- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Laprade, L.
- Articles by Winston, F.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Laprade, L.
- Articles by Winston, F.
Genetics, Vol. 177, 2007-2017, December 2007, Copyright © 2007
doi:10.1534/genetics.107.081976
Characterization of New Spt3 and TATA-Binding Protein Mutants of Saccharomyces cerevisiae: Spt3–TBP Allele-Specific Interactions and Bypass of Spt8
Lisa Laprade, David Rose1 and Fred Winston2
Department of Genetics, Harvard Medical School, Boston, MA 02115
2 Corresponding author: Department of Genetics, Harvard Medical School, 77 Ave. Louis Pasteur, Boston, MA 02115.
E-mail: winston{at}genetics.med.harvard.edu
The Spt-Ada-Gcn5-acetyltransferase (SAGA) complex of Saccharomyces cerevisiae is a multifunctional coactivator complex that has been shown to regulate transcription by distinct mechanisms. Previous results have shown that the Spt3 and Spt8 components of SAGA regulate initiation of transcription of particular genes by controlling the level of TATA-binding protein (TBP/Spt15) associated with the TATA box. While biochemical evidence exists for direct Spt8–TBP interactions, similar evidence for Spt3–TBP interactions has been lacking. To learn more about Spt3–TBP interactions in vivo, we have isolated a new class of spt3 mutations that cause a dominant-negative phenotype when overexpressed. These mutations all cluster within a conserved region of Spt3. The isolation of extragenic suppressors of one of these spt3 mutations has identified two new spt15 mutations that show allele-specific interactions with spt3 mutations with respect to transcription and the recruitment of TBP to particular promoters. In addition, these new spt15 mutations partially bypass an spt8 null mutation. Finally, we have examined the level of SAGA–TBP physical interaction in these mutants. While most spt3, spt8, and spt15 mutations do not alter SAGA–TBP interactions, one spt3 mutation, spt3-401, causes a greatly increased level of SAGA–TBP physical association. These results, taken together, suggest that a direct Spt3–TBP interaction is required for normal TBP levels at Spt3-dependent promoters in vivo.
EUKARYOTIC transcription initiation requires many different classes of protein factors for transcription to occur in a specific and regulated fashion. One large and critical set of factors is coactivators, large multi-protein complexes that are recruited to regulatory regions by site-specific DNA binding factors. Different coactivators have been shown to regulate transcription by a variety of mechanisms, including recruitment of general transcription factors, covalent modification of histones, and remodeling or movement of nucleosomes (NAAR et al. 2001; MARTINEZ 2002).
One coactivator complex that has been extensively studied is SAGA (Spt-Ada-Gcn5-acetyltransferase). Originally identified in Saccharomyces cerevisiae, SAGA is highly conserved in terms of function, composition, and structure (TIMMERS and TORA 2005; DANIEL and GRANT 2007). Several lines of evidence have established that SAGA is multifunctional, capable of activating transcription by several distinct mechanisms (MARTINEZ 2002; TIMMERS and TORA 2005) as well as playing a role in mRNA export (RODRIGUEZ-NAVARRO et al. 2004; CABAL et al. 2006). Two of the transcriptional activation mechanisms by which SAGA functions are dependent upon characterized histone modifying enzymes within SAGA: Gcn5, a histone acetyltransferase (BROWNELL et al. 1996; GRANT et al. 1997), and Ubp8, a histone deubiquitylase (HENRY et al. 2003; DANIEL et al. 2004). Gcn5 has been shown to play broad roles in transcriptional regulation (LEE et al. 2000), while Ubp8 has been shown to play roles in transcription, histone methylation levels, and mRNA export (HENRY et al. 2003; KOHLER et al. 2006; SHUKLA et al. 2006). Recent evidence suggests that both Gcn5 and Ubp8 function along transcribed sequences as well as in regulatory regions (GOVIND et al. 2007; WYCE et al. 2007).
A third set of components by which SAGA controls transcription are Spt3 and Spt8. In their most widely studied role, these two factors have been shown to activate transcription by the recruitment of the general transcription factor TATA-binding protein (TBP) to particular promoters in vivo (DUDLEY et al. 1999b; BHAUMIK and GREEN 2001, 2002; LARSCHAN and WINSTON 2001). In other cases, Spt3 and Spt8 have been shown to play the opposite role, by inhibiting TBP–TATA interactions (BELOTSERKOVSKAYA et al. 2000; YU et al. 2003). The factors that determine positive vs. negative regulation by Spt3 and Spt8 are not currently understood, although the factors Swi/Snf or yFACT may play a role (BISWAS et al. 2005; MITRA et al. 2006). In addition to controlling the level of TBP–TATA interaction, Spt3 and Spt8 have been implicated in recruiting Mot1 to activate transcription by a mechanism independent of TBP recruitment (TOPALIDOU et al. 2004; VAN OEVELEN et al. 2005). A recent study also suggests a role for Spt3 outside of SAGA (JAMES et al. 2007).
Different studies have provided mixed views of the nature of the Spt3–TBP and Spt8–TBP interactions. Genetic studies involving allele-specific interactions have implicated Spt3 as having a direct interaction with TBP (EISENMANN et al. 1992; LARSCHAN and WINSTON 2001). In addition, Spt3 is homologous to two human TAFs, TAF11 and TAF13, which have been shown to interact directly with TBP (MENGUS et al. 1995; BIRCK et al. 1998; LAVIGNE et al. 1999). Biochemical experiments have not yet been able to demonstrate direct Spt3–TBP interactions. In contrast, three different studies have shown that Spt8 can interact directly with TBP in vitro (BELOTSERKOVSKAYA et al. 2000; WARFIELD et al. 2004; SERMWITTAYAWONG and TAN 2006). One of these studies also showed that, in vitro, Spt8 and TATA box DNA compete for binding to TBP, suggesting a two-step model in which SAGA, via Spt8, binds TBP to facilitate its subsequent transfer to a TATA box (SERMWITTAYAWONG and TAN 2006). While these studies suggest that Spt8 acts more directly than Spt3 in TBP recruitment, this possibility does not fit well with earlier results that a particular spt3 mutation can suppress an spt8
mutation (EISENMANN et al. 1994) and that one form of SAGA lacks Spt8 (PRAY-GRANT et al. 2002; STERNER et al. 2002; WU and WINSTON 2002).
To learn more about the role of Spt3 and its possible functional interactions with TBP, we have identified dominant-negative spt3 mutations and found that these mutations cluster within a conserved region of Spt3. A search for extragenic suppressors of one of these spt3 mutations identified mutations in both SPT3 and SPT15 (TBP). Furthermore, analysis of the new spt15 suppressor mutations demonstrated that they are also able to partially bypass the requirement for Spt8. Finally, purification of SAGA from several mutants revealed that one spt3 mutation causes an aberrantly high level of SAGA–TBP association. Taken together, these results support the idea that Spt3 and TBP specifically recognize each other in a way that is required for SAGA-mediated regulation at particular promoters.
Yeast strains, genetic methods, and plasmids:
All S. cerevisiae strains used in this study are descended from a GAL2+ derivative of S288C (WINSTON et al. 1995). Standard methods for mating, sporulation, transformation, gene replacement, and tetrad analysis were used (ROSE et al. 1990). Yeast growth media, including rich medium (YPD) and synthetic complete medium lacking particular nutrients (for example, SC-His) have been previously described (ROSE et al. 1990). Plasmid pDR11 is a high-copy-number (2µ) URA3 plasmid derived from pDAD2 (generously provided by David Pellman). In pDR11, the SPT3 coding region is under control of the GAL10 promoter. pDR77 contains the spt3-193 mutant cloned into pRS306. We have used lower-case nomenclature to denote the spt3 mutations as they are recessive when integrated in the genome.
Isolation of spt3 dominant-negative mutations:
To screen for spt3 mutants, SPT3 was mutagenized using standard PCR conditions previously shown to be successful (HIRSCHHORN et al. 1995). In addition, plasmid pDR11 was digested with EcoRI and BamHI and the vector portion was purified. The mutagenized SPT3 PCR fragment and the purified pDR11 fragment were then mixed and used to cotransform S. cerevisiae strain FY374 (Table 1). By this procedure, the PCR fragment is able to recombine with the vector to reconstitute a complete plasmid (MUHLRAD et al. 1992). Ura+ transformants were then screened by replica plating onto plates lacking histidine and containing galactose as the carbon source. This tested for suppression of the his4-917 insertion mutation, previously shown to be suppressed by spt3 mutations (WINSTON et al. 1984a). Approximately 70,000 transformants were screened from seven independent pools of PCR-mutagenized SPT3.
|
Isolation and genetic analysis of suppressors of spt3-193:
Fifty single colonies each for S. cerevisiae strains FY2006 and FY2007 (Table 1) were inoculated into 1 ml YPD cultures and grown to saturation. Each of the 100 cultures was washed twice with sterile water, resuspended in sterile water, and plated (0.1 ml) on synthetic complete medium lacking lysine and containing galactose as the carbon source (SC Gal-Lys plates). The plates were irradiated with 50 µJ of ultraviolet (UV) light using a Stratalinker (Stratagene) and the plates were incubated at 30° for 5 days, after which there were
1000 colonies per plate. Two colonies from each plate were purified and saved for further study. A pilot test showed that UV irradiation stimulated the frequency of colony formation under these conditions and therefore each mutant was considered to be independent. Following purification, the 200 candidates were screened for strong suppression by testing for growth on SC-Gal, SC-Lys, and SC-His to test spt3-193 phenotypes. This led to the identification of 73 candidates. Of these, 44 were shown to be recessive and the 10 with the strongest phenotypes were chosen for additional analysis. In addition, one suppressor of spt3-193 was isolated by a modification of the above method, beginning with strain FY294 (Table 1) containing plasmid H45a (pDR11 with the spt3-193 mutation). In this case, Lys+ suppressors were selected, screened for those with a His– phenotype, and a single suppressor was identified.
RNA isolation and Northern analysis:
To prepare RNA, strains were grown to 1–2 x 107 cells/ml in YPD. RNA isolation and Northern analysis were performed as previously described (AUSUBEL et al. 1991; SWANSON et al. 1991). The Ty1 probe used for Northern analysis has been previously described (WINSTON et al. 1987). Probes for BDF2, HO, and ACT1 were synthesized by PCR amplification from genomic DNA and labeled with [
-32P]dATP by random priming (AUSUBEL et al. 1991). The specific regions amplified and the primers used are as follows: BDF2, +716 to +1215 (5' TGCCACCAAGAGTTTTACCC 3' and 5' GCCTTCTGGATTGAATTGGA 3'); HO, +445 to +651 (5' TGGAGCGCTCTAAAGGAGAA 3' and 5' ACCAAGCATCCAAGCCATAC 3'); and ACT1, –376 to +1015 (5' TACCCGCCACGCGTTTTTTTCTTT 3' and 5' ATTGAAGAAGATTGAGCAGCGGTTTG 3').
TAP purifications:
TAP purifications (RIGAUT et al. 1999) were performed as previously described (WU and WINSTON 2002) except that the extract with 800 µl of 1:1 immunoglobulin G (IgG)-Sepharose (Sigma) was incubated at 4° overnight. Silver staining of the SDS–PAGE gels was done using a kit from Invitrogen.
Protein extracts and Western analysis:
Whole-cell protein extracts were prepared as previously described (WU and WINSTON 2002) and protein concentrations were determined by Bradford assay (Bio-Rad). Equal amounts of whole-cell extracts or TAP-purified complexes were separated on SDS–PAGE gels. Transfer was performed as previously described (SWANSON and WINSTON 1992). The following antibodies were used at the following dilutions: TBP (1:2500) and Spt3 (1:2000). The TBP antibodies were kindly provided by Steve Buratowski and Greg Prelich, and the Spt3 antibodies were kindly provided by Martine Collart. Horseradish peroxidase (HRP)-conjugated secondary antibodies (Jackson Labs) were used at a 1:10,000 dilution and were detected by chemiluminescence (Perkin Elmer). The 12CA5 anti-HA1 antibody (used at 1:5000) was a generous gift from Brad Cairns.
Chromatin immunoprecipitation analysis of TBP binding:
Chromatin immunoprecipitation experiments were done as previously described (SHIRRA et al. 2005). The primers for the BDF2 TATA region were 5' GACTCAAATAAATGCGCGATG 3' and 5' TTAGTACGAGACATAGCCGCC 3', and the primers used for an untranscribed region have been previously described (KOMARNITSKY et al. 2000). TBP antibodies provided by Greg Prelich were used for the immunoprecipitations, using 2 µl in each experiment. Dilutions of input DNA (1/50, 1/100, and 1/200) and immunoprecipitated DNA (1/1, 1/2, and 1/4 for TBP) were analyzed by quantitative PCR and the products were separated on a 6% nondenaturing polyacrylamide gel. In each experiment, the percent immunoprecipitation was calculated and normalized to an untranscribed region on chromosome V.Isolation and analysis of spt3 dominant-negative mutants:
Previous studies have demonstrated that Spt3 is a component of the SAGA coactivator complex, although it is not required for the structural integrity of the complex (GRANT et al. 1997; ROBERTS and WINSTON 1997; STERNER et al. 1999; WU and WINSTON 2002; WU et al. 2004). To understand more about the interactions of Spt3 with other proteins, both within SAGA and outside of SAGA, and to identify new classes of spt3 mutants, we sought to isolate dominant-negative spt3 alleles. Dominant-negative mutations have been hypothesized to disrupt wild-type function by many possible avenues (HERSKOWITZ 1987).
To isolate such mutants, we mutagenized the SPT3 gene and screened candidates for an Spt– phenotype upon overexpression in an SPT3+ host (described in MATERIALS AND METHODS). The Spt– phenotype tested was suppression of the His– phenotype conferred by his4-917, previously described for spt3 mutants (WINSTON et al. 1984a). This insertion mutation was chosen as it is more permissive for suppression than other Ty or solo
insertion mutations. From an initial screen of 70,000 transformants, 270 were scored as His+/Spt–. Of these, 98 candidates were recovered into Escherichia coli, and 79 of them again conferred an Spt– phenotype after retransformation of an SPT3+ host strain, FY374 (Figure 1A, Table 2, and data not shown). Twenty-four of these plasmids were then sequenced and 17 are predicted to cause single amino acid changes at nine different positions in Spt3 (Table 2). Notably, eight of these nine positions are clustered over a small, 24-amino-acid span of Spt3 (337 amino acids in length). At three positions, M188, Y193, and W196, different amino acid changes were identified in different mutants. Of these nine positions in Spt3, most are highly conserved in Schizosaccharomyces pombe and human Spt3 (Figure 1B).
|
|
Isolation of suppressors of an spt3 dominant-negative mutation identifies new spt15 mutations:
If the spt3 dominant-negative mutations impair an interaction with another factor, then the isolation and analysis of suppressor mutations might point toward the identity of such a factor. We therefore isolated suppressors of one of the strongest spt3 mutations, spt3-193. We used a strain in which the spt3-193 mutation had been integrated into the genome, replacing the wild-type SPT3 sequence. In this configuration, spt3-193 is fully recessive in diploids (data not shown), likely due to the lower level of expression from the SPT3 promoter compared to the GAL1 promoter. This strain displays strong mutant phenotypes; in particular, the spt3-193 mutant is His+ Lys– in a his4-917
lys2-173R2 background and it is also Gal–.
Beginning with strains FY2006 and FY2007 (Table 1), both of which contain the his4-917
and lys2-173R2 insertion mutations, suppressors of spt3-193 were selected and analyzed as described in MATERIALS AND METHODS. Briefly, 200 Lys+ Gal+ revertants were selected and then screened for those that also became His–. Those candidates that suppressed all three phenotypes were then tested for dominance or recessiveness. We have focused our studies on 10 recessive, independent mutations that conferred the strongest phenotypes. These mutations were first tested for linkage to spt3-193. Tetrad analysis revealed that 6 of the mutations were tightly linked to spt3-193 and 4 were unlinked (data not shown).On the basis of our previous isolation of extragenic suppressors of spt3 that were in the SPT15 gene, the 4 unlinked suppressors were each tested for linkage to SPT15 and were shown to be tightly linked.
Each class of mutation was then subjected to DNA sequence analysis (MATERIALS AND METHODS). For the six linked mutations, each one contained an identical second-site mutation in SPT3 that causes the predicted amino acid change E240K. This result was particularly surprising as the same mutation, named spt3-401, had been previously isolated as a suppressor of an spt15 mutation, spt15-21 (EISENMANN et al. 1992). Thus, spt3-401 can suppress either spt3-193 or spt15-21. For the four unlinked mutations, the SPT15 gene was completely sequenced. One mutant, named spt15-180, had two adjacent base pair changes, encoding a predicted amino acid change in TBP of G180Y. The other three mutants each had the identical spt15 mutation, causing the predicted amino acid change K239I. Previous studies have identified other changes at this position that affect interactions of TBP with Spt3, TFIIA, and TFIIB (EISENMANN et al. 1992; BURATOWSKI et al. 2002). Interestingly, G180 and K239 are near one another in the structure of TBP and fall within a small region that contains four other TBP amino acids previously identified as important for functional interactions with Spt3 (Figure 2; (EISENMANN et al. 1992)).
|
The spt3–spt15 interactions are allele specific:
To explore the nature of the genetic interactions between the new class of spt3 mutations and their spt15 suppressor mutations, several classes of double mutants were constructed and analyzed. First, we tested the ability of the new spt15 mutations, spt15-180 and spt15-239, to suppress spt3-196, another strong spt3 dominant-negative mutation. These results (Table 3) show that the suppression is allele specific, as spt3-196 is suppressed by only one of the two spt15 mutations. This result suggests that specific recognition is required between Spt3 and TBP for suppression.
|
As a second test, we extended the analysis of the new spt3 and spt15 mutations to examine their interactions with a previously described pair of mutations, spt3-401 and spt15-21, that show allele-specific, mutual suppression (EISENMANN et al. 1992; LARSCHAN and WINSTON 2001; YU et al. 2003). To do this, we constructed several spt3–spt15 double mutant combinations between the new mutations and the two previously studied mutations. Our results (Table 4 and examples shown in Figure 3) demonstrate that a high degree of allele specificity extends to all of these mutants. With respect to spt3–spt15 genetic interactions, these results can be summarized as follows: (1) two sets of pairings of spt3 and spt15 mutations confer suppression (Table 4, lines 8, 9, and 14) and (2) combining spt3 and spt15 mutations from the different pairs often results in more severe phenotypes than observed in the single mutants (Table 4, lines 11–13). This is particularly evident for combinations of spt3-401 with spt15-180 and spt15-239, which individually have weak or undetectable phenotypes, but when combined have strong mutant phenotypes (Table 4, compare lines 3, 6, and 7 to lines 12 and 13; Figure 3). In addition, no interactions are observed between an spt3
(null) mutation and the spt15 mutations (Table 4, lines 15–17). Thus, distinct combinations of spt3 and spt15 mutations show either allele-specific suppression or allele-specific enhancement of mutant phenotypes.
|
|
As Spt3 is required for normal transcription of particular genes in S. cerevisiae (LEE et al. 2000; HUISINGA and PUGH 2004), we examined the new spt3 and spt15 mutants, as well as several mutant combinations, to determine their effects on transcription. To do this, we measured the mRNA levels for BDF2 and Ty1 elements, previously shown to be Spt3 dependent (WINSTON et al. 1984b; BHAUMIK and GREEN 2002). Our results (Figure 4A) show that the mRNA levels of these Spt3-dependent genes strongly correspond to their Spt– phenotypes. Specifically, spt3-401, spt15-180, and spt15-239 all partially suppress the transcriptional defects of spt3-193. In addition, we examined mRNA levels for the HO gene, previously shown to be repressed by Spt3 in a gcn5
background (YU et al. 2003). In this case (Figure 4B), our results again show that the allele-specific interactions are reflected at the transcriptional level. Given the multiple cases of allele specificity, these results suggest that Spt3 and TBP directly cooperate to control transcription at particular promoters in vivo.
|
The Spt3-Y193C mutant protein is defective for TBP recruitment even though it is present in SAGA:
Previous studies have demonstrated that in an spt3 null mutant, the level of TBP recruitment to particular promoters is greatly diminished (DUDLEY et al. 1999a; BHAUMIK and GREEN 2001, 2002; LARSCHAN and WINSTON 2001). To test if the new class of spt3 mutants causes a similar defect, we measured TBP binding by chromatin immunoprecipitation (ChIP) analysis in an spt3-193 mutant. Our results (Figure 5) show that, consistent with its transcriptional defect, an spt3-193 mutant has a reduced level of TBP associated with the BDF2 TATA region, equal to the reduction observed for an spt3 null mutant. Furthermore, in the spt3-193 spt15-180 and spt3-193 spt15-239 double mutants, the TBP binding defect is suppressed, although suppression by spt15-180 is modest. These results suggest that the product of spt3-193, Spt3-Y193C, is defective for TBP recruitment, but that this defect can be suppressed by compensating changes in TBP.
|
One obvious explanation for the TBP recruitment defect in the spt3-193 mutant is that the Spt3 mutant protein is either unstable or unable to assemble into SAGA, thereby mimicking an spt3 null mutant. To test this possibility, we purified SAGA from an spt3-193 mutant and tested for the presence of Spt3 in purified SAGA. We also tested a second strong spt3 mutant, spt3-196, which was also isolated in the dominant-negative screen. Our results (Figure 6) show that both mutant Spt3 proteins are present within SAGA at normal levels. The mutant defects, therefore, are not caused by an inability of Spt3 to assemble into SAGA.
|
Both new spt15 mutations bypass spt8
:
Previous work showed that a mutation in SPT3, spt3-401, conferred suppression of an spt8
mutation (EISENMANN et al. 1994). To test if this might be true for any of the new spt3 or spt15 mutations isolated in this study, we combined spt3-193, spt15-180, and spt15-239 each with spt8
. Our results (Figure 7) show that both spt15-180 and spt15-239 confer suppression of spt8
, as measured by the Spt– phenotype (Figure 7A) and by transcriptional effects (Figure 7B). These results constitute the first demonstration that TBP mutants can bypass the requirement for Spt8. As described above, these spt15 mutations do not suppress spt3
; therefore, they are still Spt3 dependent, although they are partially Spt8 independent.
|
The level of the TBP–SAGA association is increased in an spt3-401 mutant:
Previous studies have shown that TBP can directly interact with SAGA in vitro (STERNER et al. 1999; WARFIELD et al. 2004; SERMWITTAYAWONG and TAN 2006) and have suggested direct interactions in vivo (EISENMANN et al. 1992; LEE and YOUNG 1998; ROBERTS and WINSTON 1997; SALEH et al. 1997; SANDERS et al. 2002). To test whether any of the spt3, spt8, or spt15 mutations analyzed in this work affect the level of this interaction, we purified SAGA in wild-type and several mutant strains and then determined the level of TBP that copurified. Our results (Figure 8) show that, as previously shown, a low level of TBP copurifies with SAGA (SALEH et al. 1997; SANDERS et al. 2002) (Figure 8A, lane 2; Figure 8B, lane 2). Furthermore, this level of copurification is not significantly altered in spt3
, spt8
, and spt3
spt8
mutants (Figure 8A). When we examined other mutants, however, we observed that one mutation, spt3-401, unexpectedly causes a large increase in the level of the TBP–SAGA association (Figure 8B, lane 6). In an spt3-401 spt15-21 double mutant, which has a wild-type phenotype, there is a normal level of SAGA–TBP association. In conclusion, this assay suggests that neither Spt3 nor Spt8 is required for SAGA–TBP interactions in vivo, although a particular change in Spt3 can increase this interaction.
|
but not spt3
, and the increased SAGA–TBP interactions in an spt3-401 mutant all support a model in which direct recognition between Spt3 and TBP is important for transcription in vivo.
Along the primary sequence of Spt3, four distinct regions have now been identified as important for functional interactions with TBP. Previous studies identified spt3 mutations that encode changes at positions 74, 240, and the termination codon (338) as suppressors of spt15-21 (EISENMANN et al. 1992) and our current studies identified changes in a fourth region, spanning amino acids 178–202. Based on the homology between Spt3 and human Taf11, and the structure of human Taf11 (BIRCK et al. 1998), most amino acids altered in our Spt3 mutants (with the exception of A202) lie on the same face of a putative
-helix. Furthermore, a model for Spt3 structure (BIRCK et al. 1998), suggests that these regions may conceivably exist near one another in the folded protein. Finally, given that the E240K change, encoded by spt3-401, significantly increases interactions with TBP, E240 may normally exist close to TBP, possibly in direct contact. Structural analysis of Spt3 is required to begin to understand the interactions of these regions in Spt3 with TBP.
In contrast to Spt3, the structure of TBP is well established and it is clear that the amino acid changes that we have identified contribute to a change of a specific region of TBP (Figure 2). Based on the clustering of these positions and the strong allele-specific interactions between spt3 and spt15 mutations, the simplest hypothesis is that this region of TBP directly interacts with Spt3. We cannot rule out other models in which Spt3 and TBP interact indirectly by altered interactions with other proteins, such as those in SAGA or other general transcription factors. For example, evidence exists for functional interactions of Spt3 with Mot1 (COLLART 1996; MADISON and WINSTON 1997; TOPALIDOU et al. 2004; VAN OEVELEN et al. 2005). Such a model does not easily explain the allele specificity that has been demonstrated between spt3 and spt15 mutations, however, including at the level of TBP recruitment (this work and LARSCHAN and WINSTON 2001).
The model that Spt3 and TBP directly interact stands in contrast to biochemical analysis of SAGA–TBP interactions. One recent study that tested specifically for SAGA–TBP physical interactions, demonstrated that two SAGA subunits, Spt8 and Ada1, interact directly with TBP, with no evidence for Spt3–TBP contact (SERMWITTAYAWONG and TAN 2006). Those results are consistent with an earlier study that also found direct Spt8–TBP interactions (WARFIELD et al. 2004). The differences between the biochemical and genetic studies can be explained by two general classes of models. First, as stated above, Spt3 may not normally interact directly with TBP. Second, Spt3 may indeed interact directly with TBP, but the methods used have not been able to detect this interaction. One previous method used to detect SAGA–TBP interactions in vitro used TBP conjugated with Sulfo-SBED, a photoactivatable lysine-specific reagent that can transfer biotin from the donor molecular to a nearby protein (SERMWITTAYAWONG and TAN 2006). Such an experiment requires that the conjugated lysine in TBP be nearby Spt3; however, the only lysine in the region of TBP believed to interact with Spt3 is K239, a position that is known to be important for normal Spt3–TBP interactions (EISENMANN et al. 1992). Therefore, the conjugation of Sulfo-SBED at K239 might impair Spt3–TBP interactions. Additional types of biochemical studies are necessary to definitively resolve the issue of whether Spt3 and TBP normally interact directly.
The spt3-401 mutation has several properties of interest, as we have shown that it increases SAGA–TBP interactions and suppresses spt3-193, in addition to past findings that it suppresses spt15-21 (EISENMANN et al. 1992) and spt8
(EISENMANN et al. 1994). Based on these results, the simplest hypothesis is that the Spt3-E240K mutant encoded by spt3-401 confers increased affinity between Spt3 and TBP and that this increased affinity overcomes particular defects in either TBP or Spt3, or loss of Spt8. The spt3-401 mutation also causes a modest Spt– phenotype. One possible reason for this defect can be explained by a recently proposed "handoff" model for SAGA function, in which TBP is initially recruited by SAGA and then transferred to bind to a TATA element (SERMWITTAYAWONG and TAN 2006). By this model, the increased Spt3–TBP interaction in spt3-401 mutants might impair the handoff, thereby reducing the level of TBP at particular TATA elements. Such a defective handoff might also cause a decreased level of TBP at some promoters, as assayed by ChIP, because TBP is strongly interacting with SAGA, which is associated at the UAS and therefore not bound to a TATA element to the same level. Alternatively, the increased level of Spt3–TBP interactions might sequester either protein from additional interactions, leading to a mutant phenotype. Consistent with this possibility, recent work has suggested a role for Spt3 outside of SAGA (JAMES et al. 2007). As spt3-401 does not cause strong mutant phenotypes in an otherwise wild-type background, the increased SAGA–TBP interactions must not significantly alter TBP–TATA interactions. Interestingly, previous studies identified a mammalian TBP mutant that causes both increased TBP–TAF11 interactions and defective transcriptional activation (LAVIGNE et al. 1999). The altered amino acid changes in this human TBP mutant, L270 and E271, correspond to amino acids L172 and E173 in S. cerevisiae TBP, precisely within the region identified by our spt15 mutations.
Overall, the mechanism by which SAGA recruits TBP to promoters remains unresolved; however, current evidence suggests that a number of SAGA components contribute to this activity. Our work has established a strong functional requirement for Spt3. Given that both Spt3 and TBP mutants are able to partially bypass the need for Spt8 and that spt8
causes weaker phenotypes than spt3
(EISENMANN et al. 1994; ROBERTS and WINSTON 1996; BHAUMIK and GREEN 2002), Spt3 may play a more primary role than Spt8 in the SAGA–TBP relationship. Spt8 is also required for TBP recruitment at many promoters, however, and it has been clearly demonstrated that Spt8 interacts directly with TBP (BHAUMIK and GREEN 2002; WARFIELD et al. 2004; SERMWITTAYAWONG and TAN 2006). One study suggests that Spt8 is necessary for SAGA–TBP interactions (STERNER et al. 1999), while others suggest that additional factors may contribute, including Spt3, Ada1, and Ada2 (BARLEV et al. 1995; SERMWITTAYAWONG and TAN 2006). The resolution to the question of the mechanism by which SAGA interacts to recruit TBP to TATA elements must await additional biochemical and structural analyses.
AUSUBEL, F. M., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN et al., 1991 Current Protocols in Molecular Biology. Greene Publishing Associates and Wiley-Interscience, New York.
BARLEV, N. A., R. CANDAU, L. WANG, P. DARPINO, N. SILVERMAN et al., 1995 Characterization of physical interactions of the putative transcriptional adaptor, ADA2, with acidic activation domains and TATA-binding protein. J. Biol. Chem. 270: 19337–19344.
BELOTSERKOVSKAYA, R., D. E. STERNER, M. DENG, M. H. SAYRE, P. M. LIEBERMAN et al., 2000 Inhibition of TATA-binding protein function by SAGA subunits Spt3 and Spt8 at Gcn4-activated promoters. Mol. Cell Biol. 20: 634–647.
BHAUMIK, S. R., and M. R. GREEN, 2001 SAGA is an essential in vivo target of the yeast acidic activator Gal4p. Genes Dev. 15: 1935–1945.
BHAUMIK, S. R., and M. R. GREEN, 2002 Differential requirement of SAGA components for recruitment of TATA-box-binding protein to promoters in vivo. Mol. Cell Biol. 22: 7365–7371.
BIRCK, C., O. POCH, C. ROMIER, M. RUFF, G. MENGUS et al., 1998 Human TAF(II)28 and TAF(II)18 interact through a histone fold encoded by atypical evolutionary conserved motifs also found in the SPT3 family. Cell 94: 239–249.[CrossRef][Medline]
BISWAS, D., Y. YU, M. PRALL, T. FORMOSA and D. J. STILLMAN, 2005 The yeast FACT complex has a role in transcriptional initiation. Mol. Cell Biol. 25: 5812–5822.
BROWNELL, J. E., J. ZHOU, T. RANALLI, R. KOBAYASHI, D. G. EDMONDSON et al., 1996 Tetrahymena histone acetyltransferase A: a homolog to yeast Gcn5p linking histone acetylation to gene activation. Cell 84: 843–851.[CrossRef][Medline]
BURATOWSKI, R. M., J. DOWNS and S. BURATOWSKI, 2002 Interdependent interactions between TFIIB, TATA binding protein, and DNA. Mol. Cell Biol. 22: 8735–8743.
CABAL, G. G., A. GENOVESIO, S. RODRIGUEZ-NAVARRO, C. ZIMMER, O. GADAL et al., 2006 SAGA interacting factors confine sub-diffusion of transcribed genes to the nuclear envelope. Nature 441: 770–773.[CrossRef][Medline]
COLLART, M. A., 1996 The NOT, SPT3, and MOT1 genes functionally interact to regulate transcription at core promoters. Mol. Cell Biol. 16: 6668–6676.[Abstract]
DANIEL, J. A., and P. A. GRANT, 2007 Multi-tasking on chromatin with the SAGA coactivator complexes. Mutat. Res. 618: 135–148.[Medline]
DANIEL, J. A., M. S. TOROK, Z. W. SUN, D. SCHIELTZ, C. D. ALLIS et al., 2004 Deubiquitination of histone H2B by a yeast acetyltransferase complex regulates transcription. J. Biol. Chem. 279: 1867–1871.
DUDLEY, A. M., L. J. GANSHEROFF and F. WINSTON, 1999a Specific components of the SAGA complex are required for Gcn4- and Gcr1- mediated activation of the his4–912delta promoter in Saccharomyces cerevisiae. Genetics 151: 1365–1378.
DUDLEY, A. M., C. ROUGEULLE and F. WINSTON, 1999b The Spt components of SAGA facilitate TBP binding to a promoter at a post-activator-binding step in vivo. Genes Dev. 13: 2940–2945.
EISENMANN, D. M., K. M. ARNDT, S. L. RICUPERO, J. W. ROONEY and F. WINSTON, 1992 SPT3 interacts with TFIID to allow normal transcription in Saccharomyces cerevisiae. Genes Dev. 6: 1319–1331.
EISENMANN, D. M., C. CHAPON, S. M. ROBERTS, C. DOLLARD and F. WINSTON, 1994 The Saccharomyces cerevisiae SPT8 gene encodes a very acidic protein that is functionally related to SPT3 and TATA-binding protein. Genetics 137: 647–657.[Abstract]
GOVIND, C. K., F. ZHANG, H. QIU, K. HOFMEYER and A. G. HINNEBUSCH, 2007 Gcn5 promotes acetylation, eviction, and methylation of nucleosomes in transcribed coding regions. Mol. Cell 25: 31–42.[CrossRef][Medline]
GRANT, P. A., L. DUGGAN, J. COTE, S. M. ROBERTS, J. E. BROWNELL et al., 1997 Yeast Gcn5 functions in two multisubunit complexes to acetylate nucleosomal histones: characterization of an Ada complex and the SAGA (Spt/Ada) complex. Genes Dev. 11: 1640–1650.
HENRY, K. W., A. WYCE, W. S. LO, L. J. DUGGAN, N. C. EMRE et al., 2003 Transcriptional activation via sequential histone H2B ubiquitylation and deubiquitylation, mediated by SAGA-associated Ubp8. Genes Dev. 17: 2648–2663.
HERSKOWITZ, I., 1987 Functional inactivation of genes by dominant negative mutations. Nature 329: 219–222.[CrossRef][Medline]
HIRSCHHORN, J. N., A. L. BORTVIN, S. L. RICUPERO-HOVASSE and F. WINSTON, 1995 A new class of histone H2A mutations in Saccharomyces cerevisiae causes specific transcriptional defects in vivo. Mol. Cell Biol. 15: 1999–2009.[Abstract]
HUISINGA, K. L., and B. F. PUGH, 2004 A genome-wide housekeeping role for TFIID and a highly regulated stress-related role for SAGA in Saccharomyces cerevisiae. Mol. Cell 13: 573–585.[CrossRef][Medline]
JAMES, N., E. LANDRIEUX and M. A. COLLART, 2007 A SAGA-independent function of SPT3 mediates transcriptional deregulation in a mutant of the Ccr4-Not complex in Saccharomyces cerevisiae. Genetics 177: 123–135.
KIM, Y., J. H. GEIGER, S. HAHN and P. B. SIGLER, 1993 Crystal structure of a yeast TBP/TATA-box complex. Nature 365: 512–520.[CrossRef][Medline]
KOHLER, A., P. PASCUAL-GARCIA, A. LLOPIS, M. ZAPATER, F. POSAS et al., 2006 The mRNA export factor Sus1 is involved in Spt/Ada/Gcn5 acetyltransferase-mediated H2B deubiquitinylation through its interaction with Ubp8 and Sgf11. Mol. Biol. Cell 17: 4228–4236.
KOMARNITSKY, P., E. J. CHO and S. BURATOWSKI, 2000 Different phosphorylated forms of RNA polymerase II and associated mRNA processing factors during transcription. Genes Dev. 14: 2452–2460.
LARSCHAN, E., and F. WINSTON, 2001 The S. cerevisiae SAGA complex functions in vivo as a coactivator for transcriptional activation by Gal4. Genes Dev. 15: 1946–1956.
LAVIGNE, A. C., Y. G. GANGLOFF, L. CARRE, G. MENGUS, C. BIRCK et al., 1999 Synergistic transcriptional activation by TATA-binding protein and hTAFII28 requires specific amino acids of the hTAFII28 histone fold. Mol. Cell Biol. 19: 5050–5060.
LEE, T. I., and R. A. YOUNG, 1998 Regulation of gene expression by TBP-associated proteins. Genes Dev. 12: 1398–1408.
LEE, T. I., H. C. CAUSTON, F. C. HOLSTEGE, W. C. SHEN, N. HANNETT et al., 2000 Redundant roles for the TFIID and SAGA complexes in global transcription. Nature 405: 701–704.[CrossRef][Medline]
MADISON, J. M., and F. WINSTON, 1997 Evidence that Spt3 functionally interacts with Mot1, TFIIA, and TATA- binding protein to confer promoter-specific transcriptional control in Saccharomyces cerevisiae. Mol. Cell Biol. 17: 287–295.[Abstract]
MARTINEZ, E., 2002 Multi-protein complexes in eukaryotic gene transcription. Plant Mol. Biol. 50: 925–947.[CrossRef][Medline]
MENGUS, G., M. MAY, X. JACQ, A. STAUB, L. TORA et al., 1995 Cloning and characterization of hTAFII18, hTAFII20 and hTAFII28: three subunits of the human transcription factor TFIID. EMBO J. 14: 1520–1531.[Medline]
MITRA, D., E. J. PARNELL, J. W. LANDON, Y. YU and D. J. STILLMAN, 2006 SWI/SNF binding to the HO promoter requires histone acetylation and stimulates TATA-binding protein recruitment. Mol. Cell Biol. 26: 4095–4110.
MUHLRAD, D., R. HUNTER and R. PARKER, 1992 A rapid method for localized mutagenesis of yeast genes. Yeast 8: 79–82.[CrossRef][Medline]
NAAR, A. M., B. D. LEMON and R. TJIAN, 2001 Transcriptional coactivator complexes. Annu. Rev. Biochem. 70: 475–501.[CrossRef][Medline]
PRAY-GRANT, M. G., D. SCHIELTZ, S. J. MCMAHON, J. M. WOOD, E. L. KENNEDY et al., 2002 The novel SLIK histone acetyltransferase complex functions in the yeast retrograde response pathway. Mol. Cell Biol. 22: 8774–8786.
RIGAUT, G., A. SHEVCHENKO, B. RUTZ, M. WILM, M. MANN et al., 1999 A generic protein purification method for protein complex characterization and proteome exploration. Nat. Biotechnol. 17: 1030–1032.[CrossRef][Medline]
ROBERTS, S. M., and F. WINSTON, 1996 SPT20/ADA5 encodes a novel protein functionally related to the TATA- binding protein and important for transcription in Saccharomyces cerevisiae. Mol. Cell Biol. 16: 3206–3213.[Abstract]
ROBERTS, S. M., and F. WINSTON, 1997 Essential functional interactions of SAGA, a Saccharomyces cerevisiae complex of Spt, Ada, and Gcn5 proteins, with the Snf/Swi and Srb/mediator complexes. Genetics 147: 451–465.[Abstract]
RODRIGUEZ-NAVARRO, S., T. FISCHER, M. J. LUO, O. ANTUNEZ, S. BRETTSCHNEIDER et al., 2004 Sus1, a functional component of the SAGA histone acetylase complex and the nuclear pore-associated mRNA export machinery. Cell 116: 75–86.[CrossRef][Medline]
ROSE, M. D., F. WINSTON and P. HIETER, 1990 Methods in Yeast Genetics: A Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SALEH, A., V. LANG, R. COOK and C. J. BRANDL, 1997 Identification of native complexes containing the yeast coactivator/repressor proteins NGG1/ADA3 and ADA2. J. Biol. Chem. 272: 5571–5578.
SANDERS, S. L., J. JENNINGS, A. CANUTESCU, A. J. LINK and P. A. WEIL, 2002 Proteomics of the eukaryotic transcription machinery: identification of proteins associated with components of yeast TFIID by multidimensional mass spectrometry. Mol. Cell Biol. 22: 4723–4738.
SERMWITTAYAWONG, D., and S. TAN, 2006 SAGA competes with DNA to bind TBP via the Spt8 subunit: a handoff model for SAGA recruitment of TBP to the core promoter. EMBO J. 25: 3791–3800.[CrossRef][Medline]
SHIRRA, M. K., S. E. ROGERS, D. E. ALEXANDER and K. M. ARNDT, 2005 The Snf1 protein kinase and Sit4 protein phosphatase have opposing functions in regulating TATA-binding protein association with the Saccharomyces cerevisiae INO1 promoter. Genetics 169: 1957–1972.
SHUKLA, A., N. STANOJEVIC, Z. DUAN, P. SEN and S. R. BHAUMIK, 2006 Ubp8p, a histone deubiquitinase whose association with SAGA is mediated by Sgf11p, differentially regulates lysine 4 methylation of histone H3 in vivo. Mol. Cell Biol. 26: 3339–3352.
STERNER, D. E., P. A. GRANT, S. M. ROBERTS, L. J. DUGGAN, R. BELOTSERKOVSKAYA et al., 1999 Functional organization of the yeast SAGA complex: distinct components involved in structural integrity, nucleosome acetylation, and TATA-binding protein interaction. Mol. Cell Biol. 19: 86–98.
STERNER, D. E., R. BELOTSERKOVSKAYA and S. L. BERGER, 2002 SALSA, a variant of yeast SAGA, contains truncated Spt7, which correlates with activated transcription. Proc. Natl. Acad. Sci. USA 99: 11622–11627.
SWANSON, M. S., and F. WINSTON, 1992 SPT4, SPT5 and SPT6 interactions: effects on transcription and viability in Saccharomyces cerevisiae. Genetics 132: 325–336.[Abstract]
SWANSON, M. S., E. A. MALONE and F. WINSTON, 1991 SPT5, an essential gene important for normal transcription in Saccharomyces cerevisiae, encodes an acidic nuclear protein with a carboxy-terminal repeat. Mol. Cell Biol. 11: 3009–3019 (erratum: Mol. Cell Biol. 11: 4286).
TIMMERS, H. T., and L. TORA, 2005 SAGA unveiled. Trends Biochem. Sci. 30: 7–10.[CrossRef][Medline]
TOPALIDOU, I., M. PAPAMICHOS-CHRONAKIS, G. THIREOS and D. TZAMARIAS, 2004 Spt3 and Mot1 cooperate in nucleosome remodeling independently of TBP recruitment. EMBO J. 23: 1943–1948.[CrossRef][Medline]
VAN OEVELEN, C. J., H. A. VAN TEEFFELEN and H. T. TIMMERS, 2005 Differential requirement of SAGA subunits for Mot1p and Taf1p recruitment in gene activation. Mol. Cell Biol. 25: 4863–4872.
WARFIELD, L., J. A. RANISH and S. HAHN, 2004 Positive and negative functions of the SAGA complex mediated through interaction of Spt8 with TBP and the N-terminal domain of TFIIA. Genes Dev. 18: 1022–1034.
WINSTON, F., D. T. CHALEFF, B. VALENT and G. R. FINK, 1984a Mutations affecting Ty-mediated expression of the HIS4 gene of Saccharomyces cerevisiae. Genetics 107: 179–197.
WINSTON, F., K. J. DURBIN and G. R. FINK, 1984b The SPT3 gene is required for normal transcription of Ty elements in S. cerevisiae. Cell 39: 675–682.[CrossRef][Medline]
WINSTON, F., C. DOLLARD, E. A. MALONE, J. CLARE, J. G. KAPAKOS et al., 1987 Three genes are required for trans-activation of Ty transcription in yeast. Genetics 115: 649–656.
WINSTON, F., C. DOLLARD and S. L. RICUPERO-HOVASSE, 1995 Construction of a set of convenient Saccharomyces cerevisiae strains that are isogenic to S288C. Yeast 11: 53–55.[CrossRef][Medline]
WU, P. Y., and F. WINSTON, 2002 Analysis of Spt7 function in the Saccharomyces cerevisiae SAGA coactivator complex. Mol. Cell Biol. 22: 5367–5379.
WU, P. Y., C. RUHLMANN, F. WINSTON and P. SCHULTZ, 2004 Molecular architecture of the S. cerevisiae SAGA complex. Mol. Cell 15: 199–208.[CrossRef][Medline]
WYCE, A., T. XIAO, K. A. WHELAN, C. KOSMAN, W. WALTER et al., 2007 H2B ubiquitylation acts as a barrier to Ctk1 nucleosomal recruitment prior to removal by Ubp8 within a SAGA-related complex. Mol. Cell 27: 275–288.[CrossRef][Medline]
YU, Y., P. ERIKSSON, L. T. BHOITE and D. J. STILLMAN, 2003 Regulation of TATA-binding protein binding by the SAGA complex and the Nhp6 high-mobility group protein. Mol. Cell Biol. 23: 1910–1921.
Communicating editor: A. P. MITCHELL
This article has been cited by other articles:
![]() |
D. Helmlinger, S. Marguerat, J. Villen, S. P. Gygi, J. Bahler, and F. Winston The S. pombe SAGA complex controls the switch from proliferation to sexual differentiation through the opposing roles of its subunits Gcn5 and Spt8 Genes & Dev., November 15, 2008; 22(22): 3184 - 3195. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mohibullah and S. Hahn Site-specific cross-linking of TBP in vivo and in vitro reveals a direct functional interaction with the SAGA subunit Spt3 Genes & Dev., November 1, 2008; 22(21): 2994 - 3006. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Laprade, L.
- Articles by Winston, F.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Laprade, L.
- Articles by Winston, F.








