIER, W. SELLECK, N. LACOSTE, R. T. UTLEY et al., 2003 Yeast enhancer of polycomb defines global Esa1-dependent acetylation of chromatin. Genes Dev. 17: 1415–1428.
BRANZEI, D., and M. FOIANI, 2007 Interplay of replication checkpoints and repair proteins at stalled replication forks. DNA Rep. 6: 994–1003.[CrossRef]
BURKE, T. W., J. COOKS-GOWEN, M. ASANO and J. R. NEVINS, 2001 Replication factors MCM2 and ORC1 interact with the histone acetyltransferase HBO1. J. Biol. Chem. 276: 15397–15408.
CASPARI, T., J. M. MURRAY and A. M. CARR, 2002 Cdc2-cyclin B kinase activity links Crb2 amd Rqh1-topoisomerase III. Genes Dev. 16: 1195–1208.
CATLETT, M. G., and S. L. FORSBURG, 2003 Schizosaccharomyces pombe Rdh54 (TID1) acts with Rhp54 (RAD54) to repair meiotic double-strand breaks. Mol. Biol. Cell 14: 4707–4720.
CLARKE, A. S., J. E. LOWELL, S. J. JACOBSON and L. PILLUS, 1999 Esa1p is an essential histone acetyltransferase required for cell cycle progression. Mol. Cell. Biol. 19: 2515–2526.
CLARKE, A. S., E. SAMAL and L. PILLUS, 2006 Distinct roles for the essential MYST family HAT Esa1p in transcriptional silencing. Mol. Biol. Cell 17: 1744–1757.
DECKERT, J., and K. STRUHL, 2001 Histone acetylation at promoters is differentially affected by specific activators and repressors. Mol. Cell. Biol. 21: 2726–2735.
DE LA CRUZ, X., S. LOIS, S. SANCHEZ-MOLINA and M. A. MARTINEZ-BALBAS, 2005 Do protein motifs read the histone code? BioEssays 27: 164–175.[CrossRef][Medline]
DOWNS, J. A., S. ALLARD, O. JOBIN-ROBITAILLE, A. JAVAHERI, A. AUGER et al., 2004 Binding of chromatin-modifying activities to phosphorylated histone H2A at DNA damage sites. Mol. Cell 16: 979–990.[CrossRef][Medline]
DU, L. L., T. M. NAKAMURA, B. A. MOSER and P. RUSSELL, 2003 Retention but not recruitment of Crb2 at double-strand breaks requires Rad1 and Rad3 complexes. Mol. Cell. Biol. 23: 6150–6158.
DUL, B. E., and N. C. WALWORTH, 2007 The plant homeodomain fingers of fission yeast Msc1 exhibit E3 ubiquitin ligase activity. J. Biol. Chem. 282: 18397–18406.
DURANT, M., and B. F. PUGH, 2006 Genome-wide relationships between TAF1 and histone acetyltransferases in Saccharomyces cerevisiae. Mol. Cell. Biol. 26: 2791–2802.
EARLY, A., L. S. DRURY and J. F. DIFFLEY, 2004 Mechanisms involved in regulating DNA replication origins during the cell cycle and in response to DNA damage. Philos. Trans. R. Soc. Lond. B Biol. Sci. 359: 31–38.
EBERHARTER, A., R. FERREIRA and P. BECKER, 2005 Dynamic chromatin: concerted nucleosome remodelling and acetylation. Biol. Chem. 386: 745–751.[CrossRef][Medline]
EKWALL, K., 2007 Epigenetic control of centromere behavior. Annu. Rev. Genet. 41: 63–81.[CrossRef][Medline]
FORSBURG, S. L., and N. RHIND, 2006 Basic methods for fission yeast. Yeast 23: 173–183.[CrossRef][Medline]
FOSTER, E. R., and J. A. DOWNS, 2005 Histone H2A phosphorylation in DNA double-strand break repair. FEBS J. 272: 3231–3240.[CrossRef][Medline]
FUJITA, A., A. TONOUCHI, T. HIROKO, F. INOSE, T. NAGASHIMA et al., 1999 Hsl7p, a negative regulator of Ste20p protein kinase in the Saccharomyces cerevisiae filamentous growth-signaling pathway. Proc. Natl. Acad. Sci. USA 96: 8522–8527.
GALARNEAU, L., A. NOURANI, A. A. BOUDREAULT, Y. ZHANG, L. HELIOT et al., 2000 Multiple links between the NuA4 histone acetyltransferase complex and epigenetic control of transcription. Mol. Cell 5: 927–937.[CrossRef][Medline]
GILBRETH, M., P. YANG, D. WANG, J. FROST, A. POLVERINO et al., 1996 The highly conserved skb1 gene encodes a protein that interacts with Shk1, a fission yeast Ste20/PAK homolog. Proc. Natl. Acad. Sci. USA 93: 13802–13807.
GLYNN, J. M., R. J. LUSTIG, A. BERLIN and F. CHANG, 2001 Role of bud6p and tea1p in the interaction between actin and microtubules for the establishment of cell polarity in fission yeast. Curr. Biol. 11: 836–845.[CrossRef][Medline]
GÓMEZ, E. G., and S. L. FORSBURG, 2003 Analysis of Schizosaccharomyces pombe cell cycle, pp. 93–111 in Cell Cycle Checkpoint Protocols, edited by H. G. LIEBERMAN. Humana Press, Tatawa, NJ.
GÓMEZ, E. G., M. G. CATLETT and S. L. FORSBURG, 2002 Different phenotypes in vivo are associated with ATPase motif mutations in Schizosaccharomyces pombe minichromosome maintenance proteins. Genetics 160: 1305–1318.
GÓMEZ, E. B., J. ESPINOSA and S. L. FORSBURG, 2005 S. pombe mst2+ encodes a MYST-family histone acetyltransferase required for telomere silencing. Mol. Cell. Biol. 25: 8887–8903.
GREWAL, S. I., and S. JIA, 2007 Heterochromatin revisited. Nat. Rev. Genet. 8: 35–46.[CrossRef][Medline]
GUILLEMETTE, B., and L. GAUDREAU, 2006 Reuniting the contrasting functions of H2A.Z. Biochem. Cell Biol. 84: 528–535.[CrossRef][Medline]
GUNJAN, A., J. PAIK and A. VERREAULT, 2005 Regulation of histone synthesis and nucleosome assembly. Biochimie 87: 625–635.[Medline]
IIZUKA, M., and B. STILLMAN, 1999 Histone acetyltransferase HBO1 interacts with the ORC1 subunit of the human initiator protein. J. Biol. Chem. 274: 23027–23034.
IIZUKA, M., T. MATSUI, H. TAKISAWA and M. M. SMITH, 2006 Regulation of replication licensing by acetyltransferase Hbo1. Mol. Cell. Biol. 26: 1098–1108.
IKURA, T., V. V. OGRYZKO, M. GRIGORIEV, R. GROISMAN, J. WANG et al., 2000 Involvement of the TIP60 histone acetylase complex in DNA repair and apoptosis. Cell 102: 463–473.[CrossRef][Medline]
JENUWEIN, T., and C. D. ALLIS, 2001 Translating the histone code. Science 293: 1074–1080.
JIANG, X., Y. SUN, S. CHEN, K. ROY and B. D. PRICE, 2006 The FATC domains of PIKK proteins are functionally equivalent and participate in the Tip60-dependent activation of DNA-PKcs and ATM. J. Biol. Chem. 281: 15741–15746.
KARLSSON-ROSENTHAL, C., and J. B. MILLAR, 2006 Cdc25: mechanisms of checkpoint inhibition and recovery. Trends Cell Biol. 16: 285–292.[CrossRef][Medline]
KEOGH, M. C., T. A. MENNELLA, C. SAWA, S. BERTHELET, N. J. KROGAN et al., 2006 The Saccharomyces cerevisiae histone H2A variant Htz1 is acetylated by NuA4. Genes Dev. 20: 660–665.
KIM, M. Y., E. J. ANN, J. Y. KIM, J. S. MO, J. H. PARK et al., 2007 Tip60 histone acetyltransferase acts as a negative regulator of Notch1 signaling by means of acetylation. Mol. Cell. Biol. 27: 6506–6519.
KOUZARIDES, T., 2007 Chromatin modifications and their function. Cell 128: 693–705.[CrossRef][Medline]
LAFON, A., C. S. CHANG, E. M. SCOTT, S. J. JACOBSON and L. PILLUS, 2007 MYST opportunities for growth control: yeast genes illuminate human cancer gene functions. Oncogene 26: 5373–5384.[CrossRef][Medline]
LEE, J. H., J. R. COOK, B. P. POLLACK, T. G. KINZY, D. NORRIS et al., 2000 Hsl7p, the yeast homologue of human JBP1, is a protein methyltransferase. Biochem. Biophys. Res. Commun. 274: 105–111.[CrossRef][Medline]
LEE, K. K., and J. L. WORKMAN, 2007 Histone acetyltransferase complexes: one size doesn't fit all. Nat. Rev. Mol. Cell Biol. 8: 284–295.[CrossRef][Medline]
LE MASSON, I., D. Y. YU, K. JENSEN, A. CHEVALIER, R. COURBEYRETTE et al., 2003 Yaf9, a novel NuA4 histone acetyltransferase subunit, is required for the cellular response to spindle stress in yeast. Mol. Cell. Biol. 23: 6086–6102.
LEVERSON, J. D., H. K. HUANG, S. L. FORSBURG and T. HUNTER, 2002 The Schizosaccharomyces pombe aurora-related kinase Ark1 interacts with the inner centromere protein Pic1 and mediates chromosome segregation and cytokinesis. Mol. Biol. Cell 13: 1132–1143.
MA, X. J., Q. LU and M. GRUNSTEIN, 1996 A search for proteins that interact genetically with histone H3 and H4 amino termini uncovers novel regulators of the Swe1 kinase in Saccharomyces cerevisiae. Genes Dev. 10: 1327–1340.
MEISTER, P., A. TADDEI, L. VERNIS, M. POIDEVIN, S. M. GASSER et al., 2005 Temporal separation of replication and recombination requires the intra-S checkpoint. J. Cell Biol. 168: 537–544.
MELLONE, B. G., and R. C. ALLSHIRE, 2003 Stretching it: putting the CEN(P-A) in centromere. Curr. Opin. Genet. Dev. 13: 191–198.[CrossRef][Medline]
MILLAR, C. B., and M. GRUNSTEIN, 2006 Genome-wide patterns of histone modifications in yeast. Nat. Rev. Mol. Cell Biol. 7: 657–666.[CrossRef][Medline]
MILLAR, C. B., F. XU, K. ZHANG and M. GRUNSTEIN, 2006 Acetylation of H2AZ Lys 14 is associated with genome-wide gene activity in yeast. Genes Dev. 20: 711–722.
MINODA, A., S. SAITOH, K. TAKAHASHI and T. TODA, 2005 BAF53/Arp4 homolog Alp5 in fission yeast is required for histone H4 acetylation, kinetochore-spindle attachment, and gene silencing at centromere. Mol. Biol. Cell 16: 316–327.
MIYAMOTO, M., K. TANAKA and H. OKAYAMA, 1994 res2+, a new member of the cdc10+/SWI4 family, controls the start of mitotic and meiotic cycles in fission yeast. EMBO J. 13: 1873–1880.[Medline]
MORENO, S., A. KLAR and P. NURSE, 1991 Molecular genetic analysis of the fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194: 795–823.[Medline]
MORRISON, A. J., and X. SHEN, 2005 DNA repair in the context of chromatin. Cell Cycle 4: 568–571.[Medline]
MORRISON, A. J., J. HIGHLAND, N. J. KROGAN, A. ARBEL-EDEN, J. F. GREENBLATT et al., 2004 INO80 and gamma-H2AX interaction links ATP-dependent chromatin remodeling to DNA damage repair. Cell 119: 767–775.[CrossRef][Medline]
NAKAGAWA, H., J. K. LEE, J. HURWITZ, R. C. ALLSHIRE, J. NAKAYAMA et al., 2002 Fission yeast CENP-B homologs nucleate centromeric heterochromatin by promoting heterochromatin-specific histone tail modifications. Genes Dev. 16: 1766–1778.
OSMAN, F., J. DIXON, A. R. BARR and M. C. WHITBY, 2005 The F-Box DNA helicase Fbh1 prevents Rhp51-dependent recombination without mediator proteins. Mol. Cell. Biol. 25: 8084–8096.
OSTERMANN, K., A. LORENTZ and H. SCHMIDT, 1993 The fission yeast rad22 gene, having a function in mating-type switching and repair of DNA damages, encodes a protein homolog to rad52 of Saccharomyces cerevisiae. Nucleic Acids Res. 21: 5940–5944.
PANKRATZ, D. G., and S. L. FORSBURG, 2005 Meiotic S-phase damage activates recombination without checkpoint arrest. Mol. Biol. Cell 16: 1651–1660.
PAPAMICHOS-CHRONAKIS, M., J. E. KREBS and C. L. PETERSON, 2006 Interplay between Ino80 and Swr1 chromatin remodeling enzymes regulates cell cycle checkpoint adaptation in response to DNA damage. Genes Dev. 20: 2437–2449.
ROBERT, F., S. HARDY, Z. NAGY, C. BALDEYRON, R. MURR et al., 2006 The transcriptional histone acetyltransferase cofactor TRRAP associates with the MRN repair complex and plays a role in DNA double-strand break repair. Mol. Cell. Biol. 26: 402–412.
RUAULT, M., and L. PILLUS, 2006 Chromatin-modifiying enzymes are essential when the Saccharomyces cerevisiae morphogenesis checkpoint is constitutively activated. Genetics 174: 1135–1149.
SELLECK, W., I. FORTIN, D. SERMWITTAYAWONG, J. COTE and S. TAN, 2005 The Saccharomyces cerevisiae Piccolo NuA4 histone acetyltransferase complex requires the Enhancer of Polycomb A domain and chromodomain to acetylate nucleosomes. Mol. Cell. Biol. 25: 5535–5542.
SHARP, J. A., A. A. FRANCO, M. A. OSLEY and P. D. KAUFMAN, 2002 Chromatin assembly factor I and Hir proteins contribute to building functional kinetochores in S. cerevisiae. Genes Dev. 16: 85–100.
SHERMAN, D. A., S. G. PASION and S. L. FORSBURG, 1998 Multiple domains of fission yeast Cdc19p (MCM2) are required for its association with the core MCM complex. Mol. Biol. Cell 9: 1833–1845.
SHOGREN-KNAAK, M., H. ISHII, J. M. SUN, M. J. PAZIN, J. R. DAVIE et al., 2006 Histone H4–K16 acetylation controls chromatin structure and protein interactions. Science 311: 844–847.
SHULEWITZ, M. J., C. J. INOUYE and J. THORNER, 1999 Hsl7 localizes to a septin ring and serves as an adapter in a regulatory pathway that relieves tyrosine phosphorylation of Cdc28 protein kinase in Saccharomyces cerevisiae. Mol. Cell. Biol. 19: 7123–7137.
SMITH, E. R., A. EISEN, W. GU, M. SATTAH, A. PANNUTI et al., 1998 ESA1 is a histone acetyltransferase that is essential for growth in yeast. Proc. Natl. Acad. Sci. USA 95: 3561–3565.
SOMMARIVA, E., T. K. PELLNY, N. KARAHAN, S. KUMAR, J. A. HUBERMAN et al., 2005 Schizosaccharomyces pombe Swi1, Swi3, and Hsk1 are components of a novel S-phase response pathway to alkylation damage. Mol. Cell. Biol. 25: 2770–2784.
SQUATRITO, M., C. GORRINI and B. AMATI, 2006 Tip60 in DNA damage response and growth control: many tricks in one HAT. Trends Cell Biol. 16: 433–442.[CrossRef][Medline]
SUN, Y., X. JIANG, S. CHEN, N. FERNANDES and B. D. PRICE, 2005 A role for the Tip60 histone acetyltransferase in the acetylation and activation of ATM. Proc. Natl. Acad. Sci. USA 102: 13182–13187.
SYKES, S. M., H. S. MELLERT, M. A. HOLBERT, K. LI, R. MARMORSTEIN et al., 2006 Acetylation of the p53 DNA-binding domain regulates apoptosis induction. Mol. Cell 24: 841–851.[CrossRef][Medline]
TAMBURINI, B. A., and J. K. TYLER, 2005 Localized histone acetylation and deacetylation triggered by the homologous recombination pathway of double-strand DNA repair. Mol. Cell. Biol. 25: 4903–4913.
TANAKA, K., K. OKAZAKI, N. OKAZAKI, T. UEDA, A. SUGIYAMA et al., 1992 A new cdc gene required for S phase entry of Schizosaccharomyces pombe encodes a protein similar to the cdc10+ and SWI4 gene products. EMBO J. 11: 4923–4932.[Medline]
TANG, Y., J. LUO, W. ZHANG and W. GU, 2006 Tip60-dependent acetylation of p53 modulates the decision between cell-cycle arrest and apoptosis. Mol. Cell 24: 827–839.[CrossRef][Medline]
TSUKUDA, T., A. B. FLEMING, J. A. NICKOLOFF and M. A. OSLEY, 2005 Chromatin remodelling at a DNA double-strand break site in Saccharomyces cerevisiae. Nature 438: 379–383.[CrossRef][Medline]
UENO, M., R. KUROKAWA, H. RENAULD, K. WATANABE, T. USHIMARU et al., 2001 Schizosaccharomyces pombe taf1+ is required for nitrogen starvation-induced sexual development and for entering the dormant GO state. Curr. Genet. 38: 307–313.[CrossRef][Medline]
UTLEY, R. T., and J. COTE, 2003 The MYST family of histone acetyltransferases. Curr. Top. Microbiol. Immunol. 274: 203–236.[Medline]
VAN ATTIKUM, H., and S. M. GASSER, 2005a ATP-dependent chromatin remodeling and DNA double-strand break repair. Cell Cycle 4: 1011–1014.[Medline]
VAN ATTIKUM, H., and S. M. GASSER, 2005b The histone code at DNA breaks: A guide to repair? Nat. Rev. Mol. Cell Biol. 6: 757–765.[CrossRef][Medline]
VOGELAUER, M., L. RUBBI, I. LUCAS, B. J. BREWER and M. GRUNSTEIN, 2002 Histone acetylation regulates the time of replication origin firing. Mol. Cell 10: 1223–1233.[CrossRef][Medline]
YU, Y., Y. TENG, H. LIU, S. H. REED and R. WATERS, 2005 UV irradiation stimulates histone acetylation and chromatin remodeling at a repressed yeast locus. Proc. Natl. Acad. Sci. USA 102: 8650–8655.
ZHU, Y., T. TAKEDA, K. NASMYTH and N. JONES, 1994 pct1+, which encodes a new DNA-binding partner of p85cdc10, is required for meiosis in the fission yeast Schizosaccharomyces pombe. Genes Dev. 8: 885–898.
Communicating editor: E. JONES
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Data Supplement
-
All Versions of this Article:
genetics.107.085779v1
179/2/757 most recent - Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Gómez, E. B.
- Articles by Forsburg, S. L.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Gómez, E. B.
- Articles by Forsburg, S. L.





