- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Peretz, G.
- Articles by Abdu, U.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Peretz, G.
- Articles by Abdu, U.
Genetics, Vol. 177, 1691-1702, November 2007, Copyright © 2007
doi:10.1534/genetics.107.079517
Expression of the Drosophila melanogaster GADD45 Homolog (CG11086) Affects Egg Asymmetric Development That Is Mediated by the c-Jun N-Terminal Kinase Pathway
Gabriella Peretz, Anna Bakhrat and Uri Abdu1
Department of Life Sciences and the National Institute for Biotechnology in the Negev, Ben-Gurion University, Beer-Sheva, 84105 Israel
1 Corresponding author: Department of Life Sciences, The National Institute for Biotechnology in the Negev, Ben-Gurion University, POB 653, Beer-Sheva, 84105 Israel.
E-mail: abdu{at}bgu.ac.il
The mammalian GADD45 (growth arrest and DNA-damage inducible) gene family is composed of three highly homologous small, acidic, nuclear proteins: GADD45
, GADD45β, and GADD45
. GADD45 proteins are involved in important processes such as regulation of DNA repair, cell cycle control, and apoptosis. Annotation of the Drosophila melanogaster genome revealed that it contains a single GADD45-like protein (CG11086; D-GADD45). We found that, as its mammalian homologs, D-GADD45 is a nuclear protein; however, D-GADD45 expression is not elevated following exposure to genotoxic and nongenotoxic agents in Schneider cells and in adult flies. We showed that the D-GADD45 transcript increased following immune response activation, consistent with previous microarray findings. Since upregulation of GADD45 proteins has been characterized as an important cellular response to genotoxic and nongenotoxic agents, we aimed to characterize the effect of D-GADD45 overexpression on D. melanogaster development. Overexpression of D-GADD45 in various tissues led to different phenotypic responses. Specifically, in the somatic follicle cells overexpression caused apoptosis, while overexpression in the germline affected the dorsal–ventral polarity of the eggshell and disrupted the localization of anterior–posterior polarity determinants. In this article we focused on the role of D-GADD45 overexpression in the germline and found that D-GADD45 caused dorsalization of the eggshell. Since mammalian GADD45 proteins are activators of the c-Jun N-terminal kinase (JNK)/p38 mitogen-activated protein kinase (MAPK) signaling pathways, we tested for a genetic interaction in D. melanogaster. We found that eggshell polarity defects caused by D-GADD45 overexpression were dominantly suppressed by mutations in the JNK pathway, suggesting that the JNK pathway has a novel, D-GADD45-mediated, function in the Drosophila germline.
THE GADD45 (growth arrest and DNA-damage inducible) gene family plays an important role in regulation of DNA repair, cell cycle control, and apoptosis, although its involvement in development is largely unknown. The GADD45 gene family is composed of three highly homologous (55–58% overall identity at the amino acid level), small, acidic, nuclear proteins: GADD45
(FORNACE et al. 1989), GADD45β (MyD118, ABDOLLAHI et al. 1991), and GADD45
(CR6, cytokine response gene 6) (BEADLING et al. 1993). In recent years, evidence has emerged that the proteins encoded by these genes play similar but not identical roles in terminal differentiation and negative growth control, including growth suppression and apoptotic cell death (AZAM et al. 2001; ZHANG et al. 2001; VAIRAPANDI et al. 2002).
One of the well-described responses to genotoxic and nongenotoxic stresses is the rapid upregulation of different GADD45 proteins, which in turn affect cell-cycle regulation, cell survival, and cell death (FORNACE et al. 1988, 1989; KASTAN et al. 1992). It has been shown that all the GADD45 proteins mediate cell-cycle regulation through interactions with PCNA (KELMAN and HURWITZ 1998; AZAM et al. 2001), the cyclin-dependent kinase inhibitor p21 (KEARSEY et al. 1995), and the Cdk/cyclin B complex (ZHAN et al. 1999; JIN et al. 2002; VAIRAPANDI et al. 2002). The potential role of GADD45 proteins in apoptosis emanates from the observation that GADD45 expression is enhanced during apoptosis following induction by a variety of genotoxic agents (reviewed in SHEIKH et al. 2000). Several studies have shown that GADD45 proteins may play a role in apoptosis via activation of the c-Jun N-terminal kinase (JNK) and/or p38 mitogen-activated protein kinase (MAPK) signaling pathways (TAKEKAWA and SAITO 1998; HARKIN et al. 1999). GADD45 proteins physically interact with the MAPKKK, MTK1 (synonym MEKK4), and the ensuing interactions result in the activation of MTK1. Activated MTK1 is thought to further activate its downstream targets JNK and p38 (TAKEKAWA and SAITO 1998). It was shown that the N-terminal of MTK1 auto-inactivates its kinase activity and binding of GADD45 proteins to MTK1 relieves this inhibition (MITA et al. 2002, MIYAKE et al. 2007). It was proposed that in response to genotoxic stress, p53 is activated, which causes transcriptional upregulation of GADD45
, and GADD45
interacts with MTK1 to initiate the JNK/p38-mediated apoptotic pathway.
Several model systems have been used to analyze the role of GADD45 proteins during development. GADD45
-null mice exhibit several phenotypes including genomic instability, increased radiation carcinogenesis, and a low frequency of exencephaly (HOLLANDER et al. 1999). GADD45
-deficient mice develop normally and are indistinguishable from their littermates, possibly due to functional redundancy among the GADD45 family members (HOFFMEYER et al. 2001). In the fish, Oryzias latipes, ectopic expression of GADD45
leads to cell cycle arrest without inducing apoptosis. Loss of function of GADD45
causes a significant increase in apoptosis, suggesting that GADD45
is an important component of the molecular pathway that coordinates cell cycle vs. apoptosis decisions during vertebrate development (CANDAL et al. 2004). The zebrafish GADD45β genes were found to be periodically expressed as paired stripes in the anterior presomitic mesoderm. Both knockdown and overexpression of GADD45β genes caused somite defects with different consequences for marker gene expression, indicating that the regulated expression of GADD45β genes is required for somite segmentation (KAWAHARA et al. 2005). The possible functional redundancy among the GADD45 proteins in these model systems makes the analysis of the molecular function of GADD45 difficult. Annotation of the Drosophila melanogaster genome revealed that it contains only one GADD45-like protein (CG11086, D-GADD45).
Since upregulation of GADD45 proteins may affect cell cycle regulation, cell survival, and cell death, we aimed to study the effect of D-GADD45 overexpression on D. melanogaster oogenesis. We found that overexpression of D-GADD45 in the somatic follicle cells led to apoptosis of the entire egg chamber. On the other hand, overexpression of D-GADD45 in the germline did not cause apoptosis but affected the dorsal–ventral polarity of the eggshell. Moreover, D-GADD45 also affected anterior–posterior polarity determinants. However, anterior oocyte nuclear migration and bcd localization were unaffected. Finally, we found that mutations in the MAPK–JNK pathway dominantly suppressed the egg asymmetric defects in D-GADD45 overexpression ovaries, suggesting a novel, D-GADD45-mediated function for the JNK pathway in the germline.
Drosophila strains:
Oregon-R was used as wild-type control. The following transgenic and mutant flies were used: CY2-Gal4 (QUEENAN et al. 1997); GR1-Gal4 (kindly provided by T. Schüpbach), nanos-Gal4-VP16 (VAN DOREN et al. 1998); Act5C-GAL4, 32B-Gal4, GMR-GAL4, Tub-Gal4, hepG0208 and hepr75 (Bloomington Stock Center), kinesin β-GAL insertion line KZ503 and the Nod-β GAL insertion line NZ143.2 (CLARK et al. 1994, 1997), P[w+ lac-Z]BB142) (SCHÜPBACH and ROTH 1994), and licH6 (SUZANNE et al. 1999, kindly provided by S. Noselli). Flies were cultured in standard cornmeal/agar medium at 25°. The balancer chromosomes used in this study, as well as marker mutations have been described in (LINDSLEY and ZIMM 1992) and in FlyBase (http://flybase.bio.indiana.edu).
Transgenic flies:
To make the pUASp-GADD45 construct the entire coding sequence of D-GADD45 (CG11086) was amplified from an EST template (RH70774) by PCR using modified primers to create a KpnI restriction site at the 5' end (GGTACCATGGTCGTCGAGGAGAACTGC) and a NotI site at the 3' end (GCGGCCGCCTACACAGCCGGCAGC). The resulting PCR product was cut using KpnI and NotI and was cloned into pUASp. P-element-mediated germline transformation of this construct was carried out according to standard protocols (SPRADLING 1986). Five independent UAS-D-GADD45 lines were established.
Preparation of the eggshell for dark-field microscopy:
Freshly laid eggs were collected on apple juice plates and placed in a drop of Hoyer's mount (NUSSLEIN-VOLHARD and WIESCHAUS 1980). After an overnight incubation at 65° the slides were examined by dark-field microscopy.
β-Galactosidase staining:
Ovaries were dissected in PBS transferred to glutaraldehyde fixative and rocked for 8 min, followed by washes (3 x 10 min) in PBST (PBS with 1% Triton X-100). The ovaries were then placed in staining buffer [0.05 M K3(Fe(CN)6), 0.05 M K4(Fe(CN)6) in PBS] with X-gal stock solution (10% in N,N-dimethylformamide) added to a final concentration of 1% and stained in the dark, overnight at 37°. The next day the ovaries were washed (3 x 10 min) in PBST and mounted on slides in 50% glycerol.
In situ hybridization and antibody staining:
RNA in situ hybridization on ovaries was performed using digoxigenin-labeled probes (Roche, Indianapolis) according to standard protocols (ROTH and SCHÜPBACH 1994). Antibody staining of ovaries was carried out as described (QUEENAN et al. 1999), using mouse anti-Grk ID12 1:10, rabbit anti-Oskar 1:3000 (kindly provided by P. MacDonald), mouse anti-
-tubulin 1:200 (Sigma, St. Louis), rabbit anti β-Gal 1:200 (Promega), mouse anti-BR-C 1:100 (Hybridoma Bank, University of Iowa), mouse anti-Lamin 1:50 (Hybridoma Bank, University of Iowa). Secondary antibodies used were goat
-rabbit 1:500 (Molecular Probes, Eugene, OR) and Cy3 goat
-mouse 1:100 (Jackson ImmunoResearch, West Grove, PA). Oregon green 488 and Alexa Fluor 546 phalloidin (Molecular Probes) were used at 1:500 and Hoechst was used at 1 µg/ml (Molecular Probes). Egg chambers were photographed on a Zeiss LSM510 Laser-scanning confocal microscope.
Scanning electron microscopy:
To prepare scanning electron microscopy (SEM) samples, fly heads were dehydrated through an ethanol series (25, 50, 75, and twice with 100%) for 10 min each followed by a hexamethyldisilazane (HMDS, Electron Microscopy Sciences) series (50, 75, and twice with 100%) for 2 hr each. Flies were air dried overnight under the hood, sputter coated with gold, mounted onto SEM stubs, and analyzed with a JSM-5610LV scanning electron microscope.
Yeast culture:
The entire coding sequence of CG11086 was amplified by PCR using modified primers to create a SpeI restriction site at the 5' end (ACTAGTATGGTCGTCGAGGAGAACTGC) and a SacI site at the 3' end (GAGCTCCTACACAGCCGGCAGCTGG). The resulting PCR product was cut using SpeI and SacI and was cloned as a GFP fusion in the pHY315–GFP yeast expression vector (kindly provided by S. Elledge). Transfection to yeast was carried out as described elsewhere (ADAMS et al. 1997). For DNA staining cells were incubated with DAPI at 1 µg/ml (Molecular Probes) for 30 min.
Cell culture:
Drosophila Schneider 2 (S2) and S2R+ cells were grown in Schneider cell medium (Biological Industries, Beer-Sheva, Israel) supplemented with 10% fetal calf serum and penicillin–streptomycin–amphotericin (Biological Industries). Cells were cultured at 25°. For transfection, four million cells were plated in 1 ml Schneider medium. Cells were transfected with 1 µg plasmid DNA using the ESCORT IV transfection reagent (Sigma) according to the manufacturer's protocol.
To make the UAS–GFP–GADD45 construct for the localization experiment the entire coding sequence of EGFP (Invitrogen) was amplified by PCR using modified primers to create a KpnI restriction site at the 5' end (GGTACCATGGTGAGCAAGGGCGAGGAGC) and an XbaI site at the 3' end (TCTAGACTTGTACAGCTCGTCCATGCCG). The resulting PCR product was cloned into pBluescript. D-GADD45 (CG11086) was amplified by PCR using modified primers to create an XbaI restriction site at the 5' end (TCTAGAATGGTCGTCGAGGAGAACTGC) and a NotI site at the 3' end (GCGGCCGCCTACACAGCCGGCAGC). The resulting PCR product was cloned into pBluescript-GFP. The sequence composed of D-GADD45 and GFP was cut using KpnI and NotI and cloned into pUASp as a GFP fusion. For immunostaining, S2 cells were fixed with 4% formaldehyde for 15 min. After permeabilization with 0.2% Triton-X100, cells were incubated with mouse anti Lamin antibody 1:10 (Hybridoma Bank, University of Iowa) in 0.2% FSG. Cy3 goat
-mouse 1:1000 (Jackson ImmunoResearch) was used for detection. Cells were photographed on a Zeiss LSM510 Laser-scanning confocal microscope.
Stress experiments:
To study the effect of stress on D-GADD45 transcription, different treatments were applied to S2 cells and Drosophila flies. For toxic metal stress S2 cells were left untreated or received 200 µM NaAsO2 (Sigma–Aldrich) and were harvested 2 hr later. For UV radiation, S2 cells were irradiated with UVC to a dose of 300 Jm–2 and were harvested 2 hr later. For paraquat treatment, Drosophila wild-type adult males, aged 3–4 days were starved for 2 hr and then transferred to vials containing only filter paper soaked with 20 mM paraquat in 5% sucrose solution. Control vials contained only 5% sucrose solution. RNA was extracted from flies 24 hr later. For X-ray treatment, Drosophila wild-type adult males aged 3–4 days were treated with 2500 rads in the Faxitron RX650 (Faxitron X-Ray, Wheeling, IL). RNA was extracted form flies 2 hr later. Each assay was repeated twice more.
Infection experiments:
For septic injury experiments, we used Drosophila wild-type adult males, aged 3–4 days at 25°. Septic injury was performed by pricking the thorax of the flies with a needle previously dipped into a concentrated bacterial culture of the gram-negative strain Escherichia coli and gram-positive strains Micrococcus luteus and Enterococcus faecalis (kindly provided by B. Lemaitre). Then flies were incubated at 25° and collected 2 hr after infection.
Real-time RT–PCR:
Total RNA was extracted from flies and S2 cells using the NucleoSpin RNA II kit, including DNase treatment, according to the manufacturer's instructions (Macherey-Nagel). cDNA was transcribed in 1–3 µg of total RNA using reverse transcriptase and oligo(dT) (ABgene) in a 20-µl reaction according to the manufacturer's instructions (Bio-Lab, Jerusalem). Real-time PCR was performed using the Mx3000p (Stratagene, La Jolla, CA). Reverse-transcribed total RNA (200 ng) was amplified in a 20-µl reaction containing 200 nM of each primer and 10 µl of SYBR Green PCR Master Mix (Stratagene).Forward and reverse primer sequences were as follows: Rp49 Fwd, CCGCTTCAAGGGACAGTATCTG; Rp49 Rev, CACGTTGTGCACCAGGAACTT; GADD45 Rev, CGTAGATGTCGTTCTCGTAGC; GADD45 Fwd, CATCAACGTGCTCTCCAAGTC; Drosomycin Fwd, TCAAGTACTTGTTCGCCCTC; and Drosomycin Rev, ATCCTTCGCACCAGCACTTC.
The amount of gene product in each sample was determined by the comparative quantification method using the MxPro software (Stratagene). Ribosomal protein 49 was used in all experiments to normalize for differences in total cDNA between samples. All quantitative PCR analyses were performed in triplicate.
The CG11086 gene encodes the Drosophila GADD45 homolog that is localized to the cell nucleus:
On the basis of BLAST results it was found that the D. melanogaster gene CG11086 is related to the mammalian growth arrest and DNA damage inducible (GADD45) gene family. This Drosophila GADD45-like protein (D-GADD45) shows strongest amino acid sequence identity with human GADD45
(31%). D-GADD45 corresponds to a single exon with an ORF encoding a 163-amino acid protein. Protein features include a ribosomal protein domain that starts at position 33 and ends at position 134 (KOONIN 1997). As a first step we wanted to assess whether D-GADD45 localizes to the nucleus as its mammalian homologs (AZAM et al. 2001; ZHANG et al. 2001; VAIRAPANDI et al. 2002). For this purpose the green fluorescent protein (GFP) tag was fused to the N terminus of D-GADD45 and we tested the localization of the fused protein in two cell systems, the yeast Saccharomyces cerevisiae and in the Drosophila embryo-derived Schneider S2 cell line. In both S2 and yeast, the protein showed a distinct localized distribution within the cell nucleus, demonstrating conservation of this property (Figure 1, A–E).
|
D-GADD45 is not upregulated following different stress stimuli:
One of the well described responses to genotoxic and nongenotoxic stresses is the rapid upregulation of GADD45 proteins, which in turn affect cell cycle regulation, cell survival, and cell death (FORNACE et al. 1988, 1989; KASTAN et al. 1992). To examine D-GADD45 gene expression in response to exposure to different stressful agents, we used real-time PCR. We tested the response in both S2 cells and in the whole fly using a wide range of stressful conditions.
In mice, GADD45
was identified as a gene whose expression is increased following arsenic-induced stress (LIU et al. 2001). To study the effect of this stress on D-GADD45 transcription, we treated S2 cells with the toxic metal, arsenite. We found that treatment did not lead to D-GADD45 induction (Figure 2A). GADD45
was identified as a gene whose expression is induced following treatment with UV radiation (FORNACE et al. 1988). S2 cells were therefore also treated with UV radiation. D-GADD45 mRNA levels in UV treated cells were similar to those found in the control (Figure 2A). GADD45
was also found to be rapidly and strongly induced in human lymphoblast cell lines following X-ray irradiation (PAPATHANASIOU et al. 1991). For this reason, we treated flies with X rays, which causes DNA breaks. In this experiment we also found that the mRNA level of D-GADD45 in irradiated flies was similar to that found in nonirradiated flies (Figure 2B).
|
All three GADD45 isoforms displayed a significant increase in expression in young mice following injection of paraquat (EDWARDS et al. 2003). This is why we chose to feed flies with paraquat and examine the level of D-GADD45 mRNA. We found that the mRNA levels of D-GADD45 did not differ significantly between treated and untreated extracts (Figure 2B).
D-GADD45 is upregulated upon activation of the immune response:
In a genomewide microarray analysis D-GADD45 was identified as a gene whose expression is induced following microbial infection (DE GREGORIO et al. 2001). In another study aimed to identify clusters of high-affinity Dorsal binding sites in the Drosophila genome, a cluster of three optimal Dorsal binding sites was identified 3 kb upstream to the D-GADD45 transcription start site (MARKSTEIN et al. 2002). Dorsal is an NF-B-like transcription factor belonging to the Toll pathway that is activated mainly by gram-positive bacteria and fungi infections (HOFFMANN and REICHHART 2002; TZOU et al. 2002).To strengthen the possible role for D-GADD45 in the immune response we conducted septic injury experiments in which wild-type flies were pricked in the thorax with a needle previously dipped into a concentrated gram-positive (Micrococcus luteus and Enterococcus faecalis) and gram-negative (Escherichia coli) bacterial culture. We analyzed the change in mRNA levels of D-GADD45 by real-time PCR. As a positive control we also checked the mRNA level of Drosomycin, which is a known AMP that is induced by septic injury. Following septic injury the level of D-GADD45 mRNA was significantly increased as compared with uninfected flies (Figure 2B). The mRNA level of our positive control, Drosomycin, also increased significantly, in accordance with previous results of others (data not shown).
D-GADD45 overexpression in somatic cells causes apoptosis:
To study the effect of overexpression of D-GADD45 in vivo we used the UAS-Gal4 binary system (BRAND and PERRIMON 1993) in which ubiquitous or tissue-specific expression can be induced. We cloned the full length D. melanogaster GADD45-like protein (CG11086) into the pUASp vector allowing expression in both somatic and germline tissues (RORTH 1998). Five transgenic lines harboring the construct were generated. Several Gal4 driver lines were used to express D-GADD45 at various times and in different somatic tissues. We found that the ubiquitous overexpression using Act and Tub Gal4 lines caused lethality in all the transgenic lines.Next, we studied the effects of overexpression of D-GADD45 in the somatic follicle cells surrounding the egg chamber using CY2-Gal4 (Figure 3, A–D) and GR1-Gal4 (data not shown) drivers. Overexpression of D-GADD45 causes apoptosis of the egg chamber as revealed by DNA staining, which shows condensation and fragmentation of nurse cell DNA followed by apoptosis of the entire egg chamber (Figure 3D). This pattern of apoptosis of follicle cells that is followed by germline degeneration was previously reported by CHAO and NAGOSHI (1999). Since we found that overexpression of D-GADD45 in the somatic follicle cells led to apoptosis, we tested whether this is general to somatic cells or rather a tissue-specific response. For this purpose, D-GADD45 was overexpressed in other somatic tissues. No apoptosis was observed in somatic tissues such as the compound eye (Figure 3, E and F) and wing imaginal discs (data not shown).
|
D-GADD45 overexpression in germline affects the dorsal–ventral patterning of the eggshell:
To assess the potential role of D-GADD45 during D. melanogaster oogenesis, we overexpressed D-GADD45 in the germline. Overexpression in the germline using nanos-Gal4 promoter leads to the production of a broad range of abnormal eggshell phenotypes, ranging from normal morphology to dorsalized (Figure 3; Table 1). The eggshell phenotypes vary from being wild-type like, bearing two dorsal appendages (Figure 4A), to weakly dorsalized eggs that have two broadened dorsal appendages (Figure 4B), and moderately dorsalized with one broadened dorsal appendage on the dorsal midline (Figure 4C). This observation suggests that overexpression of D-GADD45 in the germline affects the dorsal–ventral (D/V) polarity of the oocyte. Relatively lower percentages of the eggshell showed an additional phenotype, where the eggs had a more posteriorly located patch of dorsal appendage material (Figure 4D). This phenotype could arise from defects in dorsal–ventral pattering but were harder to classify. We analyzed the severity of dorsalized phenotypic class among the five different transgenic lines (Table 1).
|
|
D-GADD45 overexpression in germline affects grk RNA localization:
Since overexpression of D-GADD45 in the germ cells affects the dorsal–ventral polarity of the oocyte (Figure 4, Table 1) we decided to check whether the overexpression has an effect on factors involved in the establishment of this embryonic axis.
The anterior–posterior (A/P) and dorsal–ventral (D/V) axes of the D. melanogaster embryo are established during oogenesis by a communication between the oocyte and the surrounding follicle cells (SCHÜPBACH 1987; RUOHOLA-BAKER et al. 1994). This communication is mediated by a single signaling system involving gurken (grk) and Epidermal growth factor receptor (Egfr) genes (GONZÁLEZ-REYES et al. 1995; ROTH et al. 1995). grk encodes a TGF-
-like protein that is expressed in the germline and is secreted from the oocyte (NEUMAN-SILBERBERG and SCHÜPBACH 1993, 1996). Egfr is expressed throughout the follicular epithelium (KAMMERMEYER and WADSWORTH 1987; SAPIR et al. 1998), where it acts as a receptor for Gurken.
D-GADD45 overexpression in the germline affects asymmetric development during oogenesis, with phenotypic consequences on D/V patterning of the eggshell suggesting that it might affect the grk–Egfr pathway. Therefore we examined the localization of grk RNA and protein. In wild-type ovaries, grk RNA accumulates in the oocyte during early stages of oogenesis. At mid-oogenesis, it is localized within the oocyte, first transiently in an anterior–cortical ring, and then to a dorsal–anterior domain in the cytoplasm directly overlying the oocyte nucleus (Figure 5A). Grk protein is restricted to the oocyte and in mid-oogenesis, is localized to the dorsal–anterior corner of the oocyte, similar to the RNA (NEUMAN-SILBERBERG and SCHÜPBACH 1996; Figure 5C).
|
At stage 9, 57% of D-GADD45 overexpression egg chambers display a mislocalized grk RNA pattern. grk mRNA is detected as a circular ring along the anterior cortex (Figure 5B, arrows). Thus, it seems that overexpression of D-GADD45 affects the proper localization of grk mRNA to the dorsal–anterior region of the oocyte. To determine if the mislocalized RNA in these ovaries is translated, we analyzed Grk protein expression by whole-mount antibody staining. We did not observe egg chambers where Grk was mislocalized (Figure 5D), possibly due to insensitivity of this assay.
D-GADD45 overexpression in germline affects Grk activity:
To gain further insight into the effect overexpression of D-GADD45 has on the grk–Egfr pathway we tested grk activity using the kekon (kek)-lacZ enhancer trap line and BR-C patterning. The kek gene is a target of the Egfr in the follicle cells and thus serves as an indirect and sensitive assay to measure grk activity in the oocyte. In wild-type egg chambers, kek is expressed in a characteristic graded dorsal–anterior pattern reflecting both the intensity and localization of the underlying grk signal (Figure 6A; MUSACCHIO and PERRIMON 1996; SAPIR et al. 1998; SUZANNE et al. 1999). Overexpression of D-GADD45 disrupts the kek-lacZ graded pattern. In 72% of the egg chambers kek signal is significantly expanded throughout the follicle cells that span the oocyte, losing its high point in the dorsal–anterior corner (Figure 6B). This result suggests an increase of grk activity consistent with the dorsalization of the chorion.
|
An additional marker, Broad-Complex (BR-C), belongs to a family of transcription factors that are expressed in the follicle cells in a dynamic pattern, the late pattern being defined by two groups of dorsal–anterior follicle cells at stage 10B of oogenesis. BR-C was also shown to be involved in dorsal appendage morphogenesis. The dorsal–anterior expression pattern is specified by the Grk–Egfr and decapentaplegic (DPP) signaling pathways and can therefore serve as an additional marker for Grk–Egfr signaling (DENG and BOWNES 1997). Using an antibody for BR-C we can examine the distribution pattern of BR-C. In a wild-type stage-11 egg chamber two groups of lateral–dorsal–anterior follicle cells are heavily stained (Figure 6C, arrows), while the posterior and the ventral follicle cells are weakly stained. Expression of D-GADD45 disrupts the BR-C and leads to a range of patterns. Stage-11 egg chambers display a complete loss of the dorsal–anterior gap between the two groups of the lateral–dorsal cells (Figure 6D). Eighty-seven percent of the egg chambers showed a laterally expanded staining (Figure 6D, bracket). In late stages of oogenesis, wild-type stage-13 egg chamber expression is detectable only in the dorsal appendage-associated follicle cells (Figure 6E, arrows). Once again with germline D-GADD45 overexpression there is no detectable dorsal gap (Figure 6F), which may correspond with the broadened, fused, dorsal appendages described previously. In fact, there is in general a very good correspondence between our observations of kek or BR-C expansion and loss of dorsal gap during oogenesis and the high percentage of dorsalized eggshells produced by the females (Table 1).
D-GADD45 overexpression in germline affects anterior–posterior polarity determinants:
The localization of bicoid (bcd) and oskar (osk) mRNA to the anterior and posterior poles of the oocyte define the A/P axis of the embryo. osk mRNA, at the posterior pole, directs assembly of the pole plasm, containing determinants of the abdomen and germline (EPHRUSSI and LEHMANN 1992; REICHMANN and EPHRUSSI 2001). Since osk is fundamental for oocyte polarization, we decided to check the localization of osk RNA and protein in egg chambers of flies overexpressing D-GADD45 in the germline.In situ hybridization of D-GADD45 overexpression egg chambers revealed that the osk RNA transcript is mislocalized. In stage-9 egg chambers osk mRNA was found along the anterior cortex and in a more diffused pattern at the posterior pole (data not shown). The majority of stage-10 egg chambers were also missing the tightly localized crescent (Figure 7B) seen in wild-type egg chambers (Figure 7A). Immunofluorescent staining of stage-10 egg chambers with anti-Oskar antibody revealed that Osk protein was localized to the posterior pole of the oocyte but was not restricted to a cortical crescent (Figure 7D) as in wild-type egg chambers of this stage (Figure 7C).
|
Next we examined the localization of bcd mRNA, which is localized at the anterior pole and later on is translated after fertilization to produce a morphogen gradient that patterns the anterior region of the embryo (DRIEVER 1993). We found that bcd mRNA is correctly localized along the anterior cortex of egg chambers with D-GADD45 overexpression (data not shown).
Since the localization of osk and grk RNA's are dependent on cytoskeleton organization in the oocyte, we asked whether the actin and/or the microtubule network are altered during oogenesis. To investigate the polarity and transport to the posterior pole of the oocyte, we used the plus-end microtubule-associated motor protein, kinesin, fused to the bacterial β-galactosidase enzyme (Kin:β-gal) as a reporter (CLARK et al. 1994, 1997). Immunofluorescence assay with anti-β-Gal demonstrated a less compact staining at a more central region of the oocyte in egg chambers with D-GADD45 overexpression in the germline (Figure 7F) as compared to wild-type ovaries (Figure 7E).
To analyze transport to the anterior pole, we used the microtubule minus-end marker Nod: β-gal (CLARK et al. 1997). We found that Nod:β-gal localization in flies with D-GADD45 overexpression in the germline is similar to that observed in wild-type stage-9 egg chambers, the fusion protein is concentrated along the anterior cortex of the oocyte (data not shown). These results are consistent with the proper localization of bcd mRNA as described above. We were also able to observe normal oocyte nucleus migration to the anterodorsal position at stage 8 of oogenesis in these egg chambers (GONZÁLEZ-REYES et al. 1995; ROTH et al. 1995; data not shown).
Next, we asked whether the actin and/or the microtubule network are altered during oogenesis. To analyze the organization of the microtubule network in egg chambers with D-GADD45 overexpression in the germline, we used
-tubulin staining. Using this tool, we were unable to detect any defect in the microtubule network (data not shown). Also, to examine the actin network, ovaries were stained with Rhodamine-conjugated phalloidin; however, no obvious defects in the organization of the actin network and ring canal structure were found in the transgenic flies' ovaries.
D-GADD45 overexpression in germline affects the MAPK pathway:
In eukaryotes from yeasts to mammals, various cellular stresses generate intracellular signals that converge on the MAPK pathways (MITA et al. 2002). Three main MAPK families are the extracellular signal-regulated kinase (ERK), p38, and JNK. Several studies have shown that the GADD45 proteins may play a role in the JNK and/or p38 MAPK signaling pathways (TAKEKAWA and SAITO 1998; HARKIN et al. 1999). The genome of the fruit fly D. melanogaster possesses all MAPK families present in the mammalian genome, but represented, typically, by fewer genes (RYABININA et al. 2006). Therefore, D. melanogaster makes an excellent, simple model system for studying signaling in evolutionary conserved pathways.Human GADD45 proteins were shown to physically interact with the MAPKKK, MTK1 (synonym MEKK4), resulting in the activation of MTK1 which further activates both JNK and p38 (TAKEKAWA and SAITO 1998). Since GADD45 proteins were shown to activate the JNK and/or p38 MAPK signaling pathways, we searched for a genetic interaction between the D-GADD45 and p38/JNK kinases. It was previously shown that flies mutant for licorne (lic, synonym D-MKK3), the D. melanogaster p38 MAPKK, display a ventralized eggshell phenotype (SUZANNE et al. 1999). Loss of function of lic in the germline leads to reduced Egfr activity in the follicle cells due to a reduction of Grk protein in the oocyte. Lic is also required for maintenance of osk mRNA localization during midoogenesis. In stage-9 lic germ-line clones osk mRNA is mislocalized, diffusing through the whole oocyte in a gradient from the posterior to the anterior pole. SUZANNE et al. (1999) proposed that the patterning of the egg relies on activation of the p38 MAPK pathway. We hypothesized that D-GADD45 overexpression, which caused dorsalization of the eggshell, could be an effect mediated through interactions of D-GADD45 with the MAPK protein(s).
To elucidate the nature of D-GADD45 regulation of the MAPK pathway, we generated flies with D-GADD45 overexpression in a partially deficient p38 and JNK background. The fly stock used was doubly mutant for both lic and hemipterous (hep), the D. melanogaster JNKK gene (SUZANNE et al. 1999). We found that reducing the level of both lic and hep significantly suppressed the dorsalized eggshell phenotype (Table 2). Next, we analyzed whether reducing the level of p38 and JNK kinases also affects the mislocalization of Osk protein in D-GADD45 overexpression ovaries. We found that the defects in Osk protein localization were also considerably reduced from 84 to only 33% in these flies.
|
Next we intended to pinpoint the dominant suppression to either the p38 or the JNK pathway. Since there are no flies singly mutant for lic, we examined the effect of D-GADD45 overexpression in a single hep deficient background. To our surprise we found, using two different hep mutant alleles, that the dorsal–ventral patterning defects caused by D-GADD45 overexpression were dominantly suppressed (Table 2). The level of suppression was similar to that of the heterozygous deficiency that uncovers both hep and lic, suggesting that hep is the main D-GADD45 activator in the germline.
D-GADD45 was identified as a gene whose expression is induced following microbial infection (DE GREGORIO et al. 2001). It was also shown that D-GADD45 expression may be regulated by the NF-B-like transcription factor, Dorsal, which has an optimal binding site 3 kb upstream to D-GADD45 transcription start site (MARKSTEIN et al. 2002). Our results are consistent with those found by DE GREGORIO et al (2001) and further strengthen a possible function for D-GADD45 in the immune response. Given that Drosophila is devoid of an adaptive immune system and relies only on innate immune reactions for its defense, D-GADD45 may play an important role during infection.
We found that ubiquitous overexpression of D-GADD45 was lethal, most likely due to apoptosis, as we directly demonstrated in the follicle cells. However, our results suggest that apoptosis induced by overexpression of D-GADD45 is tissue specific since overexpression of D-GADD45 in other somatic tissues, such as the eye and wing, did not lead to apoptosis. Also, overexpression in the germline did not cause cell death; rather, it affected egg chamber asymmetric development. The apparent phenotypic differences in overexpression of D-GADD45 in the germline as opposed to somatic derived tissues probably reflect the complexity of the biological functions of GADD45, which may be subject to tissue- and/or signal-specific regulation that ultimately dictate their output. Similarly, it has been shown that individual members of the GADD45 family play critical roles in negative growth control in some tissues while in others they are associated with uncontrolled cell growth and tumor development. GADD45
was identified as an important mediator of tumor suppression in human ovarian cancer cells (JIANG et al. 2003). While in pancreatic ductal adenocarcinoma GADD45
was found to be overexpressed at the mRNA and protein level. Downregulation of GADD45
by means of RNAi reduced proliferation and induced apoptosis in pancreatic cancer cells implying that GADD45
contributes to pancreatic cancer cell proliferation and viability (SCHNEIDER et al. 2006).
We found that overexpression of D-GADD45 in the germline resulted in dorsalization of the chorion due to defects in grk localization and translation. We also showed that the posterior markers osk and Kin:β-gal were mislocalized during mid-oogenesis. On the other hand, D-GADD45 overexpression did not affect the localization of anterior end markers such as bcd and Nod:β-gal and also the anterior oocyte nuclear migration is unaffected. Similar results were reported in mutants of squid (sqd) which encodes a heterogeneous nuclear ribonucleoprotein (hnRNP). In these mutants grk mRNA is mislocalized along the anterior ring, leading to dorsalization of the eggshell (KELLEY 1993; NEUMAN-SILBERBERG and SCHÜPBACH 1993, 1996; MATUNIS et al. 1994). Furthermore, loss of sqd function causes an aberrant localization of osk and Kin:β-gal, but does not affect bcd localization and oocyte nucleus migration (NORVELL et al. 2005; STEINHAUER and KALDERON 2005). It was shown that in sqd mutant oocytes short microtubules (MTs) around the entire oocyte cortex are retained, including at the posterior pole, unlike wild-type MTs which emanate mostly from the anterior. It was suggested that the primary MT defect in sqd mutants is the failure to eliminate cortical sites of MT nucleation beyond stage 7 (STEINHAUER and KALDERON 2005). It is possible that D-GADD45 overexpression also affects MT organization in the oocyte. This possibility is further supported by the finding that GADD45
interacts with elongation factor 1
(EF-1
), a microtubule-severing protein that plays an important role in maintaining microtubule cytoskeletal stability (TONG et al. 2005). To test whether D-GADD45 affects MT organization, we stained the ovaries with anti-tubulin. Using this tool, we were unable to detect any gross morphological changes in the MT network. Given that the patterning defect seen in D-GADD45 overexpression is weaker than that in sqd mutants, it could be that this kind of staining is not sensitive enough to identify the MT network alterations in D-GADD45 overexpression flies.
We found a genetic interaction between D-GADD45 and proteins of the MAPK–JNK pathway. Mutations in the JNKK, hemipterous, dominantly suppressed the dorsalized eggshell phenotype. This genetic interaction is supported by the finding that in human cells GADD45 proteins act as initiators of JNK/p38 signaling via their interaction with the MAPKKK, MTK1 (TAKEKAWA and SAITO 1998). It was shown that the N-terminal of MTK1 inhibits its C-terminal kinase domain by preventing the kinase domain from interacting with its substrate, MKK6, and binding of GADD45 proteins relieves this auto-inhibition (MITA et al. 2002; MIYAKE et al. 2007).
Up until now the only roles attributed to the JNK pathway during oogenesis were in the follicle cells and included morphogenesis of the dorsal appendages and the micropyle (SUZANNE et al. 2001). It was also reported that the JNK pathway is involved in the morphogenetic process of dorsal closure during embryogenesis (IP and DAVIS 1998; NOSELLI 1998; AGNÈS et al. 1999; NOSELLI and AGNÈS 1999). To our surprise, we found that eggshell patterning defects caused by D-GADD45 overexpression are dominantly suppressed in a hep deficient background suggesting an additional role for the JNK pathway in the germline. This novel function may have gone unnoticed in the past while studying JNK loss-of-function alleles due to redundancy with some other pathway. In our study overexpression of the JNK activator, D-GADD45, may have unmasked this new role during oogenesis.
ABDOLLAHI, A., K. A. LORD, B. HOFFMANN-LIEBERMANN and D. LIEBERMANN, 1991 Sequence and expression of a cDNA encoding MyD118: a novel myeloid differentiation primary response gene induced by multiple cytokines. Oncogene 6: 165–167.[Medline]
ADAMS, A., D. E. GOTTSHLING, C. A. KAISER and T. STEARNS, 1997 Methods in Yeast Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
AGNÈS, F., M. SUZANNE and S. NOSELLI, 1999 The Drosophila JNK pathway controls the morphogenesis of imaginal disc during metamorphosis. Development 126: 5453–5462.[Abstract]
AZAM, N., M. VAIRAPANDI, W. ZHANG, B. HOFFMAN and D. A. LIEBERMANN, 2001 Interaction of CR6 (GADD45
) with proliferating cell nuclear antigen impedes negative growth control. J. Biol. Chem. 276: 2766–2774.
BEADLING, C., K. W. JOHNSON and K. A. SMITH, 1993 Isolation of interleukin 2-induced immediate-early genes. Proc. Natl. Acad. Sci. USA 90: 2719–2723.
BRAND, A. H., and N. PERRIMON, 1993 Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118: 401–415.[Abstract]
BRODSKY, M. H., B. T. WEINERT, G. TSANG, Y. S. RONG, N. M. MCGINNIS et al., 2004 Drosophila melanogaster MNK/Chk2 and p53 regulate multiple DNA repair and apoptotic pathways following DNA damage. Mol. Cell. Biol. 24(3): 1219–1231.
CANDAL, E., V. THERMES, J. S. JOLY and F. BOURRAT, 2004 Medaka as a model system for the characterisation of cell cycle regulators: a functional analysis of Ol-Gadd45
during early embryogenesis. Mech. Dev. 121: 945–958.[CrossRef][Medline]
CHAO, S. H., and R. N. NAGOSHI, 1999 Induction of apoptosis in the germline and follicle layer of Drosophila egg chambers. Mech. Dev. 88: 159–172.[CrossRef][Medline]
CLARK, I., E. GINIGER, H. RUOHOLA-BAKER, L. Y. JAN and Y. N. JAN, 1994 Transient posterior localization of a kinesin fusion protein reflects anteroposterior polarity of the Drosophila oocyte. Curr. Biol. 4: 289–300.[CrossRef][Medline]
CLARK, I. E., L. Y. JAN and Y. N. JAN, 1997 Reciprocal localization of Nod and kinesin fusion proteins indicates microtubule polarity in the Drosophila oocyte, epithelium, neuron and muscle. Development 124: 461–470.[Abstract]
DE GREGORIO, E., P. T. SPELLMAN, G. M. RUBIN and B. LEMAITRE, 2001 Genome-wide analysis of the Drosophila immune response by using oligonucleotide microarrays. Proc. Natl. Acad. Sci. USA 98(22): 12590–12595.
DENG, W. M., and M. BOWNES, 1997 Two signalling pathways specify localised expression of the Broad-Complex in Drosophila eggshell patterning and morphogenesis. Development 124(22): 4639–4647.[Abstract]
DRIEVER, W., 1993 Maternal control of anterior development in the Drosophila embryo, pp. 301–324 in The Development of Drosophila melanogaster, Vol. I, edited by M. BATE and A. MARTINEZ-ARIAS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
EDWARDS, M. G., D. SARKAR, R. KLOPP, J. D. MORROW, R. WEINDRUCH et al., 2003 Age-related impairment of the transcriptional responses to oxidative stress in the mouse heart. Physiol. Genomics 13: 119–127.
EPHRUSSI, A., and R. LEHMANN, 1992 Induction of germ cell formation by oskar. Nature 358: 387–392.[CrossRef][Medline]
FORNACE, JR., A. J., D. W. NEBERT, M. C. HOLLANDER, J. D. LUETHY, M. PAPATHANASIOU et al., 1989 Mammalian genes coordinately regulated by growth arrest signals and DNA-damaging agents. Mol. Cell. Biol. 9: 4196–4203.
FORNACE, JR., A. J., I. ALAMO, JR. and M. C. HOLLANDER, 1988 DNA damage inducible transcripts in mammalian cells. Proc. Natl. Acad. Sci. USA 85: 8800–8804.
GIRARDOT, F., V. MONNIER and H. TRICOIRE, 2004 Genome wide analysis of common and specific stress responses in adult Drosophila melanogaster. BMC Genomics 5(1): 74.[CrossRef][Medline]
GONZÁLEZ-REYES, A., H. ELLIOTT and D. ST JOHNSTON, 1995 Polarization of both major body axes in Drosophila by gurken-torpedo signalling. Nature 375: 654–658.[CrossRef][Medline]
HARKIN, D. P., J. M. BEAN, D. MIKLOS, Y. H. SONG, V. B. TRUONG et al., 1999 Induction of GADD45 and JNK/SAPK-dependent apoptosis following inducible expression of BRCA1. Cell 97: 575–586.[CrossRef][Medline]
HOFFMANN, J. A., and J. M. REICHHART, 2002 Drosophila innate immunity: an evolutionary perspective. Nat. Immunol. 3: 121–126.[CrossRef][Medline]
HOFFMEYER, A., R. PIEKORZ, R. MORIGGL and J. N. IHLE, 2001 Gadd45gamma is dispensable for normal mouse development and T-cell proliferation. Mol. Cell. Biol. 9: 3137–3143.
HOLLANDER, M. C., M. S. SHEIKH, D. V. BULAVIN, K. LUNDGREN, L. AUGERI-HENMUELLER et al., 1999 Genomic instability in Gadd45a-deficient mice. Nat. Genet. 23: 176–184.[CrossRef][Medline]
IP, Y. T., and R. J. DAVIS, 1998 Signal transduction by the c-Jun N-terminal kinase (JNK)–from inflammation to development. Curr. Opin. Cell Biol. 10: 205–219.[CrossRef][Medline]
JIANG, F., P. LI, A. J. FORNACE, JR., S. V. NICOSIA and W. BAI, 2003 G2/M arrest by 1,25-dihydroxyvitamin D3 in ovarian cancer cells mediated through the induction of GADD45 via an exonic enhancer. J. Biol. Chem. 278: 48030–48040.
JIN, S., T. TONG, W. FAN, F. FAN, M. J. ANTINORE et al., 2002 GADD45-induced cell cycle G2-M arrest associates with altered subcellular distribution of cyclin B1 and is independent of p38 kinase activity. Oncogene 21: 8696–8704.[CrossRef][Medline]
KAMMERMEYER, K. L., and S. C. WADSWORTH, 1987 Expression of Drosophila epidermal growth factor receptor homologue in mitotic cell populations. Development 100: 201–210.
KASTAN, M. B., Q. ZHAN, W. S. EL-DEIRY, F. CARRIER, T. JACKS et al., 1992 A mammalian cell cycle checkpoint pathway utilizing p53 and GADD45 is defective in ataxia-telangiectasia. Cell 71: 587–597.[CrossRef][Medline]
KAWAHARA, A., Y. S. CHE, R. HANAOKA, H. TAKEDA and I. B. DAWID, 2005 Zebrafish GADD45β genes are involved in somite segmentation. Proc. Natl. Acad. Sci. USA 102(2): 361–366.
KEARSEY, J. M., P. J. COATES, A. R. PRESCOTT, E. WARBRICK and P. A. HALL, 1995 Gadd45 is a nuclear cell cycle regulated protein which interacts with p21Cip1. Oncogene 9: 1675–1683.
KELLEY, R. L., 1993 Initial organization of the Drosophila dorsoventral axis depends on an RNA-binding protein encoded by the squid gene. Genes Dev. 7(6): 948–960.
KELMAN, Z., and J. HURWITZ, 1998 Protein-PCNA interactions: a DNA-scanning mechanism? Trends Biochem. Sci. 23: 236–238.[CrossRef][Medline]
KOONIN, E. V., 1997 Cell cycle and apoptosis: possible roles of Gadd45 and MyD118 proteins inferred from their homology to ribosomal proteins. J. Mol. Med. 75: 236–238.[Medline]
LINDSLEY, D. L., and G. G. ZIMM, 1992 The Genome of Drosophila melanogaster. Academic Press, New York.
LIU, J., M. B. KADIISKA, Y. LIU, T. LU, W. QU et al., 2001 Stress-related gene expression in mice treated with inorganic arsenicals. Toxicol. Sci. 61(2): 314–320.
MARKSTEIN, M., P. MARKSTEIN, V. MARKSTEIN and M. S. LEVINE, 2002 Genome-wide analysis of clustered Dorsal binding sites identifies putative target genes in the Drosophila embryo. Proc. Natl. Acad. Sci. USA 99: 763–768.
MATUNIS, E. L., R. KELLEY and G. DREYFUSS, 1994 Essential role for a heterogeneous nuclear ribonucleoprotein (hnRNP) in oogenesis: hrp40 is absent from the germ line in the dorsoventral mutant squid. Proc. Natl. Acad. Sci. USA 91(7): 2781–2784.
MITA, H., J. TSUTSUI, M. TAKEKAWA, E. A. WITTEN and H. SAITO, 2002 Regulation of MTK1/MEKK4 kinase activity by its N-terminal autoinhibitory domain and GADD45 binding. Mol. Cell. Biol. 22: 4544–4555.
MIYAKE, Z., M. TAKEKAWA, Q. GE and H. SAITO, 2007 Activation of MTK1/MEKK4 by GADD45 through induced N-C dissociation and dimerization-mediated trans autophosphorylation of the MTK1 kinase domain. Mol. Cell. Biol. 27(7): 2765–2776.
MUSACCHIO, M., and N. PERRIMON, 1996 The Drosophila kekkon genes: novel members of both the leucine-rich repeat and immunoglobulin superfamilies expressed in the CNS. Dev. Biol. 178: 63–76.[CrossRef][Medline]
NEUMAN-SILBERBERG, F. S., and T. SCHÜPBACH, 1993 The Drosophila dorsoventral patterning gene gurken produces a dorsally localized RNA and encodes a TGF alpha-like protein. Cell 75: 165–174.[CrossRef][Medline]
NEUMAN-SILBERBERG, F. S., and T. SCHÜPBACH, 1996 The Drosophila TGF-alpha-like protein Gurken: expression and cellular localization during Drosophila oogenesis. Mech. Dev. 59: 105–113.[CrossRef][Medline]
NORVELL, A., A. DEBEC, D. FINCH, L. GIBSON and B. THOMA, 2005 Squid is required for efficient posterior localization of oskar mRNA during Drosophila oogenesis. Dev. Genes Evol. 215(7): 340–349.[CrossRef][Medline]
NOSELLI, S., 1998 JNK signaling and morphogenesis in Drosophila. Trends Genet. 14: 33–38.[CrossRef][Medline]
NOSELLI, S., and F. AGNÈS, 1999 Roles of the JNK signaling pathway in Drosophila morphogenesis. Curr. Opin. Genet. Dev. 9: 466–472.[CrossRef][Medline]
NUSSLEIN-VOLHARD, C., and E. WIESCHAUS, 1980 Mutations affecting segment number and polarity in Drosophila. Nature 287(5785): 795–801.[CrossRef][Medline]
PAPATHANASIOU, M. A., N. C. KERR, J. H. ROBBINS, O. W. MCBRIDE, I. ALAMO, JR. et al., 1991 Induction by ionizing radiation of the gadd45 gene in cultured human cells: lack of mediation by protein kinase C. Mol. Cell. Biol. 11(2): 1009–1016.
QIN, W., S. J. NEAL, R. M. ROBERTSON, J. T. WESTWOOD and V. K. WALKER, 2005 Cold hardening and transcriptional change in Drosophila melanogaster. Insect Mol. Biol. M(6): 607–613.
QUEENAN, A. M., A. GHABRIAL and T. SCHÜPBACH, 1997 Ectopic activation of torpedo/Egfr, a Drosophila receptor tyrosine kinase, dorsalizes both the eggshell and the embryo. Development 124(19): 3871–3880.[Abstract]
QUEENAN, A. M., G. BARCELO, C. VAN BUSKIRK and T. SCHÜPBACH, 1999 The transmembrane region of Gurken is not required for biological activity, but is necessary for transport to the oocyte membrane in Drosophila. Mech. Dev. 89: 35–42.[CrossRef][Medline]
REICHMANN, V., and A. EPHRUSSI, 2001 Axis formation during Drosophila oogenesis. Curr. Opin. Genet. Dev. 11: 374–383.[CrossRef][Medline]
RORTH, P., 1998 Gal4 in the Drosophila female germline. Mech. Dev. 78: 113–118.[CrossRef][Medline]
ROTH, S., and T. SCHÜPBACH, 1994 The relationship between ovarian and embryonic dorsoventral patterning in Drosophila. Development 120(8): 2245–2257.[Abstract]
ROTH, S., F. S. NEUMAN-SILBERBERG, G. BARCELO and T. SCHÜPBACH, 1995 Cornichon and the EGF receptor signaling process are necessary for both anterior-posterior and dorsal-ventral pattern formation in Drosophila. Cell 81: 967–978.[CrossRef][Medline]
RUOHOLA-BAKER, H., L. Y. JAN and Y. N. JAN, 1994 The role of gene cassettes in axis formation during Drosophila oogenesis. Trends Genet. 10: 89–94.[CrossRef][Medline]
RYABININA, O. P., E. SUBBIAN and M. S. IORDANOV, 2006 D-MEKK1, the Drosophila orthologue of mammalian MEKK4/MTK1, and Hemipterous/D-MKK7 mediate the activation of D-JNK by cadmium and arsenite in Schneider cells. BMC Cell Biol. 7: 7.[CrossRef][Medline]
SAPIR, A., R. SCHWEITZER and B. Z. SHILO, 1998 Sequential activation of the EGF receptor pathway during Drosophila oogenesis establishes the dorsoventral axis. Development 125: 191–200.[Abstract]
SCHNEIDER, G., A. WEBER, U. ZECHNER, F. OSWALD, H. M. FRIESS et al., 2006 GADD45a is highly expressed in pancreatic ductal adenocarcinoma cells and required for tumor cell viability. Int. J. Cancer 118: 2405–2411.[CrossRef][Medline]
SCHÜPBACH, T., 1987 Germ line and soma cooperate during oogenesis to establish the dorsoventral pattern of egg shell and embryo in Drosophila melanogaster. Cell 49(5): 699–707.[CrossRef][Medline]
SCHÜPBACH, T., and S. ROTH, 1994 Dorsoventral patterning in Drosophila oogenesis. Curr. Opin. Genet. Dev. 4(4): 502–507.[CrossRef][Medline]
SHEIKH, M. S., M. C. HOLLANDER and A. J. FORNACE, JR., 2000 Role of Gadd45 in Apoptosis. Biochem. Pharmacol. 59: 43–45.[CrossRef][Medline]
SPRADLING, A. C., 1986 P element-mediated transformation, pp. 175–197 in Drosophila—A Practical Approach, edited by D. B. ROBERTS. IRL, Oxford.
STEINHAUER, J., and D. KALDERON, 2005 The RNA-binding protein Squid is required for the establishment of anteroposterior polarity in the Drosophila oocyte. Development 132(24): 5515–5525.
SUZANNE, M., I. KENJI, G. BRUNO, A. FRANCOIS, M. EIJI et al., 1999 The Drosophila p38 MAPK pathway is required during oogenesis for egg asymmetric development. Genes Dev. 13: 1464–1474.
SUZANNE, M., N. PERRIMON and S. NOSELLI, 2001 The Drosophila JNK pathway controls the morphogenesis of the egg dorsal appendages and micropyle. Dev. Biol. 237: 282–294.[CrossRef][Medline]
TAKEKAWA, M., and H. SAITO, 1998 A family of stress-inducible GADD45-like proteins mediate activation of the stress-responsive MTK1/MEKK4 MAPKKK. Cell 95: 521–530.[CrossRef][Medline]
TERASHIMA, J., and M. A. BOWNES, 2005 A microarray analysis of genes involved in relating egg production to nutritional intake in Drosophila melanogaster. Cell Death Differ. 12(5): 429–440.[CrossRef][Medline]
TONG, T., J. JI, S. JIN, X. LI, W. FAN et al., 2005 Gadd45a expression induces Bim dissociation from the cytoskeleton and translocation to mitochondria. Mol. Cell. Biol. 25(11): 4488–4500.
TZOU, P., E. DE GREGORIO and B. LEMAITRE, 2002 How Drosophila combats microbial infection: a model to study innate immunity and host–pathogen interactions. Curr. Opin. Microbiol. 5: 102–110.[CrossRef][Medline]
VAIRAPANDI, M., A. G. BALLIET, B. HOFFMAN and D. A. LIEBERMANN, 2002 GADD45b and GADD45g Are cdc2/CyclinB1 kinase inhibitors with a role in S and G2/M cell cycle checkpoints induced by genotoxic stress. J. Cell. Physiol. 192: 327–338.[CrossRef][Medline]
VAN DOREN, M., A. L. WILLIAMSON and R. LEHMANN, 1998 Regulation of zygotic gene expression in Drosophila primordial germ cells. Curr. Biol. 8: 243–246.[CrossRef][Medline]
ZHAN, Q., M. J. ANTINORE, X. W. WANG, F. CARRIER, M. L. SMITH et al., 1999 Association with Cdc2 and inhibition of Cdc2/Cyclin B1 kinase activity by the p53-regulated protein Gadd45. Oncogene 18: 2892–2900.[CrossRef][Medline]
ZHANG, W., B. HOFFMAN and D. A. LIEBERMANN, 2001 Ectopic expression of MyD118/Gadd45/CR6 (Gadd45beta/alpha/gamma) sensitizes neoplastic cells to genotoxic stress-induced apoptosis. Int. J. Oncol. 18: 749–757.[Medline]
Communicating editor: T. C. KAUFMAN
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Peretz, G.
- Articles by Abdu, U.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Peretz, G.
- Articles by Abdu, U.






