| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
* Department of Molecular Biology, The Scripps Research Institute, La Jolla, California 92037 and Department of Genetics, University of Cambridge, Cambridge CB2 3EH, United Kingdom
1 Corresponding author: The Scripps Research Institute, Department of Molecular Biology, MB-7, 10550 N. Torrey Pines Rd., La Jolla, CA 92007.
E-mail: sreed{at}scripps.edu
 |
ABSTRACT |
|---|
 TOP ABSTRACT MATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
However, there is not yet a consensus concerning whether Mcd1 is the only critical target of Esp1 for anaphase or whether one or more other Esp1-dependent events are required for anaphase. The Mcd1-only model is based on an experiment where Mcd1 was engineered to have a site cleavable by an ectopically expressed protease, Tev, and Esp1 was inhibited indirectly by depleting cells of the essential mitotic cofactor of the APC, Cdc20 (UHLMANN et al. 2000). Presumably under conditions of Cdc20 depletion, APC would be inactive, Pds1 stabilized, and Esp1 kept inactive. Under conditions of Tev induction and Cdc20 depletion, anaphase occurred. This result is supported by anaylsis of two different esp1 temperature-sensitive mutants in the absence of functional Mcd1 (SEVERIN et al. 2001; STEGMEIER et al. 2002). However, a different result was obtained when Esp1 was inactivated directly using a more stringent temperature-sensitive esp1 allele (JENSEN et al. 2001). Under conditions of Mcd1 depletion and Esp1 thermal inactivation, anaphase did not occur, even though loss of sister chromatid cohesion could be observed. This suggests that Esp1 has at least one function, in addition to Mcd1 cleavage, required for anaphase. To resolve this discrepancy and further elucidate the mitotic functions of Esp1, we have investigated the role of Esp1 in anaphase in greater detail. We report here that multiple temperature-sensitive mutations directed to different regions of the Esp1 polypeptide are blocked at metaphase even if Mcd1 is eliminated and sister chromatid cohesion lost and that active Esp1 protease is specifically required for spindle elongation under such circumstances.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
ns ade1 his2 leu2-3,112 trp1-1 (RICHARDSON et al. 1989). Esp1-1 was backcrossed to the BF264-15DU background five times. Genetic procedures and yeast media were formulated according to (AUSUBEL et al. 2002). For enhanced expression of the TET repressor GFP fusion protein under the CUP1 promoter, CuSO4 was added to a final concentration of 250 µM. The disruption of genes was carried out by the PCR-based targeting technique (WACH et al. 1994).
|
GAL1-MCD1 constructs were allowed to reenter the cell cycle by diluting the culture to OD600 0.15 in room temperature YEP galactose for 2 hr and then were centrifuged to remove the medium and placed in YEP dextrose (YEPD) containing 12.5 ng/ml 
-factor. Cells were allowed to synchronize in G1 for 2 hr, washed two times in YEPD, and released into 34° YEPD. Samples of the synchronized culture were collected at 15-min intervals and fixed for 30 min in 10% formalin. Cells were sonicated briefly to break up clumps, centrifuged at low speed to remove medium, and washed with phosphate-buffered saline (PBS). Cells were stored at 4° in PBS containing 25% glycerol until microscopic analysis could be performed.
For analysis of cells in which Mcd1 had been cleaved with TEV protease, overnight cultures of yeast bearing MCD1(TEV)-myc6 as their sole copy of MCD1 were passaged overnight in YEPD. The next morning the culture was transferred to fresh YEP raffinose (YEPR) at an OD600 of 0.3 and allowed to reenter the cell cycle for 2 hr. Cells were then arrested in G1 for 1.75 hr by the addition of -factor at a concentration of 12.5 ng/ml. The GAL1-HA-TEV-CMV(NLS) construct was then induced for 1 hr by the addition of galactose to 2% (w/v) prior to release from G1. Cells were released from G1 by centrifuging at low speed, removing the medium, washing two times in YEPR containing 2% galactose (gal), and releasing into YEPR + 2% gal at 34°. Samples of the synchronized culture were collected at regular intervals and either fixed in 10% formalin (1 ml) for microscopic analysis or centrifuged and frozen at –80° (25 ml) for biochemical analysis.
To compare temperature sensitivity of mutant Esp1 proteins, overnight cultures grown at room temperature in YEPD were diluted to OD600 = 0.2 in YEPD + 12.5 ng/ml -factor. Cells were arrested for 3 hr, and then collected, washed twice in YEPD, and released into 34° YEPD. Sixty minutes after release, -factor was added back to the cultures to prevent reentry into S phase and new synthesis of Mcd1. Aliquots of cells were collected at 0, 60, and 120 min after the initial release from -factor. Approximately 50 µg of protein were loaded into each lane of an 8% SDS–PAGE gel. To assess Mcd1 cleavage, blots were probed with anti-myc antibody (9E10). Blots were also probed with anti--tubulin (YOL-1) for normalization.
To carry plating assays to compare temperature sensitivity of esp1 alleles, serial threefold dilutions were prepared in YEPD liquid medium and spotted onto YEPD plates so that the most concentrated drop contained 5000 cells. Triplicate spotting was carried out with one plate incubated at 22°, a second at 30°, and a third at 33.5°. Plates were incubated until significant colony formation was observed for the wild-type control.
Cell biology protocols:
Fluorescence microscopy was performed on a Zeis Axioskop2 with a 63x objective. Images of cells were captured using Axiovision Rel. 4.3 software. Specifically, images for FITC and Cy3 filter sets (Carl Zeis, Thornwood, NY) were captured in seven planes of focus. These images were first analyzed for loss of cohesion (FITC) by selecting cells that exhibited two clearly separated chromosome IV dots and then scoring spindle length in the Cy3 channel. Cells that did not exhibit loss of cohesion were not scored for spindle length. Cells were scored for budding by counting at least 200 cells using transmission microscopy. Cells were scored for loss of cohesion by evaluating separation of chromosome IV dots in 100 cells at each time point. For time-lapse recordings of spindle dynamic behavior, strains CBY128 and CBY102 (esp1-C113 or ESP1, respectively, and containing Mcd1 GAL1:Myc-MCD1 trp1::TET(o)::TRP1 CUP1PTET(rep)-GFP HIS3:mCherry:TUB1) were grown overnight in selective galactose-containing medium at 25° to obtain cultures with no more than 20% budded cells. After collecting by centrifugation, cells were resuspended to a concentration of 3 x 106 cells/ml in synthetic glucose-containing medium (to repress GAL1:MCD1) and incubated for 1.5 hr at 32° before mounting on the same medium containing 25% w/v gelatin to perform time-lapse recordings at 32° using a Nikon Eclipse E800 with a CFI Plan Apochromat 100x N.A. 1.4 objective, Chroma Technology triple band filter set 82000v2 and a Coolsnap-HQ CCD camera (Roper Scientific). Five-plane Z-stacks were acquired at 30-sec or 1-min intervals and images were processed as previously described (MADDOX et al. 1999; HUISMAN et al. 2004). To avoid excessive photobleaching of tagged microtubule-based structures, cells were monitored by direct observation to select cells that had undergone loss of sister chromatid cohesion and contained a short spindle at the start of the recording.
Cell lysates:
Frozen cell pellets were mixed with buffer containing 25 mM HEPES, 0.5 mM EGTA, 0.1 mM EDTA, 2 mM MgCl2, 1 mM NaHSO3, 0.02% NP-40, 20% glycerol, 50 mM NaF, 200 µM NaVO3, and complete protease inhibitor cocktail (catalog no. 1697498, Roche, Indianapolis) then transferred to 2 ml screw-cap minimally conical tubes. Glass beads (0.5 mm, Biospec) were added until their level was just under the meniscus. Cells were lysed in a FastPrep FP120 at power lever 4.5 (4 x 30 sec). Soluble lysates were quantitated for protein using the Lowry method (Bio-Rad, Hercules, CA).
Western blots:
Protein samples (50 µg) were resolved on 8% tris-glycine SDS–PAGE gels. Gels were then transferred to PVDF. Blots were blocked in 10% milk then probed with antibodies diluted in PBS containing 20 mg/ml BSA and 0.05% NaN3. To probe for the myc epitope, 9E10 was used at a dilution of 1:5000, and for detection of -tubulin the rat monoclonal YOL1/34 was used. Blots were developed using antimouse or antirat, as appropriate.
Plasmids:
The mCherry-TUB1 construct was made in a manner similar to the GFP-tubulin plasmid described previously by (STRAIGHT et al. 1997). Briefly, the mCherry-RFP sequence described by SHANER et al. (2004) was amplified by PCR and fused to the HIS3 promoter. The TUB1 gene was fused in-frame to the 3' end of mCherry-RFP. The intergenic region between CLB1 and CLB6 was added 3' of the TUB1 ORF for transcriptional termination. The HIS3(pr)-mCherry-TUB1 construct was then placed in pRS406 between XhoI and SacI for integration at the URA3 locus. For ESP1 complementation experiments ESP1 was cloned into this construct between XhoI and KpnI.
A genomic replacement of the region encoding the N terminus of the Esp1 cleavage site within Mcd1 with a TEV protease cleavage site was created using the pop-in/pop-out technique. A cassette of the sequence between Bst EII and Bst BI was created using primer sequences GATTTCGAACATAATAATTTGTCTAGTATG and GTTCGAAATCTTCATCTGGACTGAATCCTTGGAAGTATAGGTTTTCAGTATCCCATGGAGCAGCACC. This cassette changed the region encoding the Esp1 cleavage sequence WDTSLEVGRRFSP to one encoding the TEV-P cleavable site WDTENLYFQGFSP and placed a unique NcoI site within the MCD1 ORF. The plasmid pRS406 with the MCD1 gene containing this cassette was digested at the unique Bst EII site 5' to the TEV-P cleavage site. Cells were first selected on uracil dropout medium then on medium containing 5-FOA to select for loss of the URA3 marker. Pop-outs were identified as being properly recombined by selecting for NcoI cleavage of the PCR product produced by primers TCTTCAATTGACCCTTCTCGCCCA and TCGGGCACTGTTGCCGTATATTCT using genomic DNA as a template.
To place a C-terminal 6x Myc tag on Mcd1, a portion of the 3' end of the MCD1 ORF was amplified using primer sequences GATGCGGCCGCGAGCATTGATAAACCTTTCAAATAGTGC and CGTCGACCAAACTGGCACAAGAAGGAACTC. This was fused in frame with a sequence encoding six repeats of the Myc epitope EQKLISEEDL followed by the CLB1/6 transcriptional terminator. This sequence was placed in the plasmid pAG34 with SalI and SacI linkers, respectively. Yeast that were resistant to hygromycin B were tested for proper integration of the Myc-tagging construct using primers TTTCTGTGTAGGCTAGCACCTGG and AGAAGCACCCGCAGGCAATATAGA.
The galactose-inducible TEV protease expression plasmid was created by amplifying the region encoding TEV-P from the tobacco etch virus genome using primer sequences ACTCGAGCCATGGCTGAAAGCTTGTTTAAG and GTCTAGATCAGTCGACTTGCGAGTACACCAATTCATTC. A cytomegalovirus nuclear localization signal sequence (CMV_NLS) was added to the pBluescript vector by using the primer sequences CACTCTAGAGTCGACTGTACTCCACCAAAGAAGAAGAGAAAGGTTGCCTAAGCGGCCGCCACCGCGGTG and TGGCCTTTTGCTGGCCTTTTGCTCACATGT. The TEV-P sequence was fused in frame 5' to the CMV_NLS to make TEV-P-CMV_NLS. To make the expression of TEV-P-CMV_NLS inducible with galactose, the GAL1 promoter [GAL1(pr)] was amplified with primer sequences AGGGCCCTTGGATGGACGCAAAGAAGTTT and ACTCGAGCGCATAGTCAGGAACATCGTATGGGTAAGCCATGGTATAGTTT TTTCTCCTTGACGTTAAAGTATAGAG. Note that this version of the GAL1(pr) will express an HA epitope (YPYDVPDYA) tagged TEV-P-CMV_NLS (HA-TEV-P-CMV_NLS).
To introduce the HA-TEV-P-CMV_NLS under histidine selection, the HIS2 gene was amplified from yeast genomic DNA using primer sequences CTCAGCGATATCATTTTGATTTACTAAATGCTATTTATCC and CAGTGCAGATCTACAGCTTTTGTTTTTGATTTCTTTGCC. The backbone of pRS404 was amplified with primer sequences GCCAGTCAGGCCTATGCGGTGTGAAATACCGCAC and GTGCACTGATCATATGGTGCACTCTCAGTACAATC. The products of these PCRs were ligated together to form the HIS2 selectable integrating plasmid pRS40-HIS2. The GAL1(pr)-HA-TEV-P-CMV_NLS construct was then ligated into this plasmid between SacI and ApaI.
Statistical analysis:
The means in Figure 3 were compared using Student's t-test (Table 3) (SIMPSON et al. 1960).
|
|
|
RESULTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
Stringent temperature-sensitive esp1 alleles confer a block to anaphase spindle elongation in the absence of Mcd1:
We have reported previously that a temperature-sensitive allele of ESP1, esp1-B3 was defective in anaphase spindle elongation, even under conditions of Mcd1 depletion (JENSEN et al. 2001). This experiment was carried out by regulating the synthesis of the cohesin protein Mcd1 using a heterologous fusion construct of the GAL1 promoter with the MCD1 ORF. Growth of cells in dextrose medium where the GAL1 promoter is repressed leads to depletion of Mcd1. Under these conditions, even though sister chromatid cohesion was lost, on the basis of scoring of a fluorescent chromosome marker, spindle elongation did not occur. The esp1-B3 allele was derived from mutagenesis specifically in the central region of Esp1 and was characterized by a low restrictive temperature (31.5°), necessary technically for accurate scoring of spindle elongation. To determine whether cohesion-independent failure of spindle elongation is a characteristic of the esp1-B3 allele or whether it is a general characteristic of Esp1 loss of function, additional stringent temperature-sensitive alleles (restrictive temperature 
33°) in different regions of the Esp1 ORF were chosen for analysis. All temperature-sensitive strains sequenced contained multiple mutations although we did not verify which mutations contributed to the phenotype. The specific combinations of mutations in these alleles are shown in Table 2. Mutant strains contained a construct expressing an mCherry-RFP-tubulin fusion protein for monitoring spindle length and GFP-Tet repressor with a Tet operator array integrated at the TRP1 locus on chromosome IV to determine loss of sister chromatid cohesion. Mcd1 expression was under control of the GAL1 promoter, as described previously (JENSEN et al. 2001). In addition, the strains contained a mad2 deletion to prevent a mitotic delay that occurs in the absence of sister chromatid cohesion (SEVERIN et al. 2001). Cells were synchronized by mating pheromone arrest, released into dextrose medium to terminate expression of Mcd1, and were harvested as a function of time after release at 15-min intervals. Populations were lightly fixed and then scored for spindle length and loss of chromatid cohesion. Representative images used for this analysis are shown in Figure 1. Only cells where two well-separated chromosome IV spots could be observed were measured for spindle length. For each population, >60% of cells fit this criterion at peak mitotic times (supplemental Figure 1A, data not shown). It has been reported that chromosomal regions that are centromere-proximal, can separate prior to anaphase (PEARSON et al. 2001). However, there was no significant preanaphase separation at a site 12.7 kb from CEN11, more centromere-proximal than the Tet operator array used here (
16 kb from CEN4). Consistent with these observations, the Tet operator array system has been shown previously not to exhibit preanaphase separation in the esp1 mutants (JENSEN et al. 2001). Therefore, as expected, for mutants grown in the presence of galactose, so that Mcd1 was not depleted, <10% of cells showed separated chromosome IV spots, confirming that esp1 mutation prevents loss of cohesion under the experimental conditions employed (supplemental Figure 1A, data not shown). The spindle-length data are shown in Table 3 for the peak mitotic time point for the wild-type control (90 min). The peak average pole-to-pole spindle length for the wild-type strain is 6 µm at 90 min. Although fully extended spindles in S. cerevisiae are 8 µm, the smaller length of the average represents imperfect synchrony (see Figure 1). On the other hand, the three temperature-sensitive alleles analyzed, esp1-N120 (amino-terminal region), esp1-B120 (central region), and esp1-C113 (carboxy-terminal region) exhibited significantly less spindle elongation at 90 min and at later points. The entire time course for wild type and esp1-C113 is plotted in Figure 1. These data indicate that during the entire interval where wild-type cells undergo mitosis, esp1-C113 cells extend spindles to a maximum length of 4 µm with an average length of 3 µm. Therefore temperature-sensitive alleles of esp1 across the entire Esp1 ORF confer a defect in anaphase spindle elongation.
|
|
26.5 min. On the other hand, the mutant cells exhibited a marginal elongation (<3.5 µm) of the spindle by 47 min. The corresponding plots for the kinetics of spindle elongation in wild-type vs. esp1-C113 cells is shown in Figure 2C. These dynamic results are in good agreement with the still-image counts and measurements obtained from fixed cell populations (Figure 1).
|
0.001) (Table 4). Importantly, the mean spindle lengths for the esp1-C113 mutant were not significantly different in this experiment as compared to those in Figure 1, consistent with the conclusion that these spindles do not undergo anaphase spindle elongation.
|
|
-factor arrest, released into medium at 34°, and then after bud emergence, -factor was added back (60 min after release). Aliquots were harvested at the time of release from the -factor block 60 min later, which corresponds to late S phase and G2 for the wild-type strain and 120 min later, when all cells that completed mitosis would be blocked in G1 due to pheromone treatment. The rationale for the second -factor block is to prevent resynthesis of Mcd1 once cells have completed mitosis. Mcd1 levels were then determined by Western blotting and normalized to -tubulin levels (Figure 5B). In wild-type cells, high levels of Mcd1 were present at 60 min but not at 0 or 120 min, indicating that Mcd1 is synthesized and then degraded. All esp1 mutants were defective at Mcd1 degradation to varying degrees. esp1-C113, the most temperature-sensitive allele appeared to be completely defective, in that Mcd1 levels were increased between 60 and 120 min. All other temperature-sensitive mutants tested decreased Mcd1 levels by a factor of two between 60 and 120 min. Therefore, on the basis of a combination of two criteria, growth at elevated temperature and ability of Esp1 to cleave Mcd1, esp1 temperature-sensitive mutants tested can be divided into three groups, with esp1-1 and esp1-N5 falling into the least sensitive group and esp1-C113 being the most temperature sensitive. esp1-B3 and esp1-B120 were in an intermediate category, on the basis of the plate test. However, esp1-B120 protease activity was not tested.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
The entire Esp1 protein participates in its proteolytic functions:
Sequence alignments reveal that Esp1 contains a caspase-like sequence at its carboxy terminus. The proteolytic activity associated with this region is essential for Mcd1 cleavage and cohesin dissociation from sister chromatids (UHLMANN et al. 2000). However, Esp1 contains a large amino-terminal extension from the proteolytic domain that comprises the bulk of the protein. The specific molecular functions associated with this region have yet to be fully elucidated. However, highlighting the critical function of the separase amino terminus, insect separase is expressed from two essential genes: Separase (Sse) encoding the protease catalytic domain and three rows (Thr) encoding a positive regulatory domain (JAGER et al. 2001). These two proteins are required to physically interact for full proteolytic activity of SSE. Indeed, interaction of the N-terminal and caspase-like domains is required for proteolytic activity of all separases tested including those synthesized as a single polypeptide. Structural predictions suggest that THR adopts an – superhelical structure characteristic of ARM/HEAT repeats. Similarly, structural predictions have also proposed – superhelical structures in the aminotermini of separases found in humans, Caenorhabditis elegans, Arabidopsis, Schizosaccharomyces pombe, and S. cerevisiae (JAGER et al. 2004). The – superhelical structure is associated with proteins that assume scaffold or adapter roles, such as β-catenin, protein phosphatase 2A PR65/A subunit, and importin β. This suggests that the amino-terminal regions of separases are adapters that might recruit substrates to the catalytic site. Consistent with this idea, blockage of the active cleft of yeast Esp1 with a substrate-mimetic inhibitor does not inhibit association of Esp1 and Pds1, indicating that substrate recruitment sites are distal from the catalytic site (HORNIG et al. 2002). In the current study, we carried out a phenotypic analysis of a large number of temperature-sensitive alleles targeted to three distinct regions encompassing the entire Esp1 protein. We do not know the precise locations of the mutations, and it is likely due to the degree of mutagenesis that each allele contains multiple point mutations. Nevertheless, in every case, the phenotype was identical to that defined on the basis of the original temperature-sensitive esp1 allele identified, esp1-1 (BAUM et al. 1988; MCGREW et al. 1992). Specifically at restrictive temperature, sister chromatid cohesion was not lost, spindles failed to elongate, and eventually the undivided nucleus translocated into the bud. We found no alleles that were permissive for sister chromatid separation but defective in spindle elongation. These data suggest that the entire length of the Esp1 protein contributes to an integral biochemical function that targets multiple substrates and argues against a substrate-specific allocation of domains. However, because the mutant screen, although intensive, was probably not saturating, this conclusion has to be taken as tentative.
The Esp1 target regulating spindle elongation:
To date, two endoproteolytic targets of Esp1 have been identified. Mcd1 is required for maintenance of sister chromatid cohesion (UHLMANN et al. 1999) and Slk19, a kinetochore protein is required for anaphase spindle durability as well as for early mitotic exit (FEAR) pathway (SULLIVAN et al. 2001; STEGMEIER et al. 2002). However, a non-Esp1-cleavable version of Slk19 confers little of any overt phenotype (SULLIVAN et al. 2001). Certainly, there is no defect in spindle elongation, ruling out Slk19 as the Esp1 target whose cleavage is required for anaphase spindle elongation. Attempts to identify other Esp1 targets on the basis of the rather degenerate protease cleavage site consensus have failed (SULLIVAN et al. 2004). Therefore, the relevant target(s) remain(s) unknown. One untested possibility is the class of microtubule destabilizing motors that have been shown to antagonize spindle elongation. Kar3 and Kip3 have been shown to restrain the spindle elongating activities of Kip1 and Cin8, also microtubule motor proteins (STRAIGHT et al. 1998; COTTINGHAM et al. 1999). It is conceivable that Esp1 is responsible for inactivating Kar3 and/or Kip3 (or positive regulators of these proteins) at the metaphase/anaphase transition, thereby potentiating spindle elongation. Alternatively, Esp1 might target negative regulators of Kip1 and/or Cin8, allowing them to promote spindle elongation. The targeting of spindle motors or associated proteins by Esp1 would be consistent with localization of Esp1 to spindle during anaphase (JENSEN et al. 2001).
|
ACKNOWLEDGEMENTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
|
LITERATURE CITED |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
AUSUBEL, F. M., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN et al. (Editors), 2002 Short Protocols in Molecular Biology: A Compendium of Methods From Current Protocols in Molecular Biology, Ed. 5. John Wiley & Sons, New York.
BAUM, P., C. YIP, L. GOETSCH and B. BYERS, 1988 A yeast gene essential for regulation of spindle pole duplication. Mol. Cell. Biol. 8: 5386–5397.
CIOSK, R., W. ZACHARIAE, C. MICHAELIS, A. SHEVCHENKO, M. MANN et al., 1998 An ESP1/PDS1 complex regulates loss of sister chromatid cohesion at the metaphase to anaphase transition in yeast. Cell 93: 1067–1076.[CrossRef][Medline]
COHEN-FIX, O., J. M. PETERS, M. W. KIRSCHNER and D. KOSHLAND, 1996 Anaphase initiation in Saccharomyces cerevisiae is controlled by the APC-dependent degradation of the anaphase inhibitor Pds1p. Genes Dev. 10: 3081–3093.
COTTINGHAM, F. R., L. GHEBER, D. L. MILLER and M. A. HOYT, 1999 Novel roles for Saccharomyces cerevisiae mitotic spindle motors. J. Cell Biol. 147: 335–350.
GRUBER, S., C. H. HAERING and K. NASMYTH, 2003 Chromosomal cohesin forms a ring. Cell 112: 765–777.[CrossRef][Medline]
GUACCI, V., D. KOSHLAND and A. STRUNNIKOV, 1997 A direct link between sister chromatid cohesion and chromosome condensation revealed through the analysis of MCD1 in S. cerevisiae. Cell 91: 47–57.[CrossRef][Medline]
HORNIG, N. C., P. P. KNOWLES, N. Q. MCDONALD and F. UHLMANN, 2002 The dual mechanism of separase regulation by securin. Curr. Biol. 12: 973–982.[CrossRef][Medline]
HUANG, J. N., I. PARK, E. ELLINGSON, L. E. LITTLEPAGE and D. PELLMAN, 2001 Activity of the APC(Cdh1) form of the anaphase-promoting complex persists until S phase and prevents the premature expression of Cdc20p. J. Cell Biol. 154: 85–94.
HUISMAN, S. M., O. A. BALES, M. BERTRAND, M. F. SMEETS, S. I. REED et al., 2004 Differential contribution of Bud6p and Kar9p to microtubule capture and spindle orientation in S. cerevisiae. J. Cell Biol. 167: 231–244.
JAGER, H., A. HERZIG, C. F. LEHNER and S. HEIDMANN, 2001 Drosophila separase is required for sister chromatid separation and binds to PIM and THR. Genes Dev. 15: 2572–2584.
JAGER, H., B. HERZIG, A. HERZIG, H. STICHT, C. F. LEHNER et al., 2004 Structure predictions and interaction studies indicate homology of separase N-terminal regulatory domains and Drosophila THR. Cell Cycle 3: 182–188.[Medline]
JENSEN, S., M. SEGAL, D. J. CLARKE and S. I. REED, 2001 A novel role of the budding yeast separin Esp1 in anaphase spindle elongation: evidence that proper spindle association of Esp1 is regulated by Pds1. J. Cell Biol. 152: 27–40.
MADDOX, P., E. CHIN, A. MALLAVARAPU, E. YEH, E. D. SALMON et al., 1999 Microtubule dynamics from mating through the first zygotic division in the budding yeast Saccharomyces cerevisiae. J. Cell Biol. 144: 977–987.
MCGREW, J. T., L. GOETSCH, B. BYERS and P. BAUM, 1992 Requirement for ESP1 in the nuclear division of Saccharomyces cerevisiae. Mol. Biol. Cell 3: 1443–1454.[Abstract]
PAN, J., and R. H. CHEN, 2004 Spindle checkpoint regulates Cdc20p stability in Saccharomyces cerevisiae. Genes Dev. 18: 1439–1451.
PEARSON, C. G., P. S. MADDOX, E. D. SALMON and K. BLOOM, 2001 Budding yeast chromosome structure and dynamics during mitosis. J. Cell Biol. 152: 1255–1266.
PRINZ, S., E. S. HWANG, R. VISINTIN and A. AMON, 1998 The regulation of Cdc20 proteolysis reveals a role for APC components Cdc23 and Cdc27 during S phase and early mitosis. Curr. Biol. 8: 750–760.[CrossRef][Medline]
RICHARDSON, H. E., C. WITTENBERG, F. CROSS and S. I. REED, 1989 An essential G1 function for cyclin-like proteins in yeast. Cell 59: 1127–1133.[CrossRef][Medline]
SEVERIN, F., A. A. HYMAN and S. PIATTI, 2001 Correct spindle elongation at the metaphase/anaphase transition is an APC-dependent event in budding yeast. J. Cell Biol. 155: 711–718.
SHANER, N. C., R. E. CAMPBELL, P. A. STEINBACH, B. N. GIEPMANS, A. E. PALMER et al., 2004 Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat. Biotechnol. 22: 1567–1572.[CrossRef][Medline]
SHIRAYAMA, M., A. TOTH, M. GALOVA and K. NASMYTH, 1999 APCCdc20 promotes exit from mitosis by destroying the anaphase inhibitor Pds1 and cyclin Clb5. Nature 402: 203–207.[CrossRef][Medline]
SIMPSON, G., A. ROE and R. LEWONTIN, 1960 Quantitative Zoology. Harcourt, Brace, New York.
STEGMEIER, F., R. VISINTIN and A. AMON, 2002 Separase, polo kinase, the kinetochore protein Slk19, and Spo12 function in a network that controls Cdc14 localization during early anaphase. Cell 108: 207–220.[CrossRef][Medline]
STRAIGHT, A. F., W. F. MARSHALL, J. W. SEDAT and A. W. MURRAY, 1997 Mitosis in living budding yeast: anaphase A but no metaphase plate. Science 277: 574–578.
STRAIGHT, A. F., J. W. SEDAT and A. W. MURRAY, 1998 Time-lapse microscopy reveals unique roles for kinesins during anaphase in budding yeast. J. Cell Biol. 143: 687–694.
SULLIVAN, M., and F. UHLMANN, 2003 A non-proteolytic function of separase links the onset of anaphase to mitotic exit. Nat. Cell Biol. 5: 249–254.[CrossRef][Medline]
SULLIVAN, M., C. LEHANE and F. UHLMANN, 2001 Orchestrating anaphase and mitotic exit: separase cleavage and localization of Slk19. Nat. Cell Biol. 3: 771–777.[CrossRef][Medline]
SULLIVAN, M., N. C. HORNIG, T. PORSTMANN and F. UHLMANN, 2004 Studies on substrate recognition by the budding yeast separase. J. Biol. Chem. 279: 1191–1196.
TAN, A. L., P. C. RIDA and U. SURANA, 2005 Essential tension and constructive destruction: the spindle checkpoint and its regulatory links with mitotic exit. Biochem. J. 386: 1–13.[CrossRef][Medline]
UHLMANN, F., F. LOTTSPEICH and K. NASMYTH, 1999 Sister-chromatid separation at anaphase onset is promoted by cleavage of the cohesin subunit Scc1. Nature 400: 37–42.[CrossRef][Medline]
UHLMANN, F., D. WERNIC, M. A. POUPART, E. V. KOONIN and K. NASMYTH, 2000 Cleavage of cohesin by the CD clan protease separin triggers anaphase in yeast. Cell 103: 375–386.[CrossRef][Medline]
WACH, A., A. BRACHAT, R. POHLMANN and P. PHILIPPSEN, 1994 New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10: 1793–1808.[CrossRef][Medline]
YAMAMOTO, A., V. GUACCI and D. KOSHLAND, 1996 Pds1p, an inhibitor of anaphase in budding yeast, plays a critical role in the APC and checkpoint pathway(s). J. Cell Biol. 133: 99–110.
ZHU, G., P. T. SPELLMAN, T. VOLPE, P. O. BROWN, D. BOTSTEIN et al., 2000 Two yeast forkhead genes regulate the cell cycle and pseudohyphal growth. Nature 406: 90–94.[CrossRef][Medline]
Communicating editor: T. STEARNS
| ||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
120 for each point) described above. Error bars represent one standard deviation. (C) Proteolysis of Tev protease-cleavable Mcd1-6xMyc. The 105-kDa species (solid arrow) corresponds to full-length Mcd1-Myc6. The 77-kDa species (thin arrow) corresponds to the C-terminal fragment of Mcd1-Myc6 (aa 181–621) after cleavage at amino acid 180 (aa180) by Tev protease. An uncharacterized 42-kDa fragment of Mcd1 (*) is also present in ESP1 lysates.
