Genetics, Vol. 179, 441-453, May 2008, Copyright © 2008
doi:10.1534/genetics.107.084988

The Drosophila Gap Gene giant Has an Anterior Segment Identity Function Mediated Through disconnected and teashirt

Department of Genetics, North Carolina State University, Raleigh, North Carolina 27695

3 Corresponding author: Department of Genetics, Campus Box 7614, North Carolina State University, Raleigh, NC 27695-7614.
E-mail: jim_mahaffey{at}ncsu.edu

Manuscript received November 26, 2007. Accepted for publication March 10, 2008.

ABSTRACT

The C2H2 zinc-finger-containing transcription factors encoded by the disconnected (disco) and teashirt (tsh) genes contribute to the regionalization of the Drosophila embryo by establishing fields in which specific Homeotic complex (Hom-C) proteins can function. In Drosophila embryos, disco and the paralogous disco-related (disco-r) are expressed throughout most of the epidermis of the head segments, but only in small patches in the trunk segments. Conversely, tsh is expressed extensively in the trunk segments, with little or no accumulation in the head segments. Little is known about the regulation of these genes; for example, what limits their expression to these domains? Here, we report the regulatory effects of gap genes on the spatial expression of disco, disco-r, and tsh during Drosophila embryogenesis. The data shed new light on how mutations in giant (gt) affect patterning within the anterior gt domain, demonstrating homeotic function in this domain. However, the homeosis does not occur through altered expression of the Hom-C genes but through changes in the regulation of disco and tsh.


THE redundant, paralogous genes disconnected (disco) and disco-related (disco-r), referred to together as the disco genes below, and teashirt (tsh) are differentially expressed in the embryonic head and trunk segments and are therefore markers for head and trunk segment types. In the head segments the disco genes are required for the proper development of the larval mouthpart structures (MAHAFFEY et al. 2001; ROBERTSON et al. 2004), while in the trunk segments, these genes are necessary for development of the Keilin's organs, small thoracic sensory structures and some peripheral neurons (ROBERTSON et al. 2004; PATEL et al. 2007). By contrast, tsh is necessary for proper development of most of the ventral trunk epidermis (FASANO et al. 1991; RÖDER et al. 1992; DE ZULUETA et al. 1994). Both the disco genes and tsh are also members of the proximal–distal patterning network (ERKNER et al. 1999; WU and COHEN 2000; AZPIAZU and MORATA 2002; PATEL et al. 2007). The disco and tsh genes encode C2H2 zinc-finger transcription factors that are expressed early in embryonic development with precise, nearly reciprocal expression patterns in the trunk and head segments, but not much is known as to how these patterns are established. What is known is that ectopically expressing tsh in the head segments converts the expression of the disco genes to a trunk-like pattern. The Spalt major (Salm) protein represses tsh expression in the posterior labial segment (KUHNLEIN et al. 1997), but otherwise little is known regarding the regulation of disco and tsh—in particular, what factors distinguish the head and trunk modes of expression. The gap genes are logical candidates for this role.

Patterning the Drosophila embryo involves initial establishment of the axes, regionalization of the embryo, definition of the segments and their polarity, and the specification of unique identities to each segment. The early acting components of this genetic cascade include both maternally and zygotically expressed genes that set in motion the segmentation and segment identity processes. The gap genes are among the earliest zygotic factors involved in these processes. Regulated by maternal morphogens in the blastoderm, and by one another, these genes act via overlapping gradients to divide the embryo into broad regions and to regulate the expression of downstream segmentation genes (see reviews in ST. JOHNSTON and NUSSLEIN-VOLHARD 1992; PANKRATZ and JACKLE 1993; RIVERA-POMAR and JACKLE 1996; NIESSING et al. 1997; SANSON 2001).

Comparative studies in other insects have revealed significant conservation in the function of many segmentation genes (see reviews in FRENCH 2001; DAVIS and PATEL 2002; HUGHES and KAUFMAN 2002), but less clear is the functional conservation of the gap genes between insect species. Two studies—one in Tribolium castaneum, examining a giant (gt) homolog (Tc'giant) (BUCHER and KLINGLER 2004), and one in Oncopeltus fasciatus, examining a hunchback (hb) homolog (Of'hb) (LIU and KAUFMAN 2004)—conclude that the function of these gap genes is one of segmentation and segment identity, differing somewhat from the segmentation function characterized in Drosophila. The authors further state that this difference is likely due to the differential patterning of long vs. short germ-band insect embryos. The results presented here indicate that Drosophila gt, in fact, has an embryonic segment identity role similar to that observed in Tc'giant. Surprisingly, this identity function arises not only through changes in homeotic (Hom-C) gene expression, but also from the regulation of disco and tsh. This, in conjunction with other gap genes, defines the position of the embryonic head and trunk segment types.


MATERIALS AND METHODS

Drosophila stocks and culture:

Flies were reared on standard cornmeal–agar–molasses medium. The giantQ242 (gtQ242), giantX11 (gtX11), hunchback12 (hb12), Küppel2 (Kr2), caudal3 (cd3), tailless1 (tll1), huckebein2 (hkb2), salm1, and Antennapedia25 (Antp25) lines were obtained from the Bloomington, Indiana, Drosophila Stock Center, and the tsh8 line from S. Kerridge (CNRS Marseille, France). The double-mutant embryos examined were obtained by crossing gtQ242/FM7c or gtX11/FM7c females to Antp25/TM3, salm1/CyO, or tsh8/CyO males. Virgin female progeny heterozygous for the gt allele and Antp25, salm1, or tsh8 were then crossed to Antp25/TM3, salm1/CyO, or tsh8/CyO males, respectively, to yield the genotypes of interest—gt/y; Antp25/Antp25, gt/y; salm1/salm1, or gt/y; tsh8/tsh8.

Cuticle analysis:

Embryos were collected at 25° and prepared for cuticle examination as previously described (PEDERSON et al. 1996). Females were allowed to lay eggs for up to 24 hr, and embryos were aged for at least 24 hr at 25° before the mounting of unhatched terminal larvae.

In situ localization of mRNA and protein:

Colorimetric localization of mRNA and protein followed the protocols essentially as described in PEDERSON et al. (1996). The antisense digoxigenin-labeled RNA probes for disco and tsh were prepared as previously described (MAHAFFEY et al. 2001; ROBERTSON et al. 2004). Fluorescent in situs were prepared as described in PATEL et al. (2007), and images were acquired using a Zeiss Pascal laser-scanning microscope. For the pb mRNA localization, the probe template was amplified from Drosophila genomic DNA using PCR with the primers ATCGTGTCAAGGCTGCGAA (forward) and TAAGCCCGACATTCATTGGC (reverse).

Identification of mutant embryos and cuticles:

Whole embryos lacking a functional gap gene allele were identified either by the alteration of anti-Invected/Engrailed staining or by aberrant segment morphology. The loss of gt, hb, or Kr in cuticle preparations was evident by denticle belt alterations. Homozygous Antp25 cuticles were identified by the transformation of the T2 and T3 denticle belts toward T1. For the experiments presented in Figure 6, double-mutant embryos were identified by the gt abdominal phenotype and detection of either tsh mRNA or Antp protein as described in the Figure 6 legend.


Figure 6
View larger version (82K):
In this window
In a new window
Download PPT slide
 
FIGURE 6.—

tsh is required for homeosis of the labial segment in gtQ292 mutants. Embryos lacking both a functional gt allele and a functional tsh allele recover significant disco expression in the labial segment (B) when compared to embryos lacking only gt (A). Additionally, the labial segment recovers its normal lobe-like morphology and the dorsal ridge, although enlarged, is well separated from the labial segment (arrow) in the late stage double mutants (also see F). [In B, both disco and tsh mRNAs were detected. Embryos lacking both gt and tsh were identified by the abdominal segment phenotype (gt) and lack of tsh mRNA.] (C) The anterior expansion of tsh mRNA into the gnathal segments of gt mutants does not require Antp. Embryos doubly mutant for gt and Antp retain tsh transcript accumulation in the gnathal segments (D). (Embryos doubly mutant for gt and Antp had the gt abdominal segmentation defects and were not positive for Antp protein.) The reciprocal is also true. Antp protein accumulates in the labial segment of embryos lacking both gt and tsh (F), as it does in embryos lacking only gt (E). (Embryos doubly mutant for gt and tsh had the gt abdominal segmentation defects and were not positive for tsh mRNA protein.) DR, dorsal ridge; Mx, maxillary; Lb, labial; T1, first thoracic segment.

 


RESULTS

disco mRNA distribution is altered in gap mutants:

To explore the regulation of the disco gene during embryogenesis, we examined disco mRNA accumulation in homozygous gap mutant embryos. disco is normally expressed in the clypeolabrum, the optic lobe region, the antennal segment, the gnathal segments (mandibular, maxillary, and labial), the embryonic leg primordia, and transiently in similar positions in the abdominal segments and the proctodeum (Figure 1, A and B; see LEE et al. 1991; MAHAFFEY et al. 2001). Five homozygous gap gene mutants exhibited altered disco mRNA distribution—hunchback (hb), Krüppel (Kr), giant (gt), tailless (tll), and caudal (cad); the results are summarized in Table 1. Of these, hb, Kr, and gt affected the gnathal/thoracic disco expression domains. As noted above, a redundant paralog of disco, disco-r, is present in the Drosophila genome. disco-r mRNA accumulation was examined in hb12, Kr2, gtQ292, and gtX11 mutant embryos. Alterations in disco-r expression mirrored those of disco (data not shown). Because the effects on disco and disco-r mRNA accumulation appeared to be identical, our remaining studies focused on the regulation of disco. We noted that gt mutations had a particularly interesting effect, indicating a central role for gt in disco regulation and possibly head–trunk boundary formation. Therefore, we will concentrate on gt for the rest of our description. Indeed, the effects of hb and Kr could be interpreted through their known cross-regulation of gt (HULSKAMP et al. 1990; ELDON and PIRROTTA 1991; KRAUT and LEVINE 1991a,b; WU et al. 2001).


Figure 1
View larger version (106K):
In this window
In a new window
Download PPT slide
 
FIGURE 1.—

disco and tsh mRNA localization is affected by gt mutations. (A, C, E, G, I, and K) Stage 11 to early stage 12 embryos (CAMPOS-ORTEGA and HARTENSTEIN 1997). (B, D, F, H, J, and L) Late stage 12 or stage 13 embryos. (A and B) In wild-type embryos, disco expression is normally present in the gnathal (mandibular, maxillary, and labial) segments, as well as in the embryonic leg primordia, optic lobe, clypeolabrum, antennal segment, and the proctodeum. (C and D) In hemizygous gtQ292 embryos, the labial domain of disco expression is significantly reduced (white arrows). As the germ band retracts (D), labial expression of disco continues in the dorsomedial portion of the labial lobe in these mutant embryos. (E and F) Hemizygous gtX11 embryos exhibit alterations in disco expression similar to those observed in hemizygous gtQ292 individuals; however, the loss disco expression in the labial segment is more extensive. (G and H) In wild-type embryos, tsh mRNA accumulates in the epidermis of the first thoracic through eighth abdominal segments. (I and J) In gtQ292 mutant embryos, tsh expression expands through the labial segment (white arrows) and often occurs in a stripe at the mandibular/maxillary border (white arrowhead). (K and L) Hemizygous gtX11 embryos exhibit altered tsh mRNA accumulation very similar to that observed in gtQ292 individuals, although the appearance of tsh expression in the anterior maxillary segment occurs more frequently.

 

View this table:
In this window
In a new window

 
TABLE 1

The effects of examined genes on disco mRNA accumulation

 
We examined disco expression in two gt alleles, gtX11 and gtQ292. Both alleles are described as amorphic (PETSCHEK et al. 1987); however, as we discuss below, we suspect that gtQ292 is a strong hypomorphic allele, an important distinction with respect to this study. disco mRNA accumulation was significantly reduced in the labial segments of gtQ292 embryos. In the labial segments of early embryos, disco expression was reduced from encompassing the majority of the epidermis to a small patch in the dorsomedial portion of the lobe (Figure 1, C and D). At later stages, little or no disco mRNA was detected in the labial region (Figure 2, C and D). What remained resembled the thoracic appendage primordia. disco mRNA was also detected in portions of the maxillary segments. Similar effects on disco mRNA accumulation were noted in hemizygous gtX11 embryos (Figure 1, E and F; Figure 2B).


Figure 2
View larger version (66K):
In this window
In a new window
Download PPT slide
 
FIGURE 2.—

Overlap in disco and tsh mRNA accumulation in the labial segment of gt mutant embryos. Embryos were double labeled to detect disco (green) and tsh (red) mRNAs. (A) A wild-type embryo after germ-band contraction (early stage 13). No overlap of disco and tsh was noted in the head region, although there was overlapping expression in the limb primordial of the thorax (arrows). (B) In similar staged gt11 individuals, little overlap was detected, although at earlier stages there was significant overlap in the maxillary region (data not shown). Note the greater width of the first thoracic segment, T1, in the gt mutant. An asterisk marks a remaining bit of the labial segment in this embryo that has not fused with first thoracic. (C) Overlapping expression of disco and tsh in the labial region of an early stage 12 gtQ292 embryo. Note that in later stage gtQ292 embryos (D), tsh mRNA was still present in the transformed labial lobe (T1*), which resembles the limb primordial of the thoracic segments. The arrowhead marks where disco mRNA accumulation resembles that of the normal thoracic segments. Mn, mandibular; Mx, maxillary; Lb, labial; T#, first through third thoracic segments; T1*, transformed labial segment.

 

tsh mRNA distribution is altered in gap mutants:

Earlier work demonstrated that Tsh represses disco expression in the trunk and that ectopic Tsh in the gnathal segments represses and remodels the expression of the disco genes (ROBERTSON et al. 2004). Therefore, we suspected that the alterations in disco and disco-r expression in gt mutants might be mediated through altered tsh expression. To test this, we examined tsh expression in gt embryos and observed that tsh mRNA accumulation was altered in a nearly a reciprocal manner to the changes in disco mRNA distribution.

In mid-stage 11, wild-type embryos, when the gnathal segments are evident, tsh mRNA accumulates in the first thoracic through the eighth abdominal segments (FASANO et al. 1991; RÖDER et al. 1992), and this is maintained throughout remaining embryogenesis (Figure 1, G and H). The change in disco mRNA accumulation in the labial segment of gt mutant embryos was reminiscent of the change in disco caused by the ectopic tsh expression (ROBERTSON et al. 2004). Indeed, we found that tsh mRNA accumulates throughout the labial segment of gt mutants (Figure 1, I–L). Ectopic maxillary expression was observed in some individuals, primarily localized to the anterior edge of the segment. We also noted an affect on the parasegmental modulation of tsh in the trunk.

To further observe the association between disco and tsh expression in gt mutants, we fluorescently labeled probes to detect both mRNAs simultaneously (Figure 2). In the wild-type embryos before (data not shown) and after (Figure 2A) germ-band retraction, there was no colocalization of disco and tsh mRNAs at the labial/first thoracic border. Coexpression was observed in the appendage primordial of the trunk. By contrast, in embryos hemizygous for gt mutations, there was mixed and overlapping disco and tsh expression in the head. This was noted in the labial segment and somewhat in the maxillary (Figure 2, B–D). Overlapping expression in the maxillary was transient, while in gtQ292 embryos coexpression persisted in the aberrant labial segment. This labial expression appeared similar to that in the thoracic appendage primordial (Figure 2D). After germ-band retraction, there was no colocalization in the maxillary region (Figure 2, B and D). As in wild-type embryos, colocalization was observed in the trunk appendage primordial of all gt embryos.

Cuticle phenotype of gt mutants:

disco, together with Sex combs reduced (Scr), directs a labial identity (ROBERTSON et al. 2004), while tsh acts with Scr to properly pattern the first thoracic segment (FASANO et al. 1991; RÖDER et al. 1992; ANDREW et al. 1994; DE ZULUETA et al. 1994; TAGHLI-LAMALLEM et al. 2007). It seemed possible that, in the labial segment of the gtQ292 mutants, loss of disco with concomitant ectopic expression of tsh might cause a transformation of the labial segment to a first thoracic identity. This would imply that at the gnathal/trunk border gt has a segment identity role in addition to a segmentation role. Further supporting this hypothesis was the remodeling of disco expression in the labial segment of gtQ292 mutants to resemble normal thoracic disco expression (Figure 1, C and D, and Figure 2D). Therefore, we next closely reexamined the gt mutant cuticles with particular attention to the gnathal and anterior trunk segments.

Overall, the gross morphology of both gt genotypes was quite similar, and mainly as previously reported (PETSCHEK et al. 1987; PETSCHEK and MAHOWALD 1990). Terminal larval cuticles displayed defects in head involution, giving the embryo a "buttonhead"-type appearance (Figure 3, B and C). However, careful examination of the dorsal cuticle in both genotypes revealed evidence of a homeotic transformation. Ectopic thoracic-like hairs were present anterior to the normal rows of first thoracic dorsal hairs (Figure 3, H and I), which likely originate from the dorsal ridge. The appearance of dorsal hairs in the gnathal region has previously been interpreted to indicate a transformation of these segments toward a thoracic identity (JÜRGENS 1988; DE ZULUETA et al. 1994).


Figure 3
View larger version (112K):
In this window
In a new window
Download PPT slide
 
FIGURE 3.—

Cuticle analysis of hemizygous gt mutant embryos reveals homeosis of the labial segment. Cuticles of wild-type (A, D, and G), gtQ292 (B, E, and H), and gtX11 (C, F, and I) terminal larvae. Hemizygous gt mutant embryos (B and C) display defects in the ventral denticle patterning. The fifth-through-seventh abdominal denticle belts are missing or fused. In some gtQ292 embryos (B), the labial segment is transformed to a first thoracic identity. In D, E, and F, the solid arrows point to the normal anterior first thoracic denticle belt. The solid arrowheads point to the normal posterior first thoracic denticle belt, or "beard." At high magnification, a duplication of the first thoracic denticle belt is evident in occasional gtQ292 individuals (E). Open arrows point to the ectopic anterior first thoracic denticle belt. The open arrowheads point to the ectopic "beard." More commonly, the anterior first thoracic denticle belt is split at the ventral midline as in gtX11 (F). An alteration in the pattern of the dorsal hairs is also evident (H and I), with ectopic patches of hairs (open arrowheads) present anterior to the normal first thoracic segment hairs (solid arrows). mh, mouth hooks; ci, cirri; T#, thoracic segment; A#, abdominal segment; T1', segment resembling first thoracic anterior to the normal first thoracic segment; Lb/T1, fusion of the labial and first thoracic segments.

 
The denticle pattern of the ventral cuticle also provided indications of a transformation. Most gt mutant embryos (both alleles) appear to have a fusion of the labial and thoracic segments with labial tissues developing as first thoracic, yielding an enlarged first thoracic segment. In these, the first thoracic denticle belt appeared to form at the labial/maxillary border (Figure 3F), given its proximity to the maxillary-derived cuticular structures (the cirri and mouth hooks). In some instances, the anterior denticle row of the first thoracic segment was directly adjacent to the maxillary cirri. This denticle belt was frequently "split" at the ventral midline (Figure 3F), which could be a consequence of incomplete fusion between the labial and first thoracic segments (discussed further below). These observations are compatible with the loss of the labial segment, which was previously reported (PETSCHEK et al. 1987; PETSCHEK and MAHOWALD 1990). An additional observation, however, strongly supported a labial/first thoracic fusion and concomitant segment identity change in the labial segment. Some gtQ292 individuals (n = 30 of 138) had obvious homeosis of the labial segment to yield two nearly complete first thoracic segments. In these individuals, the labial and thoracic segments did not fuse, and a complete duplication of the first thoracic denticle belt was present in the transformed labial segment (Figure 3, B and E). We did not observe this unequivocal transformation of the labial segment in any hemizygous gtX11 cuticles examined (n = 115); it was observed only in gtQ292 individuals.

Segment border formation in the two gt mutants:

The differences in the labial/first thoracic fusion between the two gt genotypes prompted us to closely examine Engrailed (En) protein distribution. In wild-type embryos, En accumulates in the posterior of each gnathal and trunk segment (DINARDO et al. 1985) and thus provides a good marker for segmentation and segment morphology. Further, LARSEN et al. (2003) demonstrated the integral role of en-expressing cells in the morphological changes accompanying segment groove formation. It was previously reported that, in homozygous gt mutants, the third (labial) En stripe is severely reduced, and this was interpreted to indicate that the posterior compartment of the labial segment was deleted (PETSCHEK and MAHOWALD 1990). We found that the loss of En staining was primarily in the lateral and ventral portions of the labial segment in both gt mutant genotypes, but there was significant variation as to the extent of the loss. While most gtQ292 embryos displayed nearly complete loss of the lateral and ventral En accumulation (Figure 4H), some embryos maintained significant En protein in the posterior labial segment (Figure 4, E and K). In these individuals, we noted that a portion of the dorsal ridge was fused with the labial segment to form a contiguous segment that appeared thoracic-like. Any portion of this extended labial segment lacking En appeared to fuse with the normal first thoracic segment, but the regions accumulating En protein remained separated (see arrowheads in Figure 4 and compare Figure 4, H and K). gtX11 embryos displayed a consistent and nearly complete loss of En protein in the posterior labial segment (Figure 4, C, F, I, and L), and fusion between the labial and first thoracic segments generally appeared complete. In light of the results from LARSEN et al. (2003) demonstrating the integral role of En in segment border formation, we conclude that the persistent accumulation of En protein in some hemizygous gtQ292 embryos explains the retention of a labial/first thoracic segment border in these individuals. The presence of this segment border likely contributes to the formation of a separate ectopic first thoracic-like denticle belt in the transformed labial segment in some gtQ292 embryos. Thus, the variable loss of labial En expression provides an explanation for the difference in cuticle phenotype between the two gt genotypes that we examined.


Figure 4
View larger version (131K):
In this window
In a new window
Download PPT slide
 
FIGURE 4.—

Varying degrees of labial/first thoracic segment fusion as indicated by {alpha}-Engrailed/Invected staining of gt mutant embryos. In wild-type embryos (A, D, G, and J), En protein accumulates a striped pattern in the posterior compartment of each segment. In gtQ292 embryos (B, E, H, and K), En accumulation is reduced in the labial segment (Lb) and is severely altered in the fifth-through-seventh abdominal segments (not shown), while it appears somewhat expanded in the posterior maxillary segment (Mx). Labial En accumulation is variable in gtQ292 embryos (compare H and K). The amount of En accumulation remaining in the posterior labial segment appears to correspond to the location of and degree of segment border formation between the labial and first thoracic segment. Arrowheads point to the residual segmental grooves between these two segments. The dorsal ridge usually remains visible in these embryos, but is frequently fused, at least in part, to the dorsal labial segment. In gtX11 embryos (C, F, I, and L), the labial En stripe is more consistently and more completely lost. Correspondingly, the fusion between the labial and first thoracic segment is virtually complete. The dorsal ridge is quite reduced or absent in these individuals. DR, dorsal ridge; Mn, mandibular; Mx, maxillary; Lb, labial; T#, first through third thoracic segments.

 

Homeotic gene expression in gt mutant embryos:

The cuticle results and the alterations in disco and tsh expression observed in gt mutant embryos indicated that the labial segment was homeotically transformed toward a first thoracic identity. The differential expression of the Hom-C genes guides unique and specific segment identities in the developing Drosophila embryo (reviewed in ROBERTSON and MAHAFFEY 2005). To further assess the identity of the labial segment in gtQ292 mutant embryos, we examined the protein or mRNA accumulation from four Hom-C genes normally expressed in the gnathal or anterior trunk segments—Dfd, proboscipedia (pb), Scr, and Antennapedia (Antp). We chose to examine only gtQ292 mutant individuals because this allele exhibited a recognizable transformation (on the basis of cuticle phenotype) and suffered less fusion between the labial and first thoracic segments (on the basis of Inv/En staining). Further, the expression of these Hom-C genes was previously reported in gtX11 mutant embryos, but not in gtQ292 (JACK et al. 1988; PETSCHEK and MAHOWALD 1990; REINITZ and LEVINE 1990; RUSCH and KAUFMAN 2000).

The Dfd protein normally accumulates in the mandibular and maxillary segments and in the anterior dorsal ridge (Figure 5A) and is necessary for the proper embryonic development of the cephalopharyngeal structures derived from these regions (MERRILL et al. 1987; REGULSKI et al. 1987). As with previous studies of gtX11 (JACK and MCGINNIS 1990; REINITZ and LEVINE 1990), we observed no change in Dfd staining in gtQ292 (Figure 5B). The retention of Dfd protein accumulation suggests that there was no homeotic transformation of the mandibular segment, maxillary segment, or in the anterior portion of the dorsal ridge.


Figure 5
View larger version (110K):
In this window
In a new window
Download PPT slide
 
FIGURE 5.—

Alterations in Hom-C gene. Expression in gtQ292 mutant embryos indicates a homeotic change in labial identity (A). Dfd protein is detected in the mandibular lobe, the maxillary lobe, and the anterior dorsal ridge in wild-type embryos and is essentially unchanged in gtQ292 embryos (B). No Dfd protein is detectable in the portion of the dorsal ridge that fuses to the labial segment. When compared to wild type (C), pb mRNA accumulation is significantly reduced in the labial segment of gtQ292 embryos (E) Scr protein normally accumulates in the labial lobe and the first thoracic segment in wild-type embryos. In gtQ292 embryos (F), Scr protein accumulates throughout the fused labial/dorsal ridge, such that the pattern of accumulation mimics that observed in the first thoracic segment. The anterior limit of Antp in the wild-type embryo is the posterior half of the first thoracic segment (G), while Antp protein accumulates through much of the labial epidermis in gtQ292 embryos (H). DR, dorsal ridge; Mn, mandibular; Mx, maxillary; Lb, labial; T1, first thoracic segment; T3, third thoracic segment.

 
pb mRNA normally accumulates in the maxillary and labial segments (Figure 5C) (PULTZ et al. 1988). Because tsh was previously described as a negative regulator of pb in the first thoracic segment (RUSCH and KAUFMAN 2000), we expected a reduction in pb mRNA accumulation in gt mutants in response to the anterior expansion of tsh in these individuals. Indeed, in gt Q292 mutant embryos, pb accumulation was slightly reduced in the maxillary segment and significantly reduced in the labial (Figure 5D). The affected region coincided with ectopic tsh expression. pb transcripts were present only in the dorsal posterior portion of the labial/dorsal ridge. Loss of pb from the labial lobe supports a transformation of this segment from a gnathal toward a trunk-like identity.

In wild-type embryos, Scr protein accumulates first throughout the labial segment and then in the anterior first thoracic segment (Figure 5E). Early Scr protein accumulation was reported to be altered in gt mutant embryos (HIROMI et al. 1985; REINITZ and LEVINE 1990). We, however, found no evidence of significantly altered Scr accumulation in gtQ292 embryos. As the germ band extended and the gnathal lobes began to form, Scr protein accumulated throughout the developing labial segment. The only detectable change was a slight decrease in staining intensity in the ventral portion of the segment (data not shown). Yet, as the germ band contracted and the labial segment and dorsal ridge fused to take on a thoracic-like morphology, Scr protein accumulation was concentrated in the anterior portion of the fused labial/dorsal ridge, mimicking the pattern in the adjacent first thoracic segment (Figure 5F). The expansion of Scr protein into the portion of the dorsal ridge that fuses with the labial segment in gtQ292 embryos is consistent with transformation to a first thoracic identity. Occasionally, a persistent lobe-like protrusion was observed in the anterior labial segment of germ-band-retracted embryos, which continued to retain a strong labial-like Scr pattern (data not shown).

The initial accumulation of the Antp protein in wild-type embryos is parasegmental and it quickly resolves to include the posterior first thoracic segment and all of the second and third thoracic ectoderm (CARROLL et al. 1986). When we examined the localization of the Antp in gtQ292 embryos, we observed ectopic Antp accumulation in the labial segment epidermis, as previously described for gtX11 and gtYA82 embryos (PETSCHEK and MAHOWALD 1990; REINITZ and LEVINE 1990; RILEY et al. 1991).

The presence of Antp in the labial segment of gt mutants could be significant for two reasons. First, Antp was previously shown to activate tsh expression in the gnathal segments when ubiquitously expressed (RÖDER et al. 1992). Thus, this ectopic Antp protein might be responsible for the presence of tsh mRNA in the labial segments of gt mutant embryos (discussed further below). Second, the presence of Antp in the labial segment, along with tsh and Scr, supports a transformation of the labial segment toward a first thoracic identity, as this combination of factors is also present in the wild-type first thoracic segment.

tsh is required for the gnathal-to-trunk transformation in gt mutants:

Because tsh is required for proper trunk specification (FASANO et al. 1991; RÖDER et al. 1992; DE ZULUETA et al. 1994), and ectopic Tsh can transform the gnathal segments toward a trunk identity (JÜRGENS 1988; DE ZULUETA et al. 1994; ROBERTSON et al. 2004), we suspected that embryos doubly mutant for gt and tsh might reduce or eliminate the labial-to-first-thoracic transformation. Therefore, we examined cuticles from embryos lacking both tsh and gt and indeed observed no evidence of dorsal or ventral labial-to-thoracic transformation (data not shown). We detected no ectopic thoracic-like hairs in the dorsal cuticle anterior to the first thoracic segment, and no cuticles were found to have fused or partially fused labial/first thoracic denticles or ectopic first thoracic denticles in the ventral cuticle. The interpretation of these results, however, was confounded by the effects of the loss of tsh. Head involution was severely disrupted and there was frequently a hole in the dorsal cuticle anterior to the first thoracic segment, making a definitive assessment of dorsal transformation on the basis of dorsal cuticle patterning difficult. Further, the ventral denticle belts were quite reduced, particularly in the thoracic segments, making clear identification of a labial-to-first-thoracic transformation problematic.

To clarify the effect of removing both tsh and gt, we examined the mRNA accumulation of two gnathal factors that are altered in gt mutants. As described above, disco and pb transcript abundance was quite reduced in the labial segment of gtQ292 mutant embryos (Figure 1D and Figure 5D, respectively), while tsh mRNA spread anteriorly to include the labial segment (Figure 1I; Figure 2, B and D). If ectopic tsh were responsible for the homeotic transformation of the labial segment in gtQ292 mutant embryos, then we might expect some recovery of normal disco and pb expression in gt; tsh double mutants. Indeed, we observed significant recovery of the normal disco expression (Figure 6B). disco transcripts were detected throughout most of the labial segment. The morphology of the labial segment appeared more lobe-like, and the dorsal ridge was fully separated from the labial lobe. disco expression did not fully return to normal, however. The loss of tsh alone results in ectopic disco transcript accumulation in the ventrolateral regions of the thoracic and abdominal segments (ROBERTSON et al. 2004), and this was present in the gtQ292; tsh8 double mutants. Further, ectopic disco transcripts accumulated strongly at the anterior edge of the first thoracic segment, which is not normally observed in tsh mutant embryos. pb mRNA accumulation also recovered much of its normal expression in the labial segment in embryos lacking both gt and tsh (data not shown).

Antp is not required for the ectopic expression of tsh in the gnathal segments of gtQ292 embryos:

Antp is required for high-level expression of tsh in the thoracic epidermis of the Drosophila embryo, and ectopic expression of Antp activates a lacZ reporter element derived from the upstream regulatory region of the tsh gene (RÖDER et al. 1992; MCCORMICK et al. 1995). It seemed possible, therefore, that the ectopic activation of Antp in the labial segment of hemizygous gtQ292 mutant embryos was responsible for the ectopic accumulation of tsh and the corresponding loss of disco. However, it was also possible that gt was affecting tsh directly or through another pathway. To address this, we examined tsh mRNA accumulation in embryos hemizygous for the gtQ292 and homozygous for Antp25 (Figure 6D). tsh expression was significantly reduced in the thoracic segments, as would be expected, but the ectopic expression of tsh in the gnathal segments persisted (arrows in Figure 6D). Thus, the anterior expansion of Antp into the gnathal segments was not required for ectopic activation of tsh and the change in morphology of the labial segment. We note that the reciprocal was also true. Antp protein accumulated in the labial segment of gtQ292/y; tsh8/tsh8 mutant embryos (Figure 6F) as with embryos lacking only gt (Figure 6E). The continued presence of Antp in the labial segment of gtQ292; tsh8 embryos supports the conclusion that tsh is required for the labial-to-first-thoracic transformation in gt mutants, as the remaining ectopic Antp was unable to cause the labial-to-thoracic transformation.


DISCUSSION
We draw two significant conclusions from this study: (1) In its anterior expression domain, gt acts in both segment identity and segmentation roles, and these two roles are functionally separable; and (2) the distinction between the gnathal and trunk segment types is determined by the gap genes and is reflected by the head and trunk expression patterns of disco and tsh, which appear to be regulated by a series of repressive interactions (described below).

In addition to segmentation, the anterior gt domain functions in segment identity:

Our assertion that gt acts in both segment identity and segmentation is based upon the following observations:
  1. The dorsal cuticle of gt embryos displayed ectopic dorsal hair development anterior to the first thoracic segment, and the ventral cuticle of some gtQ292 individuals displayed first thoracic-like denticle belts in the labial segment. This ventral transformation was masked in some gt mutant alleles (i.e., gtX11).
  2. In many gt mutant embryos, the reduction or loss of En protein from the posterior labial segment likely prevented the formation of the labial/first thoracic segmental groove, resulting in the fusion of the two segments and, consequently, the presence of only one organizer for denticle development in the fused segment.
  3. In the labial segment of gt mutant embryos, the expression of the homeotic genes Scr, Antp, disco, and tsh recapitulated their expression in the first thoracic segment, indicating a transformation to a first thoracic identity.
  4. In gt mutant embryos, expression of the gnathal-specific Hom-C gene pb is significantly reduced in the labial segment, indicating a loss of gnathal identity. Such a separation of segmentation and segment identity functions as we describe for the anterior domain of different gt alleles was previously observed in the posterior gt domain (PETSCHEK et al. 1987).

Initial characterizations of the gt mutant phenotype, based on SEM studies, described a fusion between the labial, first thoracic, and second thoracic segment, which, later in development, resolved such that the first and second thoracic segments separated, but the labial segment remained fused with the thoracic segment (PETSCHEK et al. 1987). PETSCHEK and MAHOWALD (1990) describe the loss of the third (labial) En stripe as indicating the deletion of the labial posterior compartment, and they suggest that this may be the extent of the "gap" phenotype in the anterior gt domain. Our examination of gtQ292 embryos revealed clear indications of a homeotic transformation of the labial segment to a first thoracic identity. MOHLER et al. (1989) noted the presence of ectopic hairs in the dorsal cuticle of gtX11 mutants, but did not relate this observation to a change in segment identity.

LARSEN et al. (2003) determined that En-expressing cells were the first to regress during the formation of the segment groove. They describe the absolute requirement for En expression in cells adjacent to the developing groove. Thus, in gt mutant embryos, the amount of En accumulation retained in the posterior labial compartment likely determines the extent of segmentation that will occur between the labial and first thoracic segments. Embryos hemizygous for gtX11 almost completely lose the third En stripe, coinciding with the virtually complete fusion between the labial and first thoracic segments in these individuals. Consequently, we never observed a duplication of the first thoracic segment in embryos of this genotype. This lack of ventral denticle duplication in gtX11 embryos follows when considering the loss of En in the posterior labial segment. Since more of the labial En stripe remains in gtQ292 embryos, a segment border can form. Interestingly, both gtX11 and gtQ292 develop ectopic dorsal hairs anterior to the first thoracic segment. Our En staining revealed that at least a portion of the dorsal ridge fuses (or never properly separates) from the dorsal labial segment, creating a segment that resembles the first thoracic segment. It is likely that the ectopic dorsal hairs arise from the dorsal ridge, which has been transformed toward dorsal first thoracic identity.

The case for a gt segment identity function is strengthened by the alterations in the homeotic genes expressed in the gnathal and thoracic regions. In all gtQ292mutants examined, the labial segment expressed Scr, Antp, and tsh. This combination of segment identity factors is normally found in the first thoracic segment. Further, the labial segment shows significant reduction or alteration in pb and disco expression, both markers of gnathal identity.

There are two potential explanations for the differential effects on En accumulation and the ventral cuticle phenotype in the gt alleles that we examined. First, the available gtQ292 stock may, over time, have acquired second site suppressors responsible for the occasional persistence of En accumulation in the posterior labial segment. However, when we crossed this allele into a different genetic background, we continued to observe the presence of En accumulation and ventral cuticle transformation. If it is a second site suppressor of the gt mutation, then it must lie on the X chromosome carrying the gtQ292 allele. A second possibility is that the gtQ292 allele is a strong hypomorph, rather than an amorphic allele, and the residual Gt function is sufficient in some individuals to allow the labial En segmentation process to proceed, although the segment identity process remains faulty. Regardless of which explanation proves to be true, it appears that the anterior gt domain regulates embryonic patterning at two different levels—segmentation and segment identity—and that these two processes are functionally separable from one another.

This conclusion is not without precedent. Early reports suggested a possible homeotic function in addition to the segmentation function of Gt in its posterior expression domain (HARDING and LEVINE 1988; MOHLER et al. 1989). Homeotic transformations and segmentation defects are observed in the mutant phenotypes of other gap genes. For example, in hb mutants, the loss of mid-abdominal segmentation is accompanied by mirror image duplications (LEHMANN and NUSSLEIN-VOLHARD 1987; JÜRGENS 1988). Our results are significant, as they are the first to definitively demonstrate a segment identity role of the anterior gt domain.

The function of the anterior gt domain in Drosophila is similar to Tribolium:

A recent study characterized the expression and function of a gt homolog in Tribolium (Tc'gt) (BUCHER and KLINGLER 2004). As in Drosophila, Tc'gt mRNA is expressed in two primary domains—one in the anterior of the embryo, overlying the gnathal region, and a second in the region of the third thoracic segment to the second abdominal segment. Although the anterior Tc'gt domain is similarly placed as compared to Drosophila, the posterior domain is shifted forward approximately five segments. The authors used RNA interference and morpholinos to knock down the expression of Tc'gt to explore its function. Interestingly, they found that Tc'gt has a role in the identity specification of the maxillary and labial segments, but did not have a role in segmentation. The maxillary and labial segments were transformed to a first and second thoracic identity, respectively, while all three thoracic segments exhibit a third thoracic identity. There was no loss of the gnathal Tc'engrailed (Tc'En) stripes, although thoracic and abdominal Tc'En accumulation was affected to varying degrees in different embryos. Although the region affected by the loss of Tc'gt function is broader than the transformed region we observed in Drosophila gtQ292 mutants, the nature of the homeotic change is quite similar. A gnathal segment(s) is transformed to a thoracic identity, and this identity change is separate from the segmentation process. The segment identity function for gt may have been present in the last common ancestor of the holometabolous insects, and the segmentation role of the anterior gt might have been acquired separately to accommodate the long germ-band mode of development.

gt establishes the difference between gnathal and trunk segments via differential expression of tsh and disco:

In the head, disco is expressed in most cells of the segmental epidermis, while there is little or no expression of tsh. By contrast, tsh is expressed throughout most of the trunk segmental epidermis, while disco is limited to the limb primordia. The genetic studies presented here demonstrate that the difference between head and trunk expression patterns, and therefore segment types, is dependent upon the gap genes, and particularly, on gt. We summarize this regulation in Figure 7.


Figure 7
View larger version (20K):
In this window
In a new window
Download PPT slide
 
FIGURE 7.—

The gap gene giant has both homeotic functions and segmentation functions. (A) The anterior Giant domain regulates segmentation through the regulation of the pair-rule and segment polarity genes and segment identity through regulation of the Hom-C genes, tsh, and disco. (B) A summary of the genetic interactions acting to position the gnathal/trunk boundary. Zygotic gap protein gradients are shown above a diagram of the expression domains of the homeotic genes involved in gnathal/trunk specification. Repressive interactions are shown with a barred line. gt is a key player in this cascade of repressive interactions, with the alterations that we observed in hb and Kr mutants likely due to their interactive regulatory relationship with gt. The anterior domain of gt is limited by its interactions with the zygotic gap proteins Hb and Kr, both of which act as repressors of gt expression (see text for references). Gt, in turn, limits the anterior expression of tsh. Tsh represses disco, such that disco is expressed throughout the gnathal segments, but is limited to only the embryonic leg primordia in the trunk. tsh is further limited by the expression of salm in the anlagen of the maxillary and labial segments. Antp, Antennapedia; disco, disconnected; Gt, Giant; Hb, Hunchback; Kr, Krüppel; Scr, Sex combs reduced; salm, spalt major; tsh, teashirt; PS, parasegment; Man, mandibular; Max, maxillary; Lab, labial; T, thoracic segments; A, abdominal segments.

 
In gt mutant embryos, both disco and tsh expression are altered reciprocally. disco expression is severely reduced in the labial segment and in fact is altered such that the remaining disco mRNA resembled the embryonic limb primordia expression observed in the thoracic segments. There is a concomitant expansion of tsh expression into the labial segment. We previously demonstrated that UAS-driven ectopic tsh expression in the gnathal segments reduces and alters disco expression such that it mimics the expression pattern of the thoracic segments (ROBERTSON et al. 2004). Similarly, in gt mutants, it is the expansion of tsh expression into the labial segment that is responsible for the changes in disco expression. When both gt and tsh are absent, disco expression in the labial lobe recovers significantly, and the overall morphology of the labial segment and adjoining dorsal ridge is notably improved.

Our results may support a direct role for gt in the regulation of tsh. Although previous work demonstrated the requirement of Antp for appropriate tsh expression in the thoracic segments, and the loss of gt results in ectopic Antp protein in the labial segment (PETSCHEK and MAHOWALD 1990; REINITZ and LEVINE 1990; RILEY et al. 1991; RÖDER et al. 1992), Antp is not required for ectopic tsh activation in the labial and maxillary segments of gt mutants. It is likely that gt directly limits the anterior expression of both tsh and Antp. Gt functions as a short-range repressor and has been shown to bind with high affinity to the CD1 sequence (TAT GAC GCA AGA) derived from the Kr regulatory region (CAPOVILLA et al. 1992; HEWITT et al. 1999). There is a sequence ~0.5 kb upstream of the transcription start site of tsh that is similar to the CD1 sequence (TAT GAA GGA AGG), differing by only three bases. Although it remains to be investigated as to whether the Gt protein can bind to this sequence, the similarity in sequence to a known in vivo Gt-binding site supports direct repression of tsh by Gt.

The results that we present in this study, taken together with previous work, outline a model for the positioning of the gnathal/trunk boundary in the Drosophila embryo, involving a network of repressive factors. This model is presented in Figure 7, and gt is a key player in this model. The anterior domain of gt is limited by its interactions with the zygotic gap genes hb and Kr, both of which act as repressors of gt expression (HULSKAMP et al. 1990; ELDON and PIRROTTA 1991; KRAUT and LEVINE 1991a,b; WU et al. 2001). Gt in turn limits tsh expression, preventing expression in the labial segment. tsh expression is further limited by the expression of salm in the anlagen of the maxillary and labial segments. However, our results demonstrate that salm alone is insufficient for repressing tsh in the posterior labial segment in embryos lacking gt function. In the trunk segments, Tsh limits disco expression to only the embryonic appendage primordial, so that, lacking Tsh, disco expression is expanded through much of the gnathal segments.

Questions remain regarding the activation of tsh and disco. disco mRNA accumulates in the cellular blastoderm prior to gastrulation, implying the involvement of maternal factors or early acting gap genes. However, none of the gap mutants that we tested affected the initiation of the initial anterior disco domain. disco was significantly affected by the loss of maternal bcd (data not shown). This suggests that bcd and/or maternal hb may play a role in the initial activation of the anterior disco domain, after which Tsh acts to limit the disco to the gnathal region. tsh expression initiates prior to gastrulation, first with a central stripe that resolves to form a striped pattern reminiscent of the pair-rule genes. Again, none of the gap genes that we examined eliminated tsh expression. Although Kr is expressed in the central region of the embryo, where tsh is first transcribed, it is not the activator of tsh (data not shown). Early tsh may respond to maternal factors and/or a combination of gap gene products in a concentration-specific manner, which would account for our inability to detect a single activator in our gap mutant studies (data not shown). Finally, although we have found several instances where Tsh represses disco (ROBERTSON et al. 2004; LAUGIER et al. 2005; PATEL et al. 2007), we have no evidence that the reverse is true. What leads to the repression of tsh and concomitant maintenance of disco in the maxillary segment of gt mutant embryos is unclear at this time.


ACKNOWLEDGEMENTS
Many fly stocks used in this work were obtained from the Bloomington, Indiana, Drosophila Stock Center. We thank Jennifer Hutchinson for help with the fluorescent in situs. This work is supported by grant IOB-0445540 from the Developmental Mechanisms Program of the National Science Foundation to J.W.M. L.R.S. was supported by National Institutes of Health predoctoral fellowship GM-08443-10.


FOOTNOTES
1 Present address: Cato Research, Durham, NC. Back

2 Present address: Linberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill, NC. Back


LITERATURE CITED

ANDREW, D. J., M. A. HORNER, M. G. PETITT, S. M. SMOLIK and M. P. SCOTT, 1994 Setting limits on homeotic gene function: restraint of Sex combs reduced activity by teashirt and other homeotic genes. EMBO J. 13: 1132–1144.[Medline]

AZPIAZU, N., and G. MORATA, 2002 Distinct functions of homothorax in leg development in Drosophila. Mech. Dev. 119: 55–67.[CrossRef][Medline]

BUCHER, G., and M. KLINGLER, 2004 Divergent segmentation mechanism in the short germ insect Tribolium revealed by giant expression and function. Development 131: 1729–1740.[Abstract/Free Full Text]

CAMPOS-ORTEGA, J. A., and V. HARTENSTEIN, 1997 The Embryonic Development of Drosophila melanogaster, Ed. 2. Springer-Verlag, New York.

CAPOVILLA, M., E. D. ELDON and V. PIRROTTA, 1992 The giant gene of Drosophila encodes a b-ZIP DNA-binding protein that regulates the expression of other segmentation gap genes. Development 114: 99–112.[Abstract]

CARROLL, S. B., R. A. LAYMON, M. A. MCCUTCHEON, P. D. RILEY and M. P. SCOTT, 1986 The localization and regulation of Antennapedia protein expression in Drosophila embryos. Cell 47: 113–122.[CrossRef][Medline]

DAVIS, G. K., and N. H. PATEL, 2002 SHORT, LONG, AND BEYOND: molecular and embryological approaches to insect segmentation. Annu. Rev. Entomol. 47: 669–699.[CrossRef][Medline]

DE ZULUETA, P., E. ALEXANDRE, B. JACQ and S. KERRIDGE, 1994 Homeotic complex and teashirt genes co-operate to establish trunk segmental identities in Drosophila. Development 120: 2287–2296.[Abstract]

DINARDO, S., J. M. KUNER, J. THEIS and P. H. O'FARRELL, 1985 Development of embryonic pattern in D. melanogaster as revealed by accumulation of the nuclear engrailed protein. Cell 43: 59–69.[CrossRef][Medline]

ELDON, E. D., and V. PIRROTTA, 1991 Interactions of the Drosophila gap gene giant with maternal and zygotic pattern-forming genes. Development 111: 367–378.[Abstract]

ERKNER, A., A. GALLET, C. ANGELATS, L. FASANO and S. KERRIDGE, 1999 The role of Teashirt in proximal leg development in Drosophila: ectopic Teashirt expression reveals different cell behaviours in ventral and dorsal domains. Dev. Biol. 215: 221–232.[CrossRef][Medline]

FASANO, L., L. RODER, N. CORE, E. ALEXANDRE, C. VOLA et al., 1991 The gene teashirt is required for the development of Drosophila embryonic trunk segments and encodes a protein with widely spaced zinc finger motifs. Cell 64: 63–79.[CrossRef][Medline]

FRENCH, V., 2001 Insect segmentation: Genes, stripes and segments in "Hoppers"? Curr. Biol. 11: R910–R913.[CrossRef][Medline]

HARDING, K., and M. LEVINE, 1988 Gap genes define the limits of antennapedia and bithorax gene expression during early development in Drosophila. EMBO J. 7: 205–214.[Medline]

HEWITT, G. F., B. S. STRUNK, C. MARGULIES, T. PRIPUTIN, X. D. WANG et al., 1999 Transcriptional repression by the Drosophila giant protein: cis element positioning provides an alternative means of interpreting an effector gradient. Development 126: 1201–1210.[Abstract]

HIROMI, Y., A. KUROIWA and W. J. GEHRING, 1985 Control elements of the Drosophila segmentation gene fushi tarazu. Cell 43: 603–613.[CrossRef][Medline]

HUGHES, C. L., and T. C. KAUFMAN, 2002 Hox genes and the evolution of the arthropod body plan. Evol. Dev. 4: 459–499.[CrossRef][Medline]

HULSKAMP, M., C. PFEIFLE and D. TAUTZ, 1990 A morphogenetic gradient of hunchback protein organizes the expression of the gap genes Kruppel and knirps in the early Drosophila embryo. Nature 346: 577–580.[CrossRef][Medline]

JACK, T., and W. MCGINNIS, 1990 Establishment of the Deformed expression stripe requires the combinatorial action of coordinate, gap and pair-rule proteins. EMBO J. 9: 1187–1198.[Medline]

JACK, T., M. REGULSKI and W. MCGINNIS, 1988 Pair-rule segmentation genes regulate the expression of the homeotic selector gene Deformed. Genes Dev. 2: 635–651.[Abstract/Free Full Text]

JÜRGENS, G., 1988 Head and tail development of the Drosophila embryo involves spalt, a novel homeotic gene. EMBO J. 7: 189–196.[Medline]

KRAUT, R., and M. LEVINE, 1991a Spatial regulation of the gap gene giant during Drosophila development. Development 111: 601–609.[Abstract]

KRAUT, R., and M. LEVINE, 1991b Mutually repressive interactions between the gap genes giant and Kruppel define middle body regions of the Drosophila embryo. Development 111: 611–621.[Abstract]

KUHNLEIN, R. P., G. BRONNER, H. TAUBERT and R. SCHUH, 1997 Regulation of Drosophila spalt gene expression. Mech. Dev. 66: 107–118.[CrossRef][Medline]

LARSEN, C. W., E. HIRST, C. ALEXANDRE and J. P. VINCENT, 2003 Segment boundary formation in Drosophila embryos. Development 130: 5625–5635.[Abstract/Free Full Text]

LAUGIER, E., Z. YANG, L. FASANO, S. KERRIDGE and C. VOLA, 2005 A critical role of teashirt for patterning the ventral epidermis is masked by ectopic expression of tiptop, a paralog of teashirt in Drosophila. Dev. Biol. 283: 446–458.[CrossRef][Medline]

LEE, K. J., M. FREEMAN and H. STELLER, 1991 Expression of the disconnected gene during development of Drosophila melanogaster. EMBO J. 10: 817–826.[Medline]

LEHMANN, R., and C. NUSSLEIN-VOLHARD, 1987 hunchback, a gene required for segmentation of an anterior and posterior region of the Drosophila embryo. Dev. Biol. 119: 402–417.[CrossRef][Medline]

LIU, P. Z., and T. C. KAUFMAN, 2004 hunchback is required for suppression of abdominal identity, and for proper germband growth and segmentation in the intermediate germband insect Oncopeltus fasciatus. Development 131: 1515–1527.[Abstract/Free Full Text]

MAHAFFEY, J. W., C. M. GRISWOLD and Q. M. CAO, 2001 The Drosophila genes disconnected and disco-related are redundant with respect to larval head development and accumulation of mRNAs from deformed target genes. Genetics 157: 225–236.[Abstract/Free Full Text]

MCCORMICK, A., N. CORE, S. KERRIDGE and M. P. SCOTT, 1995 Homeotic response elements are tightly linked to tissue-specific elements in a transcriptional enhancer of the teashirt gene. Development 121: 2799–2812.[Abstract]

MERRILL, V. K., F. R. TURNER and T. C. KAUFMAN, 1987 A genetic and developmental analysis of mutations in the Deformed locus in Drosophila melanogaster. Dev. Biol. 122: 379–395.[CrossRef][Medline]

MOHLER, J., E. D. ELDON and V. PIRROTTA, 1989 A novel spatial transcription pattern associated with the segmentation gene, giant, of Drosophila. EMBO J. 8: 1539–1548.[Medline]

NIESSING, D., R. RIVERA-POMAR, A. LA ROSEE, T. HADER, F. SCHOCK et al., 1997 A cascade of transcriptional control leading to axis determination in Drosophila. J. Cell Physiol. 173: 162–167.[CrossRef][Medline]

PANKRATZ, M., and H. JACKLE, 1993 Blastroderm segmentation, pp. 467–516 in The Development of Drosophila melangaster, edited by M. A. BATE and A. MARTINEZ ARIAS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

PATEL, M., L. FARZANA, L. K. ROBERTSON, J. HUTCHINSON, N. GRUBBS et al., 2007 The appendage role of insect disco genes and possible implications on the evolution of the maggot larval form. Dev. Biol. 309: 56–69.[CrossRef][Medline]

PEDERSON, J. D., D. P. KIEHART and J. W. MAHAFFEY, 1996 The role of HOM-C genes in segmental transformations: reexamination of the Drosophila Sex combs reduced embryonic phenotype. Dev. Biol. 180: 131–142.[CrossRef][Medline]

PETSCHEK, J. P., and A. P. MAHOWALD, 1990 Different requirements for l(1) giant in two embryonic domains of Drosophila melanogaster. Dev. Genet. 11: 88–96.[CrossRef][Medline]

PETSCHEK, J. P., N. PERRIMON and A. P. MAHOWALD, 1987 Region-specific defects in l(1)giant embryos of Drosophila melanogaster. Dev. Biol. 119: 175–189.[CrossRef][Medline]

PULTZ, M. A., R. J. DIEDERICH, D. L. CRIBBS and T. C. KAUFMAN, 1988 The proboscipedia locus of the Antennapedia complex: a molecular and genetic analysis. Genes Dev. 2: 901–920.[Abstract/Free Full Text]

REGULSKI, M., N. MCGINNIS, R. CHADWICK and W. MCGINNIS, 1987 Developmental and molecular analysis of Deformed, a homeotic gene controlling Drosophila head development. EMBO J. 6: 767–777.[Medline]

REINITZ, J., and M. LEVINE, 1990 Control of the initiation of homeotic gene expression by the gap genes giant and tailless in Drosophila. Dev. Biol. 140: 57–72.[CrossRef][Medline]

RILEY, G. R., E. M. JORGENSEN, R. K. BAKER and R. L. GARBER, 1991 Positive and negative control of the Antennapedia promoter P2. Dev. (Suppl.) 1: 177–185.[Medline]

RIVERA-POMAR, R., and H. JACKLE, 1996 From gradients to stripes in Drosophila embryogenesis: filling in the gaps. Trends Genet. 12: 478–483.[CrossRef][Medline]

ROBERTSON, L. K., and J. W. MAHAFFEY, 2005 Insect HOM-C genes and development: lessons from Drosophila and beyond, pp. 247–303 in Comprehensive Insect Science, Vol. 1: Reproduction and Development, edited by K. IATROU. Elsevier, London.

ROBERTSON, L. K., D. B. BOWLING, J. P. MAHAFFEY, B. IMIOLCZYK and J. W. MAHAFFEY, 2004 An interactive network of zinc-finger proteins contributes to regionalization of the Drosophila embryo and establishes the domains of HOM-C protein function. Development 131: 2781–2789.[Abstract/Free Full Text]

RÖDER, L., C. VOLA and S. KERRIDGE, 1992 The role of the teashirt gene in trunk segmental identity in Drosophila. Development 115: 1017–1033.[Abstract]

RUSCH, D. B., and T. C. KAUFMAN, 2000 Regulation of proboscipedia in Drosophila by homeotic selector genes. Genetics 156: 183–194.[Abstract/Free Full Text]

SANSON, B., 2001 Generating patterns from fields of cells. EMBO Rep. 2: 1083–1088.[CrossRef][Medline]

ST. JOHNSTON, D., and C. NUSSLEIN-VOLHARD, 1992 The origin of pattern and polarity in the Drosophila embryo. Cell 68: 201–219.[CrossRef][Medline]

TAGHLI-LAMALLEM, O., A. GALLET, F. LEROY, P. MALAPERT, C. VOLA et al., 2007 Direct interaction between Teashirt and Sex combs reduced proteins, via Tsh's acidic domain, is essential for specifying the identity of the prothorax in Drosophila. Dev. Biol. 307: 142–151.[CrossRef][Medline]

WU, J., and S. M. COHEN, 2000 Proximal distal axis formation in the Drosophila leg: distinct functions of teashirt and homothorax in the proximal leg. Mech. Dev. 94: 47–56.[CrossRef][Medline]

WU, X., V. VASISHT, D. KOSMAN, J. REINITZ and S. SMALL, 2001 Thoracic patterning by the Drosophila gap gene hunchback. Dev. Biol. 237: 79–92.[CrossRef][Medline]

Communicating editor: A. J. LOPEZ