- THIS ARTICLE
-
Abstract
- Full Text (PDF)
-
All Versions of this Article:
genetics.107.085415v1
178/3/1221 most recent - Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Related articles in Genetics
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Stone, J. E.
- Articles by Jinks-Robertson, S.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Stone, J. E.
- Articles by Jinks-Robertson, S.
Originally published as Genetics Published Articles Ahead of Print on February 3, 2008.
Genetics, Vol. 178, 1221-1236, March 2008, Copyright © 2008
doi:10.1534/genetics.107.085415
Role of Proliferating Cell Nuclear Antigen Interactions in the Mismatch Repair-Dependent Processing of Mitotic and Meiotic Recombination Intermediates in Yeast
Jana E. Stone*,
,1,2,
Regan Gealy Ozbirn
,1,
Thomas D. Petes* and
Sue Jinks-Robertson*,3
* Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina 27710,
Curriculum in Genetics and Molecular Biology, University of North Carolina, Chapel Hill, North Carolina 27599 and
Graduate Division of Biological and Biomedical Sciences, Emory University, Atlanta, Georgia 30322
3 Corresponding author: Department of Molecular Genetics and Microbiology, DUMC 3020, 228 Jones Bldg., Research Dr., Durham, NC 27710.
E-mail: sue.robertson{at}duke.edu
The mismatch repair (MMR) system is critical not only for the repair of DNA replication errors, but also for the regulation of mitotic and meiotic recombination processes. In a manner analogous to its ability to remove replication errors, the MMR system can remove mismatches in heteroduplex recombination intermediates to generate gene conversion events. Alternatively, such mismatches can trigger an MMR-dependent antirecombination activity that blocks the completion of recombination, thereby limiting interactions between diverged sequences. In Saccharomyces cerevisiae, the MMR proteins Msh3, Msh6, and Mlh1 interact with proliferating cell nuclear antigen (PCNA), and mutations that disrupt these interactions result in a mutator phenotype. In addition, some mutations in the PCNA-encoding POL30 gene increase mutation rates in an MMR-dependent manner. In the current study, pol30, mlh1, and msh6 mutants were used to examine whether MMR–PCNA interactions are similarly important during mitotic and meiotic recombination. We find that MMR–PCNA interactions are important for repairing mismatches formed during meiotic recombination, but play only a relatively minor role in regulating the fidelity of mitotic recombination.
THE failure to accurately replicate and repair genomic DNA leads to a wide variety of somatic and germ-line mutations, most of which are deleterious. Organisms thus have evolved multiple mechanisms to promote the stability of DNA and ensure faithful genome propagation. One of these mechanisms is the mismatch repair (MMR) system, best known for its role in correcting errors made by DNA polymerases during DNA replication (reviewed by HARFE and JINKS-ROBERTSON 2000; SCHOFIELD and HSIEH 2003; KUNKEL and ERIE 2005). In addition to this replication-associated "spellchecker" function, the MMR system promotes genome stability via an antirecombination activity that prevents recombination between diverged sequences (reviewed by SURTEES et al. 2004). Because such sequences are not identical, there is the potential for mismatches to be present within heteroduplex recombination intermediates. The MMR system recognizes such mismatches and prevents recombination from going to completion, thereby limiting detrimental genome rearrangements between dispersed repeated sequences. In some cases, a single mismatch within heteroduplex DNA is sufficient to reduce mitotic recombination in an MMR-dependent manner (DATTA et al. 1997).
In addition to the spellchecker and antirecombination functions that promote mitotic genome stability, the MMR system is important during meiosis, specifically in meiotic recombination (reviewed by HOFFMANN and BORTS 2004; SURTEES et al. 2004). As in mitosis, sequence divergence can trigger meiotic antirecombination activity of the MMR machinery, an activity thought to be important for enforcing homolog–homolog interactions and species barriers. Mismatches formed in meiotic recombination intermediates between different alleles, however, are more often simply repaired by the MMR system. Depending on which strand is used as the template for repair, either Mendelian segregation of the alleles will be restored or a gene conversion event will occur. In the nomenclature of eight-spored asci, restoration-type repair is manifested as 4:4 events while gene conversion results in 6:2 or 2:6 allele segregation. If MMR fails to correct a mismatch, the resulting meiotic product will have both alleles, resulting in a 5:3 or 3:5 ratio, referred to as postmeiotic segregation (PMS). Loss of MMR function typically results in an increase in PMS events and a concomitant reduction in gene conversion. Finally, in addition to mismatch correction, certain MMR proteins have also been shown to be involved in the processing of meiotic recombination intermediates to produce crossovers (HUNTER and BORTS 1997; WANG et al. 1999).
The mechanism of MMR associated with DNA replication is best understood in prokaryotes, where it involves the proteins MutS, MutL, and MutH (reviewed by IYER et al. 2006; JOSEPH et al. 2006). MutS homodimers recognize errors made by DNA polymerase, binding to both base substitution and frameshift intermediates. MutH homodimers bind to nearby hemimethylated Dam sites, which mark the region as newly replicated and provide a mechanism for distinguishing the template and nascent strands. MutL homodimers promote an interaction between MutS and MutH, which activates MutH to nick the unmethylated, nascent strand. This nick provides an entry point for a helicase to unwind and exonucleases to remove the mismatch-containing region. Thus, MMR is nick directed, and importantly, repair is targeted specifically to the nascent strand.
In eukaryotes, the bacterial MutS homodimer is replaced by Msh (MutS homolog) protein heterodimers (reviewed by KUNKEL and ERIE 2005). MutS
is composed of Msh2 and Msh6 and broadly recognizes base/base mismatches and small-loop frameshift intermediates. MutSβ, which is a heterodimer of Msh2 and Msh3, recognizes small- and large-loop frameshift intermediates and may recognize specific base/base mismatches (HARRINGTON and KOLODNER 2007). MutS
and MutSβ interact primarily with the MutL-like heterodimer MutL
(composed of Mlh1 and Pms1) to correct mismatches. No MutH homolog has been found in eukaryotes, and the method of strand discrimination during the repair of replication errors is not fully understood. As in Escherichia coli, however, experiments using purified proteins or cell extracts have shown that a nick is sufficient to direct eukaryotic MMR (reviewed by IYER et al. 2006). In addition to the nicks that are naturally present in nascent DNA, recent studies have demonstrated that human MutL
has the ability to introduce additional nicks into DNA in vitro (KADYROV et al. 2006) and that disruption of the yeast MutL
endonuclease domain results in a mutator phenotype in vivo (ERDENIZ et al. 2007; KADYROV et al. 2007).
In addition to the classical MMR proteins, the proliferating cell nuclear antigen (PCNA) sliding clamp is important for the repair of replication errors. During replication, the PCNA homotrimer encircles duplex DNA and tethers the replication machinery to the template, thereby increasing DNA polymerase processivity. PCNA also acts as a landing pad for many other proteins involved in DNA metabolism (reviewed by MOLDOVAN et al. 2007). The first indication of a role for PCNA in MMR was obtained in yeast, where some alleles of the PCNA-encoding POL30 gene produce a mutator phenotype and cause instability of microsatellite repeats (JOHNSON et al. 1996; UMAR et al. 1996). PCNA has since been shown to interact directly with the MutS homologs Msh3 and Msh6 (UMAR et al. 1996; FLORES-ROZAS et al. 2000), as well as with the MutL homolog Mlh1 (UMAR et al. 1996; DZANTIEV et al. 2004; LEE and ALANI 2006). Each of these three proteins contains a putative PCNA interaction domain called the PIP box (WARBRICK 1998) which, when mutated, disrupts interaction with PCNA in vitro and confers a mutator phenotype in vivo (KOKOSKA et al. 1999; CLARK et al. 2000; FLORES-ROZAS et al. 2000; LEE and ALANI 2006). Additionally, in vitro experiments have shown that the inclusion of PCNA enhances the ability of MutS
to discriminate between DNAs containing mismatches and those that lack mismatches (FLORES-ROZAS et al. 2000). Finally, work done with human cell extracts has shown that a nick positioned 5' of a mismatch requires only hMutS
, RPA, and hExo1 to direct subsequent strand removal, but that a nick 3' to a mismatch additionally requires MutL
, PCNA, and replication factor C (RFC) for strand removal (CONSTANTIN et al. 2005).
While PCNA is clearly important in the MMR-directed repair of replication errors, it is not known if PCNA plays an equivalent role in the recombination-related functions of MMR. In spite of the basic similarities between mismatch recognition during replication and recombination, there are data suggesting fundamental differences between how the MMR system removes replication errors and how it affects recombination processes in Saccharomyces cerevisiae. For example, it appears that the MutL homologs, while essential for the repair of replication-generated mismatches, are not as important as the MutS homologs in some antirecombination processes (CHEN and JINKS-ROBERTSON 1999; NICHOLSON et al. 2000; SUGAWARA et al. 2004). In addition, separation-of-function alleles of PMS1 have been identified that reduce the mitotic antirecombination activity of MutL
and the repair of mismatches formed during meiotic recombination, but have little or no effect on the repair of replication errors (WELZ-VOEGELE et al. 2002). Mutant alleles of MLH1 have also been identified that are deficient in the repair of mismatches formed during either replication or meiotic recombination, but not both (ARGUESO et al. 2002, 2003). Finally, a member of the RecQ family of DNA helicases, Sgs1, has been shown to be involved in the mitotic antirecombination function of MMR, but plays no known role in the spellchecker or meiotic recombination functions (MYUNG et al. 2001; SPELL and JINKS-ROBERTSON 2004b; SUGAWARA et al. 2004). Given these basic differences, it is important to determine if the mitotic role of PCNA is limited only to the spellchecker function of MMR, or if it is also required for the antirecombination activity. Similarly, it is important to determine if the role of PCNA in MMR is confined to mitotic MMR processes, or if it is necessary for the repair of mismatches formed during meiotic recombination as well. In this study, we examine the effect of altering the MMR–PCNA interaction on MMR functions during both mitotic and meiotic recombination in yeast. Our results demonstrate that PCNA is important for the repair of mismatches in meiotic recombination intermediates but plays only a minor role in regulating mitotic recombination fidelity.
Media and growth conditions:
For strain constructions, cells were grown in YEP medium (2% yeast extract and 4% peptone) supplemented with 2% dextrose and 0.25 g/liter adenine (YPD; 2.5% agar for plates). Drug selections were done on YPD containing either 300 µg/ml hygromycin or 200 µg/ml G418. For mitotic recombination and mutation-rate determinations in the SJR328-derived strains with mutant chromosomal alleles, cultures were grown in YEP supplemented with 4% galactose/2% glycerol (YEPGG) and 0.25 g/liter adenine; mutation rates in AS4- and AS13-derived strains were measured in YPD-grown cultures. Selection for His+ recombinants was performed on synthetic medium supplemented with 2% galactose/2% glycerol/2% ethanol and a complete amino acid mix deficient in histidine (GGE –His). For mutation-rate analysis, cells were plated on arginine-deficient synthetic dextrose medium (SD –Arg) supplemented with 60 µg/ml canavanine. For SJR328-derived strains with plasmid-encoded msh6 alleles, cells were grown in synthetic medium supplemented with 4% galactose/2% glycerol and deficient in leucine (SGG –Leu). His+ and canavanine-resistant cells were selected as above except that leucine was omitted from the media. For the plasmid-containing strains, total cell numbers were determined on SD –Leu medium. For meiotic recombination studies, standard growth and sporulation conditions were used (SHERMAN 1991) except as noted.
Plasmids:
Plasmid pSR559 was constructed by subcloning a KpnI/NotI fragment containing the pol30-52 allele from pBL241-52 (AYYAGARI et al. 1995) into KpnI/NotI-digested pRS306 (SIKORSKI and HIETER 1989). pSR873, which contains the pol30-201,204 allele, was constructed by site-directed mutagenesis (QuickChange, Stratagene, La Jolla, CA) using the pol30-201 plasmid pRDK925 (LAU et al. 2002) as a template and introducing the pol30-204 mutation using primers pol30-204Fmut (5'-CCTCACTAAGTAAAATCCTACGTCGTGGTAACAACACCGATACATTAACACTAATTGC-3') and pol30-204Rmut (5'-GCAATTAGTGTTAATGTATCGGTGTTGTTACCACGACGTAGGATTTTACTTAGTGAGG -3'). The sequence change is underlined and creates an Hpy99I site.
Strain constructions:
A complete list of yeast strains is given in Table 1. The mitotic antirecombination experiments were done in the SJR328 background (MAT
ade2-101 his3
200 ura3-Nhe lys2
RV::hisG leu2-R) with the cβ2-100% or cβ2-4ns constructs integrated at LEU2 (NICHOLSON et al. 2000). The meiotic experiments were done using diploids obtained by mating appropriate derivatives of haploids AS4 (MAT
arg4-17 trp1-1 tyr7-1 ade6 stp22 ura3; STAPLETON and PETES 1991) and AS13 (MATa leu2-Bst ade6 ura3 rme1; STAPLETON and PETES 1991). In preparation for the introduction of chromosomal pol30 or plasmid-encoded msh6 alleles, Leu– derivatives of Leu+ strains were constructed by replacing LEU2 with a leu2
::kanMX4 allele generated using pFA6-kanMX4 (WACH et al. 1994) as a template (forward primer 5'-ATGTCTGCCCCTAAGAAGATCGTCGTTTTGCCAGGTGACCACGTTGTCAAGcagctgaagcttcgtacg and reverse primer 5'-TTAAGCAAGGATTTTCTTAACTTCTTCGGCGACAGCATCACCGACTTCGGTGGaggccactagtggatctg; LEU2-homologous sequences are capitalized). The leu2 derivative of HMY134 (SJR2705) was constructed by transforming HMY134 with a PCR-generated leu2
::hyg fragment. This fragment was produced using the same oligonucleotides described above to amplify hphMX4 from plasmid pAG32 (GOLDSTEIN and MCCUSKER 1999).
|
Strains containing the chromosomal pol30-104, pol30-201, pol30-204, or pol30-201,204 allele were constructed by one-step allele replacement using a SacI fragment derived from the appropriate plasmid and containing both the pol30 allele and a LEU2 marker [pCH1577 (JOHNSON et al. 1996), pRDK925, pRDK926 (LAU et al. 2002), or pSR873, respectively]. pol30-52 strains were constructed via two-step allele replacement using either EcoRI-digested pSR559 or pBL241-52 (AYYAGARI et al. 1995). The mlh1-QLF allele was introduced by transformation with an mlh1-QLF:kanMX4 fragment derived from KpnI-digested pEAA282 (LEE and ALANI 2006), and the mlh1
::hygMX2 allele was introduced using a PCR-derived fragment (forward primer 5'-TTTTGATACGATAGTGATAGTAAATGGAAGGTAAAAATAACATAGACCTATCAATAAGCAcagctgaagcttcgtacg and reverse primer 5'-CACAATCACACTCAGGAAATAAACAAAAAACTTTGGTATTACAGCCAAACGTTTTAAAGaggccactagtggatctg; MLH1-homologous sequences are capitalized). The presence of the mlh1-QLF and pol30 alleles was inferred by phenotype (elevated mutation rates and cold sensitivity as appropriate) and confirmed by sequencing. For complementation analysis, low copy-number plasmids derived from the CEN-LEU2 vector pRS315 (SIKORSKI and HIETER 1989) and containing wild-type (WT) or mutant MSH6 alleles were transformed into various msh6
leu2
strains (Table 1). MSH6 was contained on pRDK3572, msh6
2-251 on pRDK4650, msh6
51-251 on pRDK4715, and msh6-FFAA,
51-251 on pRDK4758 (SHELL et al. 2007). Transformants used for complementation analysis were selected and maintained on leucine-deficient medium.
The progenitor strains (indicated in parentheses) used in various constructions in the AS4- and AS13-derived strains were as follows: JSY162 (PD73), SJR2184 (PD73), SJR2203 (SJR2184), JSY332 (SJR2203), SJR2577 (AS4), and SJR2578 (PD73). The msh2
::hygB allele in JSY332 was introduced by transforming SJR2203 with a PCR fragment generated by amplification of the plasmid pAG32 (GOLDSTEIN and MCCUSKER 1999) with the primers f msh2-
and r msh2-
(KEARNEY et al. 2001). ARG4 derivatives were constructed of the strains AS4, RKY1721 (ALANI et al. 1994), and JSY173 (JSY208, JSY203, and JSY209, respectively) by one-step transplacement with the 2.4-kb SalI fragment derived from the plasmid pMW52 (WHITE et al. 1993).
Measuring mitotic recombination and mutation rates:
For strains in the SJR328 background, individual colonies were grown in 5 ml YEPGG or 10 ml SGG –Leu medium at 30° for 2 or 3 days, respectively; strains of the AS4 or AS13 background were grown for 1 day under the same conditions in YPD. The cells were harvested by centrifugation and washed with water. Appropriate dilutions were plated to select for His+ recombinants or canavanine-resistant (Can-R) mutants, as well as on the appropriate nonselective medium to determine the total number of cells per culture. Colonies were counted after 2 days on YPD and SD or after 4 days on GGE media.To calculate recombination and mutation rates, the median number of His+ or Can-R colonies was determined using at least 12 independent cultures. The method of the median (LEA and COULSON 1949) was used to calculate recombination rates (number of events per cell per generation). Ninety-five percent confidence intervals (C.I.'s) were obtained by ranking the selective medium counts in ascending order (SPELL and JINKS-ROBERTSON 2004a), and then using Table B11 from ALTMAN (1990) to determine which cultures provided the upper and lower limits of each C.I. Confidence limits on the ratio of homeologous to homologous recombination (HER:HR) were calculated using the 95% C.I.'s on individual homeologous and homologous recombination rates. To calculate the lower confidence limit for the ratio, we divided the lower value of the 95% C.I. for the homeologous rate by the upper value of the 95% C.I. for the homologous rate. The upper confidence limit for the ratio was calculated by dividing the upper limit for the homeologous rate by the lower limit for the homologous rate.
Measuring meiotic recombination:
Diploid strains were sporulated at either 18° or 30° as indicated in the tables. Because some of the mutants confer a mitotic mutator phenotype that causes high levels of spore inviability, haploid strains were mated overnight at 30° and the resulting diploids were transferred directly to sporulation medium without prior purification. Following tetrad dissection onto YPD medium, spore colonies were replica plated to various synthetic media lacking the appropriate amino acid to check the segregation of markers. Spore colonies on SD –His or SD –Arg medium were examined microscopically to detect PMS.
In the experiments involving the plasmid-borne MSH6 and msh6-FFAA,
51-251 alleles, the MATa haploid strains with the plasmids (SJR2706 and SJR2707) were grown in SD –Leu medium at 30° overnight. The MAT
strain without the plasmid (SJR2705) was grown overnight on YPD at 30°. Strains were mated and transferred to sporulation medium as described above.
The fidelity of mitotic recombination was examined using an inverted-repeat (IR) assay system (NICHOLSON et al. 2000). This system utilizes two cassettes oriented as IRs, each of which contains a 350-bp recombination substrate, a portion of the HIS3 gene, and a segment of an artificial intron (the "IR-intron" system). The substrates were either 100% identical to one another (cβ2-100% "homologous" substrates) or differed by four evenly-spaced base substitutions (cβ2-4ns "homeologous" substrates; 99% identical). A recombination event between the substrates reorients the region between them and generates a functional HIS3 gene, allowing cells to grow on medium lacking histidine (Figure 1A). While mutations in genes that have a general effect on recombination should affect homologous and homeologous recombination (HR and HER, respectively) to the same extent, those in genes that specifically regulate the fidelity of recombination will have a greater effect on the rate of HER than on the rate of HR, resulting in a ratio of HER:HR higher than that in a WT strain.
|
To examine the relevance of PCNA–MMR interactions to the repair of mismatches created during meiotic recombination (meiotic MMR), we sporulated diploid strains heterozygous for the his4-AAG and arg4-17 alleles. The his4-AAG mutation is a T-to-A transversion at the second position of the HIS4 start codon (DETLOFF et al. 1991) and the arg4-17 mutation is a T-to-A transversion at position +127 of ARG4 (WHITE et al. 1985). In both cases, heteroduplexes formed between the WT and mutant alleles create an A/A or T/T mismatch. These mismatches can be repaired to produce either a detectable gene conversion event (2 WT:6 mutant or 6 WT:2 mutant) or an undetectable restoration event (4 WT:4 mutant). If a mismatch fails to be repaired, the resulting spore colony will exhibit a sectored His+/His– or Arg+/Arg– phenotype. Such PMS events are manifested as either a 3 WT:5 mutant or a 5 mutant:3 WT segregation pattern in tetrads (Figure 1B). Other patterns of segregation in which more than one conversion and/or PMS event occur within a single tetrad are also observed, although such tetrads are much less frequent than tetrads with a single event (DETLOFF et al. 1991). The abundance of PMS tetrads relative to all classes of aberrant segregants reflects meiotic MMR efficiency.
Regulation of mitotic recombination fidelity in MMR-defective pol30 mutants:
Four of the pol30 alleles used previously by others to demonstrate a role for PCNA in the repair of replication errors were used in our experiments to determine whether PCNA is important in the MMR-dependent regulation of mitotic recombination fidelity. Two of the alleles, pol30-52 and pol30-104, confer microsatellite instability in an MMR-dependent manner (AYYAGARI et al. 1995; JOHNSON et al. 1996; KOKOSKA et al. 1999), but also have been shown to cause phenotypes not associated with MMR, such as cell–cycle and replication defects (AYYAGARI et al. 1995; AMIN and HOLM 1996; JOHNSON et al. 1996; MERRILL and HOLM 1998; CHEN et al. 1999; KOKOSKA et al. 1999). The other two pol30 alleles, pol30-201 and pol30-204, were identified in a screen for PCNA mutations that increase mutation rate without causing the additional defects associated with the pol30-52 and pol30-104 alleles (LAU et al. 2002). In addition to measuring HR and HER rates, we examined the forward mutation rate at the CAN1 locus (canavanine resistance, Can-R) in each pol30 mutant to compare the associated mutator phenotypes in our strain backgrounds to those reported previously.
The effects of the pol30 alleles in the forward mutation and mitotic recombination assays are presented in Tables 2 and 3, respectively, along with those conferred by a complete MMR deficiency (msh3
msh6
mutant). In the SJR328 background, elimination of MMR resulted in a 55-fold elevation in the Can-R rate. Although a slightly stronger mutator phenotype for the pol30-104 than for the pol30-52 allele was reported previously (CHEN et al. 1999), in our experiments the pol3-52 allele conferred a significantly stronger mutator phenotype than did the pol30-104 allele (123- and 29-fold increases in Can-R relative to WT, respectively). Relative to the pol30-52 and pol30-104 alleles, the pol30-201 and pol30-204 alleles conferred only a modest mutator phenotype, with Can-R rates being elevated 8- and 6-fold, respectively. These pol30-201 and pol30-204 mutants appear to retain 85–90% of their MMR-related spellchecker activity in our strain background, a level >25–30% reported previously (LAU et al. 2002). The variability in relative Can-R rates in different strain backgrounds suggests that inherent genetic differences can modulate the magnitude of the mutator effects associated with specific PCNA mutations (see below as well).
|
|
The effects of the pol30 alleles on mitotic recombination fidelity are best seen by dividing the HER rate by the HR rate and comparing this ratio to the HER:HR rate ratio in the WT control strain (Table 3). In the msh3
msh6
mutant, the HER:HR ratio was elevated 17-fold relative to that in a WT strain. Although both the pol30-52 and pol30-104 alleles conferred a significant increase in the HR rate (8- and 3-fold, respectively), consistent with a general replication defect, only the pol30-52 allele conferred a slightly elevated HER:HR ratio (2-fold increase). The HR rates in both the pol30-201 and pol30-204 mutant were also significantly elevated relative to that in the WT strain (2- and 4-fold, respectively). We suggest that these mild hyperrecombination phenotypes may be indicative of a subtle, perhaps background-related, replication defect that was not apparent in the initial examination of these alleles (LAU et al. 2002). The 5-fold increase in HER associated with the pol30-204 allele was similar to the 4-fold increase in HR, indicating no significant impairment in the efficiency of MMR-associated antirecombination. In contrast, in the pol30-201 strain, recombination between the HER substrates was elevated significantly more than was recombination between the HR substrates (5- and 2-fold, respectively). In the complete absence of MMR (msh3
msh6
mutant), the presence of the pol30-201 allele conferred no additional increase in the HER:HR ratio, consistent with a weak MMR-associated antirecombination activity for PCNA.
To determine the joint effect of the pol30-201 and pol30-204 mutations on the MMR-related roles of PCNA, we constructed the pol30-201,204 double mutant allele. The Can-R rate of the pol30-201,204 double mutant was 10-fold greater than that of either of the single-mutant strains and was similar to that observed in the MMR-defective (msh3
msh6
) background (Table 2). Thus, in terms of mutator phenotype, there appears to be a synergistic interaction between the two mutations when both are combined in the same protein. This synergism could reflect a complete loss of MMR or combined MMR and replication defects. In contrast, the 5-fold elevation in homologous recombination in the double mutant was very similar to the 4-fold elevation in the pol30-204 single mutant. The HER:HR ratio in the double mutant was elevated 2-fold over that of the WT strain, a value slightly less than that obtained in the pol30-201 single mutant and much less than that obtained in the msh3
msh6
background. The double-mutant data indicate that PCNA alterations can differentially affect the MMR-associated editing of replication errors and recombination intermediates.
Repair of mismatches in meiotic heteroduplex DNA in pol30 mutant strains:
The slightly elevated HER:HR ratios in the pol30-52 and pol30-201 mutants indicate that PCNA may play a minor role in the MMR-dependent regulation of mitotic recombination fidelity. These mutant alleles were introduced into diploid strains heterozygous for the his4-AAG and arg4-17 alleles to examine PMS frequencies, the elevation of which would indicate a role for PCNA in meiosis-specific MMR. As in the SJR328 background used to monitor mitotic recombination fidelity, the mutator phenotypes conferred by the pol30-52 and pol30-201 alleles were determined in the haploid parents of the diploids used in the meiotic studies. In both the AS4- and AS13-derived pol30-52 haploids, Can-R mutation rates were 3- to 6-fold higher than those observed in the corresponding MMR-defective (msh2
) mutants (Table 2). In addition, the pol30-52 msh2
AS13-derived strain had a Can-R mutation rate that was 4-fold higher than that of the pol30-52 mutant (Table 2). Thus, as reported previously, the pol30-52 allele elevates mutation rates in this genetic background in two ways: by reducing the efficiency of MMR and by elevating mutation rates by an MMR-independent mechanism (CHEN et al. 1999; KOKOSKA et al. 1999). In the AS13-derived haploid, pol30-201 conferred a mutation rate that was only slightly less than that of an msh2
mutant, a phenotype much stronger than that observed in the SJR328 background, where 85% of MMR spellchecker activity was retained in the pol30-201 mutant (Table 2). In the AS13 msh2
pol30-201 background, the mutation rate was slightly higher than that observed in the single mutants, suggesting that the pol30-201 allele may also generate mutations in an MMR-independent manner.
In AS4 x AS13-derived diploids, sporulation at 18° results in elevated frequencies of meiotic recombination at the HIS4 locus (NAG and PETES 1993; FAN et al. 1995). pol30-52 mutants are cold sensitive (AYYAGARI et al. 1995), however, and pol30-52 diploids did not sporulate efficiently at either 18° or 25°. Because sporulation of the pol30-52 diploid was most efficient at 30°, MMR-proficient (WT) and MMR-deficient (msh2
) strains were also sporulated at 30° for comparison. Sporulation of the WT strain at 30° resulted in a 3-fold decrease in the percentage of tetrads with aberrant segregation of his4-AAG relative to sporulation at 18° (Table 4), but did not significantly reduce the frequency of tetrads with aberrant segregation of arg4-17 (Table 5). Compared to the WT strain, the pol30-52 allele resulted in a significant decrease in the frequency of tetrads with aberrant segregation of arg4-17 and a slight but not statistically significant decrease in tetrads with aberrant segregation of his4-AAG.
|
|
The efficiency of meiotic MMR is commonly expressed as the ratio of the number of PMS tetrads to the total number of aberrant tetrads (PMS + gene conversion tetrads). Because of the high level of meiotic recombination in the AS4 x AS13 diploids, however, a single tetrad may contain multiple aberrant events. To more accurately reflect MMR efficiency in these diploids, we calculated the ratio of total PMS events to total aberrant events (see STONE and PETES 2006 for an explanation of the calculation). We previously reported that there was a low level of PMS among total aberrant events for the his4-AAG mismatch in the WT strain sporulated at 18° (DETLOFF et al. 1991; STONE and PETES 2006); the percentage of PMS/total aberrant events was 18% (Table 4). At 30°, this ratio was even lower (6%; Table 4). In the pol30-52 mutant strain sporulated at 30°, 30% of the aberrant events were PMS events (Table 4). This significant increase in PMS events relative to that observed in WT demonstrates that the pol30-52 mutation reduces the efficiency of meiotic repair of mismatches in recombination intermediates. The ratio of PMS to total aberrant events observed for the pol30-52 strain was only about half of the ratio found in MMR-deficient msh2
strain, however, indicating that the pol30-52 mutation reduces but does not eliminate meiotic MMR. For the arg4-17 marker, a significant reduction in the percentage of aberrant tetrads in the pol30-52 diploid (from 9.6% in WT to 1.4%) made it difficult to determine the effect of the pol30-52 mutation on PMS. Of the 74 complete tetrads examined, however, the one that was aberrant was also a PMS tetrad, whereas no PMS events were observed in the 32 aberrant tetrads from the WT strain.
In contrast to the pol30-52 allele, the pol30-201 allele does not confer cold sensitivity, thus allowing examination of the pol30-201 diploid after sporulation at 18°. The pol30-201 diploid had a lower level of aberrant segregation events at HIS4 relative to the WT strain (Table 4) but the frequency of aberrant segregation at the ARG4 locus was not affected by pol30-201 (Table 5). The efficiency of MMR, as measured by the elevated PMS/aberrant events ratio, for both the his4-AAG and arg4-17 mismatches was significantly reduced by pol30-201, with the effect on the his4-AAG mismatch being more severe. For the his4-AAG mismatch, the PMS/aberrant events ratio was
60% of that observed in the msh2
strain; for arg4-17 the ratio was only 25% of that in the msh2
strain.
The decrease in aberrant segregation of the his4-AAG marker in the pol30-201 diploid could be due to a reduction in either the initiation of recombination at HIS4 or the subsequent extension of heteroduplex DNA. Shortening of meiotic heteroduplexes can be detected genetically by examining the frequency of aberrant segregation as a function of distance from an initiating double-strand break (DSB). The aberrant segregation of markers far from the DSB will be greatly reduced compared to WT, while there will be less of an effect on segregation of markers located close to the DSB site. We thus examined the effect of the pol30-201 mutation on segregation of the his4-3133 marker, a poorly repaired marker that is located >2 kb farther from the HIS4 DSB site than the his4-AAG marker (DETLOFF et al. 1992). There was 37% aberrant segregation (126/344 tetrads) for the his4-3133 marker in the WT strain PD99 (DETLOFF et al. 1992), but only 9.4% aberrant segregation (27/288 tetrads) for this marker in the pol30-201 mutant strain JSY356. This difference corresponds to a 75% reduction relative to the WT level of aberrant segregation for his4-3133. Because the level of aberrant segregation of the his4-AAG marker was reduced by only 40% in the pol30-201 strain (Table 4), these data are consistent with a shorter average length of meiotic heteroduplexes in the pol30-201 strain. Also consistent with shortened meiotic heteroduplexes in pol30-201 strains was a 20–40% reduction in crossovers in each of three genetic intervals examined on chromosome III (data not shown). An association between shortened meiotic heteroduplexes and reduced crossing over has previously been documented in strains with a mutant DNA polymerase
(pol3-ct; MALOISEL et al. 2004).
Effect of perturbing the Mlh1–PCNA interaction on MMR functions during recombination:
Mlh1 interacts physically with PCNA and contains an amino acid sequence related to the PIP box that is required for this interaction in in vitro assays (LEE and ALANI 2006). Because mutation of this region of Mlh1 (the mlh1-Q572A,L575A,F578A or mlh1-QLF allele) confers a complete MMR defect in a frameshift reversion assay (LEE and ALANI 2006), we examined its effect on the MMR-related spellchecker and antirecombination functions in the SJR328 background. As reported for the repair of frameshift intermediates, the mlh1-QLF allele resulted in a Can-R mutation rate indistinguishable from that of an mlh1
strain (Table 6). With diverged substrates in the IR-intron system, we consistently have observed that
50% of the MMR-associated antirecombination activity persists in pms1
or mlh1
strains, indicating that the yeast MutS homologs can function independently of the major MutL heterodimer in this assay (CHEN and JINKS-ROBERTSON 1999; NICHOLSON et al. 2000; SPELL and JINKS-ROBERTSON 2003). In agreement with this observation, there was a 6-fold increase in the HER:HR ratio in the mlh1
relative to the WT strain (Table 6), compared to a 17-fold increase in this ratio in the msh3
msh6
mutant (Table 3). In the mlh1-QLF mutant, the HER:HR ratio was elevated 4-fold relative to the WT ratio. Importantly, the HER rates did not differ statistically in the mlh1
and mlh1-QLF mutants.
|
As with the pol30 alleles that confer mitotic MMR defects, we also examined the effects of the mlh1-QLF allele on meiotic segregation of the his4-AAG and arg4-17 alleles (Tables 4 and 5, respectively). In the mlh1
strain, 89% of the his4-AAG aberrant segregation events were PMS events compared to only 18% PMS events in the WT strain. There also was a strong elevation in PMS events in the mlh1-QLF mutant, with 78% of the aberrant events being PMS events. With the arg4-17 allele, 50% of the aberrant events were PMS events in both the mlh1
and mlh1-QLF strains, compared to only 1.7% PMS events in the WT control strain.
Recombination-related effects of MSH6 alleles that disrupt interaction with PCNA:
Although the only defect of Mlh1-QLF protein detected in vitro is its interaction with PCNA (LEE and ALANI 2006), it is possible that this property may not accurately reflect the molecular defect in vivo. First, it is unclear whether the region of Mlh1 containing the QLF residues is available for potential interaction with PCNA. Although the crystal structure of a bacterial MutL fragment suggests that this region would be on the surface of the eukaryotic MutL
heterodimer (GUARNE et al. 2004), there is a report that this region is buried at the heterodimer interface (KOSINSKI et al. 2005). Second, the interaction of Mlh1 with PCNA described in vitro is not only very weak relative to the Msh6–PCNA interaction, but it involves electrostatic rather than the typical hydrophobic interactions (LEE and ALANI 2006). Because of uncertainty of the molecular defect associated with the Mlh1-QLF protein, we also examined alleles of MSH6 that perturb its interaction with PCNA.
The Msh6 protein has a consensus PIP box that is required for interaction with PCNA in in vitro assays, but mutation of only the PIP box (msh6-F33AF34A allele, abbreviated here as msh6-FFAA) has only subtle effects on mutation rates (FLORES-ROZAS et al. 2000) and did not detectably affect antirecombination activity in the IR-intron assay (data not shown). A recent analysis of the Msh6–PCNA interaction indicates that the unstructured N terminus of Msh6 forms an extended tether to PCNA, and msh6 alleles that are additionally missing this region have a much stronger phenotype than those that simply have a mutated PIP box (SHELL et al. 2007). We thus examined the ability of three plasmid-encoded msh6 alleles to complement the mitotic phenotypes of an msh6
strain: msh6
2-251, msh6
51-251, and msh6-FFAA,
51-251 (SHELL et al. 2007). Whereas the msh6
51-251 allele produced a weak mutator phenotype similar to that of an msh6-FFAA allele (data not shown), the msh6-FFAA,
51-251 allele with both mutations as well as the msh6
2-251 allele produced strong mutator phenotypes in the CAN1 assay (Table 6). Our mutator results are completely consistent with those reported by SHELL et al. (2007). In the msh6
control strain, the HER:HR rate ratio was elevated 8.3-fold (Table 6), which, as reported previously, is 2-fold less than that typically seen in msh3
msh6
or msh2
mutants (NICHOLSON et al. 2000; SPELL and JINKS-ROBERTSON 2003). Only the msh6
2-251 allele elevated the HER:HR ratio a very modest 1.8-fold. Of particular significance, the Msh6-FFAA,
51-251 protein, which had lost substantial MMR function in the CAN1 forward mutation assay (14-fold elevation in Can-R rate relative to a 56-fold elevation in the absence of Msh6), retained much, if not all, antirecombination activity.
The mitotic behavior of the msh6-FFAA,
51-251 allele suggests that the antirecombination and spellchecker functions of the encoded protein may be separable. To explore this further, we analyzed the repair of meiotic heteroduplexes in an msh6
/msh6
diploid containing either an MSH6 or an msh6-FFAA,
51-251 allele on a complementing LEU2/CEN plasmid (Table 4). Because of plasmid stability issues, only those tetrads that produced at least one Leu+ spore were included in the analyses of heteroduplex repair. Even so, PMS of the his4-AAG allele was elevated in the Msh6-complemented control strain relative to a diploid with a chromosomal MSH6 allele (30% vs. 18% PMS/aberrant events). In the strain with the complementing msh6-FFAA,
51-251 allele, the level of PMS was further elevated to 62%, demonstrating a clear and substantial loss of the meiotic mismatch repair activity of the encoded protein.
In all current models of recombination strand invasion is followed by replicative extension of the invading 3' end (for a review see KROGH and SYMINGTON 2004), and hence one might expect PCNA to be present at an early stage. Because most mismatches in recombination intermediates would be formed via strand invasion (and possibly branch migration) rather than as a result of replication, however, it is not obvious whether PCNA might be similarly required for mismatch repair and/or antirecombination. It is possible, for example, that mismatch recognition and processing occurs at the initial strand-invasion step, before any DNA synthesis occurs. In addition, although repair directed to the newly synthesized DNA strand is essential for the spellchecker function of MMR, unbiased repair of mismatches generated during recombination would have relatively minor biological consequences. In the current study, we have specifically addressed the role of PCNA in the recombination-related processing of mismatches in both mitotic and meiotic recombination intermediates.
The fate of mismatches in meiotic heteroduplex DNA was assessed by tetrad dissection, where a decrease in the efficiency of mismatch repair leads to an increase in the ratio of PMS to total aberrant events. It should be noted that, as in the case of replication errors, the repair of meiotic heteroduplex DNA presumably involves mismatch excision followed by DNA synthesis to fill in the resulting gap. In the case of spontaneous mitotic recombination, it is not possible to directly study mismatch correction in an analogous manner. We thus used a mitotic antirecombination assay in which the production of recombinants between diverged sequences is strongly inhibited by the yeast MutS and MutL complexes. Because only antirecombination is dependent on the helicase activity of Sgs1 (MYUNG et al. 2001; SPELL and JINKS-ROBERTSON 2004b), its mechanism may be distinct from the nucleolytic destruction that characterizes the removal of replication errors. One can imagine scenarios in which MMR–PCNA interactions might be relevant to all, some, or none of the recombination processes involving mismatched heteroduplex DNA. As discussed in detail below, our data demonstrate that PCNA interactions are required for efficient MMR during meiotic recombination processes, but play a relatively minor role during mitotic antirecombination.
Some mutator alleles of PCNA are weakly defective in the processing of recombination intermediates:
PCNA was first implicated in MMR through the analysis of the pol30-104 (JOHNSON et al. 1996) and pol30-52 (UMAR et al. 1996) alleles, each of which additionally confers cold and mutagen sensitivity. Although teasing apart the contributions of general replication problems and specific MMR defects to mutagenesis has been difficult in the corresponding mutants, they are generally assumed to be at least partially MMR defective. In our mitotic analyses, both alleles caused a significant hyperrecombination phenotype between identical substrates, underscoring the need to include homologous substrates as a control when examining HER. Whereas the pol30-104 allele did not elevate HER to a greater extent than HR, the HER:HR ratio was elevated a modest twofold in the pol30-52 mutant. The effect of the pol30-52 allele on the repair of meiotic mismatches was much more striking, with the percentage of his4-AAG PMS events among aberrant events (hereafter referred to as % PMS) increasing fivefold, from 6.1% in the WT strain to 30% in the mutant. Even so, this increase in PMS was still significantly below the 72% observed in an msh2
strain.
To clarify the role of PCNA in MMR-related recombination processes, we also examined two pol30 alleles whose only known defect is in MMR: pol30-201 and pol30-204 (LAU et al. 2002). Both alleles caused significant increases in mitotic HR (1.7- and 4.0-fold increases for pol30-201 and pol30-204, respectively), however, and we suggest that each likely confers a subtle replication defect. The large hyperrec phenotype of the pol30-204 strain relative to the pol30-201 strain is consistent with the observation that pol3-204, but not pol30-201, mutants are slightly sensitive to MMS and UV (LAU et al. 2002). With respect to possible non-MMR defects in the pol30-201 mutant, we found that this allele also resulted in a significant reduction in aberrant segregation of the his4-AAG marker (58% for WT, 64% for msh2
, and 34% for pol30-201). The reduction in aberrant segregation was even more severe for the his4-3133 allele, which is located 2 kb farther from the site of recombination initiation than the his4-AAG marker, suggesting that heteroduplex extension is reduced in the pol30-201 mutant. Together our mitotic and meiotic recombination analyses indicate a subtle impairment of DNA synthesis in the pol30-201 mutant, at least in the strain backgrounds used in this study. On the basis of the large number of processes in which PCNA participates and the fact that many of the relevant proteins interact with the interdomain connector loop of PCNA (MOLDOVAN et al. 2007), we suggest that it may not be possible to specifically perturb one DNA metabolic process through changes in PCNA without having collateral effects on other processes.
In the mitotic antirecombination assay, the pol30-201, but not the pol30-204, allele significantly elevated the HER:HR ratio (3-fold), but to a much lesser extent than did the complete elimination of MMR (17-fold). The pol30-201 allele also reduced, but did not eliminate, the repair of mismatches in meiotic recombination intermediates (the pol30-204 allele was not analyzed), with the % PMS being elevated for both the his4-AAG and arg4-17 alleles (Tables 4 and 5). As with the pol30-52 allele, it should be noted that the meiotic defect associated with the pol30-201 allele was more pronounced than the mitotic defect. The observation that effects of the pol30 alleles on meiotic and especially mitotic recombination processes were less than those associated with the complete loss of MMR may reflect some degree of continued function of the mutant PCNAs. Alternatively, PCNA might simply increase the efficiency of, but not be absolutely required for, the MMR-dependent regulation of recombination fidelity and meiotic heteroduplex repair. Although the data obtained with the pol30-52 and pol30-201 mutants are suggestive of a minor role for PCNA in the MMR-dependent regulation of recombination, the additional DNA metabolic defects conferred by all available pol30 alleles temper the conclusions that can be drawn. For this reason, we additionally examined mutations in MMR proteins that are thought to specifically disrupt interactions with PCNA.
MMR-dependent processing of recombination intermediates is abolished in mlh1-QLF mutants:
Alteration of the canonical Msh6 PIP box sequence (msh6-FFAA allele) causes only a weak mutator phenotype (FLORES-ROZAS et al. 2000) while that of the putative Mlh1 PIP-like domain (the mlh1-QLF allele) completely eliminates the spellchecker activity of the MMR machinery (LEE and ALANI 2006; Table 2). Consistent with the relative mutator phenotypes of msh6-FFAA and mlh1-QLF strains, a PIP box-defective msh6 allele did not detectably impair the antirecombination activity of the MMR machinery (data not shown) while the mlh1-QLF allele was indistinguishable from an mlh1 null allele in terms of antirecombination activity (Table 6) and meiotic heteroduplex repair (Tables 4 and 5).
The interaction of MutL
and MutS
with PCNA was recently examined using surface plasmon resonance. Not only was the MutS
interaction with PCNA much stronger, but the salt resistances of the PCNA-containing complexes indicated that the MutL
interaction is largely ionic whereas the MutS
interaction is hydrophobic (LEE and ALANI 2006). These different strengths and modes of interaction would not be expected if Mlh1, like Msh6, interacts with PCNA via its PIP-related domain. Finally, there is debate in the literature as to whether the region of Mlh1 defined by the mlh1-QLF allele would even be available for interaction with PCNA (KOSINSKI et al. 2005, but also see CLARK et al. 2007). Given these considerations, it is not clear whether the phenotype conferred by mutating the PIP-related region of Mlh1 indeed reflects a specific PCNA-interaction defect, or whether the mlh1-QLF allele is MMR defective for an unrelated, uncharacterized reason. Additional data obtained with defined msh6 alleles and discussed below suggest that the latter may be more likely.
Relevance of the PCNA interaction to the recombination-related roles of Msh6:
Recent data suggest that many PIP-domain-containing proteins are tethered to PCNA via an unstructured, flexible linker region (SHELL et al. 2007). In the case of Msh6, this linker corresponds roughly to the region between the PIP box at the amino terminus and the DNA-binding domain, which is the first region of high homology between MutS proteins. Combining a PIP-box mutation with an internal deletion that shortens the Msh6 linker (msh6-FFAA,
51-251 allele) confers a strong mutator phenotype, whereas the individual mutations produce only a weak phenotype (SHELL et al. 2007). Given the caveats associated with MMR-defective pol30 alleles and with the mlh1-QLF allele, the double mutant msh6-FFAA,
51-251 allele may provide the most direct test for an involvement of PCNA in the recombination-related functions of the yeast MMR machinery. While the clear elevation in PMS frequency indicates defective repair of meiotic heteroduplex DNA in the msh6-FFAA,
51-251 mutant, there was no detectable impairment of MutS
antirecombination activity. Given the small, 10-fold range over which antirecombination can be measured in the IR assay, however, we cannot rule out a minor role of PCNA in regulating recombination fidelity. The relatively weak antirecombination defects conferred by the pol30-201 and pol30-52 alleles would be consistent with such a minor role, but they also could reflect the collateral effects of these alleles on DNA metabolism. We suggest that the msh6-FFAA,
51-251 allele is a separation-of-function allele that distinguishes PCNA-dependent repair activities of the yeast MMR machinery (i.e., the repair of mismatches in replication and recombination intermediates) from the antirecombination activity of the yeast MMR machinery, which our data suggest is largely, if not completely, PCNA independent. While this interpretation assumes that the functional redundancy of the Msh6 PIP domain with the region between residues 51 and 251 reflects PCNA-specific interactions, it is possible that redundancy might instead reflect alternative modes of localizing MMR proteins to regions of active DNA synthesis (see SHELL et al. 2007 for further discussion and also CLARK et al. 2007).
Implications of the PCNA requirement for the MMR-dependent processing of recombination intermediates:
The MMR machinery detects and removes replication-generated mismatches in a reaction that is facilitated by PCNA and hence likely takes place in close proximity to the replication fork. In current models of recombination, invasion of a duplex DNA is followed by DNA synthesis primed from the invading 3' end, a reaction that likewise requires a PCNA-tethered DNA polymerase. If the MMR-directed removal of mismatches in heteroduplex recombination intermediates occurs after extension of the invading 3' end begins, one might expect an involvement of PCNA that is similar to that seen during replication. The meiotic data presented here is consistent with such a model, with disruption of the Msh6–PCNA interaction resulting in elevated PMS among non-Mendelian tetrads. In contrast, the interaction of the MMR machinery with PCNA appears to be of relatively little importance during antirecombination. This suggests that there may be a very early recombination-associated fidelity check that occurs during the initial strand-invasion process, before DNA synthesis is initiated from the invading 3' end. Antirecombination data obtained using a transformation-based gap-repair assay indeed suggest that the blockage of recombination is separable from the repair of mismatches in recombination intermediates. In the gap-repair assay, recombinants produced in the presence of MMR show no evidence of persistent heteroduplexes (C. WELZ-VOEGELE and S. JINKS-ROBERTSON, unpublished data), indicating that intermediates can escape antirecombination activity of the MMR machinery and still be subject to mismatch correction. An early editing step during recombination might involve an Sgs1-mediated unwinding of the invading 3' end, as Sgs1 is involved in antirecombination but not in mismatch correction (MYUNG et al. 2001; SPELL and JINKS-ROBERTSON 2004b; SUGAWARA et al. 2004). Once DNA synthesis initiates, however, we speculate that the MMR machinery switches to a repair mode, thus making the repair of mismatches in recombination intermediates mechanistically very similar to the repair of replication errors. We note that a two-stage model also has been proposed to explain antirecombination in E. coli (STAMBUK and RADMAN 1998). Whether the late repair process we propose can also become a mechanism of antirecombination may depend on the density of mismatches in recombination intermediates.
2 Present address: Laboratory of Molecular Genetics and Laboratory of Structural Biology, National Institute of Environmental Health Sciences, National Institutes of Health, Department of Health and Human Services, Research Triangle Park, NC 27709. ![]()
ALANI, E., R. A. G. REENAN and R. D. KOLODNER, 1994 Interaction between mismatch repair and genetic recombination in Saccharomyces cerevisiae. Genetics 137: 19–39.[Abstract]
ALTMAN, D. G., 1990 Practical Statistics for Medical Research. CRC Press, New York.
AMIN, N. S., and C. HOLM, 1996 In vivo analysis reveals that the interdomain region of the yeast proliferating cell nuclear antigen is important for DNA replication and DNA repair. Genetics 144: 479–493.[Abstract]
ARGUESO, J. L., D. SMITH, J. YI, M. WAASE, S. SARIN et al., 2002 Analysis of conditional mutations in the Saccharomyces cerevisiae MLH1 gene in mismatch repair and in meiotic crossing over. Genetics 160: 909–921.
ARGUESO, J. L., A. W. KIJAS, S. SARIN, J. HECK, M. WAASE et al., 2003 Systematic mutagenesis of the Saccharomyces cerevisiae MLH1 gene reveals distinct roles for Mlh1p in meiotic crossing over and in vegetative and meiotic mismatch repair. Mol. Cell. Biol. 23: 873–886.
AYYAGARI, R., K. J. IMPELLIZZERI, B. L. YODER, S. L. GARY and P. M. BURGERS, 1995 A mutational analysis of the yeast proliferating cell nuclear antigen indicates distinct roles in DNA replication and DNA repair. Mol. Cell. Biol. 15: 4420–4429.
CHEN, C., B. J. MERRILL, P. J. LAU, C. HOLM and R. D. KOLODNER, 1999 Saccharomyces cerevisiae pol30 (proliferating cell nuclear antigen) mutations impair replication fidelity and mismatch repair. Mol. Cell. Biol. 19: 7801–7815.
CHEN, W., and S. JINKS-ROBERTSON, 1998 Mismatch repair proteins regulate heteroduplex formation during mitotic recombination in yeast. Mol. Cell. Biol. 18: 6525–6537.
CHEN, W., and S. JINKS-ROBERTSON, 1999 The role of the mismatch repair machinery in regulating mitotic and meiotic recombination between diverged sequences in yeast. Genetics 151: 1299–1313.
CLARK, A. B., F. VALLE, K. DROTSCHMANN, R. K. GARY and T. A. KUNKEL, 2000 Functional interaction of proliferating cell nuclear antigen with MSH2–MSH6 and MSH2–MSH3 complexes. J. Biol. Chem. 275: 36498–36501.
CLARK, A. B., L. DETERDING, K. B. TOMER and T. A. KUNKEL, 2007 Multiple functions for the N-terminal region of Msh6. Nucleic Acids Res. 35: 4114–4123.
CONSTANTIN, N., L. DZANTIEV, F. A. KADYROV and P. MODRICH, 2005 Human mismatch repair: reconstitution of a nick-directed bidirectional reaction. J. Biol. Chem. 280: 39752–39761.
DATTA, A., M. HENDRIX, M. LIPSITCH and S. JINKS-ROBERTSON, 1997 Dual roles for DNA sequence identity and the mismatch repair system in the regulation of mitotic crossing-over in yeast. Proc. Natl. Acad. Sci. USA 94: 9757–9762.
DETLOFF, P., J. SIEBER and T. D. PETES, 1991 Repair of specific base pair mismatches formed during meiotic recombination in the yeast Saccharomyces cerevisiae. Mol. Cell. Biol. 11: 737–745.
DETLOFF, P., M. A. WHITE and T. D. PETES, 1992 Analysis of a gene conversion gradient at the HIS4 locus in Saccharomyces cerevisiae. Genetics 132: 113–123.[Abstract]
DZANTIEV, L., N. CONSTANTIN, J. GENSCHEL, R. R. IYER, P. M. BURGERS et al., 2004 A defined human system that supports bidirectional mismatch-provoked excision. Mol. Cell 15: 31–41.[CrossRef][Medline]
ERDENIZ, N., M. NGUYEN, S. M. DESCHENES and R. M. LISKAY, 2007 Mutations affecting a putative MutL
endonuclease motif impact multiple mismatch repair functions. DNA Repair 6: 1463–1470.[CrossRef][Medline]
FAN, Q., F. XU and T. D. PETES, 1995 Meiosis-specific double-strand DNA breaks at the HIS4 recombination hot spot in the yeast Saccharomyces cerevisiae: control in cis and trans. Mol. Cell. Biol. 15: 1679–1688.
FLORES-ROZAS, H., D. CLARK and R. D. KOLODNER, 2000 Proliferating cell nuclear antigen and Msh2p-Msh6p interact to form an active mispair recognition complex. Nat. Genet. 26: 375–378.[CrossRef][Medline]
GOLDSTEIN, A. L., and J. H. MCCUSKER, 1999 Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast 15: 1541–1553.[CrossRef][Medline]
GUARNE, A., S. RAMON-MAIQUES, E. M. WOLFF, R. GHIRLANDO, X. HU et al., 2004 Structure of the MutL C-terminal domain: a model of intact MutL and its roles in mismatch repair. EMBO J. 23: 4134–4145.[CrossRef][Medline]
HARFE, B. D., and S. JINKS-ROBERTSON, 2000 DNA mismatch repair and genetic instability. Annu. Rev. Genet. 34: 359–399.[CrossRef][Medline]
HARRINGTON, J. M., and R. D. KOLODNER, 2007 Saccharomyces cerevisiae Msh2-Msh3 acts in repair of base-base mispairs. Mol. Cell. Biol. 27: 6546–6554.
HOFFMANN, E. R., and R. H. BORTS, 2004 Meiotic recombination intermediates and mismatch repair proteins. Cytogenet. Genome Res. 107: 232–248.[CrossRef][Medline]
HUNTER, N., and R. H. BORTS, 1997 Mlh1 is unique among mismatch repair proteins in its ability to promote crossing-over during meiosis. Genes Dev. 11: 1573–1582.
IYER, R. R., A. PLUCIENNIK, V. BURDETT and P. L. MODRICH, 2006 DNA mismatch repair: functions and mechanisms. Chem. Rev. 106: 302–323.[CrossRef][Medline]
JOHNSON, R. E., G. K. KOVVALI, S. N. GUZDER, N. S. AMIN, C. HOLM et al., 1996 Evidence for involvement of yeast proliferating cell nuclear antigen in DNA mismatch repair. J. Biol. Chem. 271: 27987–27990.
JOSEPH, N., V. DUPPATLA and D. N. RAO, 2006 Prokaryotic DNA mismatch repair. Prog. Nucleic Acid Res. Mol. Biol. 81: 1–49.[Medline]
KADYROV, F. A., L. DZANTIEV, N. CONSTANTIN and P. MODRICH, 2006 Endonucleolytic function of MutL
in human mismatch repair. Cell 126: 297–308.[CrossRef][Medline]
KADYROV, F. A., S. F. HOLMES, M. E. ARANA, O. A. LUKIANOVA, M. O'DONNELL et al., 2007 Saccharomyces cerevisiae MutL
is a mismatch repair endonuclease. J. Biol. Chem. 282: 37181–37190.
KEARNEY, H. M., D. T. KIRKPATRICK, J. L. GERTON and T. D. PETES, 2001 Meiotic recombination involving heterozygous large insertions in Saccharomyces cerevisiae: formation and repair of large, unpaired DNA loops. Genetics 158: 1457–1476.
KIRKPATRICK, D. T., and T. D. PETES, 1997 Repair of DNA loops involves DNA-mismatch and nucleotide-excision repair proteins. Nature 387: 929–931.[CrossRef][Medline]
KOKOSKA, R. J., L. STEFANOVIC, A. B. BUERMEYER, R. M. LISKAY and T. D. PETES, 1999 A mutation of the yeast gene encoding PCNA destabilizes both microsatellite and minisatellite DNA sequences. Genetics 151: 511–519.
KOSINSKI, J., I. STEINDORF, J. M. BUJNICKI, L. GIRON-MONZON and P. FRIEDHOFF, 2005 Analysis of the quaternary structure of the MutL C-terminal domain. J. Mol. Biol. 351: 895–909.[CrossRef][Medline]
KROGH, B. O., and L. S. SYMINGTON, 2004 Recombination proteins in yeast. Annu. Rev. Genet. 38: 233–271.[CrossRef][Medline]
KUNKEL, T. A., and D. A. ERIE, 2005 DNA mismatch repair. Annu. Rev. Biochem. 74: 681–710.[CrossRef][Medline]
LAU, P. J., H. FLORES-ROZAS and R. D. KOLODNER, 2002 Isolation and characterization of new proliferating cell nuclear antigen (POL30) mutator mutants that are defective in DNA mismatch repair. Mol. Cell. Biol. 22: 6669–6680.
LEA, D. E., and C. A. COULSON, 1949 The distribution of the numbers of mutants in bacterial populations. J. Genet. 49: 264–285.[CrossRef]
LEE, S. D., and E. ALANI, 2006 Analysis of interactions between mismatch repair initiation factors and the replication processivity factor PCNA. J. Mol. Biol. 355: 175–184.[CrossRef][Medline]
MALOISEL, L., J. BHARGAVA and G. S. ROEDER, 2004 A role for DNA polymerase
in gene conversion and crossing over during meiosis in Saccharomyces cerevisiae. Genetics 167: 1133–1142.
MERRILL, B. J., and C. HOLM, 1998 The RAD52 recombinational repair pathway is essential in pol30 (PCNA) mutants that accumulate small single-stranded DNA fragments during DNA synthesis. Genetics 148: 611–624.
MOLDOVAN, G. L., B. PFANDER and S. JENTSCH, 2007 PCNA, the maestro of the replication fork. Cell 129: 665–679.[CrossRef][Medline]
MYUNG, K., A. DATTA, C. CHEN and R. D. KOLODNER, 2001 SGS1, the Saccharomyces cerevisiae homologue of BLM and WRN, suppresses genome instability and homeologous recombination. Nat. Genet. 27: 1–4.[CrossRef][Medline]
NAG, D. K., and T. D. PETES, 1993 Physical detection of heteroduplexes during meiotic recombination in the yeast Saccharomyces cerevisiae. Mol. Cell. Biol. 13: 2324–2331.
NICHOLSON, A., M. HENDRIX, S. JINKS-ROBERTSON and G. F. CROUSE, 2000 Regulation of mitotic homeologous recombination in yeast: functions of mismatch repair and nucleotide excision repair genes. Genetics 154: 133–146.
SCHOFIELD, M. J., and P. HSIEH, 2003 DNA mismatch repair: molecular mechanisms and biological function. Annu. Rev. Microbiol. 57: 579–608.[CrossRef][Medline]
SHELL, S. S., C. D. PUTNAM and R. D. KOLODNER, 2007 The N terminus of Saccharomyces cerevisiae Msh6 is an unstructured tether to PCNA. Mol. Cell 26: 565–578.[CrossRef][Medline]
SHERMAN, F., 1991 Getting started with yeast. Meth. Enzymol. 194: 3–20.[CrossRef][Medline]
SIKORSKI, R. S., and P. HIETER, 1989 A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122: 19–27.
SPELL, R. M., and S. JINKS-ROBERTSON, 2003 Role of mismatch repair in the fidelity of RAD51- and RAD59-dependent recombination in Saccharomyces cerevisiae. Genetics 165: 1733–1744.
SPELL, R. M., and S. JINKS-ROBERTSON, 2004a Determination of mitotic recombination rates by fluctuation analysis in Saccharomyces cerevisiae, pp. 3–12 in Genetic Recombination: Reviews and Protocols, edited by A. S. WALDMAN. Humana Press, Totowa, NJ.
SPELL, R. M., and S. JINKS-ROBERTSON, 2004b Examination of the roles of the Sgs1 and Srs2 helicases in the enforcement of recombination fidelity in Saccharomyces cerevisiae. Genetics 168: 1855–1865.
STAMBUK, S., and M. RADMAN, 1998 Mechanism and control of interspecies recombination in Escherichia coli. I. Mismatch repair, methylation, recombination and replication functions. Genetics 150: 533–542.
STAPLETON, A., and T. D. PETES, 1991 The Tn3 β-lactamase gene acts as a hotspot for meiotic recombination in yeast. Genetics 127: 39–51.[Abstract]
STONE, J. E., and T. D. PETES, 2006 Analysis of the proteins involved in the in vivo repair of base–base mismatches and four-base loops formed during meiotic recombination in the yeast Saccharomyces cerevisiae. Genetics 173: 1223–1239.
SUGAWARA, N., T. GOLDFARB, B. STUDAMIRE, E. ALANI and J. E. HABER, 2004 Heteroduplex rejection during single-strand annealing requires Sgs1 helicase and mismatch repair proteins Msh2 and Msh6 but not Pms1. Proc. Natl. Acad. Sci. USA 101: 9315–9320.
SURTEES, J. A., J. L. ARGUESO and E. ALANI, 2004 Mismatch repair proteins: key regulators of genetic recombination. Cytogenet. Genome Res. 107: 146–159.[CrossRef][Medline]
UMAR, A., A. B. BUERMEYER, J. A. SIMON, D. C. THOMAS, A. B. CLARK et al., 1996 Requirement for PCNA in DNA mismatch repair at a step preceding DNA resynthesis. Cell 87: 65–73.[CrossRef][Medline]
WACH, A., A. BRACHAT, R. POHLMANN and P. PHILIPPSEN, 1994 New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10: 1793–1808.[CrossRef][Medline]
WANG, T.-F., N. KLECKNER and N. HUNTER, 1999 Functional specificity of MutL homologs in yeast: evidence for three Mlh1-based heterocomplexes with distinct roles during meiosis in recombination and mismatch correction. Proc. Natl. Acad. Sci. USA 96: 13914–13919.
WARBRICK, E., 1998 PCNA binding through a conserved motif. BioEssays 20: 195–199.[CrossRef][Medline]
WELZ-VOEGELE, C., J. E. STONE, P. T. TRAN, H. M. KEARNEY, R. M. LISKAY et al., 2002 Alleles of the yeast PMS1 mismatch-repair gene that differentially affect recombination- and replication-related processes. Genetics 162: 1131–1145.
WHITE, J. H., K. LUSNAK and S. FOGEL, 1985 Mismatch-specific post-meiotic segregation frequency in yeast suggests a heteroduplex recombination intermediate. Nature 315: 350–352.[CrossRef][Medline]
WHITE, M. A., M. DOMINSKA and T. D. PETES, 1993 Transcription factors are required for the meiotic recombination hotspot at the HIS4 locus in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 90: 6621–6625.
Communicating editor: G. R. SMITH
Related articles in Genetics:
ISSUE HIGHLIGHTS
Genetics 2008 178: NP.
This article has been cited by other articles:
![]() |
R. D. Hutton, J. A. Roberts, J. C. Penedo, and M. F. White PCNA stimulates catalysis by structure-specific nucleases using two distinct mechanisms: substrate targeting and catalytic step Nucleic Acids Res., December 1, 2008; 36(21): 6720 - 6727. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Welz-Voegele and S. Jinks-Robertson Sequence Divergence Impedes Crossover More Than Noncrossover Events During Mitotic Gap Repair in Yeast Genetics, July 1, 2008; 179(3): 1251 - 1262. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
-
All Versions of this Article:
genetics.107.085415v1
178/3/1221 most recent - Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Related articles in Genetics
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Stone, J. E.
- Articles by Jinks-Robertson, S.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Stone, J. E.
- Articles by Jinks-Robertson, S.


