Genetics, Vol. 178, 1271-1282, March 2008, Copyright © 2008
doi:10.1534/genetics.107.078626

aubergine Gene Overexpression in Somatic Tissues of auberginesting Mutants Interferes With the RNAi Pathway of a yellow Hairpin dsRNA in Drosophila melanogaster

* Dipartimento di Scienze e Tecnologie Biologiche ed Ambientali, Università del Salento, 73100 Lecce, Italy and {dagger} Dipartimento di Biologia, Università di Padova, 35121 Padova, Italy

2 Corresponding author: Dipartimento di Scienze e Tecnologie Biologiche ed Ambientali Università del Salento, Ekotekne-Via per Monteroni, 73100 Lecce, Italy.
E-mail: maria.bozzetti{at}unile.it

Manuscript received July 10, 2007. Accepted for publication January 9, 2008.

ABSTRACT

AUBERGINE (AUB) is a member of the PPD family of proteins. These proteins are implicated in RNA interference. In this article we demonstrate that the expression of the aub gene and protein increase in aubsting mutants. We used a genetic method to test whether aubsting overexpression could interfere with proper functioning of the process of RNA interference in somatic tissues of Drosophila melanogaster. This method is based on a transgenic line bearing a construct in which a fragment of the yellow (y) gene is cloned to form an inverted repeat (y-IR) under the control of the upstream activation sequence (UAS) of the yeast transcriptional activator GAL4. The UAS-y-IR transgene and the Act5C-GAL4 driver were brought together on chromosome 3 via recombination. In the resulting strain (Act5C-y-IR), transcriptional activation by GAL4 constitutively produces a dsRNA hairpin bearing cognate sequences to the yellow gene causing continuing degradation of y mRNA resulting in yellow1 (y1) phenocopies. In this genetic background, the mutation of any factor involved in RNAi should repress degradation of y mRNA, restoring the wild-type phenotype. We employed this genetic approach to show that an increased amount of AUBERGINE interferes with the regular functioning of the somatic RNAi pathway.


RNA interference (RNAi) is a widespread homology-dependent silencing mechanism mediated by double-stranded RNA (dsRNA). RNAi-mediated gene silencing suppresses gene expression by several mechanisms, including the targeted sequence-specific cleavage of mRNA, translational repression, and the maintenance of silenced regions of chromatin (reviewed in JARONCZYK et al. 2005; KAVI et al. 2005; CERUTTI and CASAS-MOLLANO 2006; VALENCIA-SANCHEZ et al. 2006; and references therein). RNAi is also known to influence many biological processes such as heterochromatin formation, post-transcriptional gene regulation during development, DNA elimination, cell-cycle regulation, RNA editing, and mRNA decay (PAL-BHADRA et al. 2004; MATZKE and BIRCHLER 2005; TOMARI and ZAMORE 2005; LEE and COLLINS 2006; and references therein). RNAi has probably evolved as a genome "immunity" system to protect the integrity of eukaryotic genomes and maintain chromosome stability through avoiding invasion by exogenous nucleic acids introduced by mobile genetic elements such as viruses and transposons.

Different classes of small RNA molecules 19–31 nt in length have been identified as sequence-specific regulators for diverse RNAi pathways; they have been classified in small interfering RNAs (siRNAs), microRNAs (miRNAs), repeat-associated small interfering RNAs (rasiRNAs), and the recently identified Piwi-associated interfering RNAs (piRNAs) (CARTHEW 2006; KIM 2006; WATANABE et al. 2006; BRENNECKE et al. 2007; LIN 2007; and references therein). Both siRNAs and miRNAs are 21–23 nt long and they are incorporated into related RNA-induced silencing complexes (RISCs), which are referred to as siRISC and miRISC. They are responsible for post-transcriptional gene silencing either by driving the cleavage of homologous mRNAs (siRNAs) or by blocking translation following binding to the 3'-UTR of homologous mRNAs (miRNAs), depending on the extent of pairing (HUTVAGNER and ZAMORE 2002; DOENCH et al. 2003; ZENG et al. 2003; TANG 2005). rasiRNAs (24–26 nt) arise from genomic repeated regions and they are presumably implicated in chromatin modifications at these sites (ARAVIN et al. 2003; PAL-BHADRA et al. 2004; VAGIN et al. 2004, 2006; GUNAWARDANE et al. 2007). piRNAs (26–31 nt) have been recently isolated from rat, mouse, Drosophila, and human male germ tissues (CARTHEW 2006; GRIVNA et al. 2006; KIM 2006; WATANABE et al. 2006; BRENNECKE et al. 2007).

Biochemical dissection of the RNAi pathway in animals has revealed that RNaseIII-like enzymes named Dicer are required for dicing the dsRNA molecule into small RNAs, which trigger RNAi pathways (PHAM and SONTHEIMER 2005; TOMARI and ZAMORE 2005; VAUCHERET 2006). While only a single Dicer protein is present in mammals, in Drosophila melanogaster, siRNAs and miRNAs are produced by distinct Dicer enzymes: Dicer-2 is involved in the production of siRNAs, starting from either dsRNAs or from short hairpin RNAs (shRNAs) resulting from RNA polymerase II transcripts of inverted repeat-bearing artificial constructs (KENNERDELL and CARTHEW 2000; LEE et al. 2004; PHAM et al. 2004; TOMARI and ZAMORE 2005); Dicer-1 is required for the processing of premicroRNA stem-loop dsRNAs into microRNAs (LEE et al. 2004). Small RNAs, generated by Dicer, are loaded onto RISCs where their unwinding takes place. In the Argonaute (Ago) family of proteins two distinct RNA-binding domains, PAZ and PIWI domains (PPD) (CERUTTI et al. 2000; HAMMOND et al. 2001; CATALANOTTO et al. 2002; MOREL et al. 2002; DENLI and HANNON 2003; LEE et al. 2004), are required to bind the siRNA and to slice the cognate RNA to be degraded, respectively (reviewed in COLLINS and CHENG 2005; LINGEL and SATTLER 2005). Members of the Ago or PPD family of proteins are key components of RISC (LIU et al. 2004; MEISTER et al. 2004; SONG et al. 2004). Most organisms have multiple members of the Ago proteins; for example, humans have 8 different Ago proteins, Caenorhabditis elegans has 27, and Schizosaccharomyces pombe has only 1. It has been demonstrated that these proteins are specialized for different functions (HAMMOND et al. 2001; CAUDY et al. 2002; ISHIZUKA et al. 2002; MOURELATOS et al. 2002; DENLI and HANNON 2003; LIU et al. 2003; VERDEL et al. 2004; YIGIT et al. 2006; BRENNECKE et al. 2007). Thus, Argonaute proteins can be grouped into Ago and Piwi subclasses: the Ago members, which are expressed ubiquitously and associated with siRNAs and miRNAs and the Piwi members, which are preferentially expressed in germ-line and stem cells (ARAVIN et al. 2006; GIRARD et al. 2006; GRIVNA et al. 2006; WATANABE et al. 2006). In D. melanogaster five members of the PPD proteins have been identified: AGO1 and AGO2, which belong to the Ago subfamily; AGO3, PIWI, and AUBERGINE (AUB), which belong to the Piwi family (COX et al. 1998; SCHMIDT et al. 1999; WILLIAMS and RUBIN 2002). For some of them a role in RNAi has been demonstrated: AGO1 and AGO2 are associated with RISC (HAMMOND et al. 2001; CARMELL et al. 2002; WILLIAMS and RUBIN 2002; MEISTER and TUSCHL 2004; OKAMURA et al. 2004; TOMARI et al. 2004); AGO3 binds the piRNAs (BRENNECKE et al. 2007); PIWI is implicated in RNAi-related mechanisms affecting both transcriptional and post-transcriptional transgene silencing (PTGS and TGS) (PAL-BHADRA et al. 2002) and in the rasiRNA-derived pathway (PELISSON et al. 2007); and AUB has been demonstrated to be required in RISC assembly in vitro (TOMARI et al. 2004) and in RNAi in oocytes in vivo (KENNERDELL et al. 2002). AUB is a polar granule component required for pole cell formation (HARRIS and MACDONALD 2001) and it is genetically involved in two processes: the translational regulation of oskar and gurken mRNAs and the localization of nanos mRNA (WILSON et al. 1996; HARRIS and MACDONALD 2001; COOK et al. 2004).

The aub gene was first described as being involved in the determination of both the dorsoventral and anteroposterior embryonic patterns during Drosophila development (SCHÜPBACH and WIESCHAUS 1991; ST JOHNSTON and NÜSSLEIN-VOLHARD 1992; WILSON et al. 1996). sting was identified in a screen for male-sterility mutants following random insertional mutagenesis with a P (lacW) element (BIER et al. 1989). Originally, the gene affected by the sting mutation was demonstrated to be a modifier of the crystal-Stellate system (SCHMIDT et al. 1999; TRITTO et al. 2003) and was named sting (Stellate interacting gene). Later, sting was determined to be an allele of aubergine (HARRIS and MACDONALD 2001). The name of this allele was thus changed to auberginesting (aubsting).

aubsting is not a "loss-of-function mutation" because its transcript is produced but it is not properly regulated in both sexes (SCHMIDT et al. 1999). In the testes of homozygous aubsting males, STELLATE crystalline aggregates form, the morphology of which depends on the number of the X-linked Stellate repeats; such males also exhibit meiotic defects in chromosome condensation and segregation. This behavior overlaps the phenotype resulting from a deletion of crystal (SCHMIDT et al. 1999; TRITTO et al. 2003). The crystal-Stellate system represents the first case of "natural dsRNA-mediated silencing"; in fact, in wild-type testes the production of STELLATE protein, the main component of crystals in the spermatocytes of aubsting mutants, is prevented by the degradation of Stellate mRNA, accompanied by the production of 25–27 nt siRNAs (ARAVIN et al. 2001). In X/Ycry males no such siRNAs are found, and Stellate mRNA is translated, leading to the production of STELLATE protein and the formation of crystalline aggregates in spermatocytes. In addition, five different Stellate/crystal homologous rasiRNAs have been identified in X/Y male testes (ARAVIN et al. 2003).

Our present understanding of dsRNAi has so far relied on the identification and characterization of numerous molecules involved in different RNAi pathways (KIM 2006; SAITO et al. 2006; VAGIN et al. 2006; WATANABE et al. 2006; PELISSON et al. 2007). In the present study we demonstrated that the auberginesting (aubsting) mutation produces an increased transcription of the aub gene leading to overexpression of the AUB protein in somatic tissues. The subsequent analysis of the RNAi triggered by a yellow hairpin dsRNA revealed that the gene silencing was impaired in aubsting mutants, suggesting that the overexpression of AUB protein interferes with some crucial component or function of the RNAi pathway in somatic tissues.


MATERIALS AND METHODS

Fly stocks:

The auberginesting P-insertion line (BIER et al. 1989; SCHMIDT et al. 1999) was kept over the CyO balancer chromosome (LINDSLEY and ZIMM 1992) and made homozygous when required in backcrosses throughout the experiments described below. We also used two different aubergine alleles that we ordered from the Bloomington Stock Center: aub[HN] cn[1] bw[1]/CyO (BL-8517) and w[1118]; aub[QC42] cn[1] bw[1]/CyO, P{ry[+t7.2] = sevRas1.V12}FK1 (BL-4968). In addition we used the strain called UAS-aub, kindly provided by M. Snee from the laboratory of Paul Macdonald. It is a transgenic fly strain UAS-GFP-aub (HARRIS and MACDONALD 2001).

The UAS-y-IR 5F transgenic line has already been described (PICCIN et al. 2001). It is homozygous for the UAS-y-IR transgene (single copy) which has been mapped to 3R 98–99. The transgenic line Act5C-GAL4/TM6B, Tb was obtained from the Bloomington Stock Center (strain 3954, y, w; P{w+; Act5C-GAL4}17bFO1/TM6B, Tb). Individuals from this line produce GAL4 constitutively under the control of an actin promoter. Sco/CyO; MKRS/TM6B is a compound strain with balancers for the two main autosomes carrying dominant mutations; the Sco chromosome present in this strain is Tp(2;2) nocSco (LINDSLEY and ZIMM 1992). w/w; Apt/TM6B is a strain used in the procedure adopted to set up the fly stock bearing the Act5C-GAL4 and UAS-y-IR constructs in association with the third chromosome. Flies were raised on a standard yeast–glucose–agar medium (ROBERTS and STANDEN 1998) and were maintained at 25°, 70% relative humidity, in 12-hr light/12-hr dark cycles.

Construction of the fly stock bearing the Act5C-GAL4 and UAS-y-IR constructs on the third chromosome:

We used transgenic line 5F (which is homozygous for the UAS-y-IR construct) and the transgenic Act5C-GAL4/TM6C, Tb "driver" line expressing GAL4 under the control of the Actin5C promoter (PICCIN et al. 2001). Using a number of crosses, we generated the w/w/Y; Act5C-y-IR/TM6B line, which, due to constitutive expression of the UAS-y-IR transgene, generates yellow male and female phenocopies.

Microscopy and images:

Phenotypes were scored using a Nikon stereomicroscope; images were collected using a Nikon digital camera mounted on a Leica stereomicroscope.

Total RNA extraction:

Total RNA was extracted from 30 mg of adults (~30 females and 40 males deprived of gonads) using RNeasy mini kit (QIAGEN, Valencia, CA) reagent following the manufacturer's protocol. The RNA concentration and purity were determined photometrically by measuring absorbance at 260 nm and A260/A280 ratio. Samples were then dissolved in 15 µl of mix (470 µl deionized formamide, 157 µl 37% formaldehyde, 98 µl 10x MOPS, 275 µl sterile water) and heated at 60° for 15 min. Two microliters of RNA loading buffer were added to each sample. Electrophoresis was performed on a 1% agarose MOPS formaldehyde gel as described in (SAMBROOK et al. 1989).

Northern blot analysis:

After electrophoresis the formaldehyde–agarose gel was photographed and washed in sterile water for 10 min and then in 20x SSC for 1 hr. Transfer was performed on a Hybond N membrane (Amersham, Piscataway, NJ) overnight. Baking was for 45 min at 80° under vacuum. Hybridization was performed in 25 ml of 5x SSPE/5x Denhardt's/0.5% SDS/herring sperm DNA (100 µg/ml) at 68° overnight. After hybridization, the filter was washed at 68° for 5 min in 2x SSC/0.1% SDS twice and then in 1x SSC/0.1% SDS for 15 min. Autoradiography was performed using Kodak film.

Probes amplification and cloning:

A 1143-bp coding fragment from yellow cDNA, amplified with upper primer 5' CTTGACTTGACCAGCCATAC 3' (with the XbaI site at the 5' end of the primer) and lower primer 5' ATGATGCCACCACCCAGATTG 3' (with the HindIII site at the 5' end of the primer) was obtained by RT–PCR; afterward it was inserted in the pGEM7 vector. The yellow fragment was excised by XbaI–HindIII restriction enzymes and labeled with standard random priming procedure using 5 µl of 32P-dATP (3000 Ci/mmol).

For normalization of the RNA amount we used the 28S RNA. We synthesized the first strand, from total RNA extracted from adults, using a 28S rRNA RT–PCR lower primer 5' ATAAAACAGAAAAGAAAACT 3' and the SuperScript II RNaseH-reverse transcriptase (Invitrogen, Carlsbad, CA). Afterward we amplified adding the upper primer 5' TAAAACAGCAGGACGGTGAT 3'. The PCR profile consisted of a denaturation step (94°, 10 min) followed by 40 cycles (94° 1 min; 50° 1 min; 72° 1 min); for the last cycle only the elongation step (72°) was extended to 10 min. The 500-bp fragment was then labeled with standard random priming procedure using 2 µl of 32P-dATP (SA 3000 Ci/mmol).

cDNA synthesis from total RNA:

Total RNA was extracted, as described before. To remove all the DNA in the preparation, the samples were incubated with DNase I RNase free (Roche, Indianapolis) (1 unit/µg RNA) at 37° for 10 min, in a total volume of 100 µl. After treatment DNase was inactivated at 75° for 10 min. DNase treated RNA was precipitated at –80° overnight and it was dissolved in 30 µl of distilled water. For first-strand cDNA synthesis, 5 µg of total RNA was used as a template for oligonucleotides dT(17) primed reverse transcription using SuperScript II RNaseH-reverse transcriptase (Invitrogen), according to the manufacturer's instructions.

Quantitative real-time PCR:

Real-time RT–PCR was performed in the SmartCycler real-time PCR (Cepheid, Sunnyvale, CA). Relative abundance of the yellow and aubergine transcripts was determined by real-time PCR using Fluo cycle for SYBR Green (Celbio) according to the manufacturer's protocol. For quantification of the yellow transcripts we used the standard curve method as described in (PONCHEL et al. 2003; LARIONOV et al. 2005) whereas we used the 2{Delta}{Delta}ct method (LIVAK and SCHMITTINGEN 2001) for the aubergine transcript determination. The primers for yellow transcript were yellow upper 5' GTGTGATGAGCGATGATGGA 3' and yellow lower 5' GCAAGAAAACGGGCATCCTA 3'; the primers for rp49 transcript were rp49 upper 5' ATCGGTTACGGATCGAACAA 3' and rp49 lower 5' GACAATCTCCTTGCGCTTCT 3' (for the standard curve of rp49 we used a clone kindly provided by Maria Berloco from the Genetics laboratory (University of Bari, Bari, Italy); the clone has a 700-bp EcoRI–HindIII coding fragment from rp49 cDNA inserted in the EcoRI–HindIII site of pUC vector); and the primers for the aub transcript were aubergine upper 5' CGTGGTCGAGGAAGAAAGCC 3' and aubergine lower 5' CCCACTTGAGCATCACCACC 3' [for the standard curve of aubergine we used the amplicon obtained by RT–PCR using the described primers; to be sure that it was the specific product of the aub gene we sequenced it; in addition we determined the melting temperature (Tm) of the amplicon]. PCR amplification was performed in a final volume of 25 µl using standard cycling parameters [10 min, 95°; 30 sec, 95°; 30 sec, 53° (yellow), 56° (rp49) and 60° (aubergine); 30 sec, 72° with the latter three steps repeated 45 times]. For each sample we calculated the amplification efficiency E = [10–1/slope] – 1 and the melting curve to ensure that the desired amplicon was detected. The efficiencies of amplification of the target genes and the control were approximately the same.

In the standard curve method, the sample amount was calculated as follows: sample [pg] = 10(ct sample – intercept)/slope. Normalization for each determination was obtained by dividing each quantitative value calculated for yellow by the quantitative value of the rp49 gene, in experimental samples. For all the genotypes we also calculated the coefficient of variation (CV) as standard deviation/mean value. Afterward, value 1 was assigned to the yellow relative amount with respect to the rp49 amount in the control genotype (aubsting/aubsting) and the fold change for each analyzed genotype was calculated. The error of the relative amount of yellow/rp49 was calculated as CV with this formula: Formula; the standard deviation shown on the graph was calculated as standard deviation = CV x mean value.

In the 2{Delta}{Delta}ct method, the relative amount of aub transcript (fold change) was calculated as follows: Formula [CtX is Ct of gene of interest (aub) and CtR is Ct of reference gene (rp49); test refers to the different cDNAs to analyze and control refers to the cDNA of reference (wild type)]. The error was calculated as Formula.

Protein extraction and Western blotting:

Protein samples were prepared from dissected tissues (40 mg) by squashing them and extracting the proteins in lysis buffer (6% SDS, 1 mM EDTA, 0.2 mM PMFS).

Samples were denatured in single-strength sample buffer [10 mM Tris/HCl, pH 8, 1 mM EDTA, 10% (v/v) glycerol, 2% (w/v) SDS, 5% (v/v) β-mercaptoethanol and 0.001% (w/v) bromophenol blue], heated for 5 min at 100°, and subjected to SDS–PAGE in minislab gel containing 10% acrylamide and 0.10% bisacrylamide. Molecular-weight markers were run to estimate the molecular weight of the immunoreactive band. After electrophoresis, the proteins were transferred electrophoretically (100 V for 1 hr) to a sheet of nitrocellulose using the mini Bio-Rad trans blot apparatus and 20 mM Tris, 150 mM glycine, 20% (v/v) methanol at pH 8.2 as transfer buffer. After protein transfer, the nitrocellulose sheet was incubated with 3% BSA (w/v) in 10 mM Tris/HCl pH 7.5, 150 mM NaCl and hybridized with anti-AUB/STING antibody, a rabbit polyclonal antiserum, ab17724 (Abcam, Cambridge, MA), diluted 1:500 in TNT buffer (10 mM Tris/HCl, pH 7.5, 150 mM NaCl, 0.5% Triton X-100). This antibody was raised against a 20-amino-acid peptide located at the C-terminal of the AUBERGINE protein (Abcam, C. WONG, personal communication). This peptide is specific for the AUBERGINE protein and no similarities have been found with any of the other PPD Drosophila proteins. Hybridization was performed overnight at room temperature. After washing, a peroxidase-conjugated donkey antirabbit IgG (Amersham) 1:2500 diluted in TNT buffer was used as the substrate for the colorimetric peroxidase reaction.


RESULTS

The aubergine gene is overexpressed in somatic tissues of aubsting mutants:

In a previous analysis by Northern blot, reported in SCHMIDT et al. (1999), we demonstrated that the expression of aub occurs prevalently in germ tissues. To quantify the amount of aub transcript in somatic tissues of homozygotes aubsting/aubsting compared to the heterozygotes and to the wild-type individuals, we performed quantitative real-time PCR starting from RNA extracted from males and females deprived of gonads. The Tm of the amplified fragment confirmed the specificity of the aub amplicon. We calculated the relative amount of aub transcript compared to rp49 transcript in the genotypes of interest using the 2{Delta}{Delta}ct method described in MATERIALS AND METHODS. Our results show that in wild-type (+/+) male somatic tissues the aub gene transcription takes place but it is improperly upregulated in both aubsting/aubsting and in aubsting/CyO male somatic tissues (supplemental Table 1 and Figure 1A, bars 2 and 3) compared to wild type (Figure 1A, bar 1). Similar results were obtained in female somatic tissues (supplemental Table 2 and Figure 1C) even if the basal aub gene transcription in wild-type (+/+) gonadless female carcasses is slightly more abundant than in wild-type (+/+) gonadless male carcasses and the increase of the aub gene transcript is reduced in gonadless female carcasses (Figure 1C) compared to gonadless male carcasses (Figure 1A). We also estimated the amount of AUB protein in aubsting/aubsting and in aubsting/CyO male mutants by Western blot. Drosophila AUB antiserum was a commercial antibody specific to the AUB protein (see MATERIALS AND METHODS). It recognizes an ~97- to 98-kDa band as expected (Figure 2). We demonstrate that there is an evident increase of AUB protein in aubsting/aubsting and in aubsting/CyO gonadless male carcasses compared to the control (Figure 2B, sections 2, 3, and 1, respectively), as expected by the transcriptional analysis reported before. These results are confirmed by the densitometric analysis reported in Figure 2C where a 3.5-fold increment in the aubsting/aubsting (Figure 2C, bar 2) and a 1.5-fold increment in aubsting/CyO (Figure 2C, bar 3) with respect to wild type (Figure 2C, bar 1), is shown. All the densitometric values are reported in supplemental Table 3. We made three different Western blot experiments and we obtained the same results (data not shown).


Figure 1
View larger version (20K):
In this window
In a new window
Download PPT slide
 
FIGURE 1.—

Real-time PCR of aub transcript. Relative amounts of aub transcript respect to rp49 in total RNA from gonadless carcasses are expressed on an arbitrary scale described in the text. (A) Bar 1, males +/+; bar 2, males aubsting/aubsting; bar 3, males aubsting/CyO. (B) Fold change of aub transcript of the same genotypes reported in A vs. +/+. (C) Bar 1, females +/+; bar 2, females aubsting/aubsting; bar 3, females aubsting/CyO. (D) Fold change of aub transcript of the same genotypes reported in C vs. +/+.

 

Figure 2
View larger version (30K):
In this window
In a new window
Download PPT slide
 
FIGURE 2.—

(A) Gel electrophoresis stained with Blue Comassie of proteins extracted from 40 mg of gonadless male carcasses from different genotypes. M, marker; lane 1, +/+; lane 2, aubsting/aubsting; lane 3, aubsting/CyO. (B) Western blot of gel reported in A, stained with an anti-AUBERGINE antibody. (C) Graph showing the densitometric analysis of the relative amount of AUB protein in Figure 2B (measured as OD x millimeters x millimeters) with respect to three different bands of proteins (marked with arrows) selected as controls. The arbitrary value of 1 was assigned to wild-type males. Bar 1, gonadless male carcasses +/+; bar 2, gonadless male carcasses aubsting/aubsting; bar 3, gonadless male carcasses aubsting/CyO. The densitometric values are reported in supplemental Table 3.

 

aubsting homozygous flies bearing the Act5C-y-IR chromosome exhibit a yellow+ phenotype:

We employed an UAS-y-IR transgenic line previously obtained in our laboratory causing heritable functional knockdown of an adult phenotype by the in vivo GAL4-driven production of a yellow-specific hairpin dsRNA. In particular, the UAS-y-IR construct consists of two inverted portions of the yellow gene, spaced by a heterologous sequence, placed under the control of a UAS domain. We previously showed that the progeny of crosses between flies harboring this transgene and flies expressing different GAL4 drivers, such as daughterless (da-GAL4) and actin (Act5C-GAL4), produced perfect yellow2 and yellow1 phenocopies, respectively (PICCIN et al. 2001). A stable strain, bearing Act-Gal4 and UAS-y-IR on the third chromosome was obtained by recombination. In this transgenic line, named Act5C-y-IR, transcriptional activation by Gal4 constitutively produces a dsRNA hairpin bearing cognate sequences to the yellow gene (y), which causes continuing degradation of y mRNA and the flies are therefore yellow1 (y1) phenocopies (PICCIN et al. 2001).

We decided to use this "tester" genetic background to evaluate whether the auberginesting mutation affects the degradation of y mRNA, thus restoring the wild-type phenotype. We employed dominant markers on chromosomes 2 and 3 to distinguish, among the progeny bearing the Act5C-y-IR constructs, flies that were homozygous from those that were heterozygous for auberginesting. In this experiment we used the Sco/CyO; MKRS/TM6B strain to introduce dominant markers on chromosome 3 of the aubsting strain and on chromosome 2 of the Act5C-y-IR strain; at first we crossed aubsting/CyO; TM6B males with +/Sco; Act5C-y-IR/MKRS females; we recovered aubsting/Sco; Act5C-y-IR/TM6B males and aubsting/Sco; Act5C-y-IR/TM6B females to be crossed.

From this cross we selected 100 individuals that were homozygous and heterozygous for aubsting and carried the Act5C-y-IR chromosome (since homozygosis for Sco and for Act5C-y-IR chromosome results in lethality, only aubsting/aubsting; Act5C-y-IR/ TM6B and aubsting/Sco; Act5C-y-IR/ TM6B genotypes are present). All the individuals that were phenotypically Sco showed a yellow-like phenotype, whereas all the individuals that were phenotypically Sco+ were also phenotypically yellow+. Chromosome-specific dominant markers allowed us to confirm that the wild-type (yellow+) progeny, bearing the Act5C-y-IR construct, were also aubsting homozygous. In Figure 3 all the individuals with the different genotypes examined are represented. Unlike males bearing the Act5C-y-IR construct (Figure 3B), which are very similar to yellow1 males (Figure 3A), aubsting heterozygous males [showing the Scutoid (Sco) phenotype], which are characterized by the loss of 10–15 sternal bristles (LINDSLEY and ZIMM 1992), have a yellow-like phenotype (Figure 3C), even if it is less evident than in the +/+ males bearing the Act5C-y-IR construct. In contrast the aubsting/aubsting homozygous males showed wild-type (yellow+) pigmentation (Figure 3D). In females the difference between aubsting heterozygous and homozygous individuals is not so clear (Figure 3, G and H). This could be explained with a reduction in the effect of the Act5C-y-IR construct in females and in fact in these flies the yellow phenotype due to the presence of the construct is not so strong (Figure 3F).


Figure 3
View larger version (107K):
In this window
In a new window
Download PPT slide
 
FIGURE 3.—

Phenotypes observed in the progeny of crosses described in the text. (A) yellow1 hemizygous male; (B) male bearing the Act5C-y-IR construct (yellow); (C) heterozygous aubsting male bearing the Act5C-y-IR construct; (D) homozygous aubsting male bearing the same Act5C-y-IR construct (yellow+) (E) yellow1 homozygous female; (F) female bearing the Act5C-y-IR construct (yellow); (G) heterozygous aubsting female bearing the Act5C-y-IR construct; and (H) homozygous aubsting female bearing the same Act5C-y-IR construct (yellow+).

 

UAS-aub flies bearing the Act5C-y-IR chromosome exhibit a yellow+ phenotype:

To confirm that the aub gene overexpression is the cause of the impaired RNAi process in somatic tissues, we used a UAS-aub strain that, subsequent to the activation by the Gal4 protein, overexpresses the aub gene and is able to rescue aub loss-of-function mutant defects (HARRIS and MACDONALD 2001). We crossed UAS-aub males with Act5C-y-IR/TM6B females to obtain individuals bearing the Act5C-y-IR construct in which the aub gene is overexpressed because of the constitutive Gal4 protein production. To compare the expression of the aub gene in the UAS-aub strain after Gal4 protein activation we performed real-time PCR experiments in these individuals. The results are shown in supplemental Tables 4 and 5 and in supplemental Figure 1S. It is clear that there is an increment of the aub gene transcription in Act5C-y-IR/UAS-aub individuals (supplemental Figure 1S, A, bar 2, and C, bar 2); it increases 7.5-fold in males and 7.2-fold in females with respect to UAS-aub individuals. The Act5C-y-IR/UAS-aub individuals showed a yellow+ phenotype (supplemental Figure 2S, B and E), supporting the hypothesis that the overexpression of the aub gene is responsible for the impaired RNAi in somatic tissues.

aubHN/aubQC42 transheterozygous flies bearing the Act5C-y-IR chromosome exhibit a yellow phenotype:

To support the idea that Aub overexpression in an aubsting mutant background is responsible for the suppression of yellow RNAi, we decided to look at the phenotypes of aubHN/aubQC42 heteroallelic flies in the presence of the Act5C-y-IR construct. It is known that the aubHN and aubQC42 alleles show hypomorphic phenotypes (WILSON et al. 1996) and in the transheterozygotes aubHN/aubQC42 the RNAi process is impaired in germ tissues (KENNERDELL et al. 2002; VAGIN et al. 2006). To obtain flies with the genotypes of our interest we used the Sco/CyO; MKRS/TM6B strain to introduce dominant markers on chromosome 3 of the aubHN strain and on chromosome 2 of the Act5C-y-IR strain; we crossed aubHN/Sco; +/TM6B males with +/CyO; Act5C-y-IR /MKRS females. We recovered aubHN/CyO; Act5C-y-IR/TM6B males and they were crossed with aubQC42/CyO; +/+ females. From this cross we selected individuals that were aubHN/aubQC42; Act5C-y-IR/+ transheterozygotes. All these flies show a yellow-like phenotype as shown in supplemental Figure 3S, C and G, and for this reason we can conclude that in these flies, somatic RNAi, triggered by a hairpin yellow dsRNA, works. This result strongly supports our suggestion that in aubsting homozygous flies somatic RNAi is impaired because of the overexpression of the AUB protein.

RNAi of yellow transcript in Act5C-y-IR is impaired in somatic tissues of aubsting mutants:

To provide further support to the phenotypic analysis, we decided to analyze the expression of the yellow gene in all the informative genotypes. For this purpose we performed a Northern blot analysis from total RNA extracted from male and female adults in the following genotypes: (1) (+/+); Act5C-y-IR/TM6B, (2) aubsting/aubsting; +/+, (3) aubsting/aubsting; Act5C-y-IR/TM6B, and (4) aubsting/Sco; Act5C-y-IR/TM6B. We hybridized the resulting filter with yellow cDNA and 28S DNA as a control. The results are shown in Figure 4A. We measured the intensity of each spot (OD x millimeters x millimeters) using the Kodak Molecular Imaging software and the relative amount of yellow transcript was determined by comparison with the amount of 28S RNA. All the values are reported in Figure 4B, and the related graph is shown in Figure 4C; an arbitrary value of 1 was assigned to aubsting homozygous males (bar 2) and females (bar 6). These data suggest that aubsting homozygotes, bearing the Act5C-y-IR constructs, do not show the reduction of the yellow transcripts that is seen in the Act5C-y-IR; +/+ individuals (compare bars 1 and 3 for males and bars 5 and 7 for females). This phenomenon is more evident in males than in females.


Figure 4
View larger version (44K):
In this window
In a new window
Download PPT slide
 
FIGURE 4.—

(A) Northern blot analysis of total RNA extracted from adult individuals and hybridized with yellow and amplified 28S probes. Lane 1, males +/+; Act5C-y-IR/TM6B; lane 2, males aubsting/aubsting; +/+; lane 3, males aubsting/aubsting; Act5C-y-IR/TM6B; lane 4, males aubsting/Sco; Act5C-y-IR/TM6B; lane 5, females +/+; Act5C-y-IR/TM6B; lane 6, females aubsting/aubsting; +/+; lane 7, females aubsting/aubsting; Act5C-y-IR/TM6B; lane 8, females aubsting/Sco; Act5C-y-IR/TM6B. (B) Densitometric values measured as (OD x millimeters x millimeters) from the Northern blot described in A. (C) Graph resulting from the relative amounts of the yellow transcript with respect to the 28S RNA amount, expressed on an arbitrary scale as described in the text. Bar 1, males +/+; Act5C-y-IR/TM6B; bar 2, males aubsting/aubsting; +/+; bar 3, males aubsting/aubsting; Act5C-y-IR/TM6B; bar 4, males aubsting/Sco; Act5C-y-IR/TM6B; bar 5, females +/+; Act5C-y-IR/TM6B; bar 6, females aubsting/aubsting; +/+; bar 7, females aubsting/aubsting; Act5C-y-IR/TM6B; bar 8, females aubsting/Sco; Act5C-y-IR/TM6B.

 
To exactly determine the amount of the yellow transcripts in somatic tissues, we performed a quantitative real-time PCR. We analyzed gonadless males and females of all the genotypes of our interest: (1) +/+; Act5C-y-IR/TM6B, (2) aubsting/aubsting; +/+, (3) aubsting/aubsting; Act5C-y-IR/TM6B, (4) aubsting/Sco; Act5C-y-IR/TM6B, (5) aubHN/aubQC42; Act5C-y-IR/+, and (6) +/+; UAS-aub/Act5C-y-IR. We determined the relative amounts of yellow transcript with respect to the rp49 transcript (as an internal control) for every single determination.

For all the genotypes we also calculated the CV; the results for all the determinations are reported in supplemental Tables 6 (males) and 7 (females). Hence a value of 1 was assigned to the relative amount of yellow with respect to the amount of rp49 in the control genotype (aubsting/aubsting; +/+) and the fold change for each genotype analyzed was calculated. The relative amount and the error associated with the yellow/rp49 estimate are shown in Figure 5. We observed a drastic reduction of y mRNA in Act5C-y-IR transgenic individuals compared to aubsting homozygotes in both males (about 1% of expression) and females (about 30% of expression) (Figure 5A, bar 1 and Figure 5C, bar 1) confirming the phenotypic observations (Figure 3, B and F and supplemental Figure 2S). The silencing of the yellow gene is dramatically reduced when the genetic background of the transgenic organisms is aubsting/aubsting; +/+ and less reduced in the aubsting/Sco; +/+ genotype. Individuals homozygous for the aubsting mutation, constitutively knocked down for the yellow transcript, show yellow mRNA levels comparable to controls (aubsting/aubsting; +/+), 80% for males (Figure 5A, bar 3) and 73% for females (Figure 5C, bar 3). A similar, but weaker, effect can be observed in heterozygous flies aubsting/Sco; +/+, 13% in males (Figure 5A, bar 4) and 35% in females (Figure 5C, bar 4). Silencing of the yellow gene is reduced by ~80% in somatic tissues of males and by ~43% in females, confirming the phenotypic observation (compare Figure 3, B and D, for males and Figure 3, F and H, for females). Unlike the aubsting homozygotes the reduction of yellow silencing is not observed in the aubHN/aubQC42; Act5C-y-IR/+ individuals (supplemental Figure 3S and Figure 5, A and C, bar 5). We also demonstrated that in UAS-aub bearing the Act5C-y-IR construct, the silencing of hairpin yellow dsRNA is impaired as in aubsting homozygotes (supplemental Figure 2S and Figure 5, A and C, bar 6).


Figure 5
View larger version (27K):
In this window
In a new window
Download PPT slide
 
FIGURE 5.—

Real-time PCR of yellow transcript. Relative amounts of yellow transcript with respect to rp49 in total RNA from gonadless adults are expressed on an arbitrary scale described in the text. (A) Bar 1, males +/+; Act5C-y-IR/TM6B; bar 2, males aubsting/aubsting; +/+; bar 3, males aubsting/aubsting; Act5C-y-IR/TM6B; bar 4, males aubsting/Sco; Act5C-y-IR/TM6B; bar 5, males aubHN/aubQC42; Act5C-y-IR/ TM6B; bar 6, males +/+; Act5C-y-IR/UAS-aub. (B) Fold change of yellow transcript of the same genotypes reported in A vs. aubsting/aubsting. (C) Bar 1, females +/+; Act5C-y-IR/TM6B; bar 2, females aubsting/aubsting; +/+; bar 3, females aubsting/aubsting; Act5C-y-IR/TM6B; bar 4, females aubsting/Sco; Act5C-y-IR/TM6B; bar 5, females aubHN/aubQC42; Act5C-y-IR/TM6B; bar 6, females +/+; Act5C-y-IR/UAS-aub. (D) Fold change of yellow transcript of the same genotypes reported in C vs. aubsting/aubsting.

 
All these results confirm that the impairing of the yellow silencing in somatic tissues is correlated to AUB overexpression in aubsting/aubsting; Act5C-y-IR/TM6B individuals.


DISCUSSION
In this article we have first of all analyzed the aub gene and protein expression in aubsting mutants because we were interested in finding out whether AUB also plays a role in somatic tissues, due to the great importance that the Piwi subclade of the PPD proteins have in different RNAi pathways. Our results show that the aub gene is not only expressed in germ tissues, as previously reported (SCHMIDT et al. 1999), but also in male and female somatic tissues (supplemental Table 1). We also demonstrate that aub gene expression increases in somatic tissues of aubsting homozygotes and to a lesser extent in heterozygotes; this increment is more evident in somatic tissues of males than in females (Figure 1) as previously suggested by Northern blot analyses (SCHMIDT et al. 1999). In this article we also show that the increment of the aub transcript in aubsting homozygous mutants corresponds to an increase in the amount of AUB protein (Figure 2). Following the characterization of the auberginesting mutation we used a genetic approach, based on the Act5C-y-IR strain, to investigate the effects of the increasing amount of AUB protein on the RNAi pathway occurring in somatic tissues in vivo.

The genetic experiments showed that the homozygous aubsting adults bearing the Act5C-y-IR construct, expected to exhibit the yellow phenotype due to RNA interference, were instead phenotypically wild type (Figure 3). We obtained similar results in the genetic background bearing both the UAS-aub and Act5C-y-IR constructs (supplemental Figure 2S). In addition we performed similar crosses using a loss-of-function heteroallelic combination: aubHN/aubQC42; Act5C-y-IR/+. The results (supplemental Figure 3S) showed that somatic RNAi functions properly in this genetic background; in fact aubHN/aubQC42; Act5C-y-IR /+ flies show a yellow-like phenotype. From the phenotypic analysis we proposed that the overexpression of the aub gene is the cause of the impaired RNAi in somatic tissue. Confirmation of the phenotypic observations came from analysis of the yellow transcript levels, by either Northern blot experiments or by quantitative RT–PCR (Figures 4 and 5 and supplemental Tables 6 and 7). Together these results strongly suggest that the increased amount of AUB protein observed in aubsting mutants is responsible for the malfunctioning of in vivo RNAi, and this causes the failed transcriptional knockdown of yellow in the Act5C-y-IR/+; aubsting/aubsting genotype (Figure 5). We still do not have an explanation for the observed difference between the two sexes with respect to the silencing of the yellow gene triggered by a yellow dsRNA (Figure 3, B and F, and supplemental Tables 6 and 7).

How might an increased amount of AUB protein interfere with the proper functioning of RNAi in somatic tissues? A function for AUB in somatic RNAi has not been demonstrated so far; in fact a recent article showed that in Drosophila, AUB as well as PIWI are not required for hairpin-induced RNAi triggered by the GMR-w-IR transgene in the eye (PELISSON et al. 2007). From our results we could hypothesize that the increased amount of AUB somehow interferes with RISC formation in Drosophila somatic tissues. It is known that a central step in functional RISC assembly is the interaction between an ARGONAUTE protein and the small RNAs with two overhanging nucleotides at their 3' ends; the recognition occurs by means of the PAZ domain of the AGO protein (LIU et al. 2004; SONG et al. 2004; KAVI et al. 2005). Subsequently, in the effector step, the small unwound RNAs guide the recognition of the RNAs to be degraded and slicing occurs by means of the DDH motif of the RNase H domain of the AGO proteins (LIU et al. 2004; MEISTER et al. 2004; SONG et al. 2004). In mammalian cells four Ago subfamily proteins have been identified: AGO1–AGO4. It has been reported that only AGO2 can cut the cognate mRNAs because it is the only one possessing the DDH motif in the PIWI domain that is competent for the "slicing" activity (MEISTER et al. 2004). The overexpression of AGO1, AGO3, and AGO4 interfere with the correct functioning of the RNAi pathway; in fact these proteins enter into the RISC but they are not able to slice the cognate mRNAs because they lack the DDH residues. As a matter of fact, in Drosophila it is known that the DmAGO2-containing RISC is involved in RNAi triggered by a hairpin dsRNA in somatic tissues (LEE et al. 2004). To test whether AUBERGINE had all the conserved amino acid residues in crucial positions of the PIWI domain we aligned the Piwi domains of four Drosophila AGO proteins: PIWI, AUB, DmAGO1, and DmAGO2. The obtained alignment, which is shown in supplemental Figure 4S, demonstrates that they have the DDH motif, which should allow them to conserve the slicing functionality. These results suggest that a different explanation should be sought for the "disturbance" caused by the overexpression of Drosophila AUB, in somatic tissues, with respect to that proposed for human cells (MEISTER et al. 2004). One alternative scenario to explain why the RNAi pathway is impaired in auberginesting mutants could be as follows: by virtue of its PAZ domain, which is highly conserved in all Drosophila AGO proteins, AUB could bind the yellow siRNAs produced by the Dicer2/R2D2 initiator RNAi complex, subtracting them away from the competent somatic RISC and thus blocking yellow mRNA degradation. In human cells, it has been demonstrated that the Piwi domain of AGO2 and the RNaseIII domain of Dicer interact directly (DOI et al. 2003); this interaction is mediated by the PIWI box region in the Piwi domain (COX et al. 1998; TAHBAZ et al. 2004; LINGEL and SATTLER 2005). The "PIWI box" of AUBERGINE appears to be slightly different, as shown in supplemental Figure 4S, from that of AGO2 which is competent for RNAi in somatic tissues leading to the suggestion that because of its different PIWI box AUB may not be able to interact with the Dicer-2/R2D2 complex and the AGO protein in the somatic RISC (TAHBAZ et al. 2004; LINGEL and SATTLER 2005). Alternatively, AUB might be able to interact normally only with specific cofactors which are expressed in germ and not in somatic tissues. If this were the case, an AUB-competent RISC can be hypothesized to function specifically in germ tissues. Interestingly, AUB was thought to have a major role in silencing repetitive elements at the germ-tissue level (VAGIN et al. 2006; BRENNECKE et al. 2007; NISHIDA et al. 2007). In addition it has been recently demonstrated that the defects in polarization of the embryo in aub loss-of-function mutants are suppressed by mutations in genes coding for ATR and CHK2 kinases involved in double-strand-break signaling. This suggests that the rasiRNA pathway could not be involved in axis specification but only in suppressing DNA damage signaling in the germ line (CHEN et al. 2007; KLATTENHOFF et al. 2007). Our results support the idea that the Argonaute proteins are not interchangeable but that they have very specific roles in different RNAi pathways functioning in different tissues, at different times and in different physiological pathways.

It is becoming clear that each Piwi subclade protein binds a specific class of small interfering RNAs (piRNAs and/or rasiRNAs); Drosophila AUB and PIWI preferentially bind the antisense strands whereas AGO3 preferentially binds the sense strands of the rasi/piRNAs. Despite their differences in size and in the RNA strand involved in the binding with the PIWI proteins (rasi/piRNAs isolated from different complexes are similar from the point of view of the type of genomic elements to which they correspond) these sequences are mainly transposons (VAGIN et al. 2006; BRENNECKE et al. 2007; GUNAWARDANE et al. 2007; LIN 2007). An increased amount of the AUB proteins did impair the Stellate silencing in vivo but could not interfere with the in vitro production of small RNAs (siRNAs) in testicular extracts (VAGIN et al. 2004), because the extra AUB protein produced by aubsting mutants has a normal role in testis and in fact it binds the rasi/piRNAs.

Although much still remains to be done toward the detailed comprehension of the molecular machinery involved in RNAi, our work provides useful entry points to the unraveling of the role of AUBERGINE and other Piwi subfamily proteins in the Drosophila germ line and in somatic RNAi.


ACKNOWLEDGEMENTS
We thank P. Macdonald and M. Snee for providing the UAS-GFP-aub strain. We also thank Serafina Massari and Sergio Pimpinelli for critical reading of the manuscript. This study was supported by a grant from the Ministero dell'Università e della Ricerca (MIUR) project: genetic and molecular characterization of RNA interference involved genes in Drosophila melanogaster. V.S. was supported by a grant provided by MIUR for the same project. R.C. acknowledges financial support from the European Community (the 6th Framework Project EUCLOCK no. 018741). R.C. also acknowledges grants from MIUR and the Italian Space Agency (DCMC grant).


FOOTNOTES
1 Deceased. Back


LITERATURE CITED

ARAVIN, A. A., N. M. NAUMOVA, A. V. TULIN, V. V. VAGIN, Y. M. ROZOVSKY et al., 2001 Double stranded RNA-mediated silencing of genomic tandem repeats and transponsable elements in the Drosophila melanogaster germline. Curr. Biol. 11: 1017–1027.[CrossRef][Medline]

ARAVIN, A., M. LAGOS-QUINTANA, A. YALCIN, M. ZAVOLAN, D. MARKS et al., 2003 The small RNA profile during Drosophila melanogaster development. Dev. Cell 5: 337–350.[CrossRef][Medline]

ARAVIN, A., D. GAIDATZIS, S. PFEFFER, M. LAGOS-QUINTANA and P. LANDGRAF, 2006 A novel class of small RNAs bind to MILI protein in mouse testes. Nature 442: 203–207.[Medline]

BIER, E., H. VAESSIN, S. SHEPHERD, K. LEE, K. MCCALL et al., 1989 Searching for pattern and mutation in the Drosophila genome with a P-lacZ vector. Genes Dev. 3: 1273–1287.[Abstract/Free Full Text]

BRENNECKE, J., A. A. ARAVIN, A. STARK, M. DUS, M. KELLIS et al., 2007 Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell 128: 1089–1103.[CrossRef][Medline]

CARMELL, M. A., Z. XUAN, M. Q. ZHANG and G. J. HANNON, 2002 The Argonaute family: tentacles that reach into RNAi, developmental control, stem cell maintenance, and tumorigenesis. Genes Dev. 16: 2733–2742.[Free Full Text]

CARTHEW, R. W., 2006 Molecular biology. A new RNA dimension to genome control. Science 313: 305–306.[Abstract/Free Full Text]

CATALANOTTO, C., G. AZZALIN, G. MACINO and C. COGONI, 2002 Involvement of small RNAs and role of the qde genes in the silencing pathway in Neurospora. Genes Dev. 16: 790795.

CAUDY, A. A., M. MYERS, G. J. HANNON and S. M. HAMMOND, 2002 Fragile X-related protein and VIG associate with the RNA interference machinery. Genes Dev. 16: 24912496.

CERUTTI, H., and J. A. CASAS-MOLLANO, 2006 On the origin and functions of RNA-mediated silencing: from protists to man. Curr. Genet. 50: 81–99.[CrossRef][Medline]

CERUTTI, L., N. MIAN and A. BATEMAN, 2000 Domains in gene silencing and cell differentiation proteins: the novel PAZ domain and redefinition of the Piwi domain. Trends Biochem. Sci. 25: 481–482.[CrossRef][Medline]

CHEN, Y., A. PANE and T. SCHÜPBACH, 2007 cutoff and aubergine mutations result in retrotransposon upregulation anc checkpoint activation in Drosophila. Curr. Biol. 17: 637–642.[CrossRef][Medline]

COLLINS, R. E., and X. CHENG, 2005 Structural domains in RNAi. FEBS Lett. 579: 5841–5849.[CrossRef][Medline]

COOK, H. A., B. S. KOPPETSCH, J. WU and W. E. THEURKAUF, 2004 The Drosophila SDE3 homolog armitage is required for oskar mRNA silencing and embryonic axis specification. Cell 116: 817–829.[CrossRef][Medline]

COX, D. N., A. CHAO, J. BAKER, L. CHANG, D. QIAO et al., 1998 A novel class of evolutionarily conserved genes defined by piwi are essential for stem cell self-renewal. Genes Dev. 12: 3715–3727.[Abstract/Free Full Text]

DENLI, A. M., and G. J. HANNON, 2003 RNAi: an ever-growing puzzle. Trends Biochem. Sci. 28: 196–201.[CrossRef][Medline]

DOENCH, J. G., C. P. PETERSEN and P. A. SHARP, 2003 SiRNAs can function as miRNAs. Genes Dev. 17: 438–442.[Abstract/Free Full Text]

DOI, N., S. ZENNO, R. UEDA, H. OHKI-HAMAZAKI, K. UI-TEI et al., 2003 Short-interfering-RNA-mediated gene silencing in mammalian cells requires dicer and eIF2C translation initiation factors. Curr. Biol. 13: 41–46.[CrossRef][Medline]

GIRARD, A., R. SACHIDANANDAM, G. J. HANNON and M. A. CARMELL, 2006 A germline-specific class of small RNAs binds mammalian Piwi proteins. Nature 442: 199–202.[Medline]

GRIVNA, S. T., E. BEYRET, Z. WANG and H. LIN, 2006 A novel class of small RNAs in mouse spermatogenic cells. Genes Dev. 20: 1709–1714.[Abstract/Free Full Text]

GUNAWARDANE, L. S., K. SAITO, K. M. NISHIDA, K. MIYOSHI, Y. KAWAMURA et al., 2007 A slicer-mediated mechanism for repeat-associated siRNA 5' end formation in Drosophila. Science 315: 1587–1590.[Abstract/Free Full Text]

HAMMOND, S. M., A. A. CAUDY and G. J. HANNON, 2001 Post-transcriptional gene silencing by double-stranded RNA. Nat. Rev. Genet. 2: 110–119.[CrossRef][Medline]

HARRIS, A. N., and P. M. MACDONALD, 2001 aubergine encodes a Drosophila polar granule component required for pole cell formation and related to eIF2C. Development 128: 2823–2832.[Medline]

HUTVAGNER, G., and P. D. ZAMORE, 2002 RNAi: nature abhors a double-strand. Curr. Opin. Genet. Dev. 12: 225–232.[CrossRef][Medline]

ISHIZUKA, A., M. C. SIOMI and H. SIOMI, 2002 A Drosophila fragile X protein interacts with components of RNAi and ribosomal proteins. Genes Dev. 16: 2497–2508.[Abstract/Free Full Text]

JARONCZYK, K., J. B. CARMICHAEL and T.C. HOBMAN, 2005 Exploring the functions of RNA interference pathway proteins: Some functions are more RISCy than others? Biochem. J. 387: 561–571.[CrossRef][Medline]

KAVI, H. H., H. R. FERNANDEZ, W. XIE and J. A. BIRCHLER, 2005 RNA silencing in Drosophila. FEBS Lett. 579: 5940–5949.[CrossRef][Medline]

KENNERDELL, J. R., and R. W. CARTHEW, 2000 Heritable gene silencing in Drosophila using double-stranded RNA. Nat. Biotechnol. 18: 896–898.[CrossRef][Medline]

KENNERDELL, J. R., S. YAMAGUCHI and R. W. CARTHEW, 2002 RNAi is activated during Drosophila oocyte maturation in a manner dependent on aubergine and spindle-E. Genes Dev. 16: 1884–1889.[Abstract/Free Full Text]

KIM, V. N., 2006 Small RNAs just got bigger: Piwi-interacting RNAs (piRNAs) in mammalian testes. Genes Dev. 20: 1993–1997.[Abstract/Free Full Text]

KLATTENHOFF, C., D. P. BRATU, N. MCGINNIS-SCHULTZ, B. S. KOPPETSCH, H. COOK et al., 2007 Drosophila rasiRNA pathway mutations disrupt embryonic axis specification through activation of an ATR/Chk2 DNA damage response. Dev. Cell 12: 45–55.[CrossRef][Medline]

LARIONOV, A., A. KRAUSE and W. MILLER, 2005 A standard curve based method for relative real time PCR data processing. BMC Bioinformatics 6: 62–78.[CrossRef][Medline]

LEE, Y. S., K. NAKAHARA, J. W. PHAM, K. KIM, Z. HE et al., 2004 Distinct roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA silencing pathways. Cell 117: 69–81.[CrossRef][Medline]

LEE, S. R., and K. COLLINS, 2006 Two classes of endogenous small RNAs in Tetrahymena thermophila. Genes Dev. 20: 28–33.[Abstract/Free Full Text]

LIN, H., 2007 piRNAs in the germline. Science 316: 397.[Abstract/Free Full Text]

LINDSLEY, D. L., and G. G. ZIMM, 1992 The Genome of Drosophila. Academic Press, San Diego.

LINGEL, A., and M. SATTLER, 2005 Novel modes of protein-RNA recognition in the RNAi pathway. Curr. Opin. Struct. Biol. 15: 107–115.[CrossRef][Medline]

LIU, Q., T. A. RAND, S. KALIDAS, F. DU, H. E. KIM et al., 2003 R2D2, a bridge between the initiation and effector steps of the Drosophila RNAi pathway. Science 301: 1921–1925.[Abstract/Free Full Text]

LIU, J., M. A. CARMELL, F. V. RIVAS, C. G. MARSDEN, J. M. THOMSON et al., 2004 Argonaute2 is the catalytic engine of mammalian RNAi. Science 305: 1437–1441.[Abstract/Free Full Text]

LIVAK, K. J., and T. D. SCHMITTINGEN, 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2[-Delta Delta C(T)]. Methods 25: 402.[CrossRef][Medline]

MATZKE, M. A., and J. A. BIRCHLER, 2005 RNAi-mediated pathways in the nucleus. Nat. Rev. Genet. 6: 24–35.[CrossRef][Medline]

MEISTER, G., and T. TUSCHL, 2004 Mechanisms of gene silencing by double-stranded RNA. Nature 431: 343–349.[CrossRef][Medline]

MEISTER, G., M. LANDTHALER, A. PATKANIOWSKA, Y. DORSETT, G. TENG et al., 2004 Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Mol. Cell 15: 185–197.[CrossRef][Medline]

MOREL, J. B., C. GODON, P. MOURRAIN, C. BECLIN, S. BOUTET et al., 2002 Fertile hypomorphic ARGONAUTE (ago1) mutants impaired in post-transcriptional gene silencing and virus resistance. Plant Cell 13: 629–639.

MOURELATOS, Z., J. DOSTIE, S. PAUSHKIN, A. SHARMA, B. CHARROUX et al., 2002 miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. Genes Dev. 16: 720–728.[Abstract/Free Full Text]

NISHIDA, K., K. SAITO, T. MORI, Y. KAWAMURA, T. NAGAMI-OKADA et al., 2007 Gene silencing mechanisms mediated by Aubergine–piRNA complexes in Drosophila male gonad. RNA 13: 1911–1922.[Abstract/Free Full Text]

OKAMURA, K., A. ISHIZUKA, H. SIOMI and M. C. SIOMI, 2004 Distinct roles for Argonaute proteins in small RNA-directed RNA cleavage pathways. Genes Dev. 18: 1655–1666.[Abstract/Free Full Text]

PAL-BHADRA, M., U. BHADRA and J. A. BIRCHLER, 2002 RNAi related mechanisms affect both transcriptional and posttranscriptional transgene silencing in Drosophila. Mol. Cell 9: 315–327.[CrossRef][Medline]

PAL-BHADRA, M., B. A. LEIBOVITCH, S. G. GANDHI, M. RAO, U. BHADRA et al., 2004 Heterochromatic silencing and HP1 localization in Drosophila are dependent on the RNAi machinery. Science 303: 669–672[Abstract/Free Full Text]

PELISSON, A., E. SAROT, G. PAYEN-GROSCHENE and A. BUCHETON, 2007 A novel repeat-associated small interfering RNA-mediated silencing pathway downregulates complementary sense gypsy transcripts in somatic cells of the Drosophila ovary. J. Virol. 4: 1951–1960.

PHAM, J. W., J. L. PELLINO, Y. S. LEE, R. W. CARTHEW and E. J. SONTHEIMER, 2004 A Dicer-2-dependent 80s complex cleaves targeted mRNAs during RNAi in Drosophila. Cell 117: 83–94.[CrossRef][Medline]

PHAM, J. W., and E. J. SONTHEIMER, 2005 Molecular requirements for RNA-induced silencing complex assembly in the Drosophila RNA interference pathway. J. Biol. Chem. 280: 39278–39283.[Abstract/Free Full Text]

PICCIN, A., A. SALAMEH, C. BENNA, F. SANDRELLI, G. MAZZOTTA et al. 2001 Efficient and heritable functional knock-out of an adult phenotype in Drosophila using a GAL4-driven hairpin RNA incorporating a heterologous spacer. Nucleic Acids Res. 29: 12e55.

PONCHEL, F., C. TOOMES, K. BRANSFIELD, F. T. LEONG, S. H. DOUGLAS et al., 2003 Real-time PCR based on SYBR-Green I fluorescence: an alternative to the TaqMan assay for a relative quantification of gene rearrangements, gene amplifications and micro gene deletions. BMC Biotechnol. 3: 18–31.[CrossRef][Medline]

ROBERTS, D. B., and G. N. STANDEN, 1998 Drosophila: A Practical Approach, Ed. 2. IRL, Oxford.

SAITO, K., K. M. NISHIDA, T. MORI, Y. KAWAMURA, K. MIYOSHI et al., 2006 Specific association of Piwi with rasiRNAs derived from retrotransposon and heterochromatic regions in the Drosophila genome. Genes Dev. 20: 2214–2222.[Abstract/Free Full Text]

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SCHMIDT, A., G. PALUMBO, M. P. BOZZETTI, P. TRITTO, S. PIMPINELLI et al., 1999 Genetic and molecular characterization of sting, a gene involved in crystal formation and meiotic drive in the male germ line of Drosophila melanogaster. Genetics 151: 749–760.[Abstract/Free Full Text]

SCHÜPBACH, T., and E. WIESCHAUS, 1991 Female sterile mutation on the second chromosome of Drosophila melanogaster. Genetics 129: 1119–1136.[Abstract]

SONG, J. J., S. K. SMITH, G. J. HANNON and L. JOSHUA-TOR, 2004 Crystal structure of Argonaute and its implications for RISC slicer activity. Science 305: 1434–1437.[Abstract/Free Full Text]

ST JOHNSTON, D., and C. NÜSSLEIN-VOLHARD, 1992 The origin of pattern and polarity in the Drosophila embryo. Cell 68: 201–219.[CrossRef][Medline]

TAHBAZ, N., F. A. KOLB, H. ZHANG, K. JARONCZYK, W. FILIPOWICZ et al., 2004 Characterization of the interactions between mammalian PAZ PIWI domain proteins and Dicer. EMBO Rep. 5: 189–194.[CrossRef][Medline]

TANG, G., 2005 siRNA and miRNA: an insight into RISCs. Trends Biochem. Sci. 30: 106–114.[CrossRef][Medline]

TOMARI, Y., T. DU, B. HALEY, D. S. SCHWARZ, R. BENNETT, 2004 RISC assembly defects in the Drosophila RNAi mutant armitage. Cell 116: 831–841.[CrossRef][Medline]

TOMARI, Y., and P. ZAMORE, 2005 Perspective: machines for RNAi. Genes Dev. 19: 517–529.[Abstract/Free Full Text]

TRITTO, P., V. SPECCHIA, L. FANTI, M. BERLOCO, R. D'ALESSANDRO et al., 2003 Structure, regulation and evolution of the crystal-Stellate system. Genetica 117: 247–257.[CrossRef][Medline]

VAGIN, V. V., M. S. KLENOV, A. I. KALMYKOVA, A. D. STOLYARENKO, R. N. KOTELNIKOV et al., 2004 The RNA interference proteins and vasa locus are involved in the silencing of retrotransposons in the female germ line of Drosophila melanogaster. RNA Biol. 1: 54–58.[Medline]

VAGIN, V. V., A. SIGOVA, C. LI, H. SEITZ, V. GVOZDEV et al., 2006 A distinct small RNA pathway silences selfish genetic elements in the germ line. Science 212: 330–334.

VALENCIA-SANCHEZ, M. A., J. LIU, G. J. HANNON and R. PARKER, 2006 Control of translation and mRNA degradation by miRNAs and siRNAs. Genes Dev. 20: 515–524.[Abstract/Free Full Text]

VAUCHERET, H., 2006 Post-transcriptional small RNA pathways in plants: mechanisms and regulations. Genes Dev. 20: 759–771.[Abstract/Free Full Text]

VERDEL, A., S. JIA, S. GERBER, T. SUGIYAMA, S. GYGI et al., 2004 RNAi-mediated targeting of heterochromatin by the RITS complex. Science 303: 672–676.[Abstract/Free Full Text]

WATANABE, T., A. TAKEDA, T. TSUKIYAMA, K. MISE, T. OKUNO et al., 2006 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. Genes Dev. 20: 1732–1743.[Abstract/Free Full Text]

WILLIAMS, R. W., and G. M. RUBIN, 2002 Argonaute1 is required for efficient RNA interference in Drosophila embryos. Proc. Nat. Acad. Sci. USA 99: 6889–6894.[Abstract/Free Full Text]

WILSON, J. E., J. E. CONNELL and P. M. MACDONALD, 1996 aubergine enhances oskar translation in the Drosophila ovary. Development 122: 1631–1639.[Abstract]

YIGIT, E., P. J. BATISTA, Y. BEI, K. M. PANG, C. G. CHEN et al., 2006 Analysis of the C. elegans Argonaute family reveals that distinct Argonautes act sequentially during RNAi. Cell 127: 747–757.[CrossRef][Medline]

ZENG, Y., R. YI and B. R. CULLEN, 2003 MicroRNAs and small interfering RNAs can inhibit mRNA expression by similar mechanisms. Proc. Natl. Acad. Sci. USA 100: 9779–9784.[Abstract/Free Full Text]

Communicating editor: K. GOLIC