- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Data Supplement
-
All Versions of this Article:
genetics.107.078030v1
178/2/919 most recent - Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Yazdani, U.
- Articles by Terman, J. R.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Yazdani, U.
- Articles by Terman, J. R.
Originally published as Genetics Published Articles Ahead of Print on February 3, 2008.
Genetics, Vol. 178, 919-929, February 2008, Copyright © 2008
doi:10.1534/genetics.107.078030
The Glucose Transporter (GLUT4) Enhancer Factor Is Required for Normal Wing Positioning in Drosophila
Umar Yazdani1, Zhiyu Huang1 and Jonathan R. Terman2
Departments of Neuroscience and Pharmacology, University of Texas Southwestern Medical Center, Dallas, Texas 75390
2 Corresponding author: Departments of Neuroscience and Pharmacology, NA4.301/5323 Harry Hines Blvd., University of Texas Southwestern Medical Center, Dallas, TX 75390.
E-mail: jonathan.terman{at}utsouthwestern.edu
Many of the transcription factors and target genes that pattern the developing adult remain unknown. In the present study, we find that an ortholog of the poorly understood transcription factor, glucose transporter (GLUT4) enhancer factor (Glut4EF, GEF) [also known as the Huntington's disease gene regulatory region-binding protein (HDBP) 1], plays a critical role in specifying normal wing positioning in adult Drosophila. Glut4EF proteins are zinc-finger transcription factors named for their ability to regulate expression of GLUT4 but nothing is known of Glut4EF's in vivo physiological functions. Here, we identify a family of Glut4EF proteins that are well conserved from Drosophila to humans and find that mutations in Drosophila Glut4EF underlie the wing-positioning defects seen in stretch mutants. In addition, our results indicate that previously uncharacterized mutations in Glut4EF are present in at least 11 publicly available fly lines and on the widely used TM3 balancer chromosome. These results indicate that previous observations utilizing these common stocks may be complicated by the presence of Glut4EF mutations. For example, our results indicate that Glut4EF mutations are also present on the same chromosome as two gain-of-function mutations of the homeobox transcription factor Antennapedia (Antp) and underlie defects previously attributed to Antp. In fact, our results support a role for Glut4EF in the modulation of morphogenetic processes mediated by Antp, further highlighting the importance of Glut4EF transcription factors in patterning and morphogenesis.
CHARACTERIZING the molecular mechanisms that pattern the developing human has been a major focus of biomedical science and studies in model organisms such as the fruit fly, Drosophila melanogaster, have proven invaluable for this endeavor. Spontaneous mutations such as Bithorax, Notch, Antennapedia, and wingless that affect the morphology of the adult fly have been the starting point for the identification of molecular pathways that play essential roles in body plan specification in both invertebrates and vertebrates. More recently, genetic screens have been designed to search for particular changes in morphology in developing and adult Drosophila (RUBIN 1988; ST. JOHNSTON 2002). Such screens have led to the identification and characterization of genetic determinants of both development and disease in mammals (BIER 2005; BILEN and BONINI 2005; TOUNTAS and FORTINI 2007).
One adult structure that is particularly useful for identifying the genes required for normal adult morphology is the wings of Drosophila. The characterization of mutations that affect the formation, shape, organization, structure, venation, and positioning of the wings has identified genes conserved both structurally and functionally across diverse phyla. Wingless, for example, the founding member of the phylogenetically conserved Wnt family of signaling molecules, was first identified as a mutation, wingless (wg1) (SHARMA and CHOPRA 1976), that prevents wing formation in Drosophila. More recently, wingless/Wnt's have been found to have widespread effects on both fly and mammalian morphogenesis by coordinating diverse cellular processes (BEJSOVEC 2006; HOPPLER and KAVANAGH 2007).
In this study we determine the underlying causality of a newly identified wing-positioning defect in adult Drosophila and find that this mutation disrupts a member of a novel family of transcription factors conserved from flies to humans. Our results reveal that the stretched out gene corresponds to the Drosophila ortholog of the glucose transporter (GLUT4) enhancer factor (Glut4EF, GEF). Glut4EF is a zinc-finger transcription factor (OSHEL et al. 2000) known to physically associate and activate transcription with the critical muscle regulator myocyte enhancing factor (MEF2) (KNIGHT et al. 2003). Glut4EF transcription factors also contain a CRARF domain that is highly similar to the transcriptional activation and DNA-binding domain present in wingless/Wnt signaling effectors, T-cell-specific factor (TCF) HMG box transcription factors (ARCE et al. 2006; HOPPLER and KAVANAGH 2007). Nothing is known, however, of Glut4EF's in vivo physiological roles. In addition to finding that Drosophila Glut4EF is required for normal adult morphology, our results indicate that previously uncharacterized mutations in Glut4EF are present within at least 11 publicly available fly lines, including within the widely used TM3 balancer chromosome. Among these fly stocks, our results indicate that mutations in Glut4EF are also present on the same chromosome as two dominant gain-of-function Antennapedia (Antp) mutations and underlie defects previously attributed to the homeobox transcription factor Antp. Furthermore, our results also support a role for Glut4EF in the modulation of morphogenetic processes mediated by Antp.
Genetics:
All complementation analyses and genetics were done using standard techniques. All stocks were obtained from the Bloomington Stock Center, except the stretchNP7418-GAL4 allele (NP7418; Drosophila Genetic Resource Center, Japan), s13308, s103402 (Szeged Stock Center), P{EPgy2}stretchEY03156 (a kind gift from Hugo Bellen), Evar631 (kind gift from Gunter Reuter), Df(3R)B22-5 (kind gift from Bill Chia), and P{wH}2-1 (kind gift from Jim Birchler).
Phenotypic characterization:
The outstretched wing phenotype was quantified by crossing adults at 25°: adult offspring from these crosses were first sorted as to genotype, placed into vials of five flies each, and then, following recovery from CO2 anesthesia, examined for outstretched wings. Wings were scored as outstretched if both wings were separated and not overlapping.
Genomic organization, molecular analysis, and transformation constructs:
The insertion site of the P{PZ}10477 P element was determined by using inverse PCR approaches (adapted from a protocol by E. Jay Rehm, Berkeley Drosophila Genome Project) to amplify that portion of genomic DNA flanking the P{PZ}10477 insertion site. In brief, genomic DNA from P{PZ}10477 flies was digested using Sau3A and subjected to inverse PCR using specific primers ("P-TR2," 5' CGACGGGACCACCTTATGTTATTTCATCATG, and "P-Lac," 5' AGCTGGCGTAATAGCGAAGAGGCCCGCA) for the P-transposable element PZ[ry,lacZ]. The resulting 163-bp PCR product was inserted into the pCR2.1-TOPO cloning vector (Invitrogen, San Diego) and sequenced. The genomic organization of the D-Glut4EF locus was determined, with the aid of the Sequencher 4.6 program (Gene Codes, Ann Arbor, MI), using our identified cDNAs, DNA flanking the insertion sites of P elements, and publicly available Drosophila genomic DNA sequences. Proteins, domains, and alignments were identified using Web-based protein domain searching and alignment tools including PFAM, BLAST, and ClustalX and our own molecular analysis. ESTs corresponding to all four isoforms [D-Glut4EFa (RE66512), D-Glut4EFb (RE25317), D-Glut4EFc (RH63124), and D-Glut4EFd (GH15792)] were obtained from the Drosophila Genome Resource Center and sequenced on both strands (sequences are deposited in GenBank). The D-Glut4EFd rescue construct was created by cutting D-Glut4EFd from EST GH15792 with two restriction endonucleases [EcoRI (5') and SalI (3')] whose sites were present in the 5'-UTR and the 3'-UTR of the GH15792 EST. This 2.2-kb fragment containing the D-Glut4EFd open reading frame (ORF) and portions of the 5'- and the 3'-UTR was then inserted into compatible restriction sites (EcoRI and XhoI) in the pUAST vector for Drosophila germline transformation. Multiple transformants were obtained.
In situ hybridization:
RNA in situ analyses on fly larvae imaginal discs were carried out using sense and anti-sense cRNA probes corresponding to the D-Glut4EFd isoform (CADIGAN et al. 1998; HUANG et al. 2007).
Imaging, quantification, and statistical analysis:
All images were captured using a Zeiss Discovery stereomicroscope or a Leica MZ16 stereomicroscope with an Axiocam HRc camera and Axiovision software. Three-dimensional reconstruction software (Extended Focus software, a kind gift from Bernard Lee) was used to construct the images of the adult flies. Brightness, contrast, and color balance of images were adjusted using Adobe Photoshop. Statistical analysis (chi-square test) was performed with the aid of the GraphPad InStat software package.Adult Drosophila stretched out (stretch) mutants exhibit abnormal wing positioning:
During the process of characterizing mutations mapped to the 85E–85F locus of the Drosophila third chromosome, we obtained a P-transposable element insertion line P{PZ}l(3)10477 that was interesting because in contrast to normal flies that hold their wings straight back over their bodies (see Figure 1A), 100% of the flies in this stock held their wings out at a 45° angle (see Figure 1B). However, previous work by others on this fly stock (see supplemental Figure S1 at http://www.genetics.org/supplemental/) suggested that there was no association of the wing phenotype with the P-transposable element insertion. In the course of designing a screen to make a mutation in the MICAL gene (TERMAN et al. 2002), we used this P-element-containing fly line (P{PZ}l(3)10477) and recombined a recessive marker (scarlet, st) onto the chromosome containing the P element. Recombined st, 10477 flies were now viable over the original P{PZ}l(3)10477 line, suggesting we had removed a second site lethality. Interestingly, the st, 10477/P{PZ}l(3)10477 flies held their wings out at an angle (Figure 1D), while st, 10477 flies heterozygous over a wild-type chromosome (st, 10477/+) or P{PZ}l(3)10477 flies heterozygous over a wild-type chromosome (10477/+) showed no abnormal wing positioning (Figure 1D; supplemental Table S1 at http://www.genetics.org/supplemental/). These results suggest that the wing-positioning defect in these flies is caused by a recessive mutation associated with the presence of the P{PZ}10477 P element.
|
|
To determine if the wing-positioning defect associated with the P{PZ}10477 P-element line was due to an alteration of a gene in the 85E–F region of the Drosophila genome, we asked if 10477 flies exhibited a wing phenotype when heterozygous to a deficiency removing the 85E–F region. Our results revealed that adult flies heterozygous for both 10477 and Df(3R)by62 (breakpoints 85D10–11 and 85F1–8) had an outstretched wing phenotype (Figure 1D). In contrast, adults heterozygous for both 10477 and an adjacent deficiency [Df(3R)by10; deleted region 85D8–85E13] appeared wild type (Figure 1D). These results indicate that the recessive mutant wing-positioning defect is associated with a gene in the 85E–F region and we have called this mutation stretched out (stretch) on the basis of the wing phenotype.
stretch mutations are present in a number of fly lines including within the TM3 balancer:
Following our initial characterization of the stretch mutation and its localization to the 85E–F region of the Drosophila genome, we reexamined the original stock we had obtained from the Bloomington Stock Center that had an outstretched wing phenotype. In particular, we wondered why the original stock P{PZ}l(3)10477, which was heterozygous for the recessive stretch10477 mutation, exhibited a 100% outstretched wing phenotype. The original stock was listed as containing a dominant Dichaete allele (CxD) that was responsible for the outstretched wing phenotype. However, our analysis of the stock suggested that CxD was not present within it (see supplemental Figure S1). Specifically, the stock had a Stubble (Sb) appearance, suggesting that the TM3 Sb balancer was present in the stock. Interestingly, the TM3 balancer is listed as having a chromosomal breakpoint in the 85E area (LINDSLEY and ZIMM 1992), which is the same location that the 10477 P element had been mapped. We therefore wondered if the TM3 balancer disrupted the same locus as the 10477 P element, thereby giving rise to an outstretched wing defect when the two alleles were present in one fly. Indeed, when we crossed the 10477 P-element line to different TM3 balancer lines (e.g., flies containing either TM3 Sb or TM3 Serrate), all 10477/TM3 flies had outstretched wings (Figure 1D). In contrast, when the 10477 line was crossed to another balancer that does not have breakpoints in the 85E–85F region (the TM6B balancer), offspring exhibited a normal, wild-type appearance (Figure 1D). Interestingly, we also found that a progenitor of the TM3 balancer, In(3LR)sep, vvlsep kniri-1 pp sep1 [breakpoints 65D2–3 and 85F2–4 (LINDSLEY and ZIMM 1992)], had a previously uncharacterized recessive wings-out phenotype and genetic complementation analysis revealed that it was also a stretch allele (Figure 1D). These data indicate that the TM3 balancer contains a previously undiscovered mutant allele of the gene disrupted by the 10477 P element and should now be listed as containing the stretch mutation, which can serve as a 100% penetrant recessive marker.In light of our identification of stretch mutations on the TM3 balancer chromosome we wondered how prevalent stretch mutations might be in other stocks and looked for additional alleles of stretch. We obtained publicly available fly stocks with breakpoints (deletions, inversions) or insertions assigned to the 85E–85F region. Of the large number of fly lines we tested using genetic complementation analysis (supplemental Figure S1 and supplemental Table S1; data not shown), we found six additional lines, including four additional P-element stocks that exhibited a recessive wing phenotype indicating they were also stretch alleles (Figure 1, D–F). Interestingly, wing-positioning defects had previously been seen in some of the stretch alleles we identified including A1 (mapped insertion 85E), In(3R)AntpR (breakpoints 84B1 and 85F) (GARBER et al. 1983), and In(3R)AntpB (breakpoints 84B1–2 and 85E) (DUNCAN and KAUFMAN 1975; KAUFMAN et al. 1980; LINDSLEY and ZIMM 1992) but their causality had either been assigned as a dominant allele (A1) or characterized to mutations in other genes [In(3R)AntpR, In(3R)AntpB; see below]. Furthermore, it is likely that the In(3LR)4f fly line (breakpoints 79D3–D4 and 85E) (CARPENTER 1994), which we have been unable to obtain, also disrupts stretch since the chromosomal breakpoints map to this location and the In(3LR)4f fly line has been indicated to have a wings-out phenotype. Finally, we also noted from our complementation analysis that the wing-positioning defect in several weaker stretch alleles was more severe in males (supplemental Table S1).
stretch mutations disrupt Drosophila Glut4EF—a member of a novel phylogenetically conserved family of transcription factors:
To determine the gene disrupted in these stretch mutants we sequenced the genomic DNA flanking several stretch P-element alleles and found that all of these P-element mutations were inserted in a novel Drosophila gene that covered >115 kb of genomic DNA (Figure 2A). This single gene had previously been annotated as three separate genes and given the names CG12418, CG12802, and CG33975 (previously CG11676 and CG32469) (Figure 2B). Our in-depth analysis of ESTs and cDNAs in that region of the genome revealed at least four different transcripts sharing overlapping exons (Figure 2, B and C). The longest of these splice variants (Glut4EFd; Figure 2, B and C) showed a high degree of amino acid identity and conserved domain organization to the mammalian glucose transporter 4 enhancer factor (Glut4EF, GEF) (Figures 3 and 4A) (OSHEL et al. 2000). Glut4EF [also called the Huntington's disease gene regulatory region-binding protein (HDBP) 1 (TANAKA et al. 2004) and SLC2A4RG] was originally characterized and named for its ability to bind to the enhancer of the Glucose Transporter 4 gene (OSHEL et al. 2000). Glut4EF proteins are also highly similar to papillomavirus binding factor (PBF) (BOECKLE et al. 2002), also called HDBP2 (TANAKA et al. 2004), osteosarcoma antigen (TSUKAHARA et al. 2004), and ZNF395 (STOECKMAN et al. 2006) (Figure 4A), and in our search of the database we found a previously uncharacterized human EST ZNF704 [similar to the mouse EST Zfp704 (BLACKSHAW et al. 2004), also called mouse glucocorticoid-induced gene 1 (Gig1)] that was highly related to Glut4EF proteins and represents a third mammalian family member (Figure 4A). Therefore, the gene disrupted in stretch mutants represents the Drosophila member of a new family of transcription factors conserved from Drosophila to mammals. We propose to name this new family of proteins the glucose transporter 4 enhancer factor (Glut4EF, GEF) family after the original member (OSHEL et al. 2000).
|
|
Drosophila Glut4EF (D-Glut4EFd), like Glut4EF, PBF, and ZNF704, contains a nuclear localization signal (NLS) and a classical C2H2 zinc-finger DNA-binding domain (Figures 3 and 4A). At their C terminus, D-Glut4EFd, Glut4EF, PBF, and ZNF704 also contain a CRARF/RKKCIRY (CR) domain that is highly similar to the transcriptional activation and DNA-binding domain present in "E" variants of TCF transcription factors (Figures 3 and 4) (ARCE et al. 2006; HOPPLER and KAVANAGH 2007). Our analysis suggested that the CRARF domain may also be important for D-Glut4EF function in proper wing positioning since a P-element insertion (EY04651) situated upstream of the CRARF domain but downstream of the NLS and the C2H2 zinc-finger DNA-binding domain resulted in an outstretched wing phenotype similar to that seen in other stretch alleles (Figures 2A and 3).
Expression of Glut4EFd rescues the wing-positioning defect observed in stretch mutants:
To confirm that disruption of D-Glut4EF was responsible for the wing-positioning defect present in stretch mutants we sought to express D-Glut4EF in a stretch mutant background. Initially, we decided to focus our rescue experiments on the D-Glut4EFd isoform since it was well conserved to mammalian Glut4EF (Figure 4A) and our P-element insertion-site mapping revealed that D-Glut4EFd was likely to be disrupted by each of the stretch P-element mutations (Figure 2B). We therefore restored the expression of D-Glut4EFd in stretch mutants, using the GAL4–UAS system (BRAND and PERRIMON 1993) and a GAL4 enhancer trap line [NP7418GAL4 (D-GlutEF-GAL4)] that we identified as being inserted within D-Glut4EF (Figures 1, D–F, and 2, A and B). Expressing one copy of the D-Glut4EFd cDNA (UAS-D-Glut4EFd) using the D-Glut4EF-GAL4 driver rescued the wing-positioning defect we observed in stretch mutants (Figure 1, C and D; supplemental Table S1). These results reveal that expression of D-Glut4EFd is sufficient to rescue the wing-positioning defect present in stretch mutants and uncover an important role for Glut4EF proteins in specifying normal adult morphology.
Mutations in D-Glut4EF are present in some mutant lines of the homeobox transcription factor Antp:
Our results highlight the importance of Glut4EF in normal adult morphology but they also reveal that previously uncharacterized mutations in stretch are present in a number of different genetic backgrounds, including on the TM3 balancer. Interestingly, two previously characterized dominant gain-of-function (GOF) mutant alleles of the homeobox gene Antennapedia (AntpB and AntpR) exhibit outstretched wing-positioning defects (Figure 5, B and D) that had previously been attributed to disruptions in Antp (VAZQUEZ et al. 1999; GUTIERREZ et al. 2003). However, both of these Antp mutants [In(3R)AntpB and In(3R)AntpR] also have chromosomal breakpoints that are in the vicinity of D-Glut4EF (85E–F) (DUNCAN and KAUFMAN 1975; KAUFMAN et al. 1980; GARBER et al. 1983; SCOTT et al. 1983; LINDSLEY and ZIMM 1992). Strikingly, our genetic complementation and mapping studies indicated that both previously characterized Antp mutants [In(3R)AntpB and In(3R)AntpR] also contained mutations in D-Glut4EF (Figures 1, D–F, 2A, and 5, B and D; supplemental Figure S1 and supplemental Table S1). For example, our results with the In(3R)AntpB allele were in line with previously published results on the chromosomal breakpoints observed in this mutant (breakpoints 84B1–2 and 85E) (DUNCAN and KAUFMAN 1975; KAUFMAN et al. 1980; LINDSLEY and ZIMM 1992) and indicated that the right chromosomal breakpoint of In(3R)AntpB falls to the right of the 85E13 region of the Drosophila third chromosome and disrupts the stretch gene (Figures 1F and 2A). In addition, phenotypic and complementation analysis indicated that heterozygous In(3R)AntpB/+ adults position their wings normally (Figure 5, A and D) but exhibit 100% penetrant wing-positioning defects when heterozygous with D-Glut4EF mutants (In(3R)AntpB/stretchNP7418-GAL4; n = 57; Figure 5D; see also Figure 1F and supplemental Table S1). In contrast, we find that Antp alleles that do not have published breakpoints in the vicinity of D-Glut4EF [AntpNs, Antp17, Antp73b, AntpYu, Antp50, AntpRM, AntpCtx, AntpPw, AntpHu (the TM6B balancer contains an AntpHu mutation), and the Antp P2 promoter mutants (Antp1 and Antp23) (LINDSLEY and ZIMM 1992)] exhibit normal wing positioning in combination with D-Glut4EF mutants (supplemental Figure S1 and supplemental Table S1). Finally, we were able to rescue the wing-positioning defects observed in adults heterozygous for both In(3R)AntpB and D-Glut4EF by expressing D-Glut4EFd under the D-Glut4EF-GAL4 driver (Figure 5, C and D; supplemental Table S1). Therefore, our results indicate that both of these previously characterized Antp mutants [In(3R)AntpB and In(3R)AntpR] contain mutations in both Antp and D-Glut4EF but it is D-Glut4EF that is needed for proper positioning of the wings.
|
D-Glut4EF modifies the morphogenetic function of Antp:
Dominant Antp alleles, like AntpB and AntpR, produce a range of homeotic transformations of anterior regions, most notably of antenna to mesothoracic leg (reviewed in KAUFMAN et al. 1990; LINDSLEY and ZIMM 1992). These mutant phenotypes are due to inappropriate expression of Antp in the eye-antennal disc (FRISCHER et al. 1986; JORGENSEN and GARBER 1987; SCHNEUWLY et al. 1987). Since our results indicate that mutations in both Antp and D-Glut4EF are present in these two previously characterized dominant Antp mutants [In(3R)AntpB and In(3R)AntpR], we wondered if D-Glut4EF might be genetically modifying the phenotypes associated with misexpression of Antp. In line with this hypothesis, we found that when we used D-Glut4EFd to rescue the outstretched wing defects present in the AntpB mutant, we also observed an increase in the severity of the antenna defects (Figure 5C). This suggested that D-Glut4EFd might be a positive modifier of Antp function. To better address this possibility we examined the expression of D-Glut4EFd and found that high levels of the D-Glut4EFd transcript were present in the regions that specify the antennae, the eye-antenna disc (Figure 6, A–C). To further examine whether D-Glut4EFd genetically modifies Antp function we looked at a dominant Antp allele that does not contain breakpoints in the vicinity of D-Glut4EF (AntpNs) (LINDSLEY and ZIMM 1992). The AntpNs allele is a dominant allele in which the antennae are transformed to legs and the head is disrupted (reviewed in LINDSLEY and ZIMM 1992) (Figure 6, D, E, G, and H). Removing one copy of the D-Glut4EF gene dramatically suppressed these severe morphogenetic defects and returned the fly to a more wild-type appearance (Figure 6, F–H). These results are consistent with the model that a Glut4EF transcription factor family member positively modulates the morphogenetic function of the homeobox transcription factor Antp.
|
Importantly, our results provide new insights into the Glut4EF family of transcription factors and are the first demonstration of a role for Glut4EF in vivo. Glut4EF was originally named for its ability to bind to the enhancer of the Glucose Transporter 4 gene, the major glucose regulator in skeletal muscle and principally responsible for insulin-mediated glucose uptake in muscle and adipose tissue (OSHEL et al. 2000). More recently, Glut4EF has been found to associate with the myocyte enhancing factor (MEF2A) to activate transcription of GLUT4 (KNIGHT et al. 2003). However, the functional significance of these interactions is poorly understood. Likewise, Glut4EF/HDBP1 also regulates expression of the Huntington's disease (HD) gene in neuronal cells in culture but the in vivo functional significance of this interaction is also not known (TANAKA et al. 2004). Members of the D-Glut4EF family of transcription factors bind to DNA sequences within a number of genes including ACCGG within GLUT4 (OSHEL et al. 2000; KNIGHT et al. 2003), GCCGGCG within the human Huntington's disease gene (TANAKA et al. 2004), and CCGG in the E2 binding site of papillomavirus genomes (BOECKLE et al. 2002). D-Glut4EFd, Glut4EF, PBF, and ZNF704 also contain a CR domain at their C terminus that is highly similar to the transcriptional activation and DNA-binding domain present in E variants of the wingless/Wnt signaling effectors, TCF transcription factors (ARCE et al. 2006; HOPPLER and KAVANAGH 2007). In TCF, the CRARF domain is necessary for transcriptional activation mediated through both β-catenin and the CREB-binding protein (CBP)/p300 (ATCHA et al. 2003; HECHT and STEMMLER 2003). This activity is important during development but its misregulation leads to overactive Wnt signaling and drives TCFs/lymphoid enhancing factors (LEFs) to transform cells (ARCE et al. 2006; POLAKIS 2007). In both Glut4EF/HDBP1 and PBF/HDBP2, the CR/CRARF domain also plays a role in DNA binding and the regulation of transcription (TANAKA et al. 2004). However, despite the similarity between Glut4EF and TCF, it remains to be determined if Glut4EF and TCF transcription factors function together in any cellular processes. Along these lines, it is interesting that mutations in one of the Drosophila Wnt's, D-Wnt-2, give rise to a "stretch-like" outstretched wing phenotype (KOZOPAS and NUSSE 2002).
Our results also indicate that previously uncharacterized mutations in Glut4EF are present in at least 11 publicly available fly lines, including within the TM3 balancer chromosome. The TM3 balancer has been used extensively in fly work since its discovery by E. B. Lewis in 1955 (LINDSLEY and ZIMM 1992) and should now include the stretch mutation, which can serve as a 100% penetrant recessive marker. Interestingly, a progenitor of the TM3 balancer discovered by H. J. Muller (LINDSLEY and ZIMM 1992), In(3LR)sep, also has a previously uncharacterized recessive wings-out phenotype and is also a stretch allele. Our results also raise the possibility that previous observations utilizing these common stocks may be complicated by the presence of Glut4EF mutations. For example, the TM3 balancer (a D-Glut4EF allele) genetically enhances defects in the homeodomain transcription factor mirr in egg morphology, epithelial morphogenesis, and expanded gene expression of the Notch signaling regulator fringe (fng) (ZHAO et al. 2000). Furthermore, our results indicate that mutations in Glut4EF are also present in two dominant gain-of-function Antp mutants and underlie defects previously attributed to Antp (VAZQUEZ et al. 1999; GUTIERREZ et al. 2003). Interestingly, a third dominant gain-of-function mutation in Antp, AntpLC (LINDSLEY and ZIMM 1992), also exhibits a wings-out phenotype, but we have been unable to obtain the line to determine if the outstretched-wing phenotype present in the AntpLC allele is also due to mutations in Glut4EF.
The Antp gene has two alternative promoters, P1 and P2, and the dominant gain-of-function antenna-to-leg transformation results from the misregulation of the Antp P2 promoter (reviewed in KAUFMAN et al. 1990; LINDSLEY and ZIMM 1992). More recently, published work suggested that the outstretched-wing phenotype in the In(3R)AntpB and In(3R)AntpR alleles was also due to a disruption of P2 promoter activity of the Antp gene (VAZQUEZ et al. 1999; GUTIERREZ et al. 2003). It was concluded that reduced expression of Antp, through a decrease in Antp P2 promoter activity in the imaginal wing disc, causes some Antp mutants to extend their wings out from the body (VAZQUEZ et al. 1999; GUTIERREZ et al. 2003). Instead, our results in combination with previously published breakpoint mapping studies (DUNCAN and KAUFMAN 1975; KAUFMAN et al. 1980; GARBER et al. 1983; SCOTT et al. 1983; LINDSLEY and ZIMM 1992) indicate that the wing phenotype in these two Antp lines [In(3R)AntpB and In(3R)AntpR] is due to mutations in Glut4EF. Furthermore, we find that Antp mutations that disrupt the Antp P2 promoter (Antp1 and Antp23) do not exhibit a wing phenotype in combination with Glut4EF mutants. However, our genetic interaction analysis indicates that Glut4EF genetically interacts with Antp and this may be through regulation of the P2 promoter activity of Antp.
Notably, our results reveal a critical role for a Glut4EF transcription factor family member in Drosophila wing positioning but the molecular mechanisms of action of Glut4EF remain poorly understood. As a step toward this understanding, our genetic results support a role for Glut4EF in modulating the function of the homeobox transcription factor Antp, a well-known regulator of morphology (LEMONS and MCGINNIS 2006). Provocatively, a reexamination of the results observed by others using the In(3R)AntpB mutation may also provide new insights into the molecular mechanisms of Glut4EF action. The stretched-out wing phenotype present in the Antp mutant In(3R)AntpB has been used previously in a screen to identify several Antp-interacting genes, including components of the SWI/SNF chromatin remodeling complex (VAZQUEZ et al. 1999; GUTIERREZ et al. 2003). Since our results indicate that the wing phenotype in the In(3R)AntpB mutant is due to defects in D-Glut4EF, work is underway to test the likely possibility that D-Glut4EF is interacting with these genes. It is also intriguing that D-Glut4EF (previously CG11676; see Figure 2B) was recently found in a transcriptional targeting screen to be a target of the Notch signaling regulator/transcriptional repressor Hairy/Enhancer of Split (BIANCHI-FRIAS et al. 2004). Mutations within several regulators of Notch signaling, including deltex, Hairless, and the Notch ligand Delta, are known to result in a "stretch-like" wings-out phenotype (VASSIN et al. 1987; NAGEL et al. 2000). Taken together, our results provide new insights into the importance of Glut4EF family transcription factors in patterning of the developing organism. In light of the possibility that Glut4EF family transcription factors may play roles in type 2 diabetes (MCGEE and HARGREAVES 2006), in Huntington's disease (TANAKA et al. 2004), and in several human cancers (BOECKLE et al. 2002; TSUKAHARA et al. 2004), future work will be directed at further understanding the molecular mechanisms of Glut4EF's action.
1 These authors contributed equally to this article. ![]()
ARCE, L., N. N. YOKOYAMA and M. L. WATERMAN, 2006 Diversity of LEF/TCF action in development and disease. Oncogene 25: 7492–7504.[CrossRef][Medline]
ATCHA, F. A., J. E. MUNGUIA, T. W. LI, K. HOVANES and M. L. WATERMAN, 2003 A new beta-catenin-dependent activation domain in T cell factor. J. Biol. Chem. 278: 16169–16175.
BATE, M., 1993 The mesoderm and its derivatives, pp. 1013–1090 in The Development of Drosophila melanogaster, edited by M. BATE and A. MARTINEZ-ARIAS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
BEJSOVEC, A., 2006 Flying at the head of the pack: Wnt biology in Drosophila. Oncogene 25: 7442–7449.[CrossRef][Medline]
BIANCHI-FRIAS, D., A. ORIAN, J. J. DELROW, J. VAZQUEZ, A. E. ROSALES-NIEVES et al., 2004 Hairy transcriptional repression targets and cofactor recruitment in Drosophila. PLoS Biol. 2: E178.[CrossRef][Medline]
BIER, E., 2005 Drosophila, the golden bug, emerges as a tool for human genetics. Nat. Rev. Genet. 6: 9–23.[Medline]
BILEN, J., and N. M. BONINI, 2005 Drosophila as a model for human neurodegenerative disease. Annu. Rev. Genet. 39: 153–171.[CrossRef][Medline]
BLACKSHAW, S., S. HARPAVAT, J. TRIMARCHI, L. CAI, H. HUANG et al., 2004 Genomic analysis of mouse retinal development. PLoS Biol. 2: E247.[CrossRef][Medline]
BOECKLE, S., H. PFISTER and G. STEGER, 2002 A new cellular factor recognizes E2 binding sites of papillomaviruses which mediate transcriptional repression by E2. Virology 293: 103–117.[CrossRef][Medline]
BRAND, A. H., and N. PERRIMON, 1993 Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118: 401–415.[Abstract]
CADIGAN, K. M., M. P. FISH, E. J. RULIFSON and R. NUSSE, 1998 Wingless repression of Drosophila frizzled 2 expression shapes the Wingless morphogen gradient in the wing. Cell 93: 767–777.[CrossRef][Medline]
CARPENTER, A. T. C., 1994 Excerpt from stocklist II. FlyBase FBrf0075380.
DUNCAN, I. W., and T. C. KAUFMAN, 1975 Cytogenic analysis of chromosome 3 in Drosophila melanogaster: mapping of the proximal portion of the right arm. Genetics 80: 733–752.
FRISCHER, L. E., F. S. HAGEN and R. L. GARBER, 1986 An inversion that disrupts the Antennapedia gene causes abnormal structure and localization of RNAs. Cell 47: 1017–1023.[CrossRef][Medline]
GARBER, R. L., A. KUROIWA and W. J. GEHRING, 1983 Genomic and cDNA clones of the homeotic locus Antennapedia in Drosophila. EMBO J. 2: 2027–2036.[Medline]
GUTIERREZ, L., M. ZURITA, J. A. KENNISON and M. VAZQUEZ, 2003 The Drosophila trithorax group gene tonalli (tna) interacts genetically with the Brahma remodeling complex and encodes an SP-RING finger protein. Development 130: 343–354.
HECHT, A., and M. P. STEMMLER, 2003 Identification of a promoter-specific transcriptional activation domain at the C terminus of the Wnt effector protein T-cell factor 4. J. Biol. Chem. 278: 3776–3785.
HEIDE, G., and K. G. GOTZ, 1996 Optomotor control of course and altitude in Drosophila melanogaster is correlated with distinct activities of at least three pairs of flight steering muscles. J. Exp. Biol. 199: 1711–1726.[Abstract]
HOPPLER, S., and C. L. KAVANAGH, 2007 Wnt signalling: variety at the core. J. Cell Sci. 120: 385–393.
HUANG, Z., U. YAZDANI, K. L. THOMPSON-PEER, A. L. KOLODKIN and J. R. TERMAN, 2007 Crk-associated substrate (Cas) signaling protein functions with integrins to specify axon guidance during development. Development 134: 2337–2347.
JORGENSEN, E. M., and R. L. GARBER, 1987 Function and misfunction of the two promoters of the Drosophila Antennapedia gene. Genes Dev. 1: 544–555.
KAUFMAN, T. C., R. LEWIS and B. WAKIMOTO, 1980 Cytogenetic analysis of chromosome 3 in Drosophila melanogaster: the homoeotic gene complex in polytene chromosome interval 84a-b. Genetics 94: 115–133.
KAUFMAN, T. C., M. A. SEEGER and G. OLSEN, 1990 Molecular and genetic organization of the antennapedia gene complex of Drosophila melanogaster. Adv. Genet. 27: 309–362.[Medline]
KNIGHT, J. B., C. A. EYSTER, B. A. GRIESEL and A. L. OLSON, 2003 Regulation of the human GLUT4 gene promoter: interaction between a transcriptional activator and myocyte enhancer factor 2A. Proc. Natl. Acad. Sci. USA 100: 14725–14730.
KOZOPAS, K. M., and R. NUSSE, 2002 Direct flight muscles in Drosophila develop from cells with characteristics of founders and depend on DWnt-2 for their correct patterning. Dev. Biol. 243: 312–325.[CrossRef][Medline]
LEMONS, D., and W. MCGINNIS, 2006 Genomic evolution of Hox gene clusters. Science 313: 1918–1922.
LINDSLEY, D. L., and G. G. ZIMM, 1992 The Genome of Drosophila melanogaster. Academic Press, San Diego.
MCGEE, S. L., and M. HARGREAVES, 2006 Exercise and skeletal muscle glucose transporter 4 expression: molecular mechanisms. Clin. Exp. Pharmacol. Physiol. 33: 395–399.[CrossRef][Medline]
MILLER, A., 1950 The internal anatomy and histology of the imago of Drosophila melanogaster, pp. 420–534 in Biology of Drosophila, edited by M. DEMEREC. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY/John Wiley & Sons, New York.
NAGEL, A. C., D. MAIER and A. PREISS, 2000 Su(H)-independent activity of hairless during mechano-sensory organ formation in Drosophila. Mech. Dev. 94: 3–12.[CrossRef][Medline]
OSHEL, K. M., J. B. KNIGHT, K. T. CAO, M. V. THAI and A. L. OLSON, 2000 Identification of a 30-base pair regulatory element and novel DNA binding protein that regulates the human GLUT4 promoter in transgenic mice. J. Biol. Chem. 275: 23666–23673.
POLAKIS, P., 2007 The many ways of Wnt in cancer. Curr. Opin. Genet. Dev. 17: 45–51.[CrossRef][Medline]
RUBIN, G. M., 1988 Drosophila melanogaster as an experimental organism. Science 240: 1453–1459.
SCHNEUWLY, S., R. KLEMENZ and W. J. GEHRING, 1987 Redesigning the body plan of Drosophila by ectopic expression of the homoeotic gene Antennapedia. Nature 325: 816–818.[CrossRef][Medline]
SCOTT, M. P., A. J. WEINER, T. I. HAZELRIGG, B. A. POLISKY, V. PIRROTTA et al., 1983 The molecular organization of the Antennapedia locus of Drosophila. Cell 35: 763–776.[CrossRef][Medline]
SHARMA, R. P., and V. L. CHOPRA, 1976 Effect of the Wingless (wg1) mutation on wing and haltere development in Drosophila melanogaster. Dev. Biol. 48: 461–465.[CrossRef][Medline]
ST. JOHNSTON, D., 2002 The art and design of genetic screens: Drosophila melanogaster. Nat. Rev. Genet. 3: 176–188.[CrossRef][Medline]
STOECKMAN, A. K., E. C. BAECHLER, W. A. ORTMANN, T. W. BEHRENS, C. J. MICHET et al., 2006 A distinct inflammatory gene expression profile in patients with psoriatic arthritis. Genes Immun. 7: 583–591.[CrossRef][Medline]
TANAKA, K., J. SHOUGUCHI-MIYATA, N. MIYAMOTO and J. E. IKEDA, 2004 Novel nuclear shuttle proteins, HDBP1 and HDBP2, bind to neuronal cell-specific cis-regulatory element in the promoter for the human Huntington's disease gene. J. Biol. Chem. 279: 7275–7286.
TERMAN, J. R., T. MAO, R. J. PASTERKAMP, H. H. YU and A. L. KOLODKIN, 2002 MICALs, a family of conserved flavoprotein oxidoreductases, function in plexin-mediated axonal repulsion. Cell 109: 887–900.[CrossRef][Medline]
TOUNTAS, N. A., and M. E. FORTINI, 2007 Drosophila as a model for human diseases. Fly 1: 47–54.
TSUKAHARA, T., Y. NABETA, S. KAWAGUCHI, H. IKEDA, Y. SATO et al., 2004 Identification of human autologous cytotoxic T-lymphocyte-defined osteosarcoma gene that encodes a transcriptional regulator, papillomavirus binding factor. Cancer Res. 64: 5442–5448.
VASSIN, H., K. A. BREMER, E. KNUST and J. A. CAMPOS-ORTEGA, 1987 The neurogenic gene Delta of Drosophila melanogaster is expressed in neurogenic territories and encodes a putative transmembrane protein with EGF-like repeats. EMBO J. 6: 3431–3440.[Medline]
VAZQUEZ, M., L. MOORE and J. A. KENNISON, 1999 The trithorax group gene osa encodes an ARID-domain protein that genetically interacts with the brahma chromatin-remodeling factor to regulate transcription. Development 126: 733–742.[Abstract]
ZHAO, D., S. WOOLNER and M. BOWNES, 2000 The Mirror transcription factor links signalling pathways in Drosophila oogenesis. Dev. Genes Evol. 210: 449–457.[CrossRef][Medline]
Communicating editor: K. G. GOLIC
This article has been cited by other articles:
![]() |
E. Karnieli and M. Armoni Transcriptional regulation of the insulin-responsive glucose transporter GLUT4 gene: from physiology to pathology Am J Physiol Endocrinol Metab, July 1, 2008; 295(1): E38 - E45. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Data Supplement
-
All Versions of this Article:
genetics.107.078030v1
178/2/919 most recent - Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Yazdani, U.
- Articles by Terman, J. R.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Yazdani, U.
- Articles by Terman, J. R.


115 kb of DNA and is adjacent to the MICAL locus that covers 



