| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Genetics, Vol. 177, 773-784, October 2007, Copyright © 2007
doi:10.1534/genetics.107.073205
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Microbiology and Molecular Genetics, University of Texas Health Science Center, Houston, Texas 77030
1 Corresponding author: University of Texas Health Science Center, 6431 Fannin, MSB 1.212, Houston, TX 77030.
E-mail: ambro.van.hoof{at}uth.tmc.edu
 |
ABSTRACT |
|---|
 TOP ABSTRACT MATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
Studies using the budding yeast Saccharomyces cerevisiae as a model system have identified two general pathways that degrade mRNAs. These two pathways are conserved in most, if not all, eukaryotes. Normally, the major deadenylase, Ccr4p, gradually removes the poly(A) tail and initiates mRNA degradation (SHYU et al. 1991; MUHLRAD and PARKER 1992; TUCKER et al. 2001). This triggers two deadenylation-dependent decay pathways. One pathway involves removal of the 5'-cap (decapping) by Dcp1p and Dcp2p (DECKER and PARKER 1993; HSU and STEVENS 1993; MUHLRAD et al. 1995; BEELMAN et al. 1996; DUNCKLEY and PARKER 1999; STEIGER et al. 2003). Decapping the transcript allows its degradation from the 5'-end by Xrn1p, a 5'–3' exoribonuclease (LARIMER et al. 1992; HSU and STEVENS 1993; MUHLRAD and PARKER 1994). In the second pathway, the transcript body is degraded from the 3'-end by a 3'–5' exoribonuclease complex: the exosome (MUHLRAD et al. 1995; JACOBS ANDERSON and PARKER 1998). Although all mRNAs appear to be degraded by these two pathways, the rate at which individual steps occur can vary widely depending on the mRNA. However, it is currently not known which mechanisms target this basal degradation machinery preferentially to some mRNAs.
In addition to affecting the expression of normal cellular genes, mRNA turnover also is important as a quality control mechanism to maintain the overall fidelity of gene expression. Eukaryotes have evolved intricate mechanisms for gene expression. These intricacies introduce not only potential points of gene regulation, but also potential errors in the form of aberrant mRNAs. While many mechanisms exist to ensure high fidelity of gene expression, errors can occur that lead to aberrant mRNAs. Hence, specialized mRNA turnover pathways, termed mRNA surveillance, degrade these aberrant mRNAs. mRNA surveillance prevents accumulation of aberrant, dominant-negative, or truncated proteins that may cause harmful effects (PULAK and ANDERSON 1993).
Interestingly, the same enzymes degrade normal and aberrant transcripts. Transcripts containing premature stop codons, retained introns, or extended 3'-UTRs are all targets for the nonsense-mediated decay pathway (ZARET and SHERMAN 1984; HE et al. 1993; MUHLRAD and PARKER 1994, 1999). Rapid degradation of nonsense transcripts bypasses deadenylation and instead triggers rapid decapping (MUHLRAD and PARKER 1994). Similarly, the exosome, independently of prior deadenylation, degrades transcripts that lack all in-frame termination codons, i.e., nonstop transcripts (FRISCHMEYER et al. 2002; VAN HOOF et al. 2002). Thus, understanding the molecular mechanisms that are responsible for the rapid decay of aberrant transcripts may provide insight into how the mRNA decay machinery targets some mRNAs preferentially.
Nonstop mRNAs arise in various ways. One source is premature polyadenylation due to inaccurate 3'-end processing events or cryptic polyadenylation signals within the coding region of the transcript (MAYER and DIECKMANN 1991; SPARKS and DIECKMANN 1998; FRISCHMEYER et al. 2002). Mutations or errors in transcription that cause a change in the normal stop codon are other mechanisms that produce nonstop transcripts.
It is estimated that 
30% of all human disease alleles generate a nonsense transcript (FRISCHMEYER and DIETZ 1999). While alleles encoding nonstop transcripts have not been studied in similar detail, generation of a nonstop transcript can indeed result in disease. Mutation of the stop codon in the human adenine phosphoribosyltransferase (APRT) gene leads to 2,8-dihydroxyadenine urolithiasis (TANIGUCHI et al. 1998). Similarly, mutation in the normal stop codon of a G-protein-coupled receptor gene that regulates puberty (GPR54) causes hypogonadotrophic hypogonadism and sterility in affected individuals (SEMINARA et al. 2003). In both cases, the nonstop mutation leads to reduced levels of the nonstop mRNA and the encoded protein. Importantly, in hypogonadotrophic hypogonadism, overexpression of the nonstop GPR54 transcript can produce a functional protein. This observation suggests that partial inhibition of the nonstop mRNA decay machinery in these patients may prove to be beneficial.
In the current model for nonstop mRNA decay, the ribosome continues translation to the end of the poly(A) tail of nonstop transcripts (VAN HOOF et al. 2002). Upon reaching the end of the transcript, the ribosome stalls. This stalled ribosome is thought to be recognized by the C-terminal domain of the Ski7p. This hypothesis is based on the similarity of this domain to eEF1A and eRF3, which are known to interact with the ribosome during translation elongation and termination, respectively (BENARD et al. 1999; VAN HOOF et al. 2002). Consistent with this hypothesis, this C-terminal domain is necessary for nonstop mRNA decay, but not for other exosome functions (VAN HOOF et al. 2002). In contrast, the N-terminal domain of Ski7p physically interacts not only with the exosome, but also with a complex of Ski2p, Ski3p, and Ski8p (ARAKI et al. 2001). This interaction is thought to recruit the exosome to the nonstop mRNA–ribosome complex, resulting in degradation of the nonstop mRNA (VAN HOOF et al. 2002).
Recently, it has been shown that proteins encoded by several nonstop reporters fail to accumulate, which cannot be fully explained by nonstop mRNA degradation (INADA and AIBA 2005; ITO-HARASHIMA et al. 2007). This suggests that additional mechanisms exist by which nonstop mRNAs are downregulated. To address the possibility that there may be additional factors required for exosome-mediated nonstop mRNA degradation and to identify factors required for any other aspects of nonstop mRNA metabolism, we used a genomic screen in S. cerevisiae. Here, we show that, in addition to the Ski7p, Ski2p, Ski3p, Ski8p, and the exosome, there are indeed additional trans-acting factors that are required for the efficient recognition or degradation of nonstop mRNA transcripts. Additionally, we provide evidence that the proteasome degrades the translated nonstop protein, which may explain why the nonstop protein fails to accumulate.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
Transformation and mutant screen:
To identify additional trans-acting factors in nonstop mRNA metabolism, we obtained the yeast deletion collection from Open Biosystems and transformed each individual strain with pAV188. Transformation was carried out by a modified version of a previously described protocol (GIETZ and WOODS 2002). Briefly, cells were grown on a YPD plate and transferred to a 96-well plate containing 10 µg of carrier DNA and 0.5 µg of pAV188 in a total volume of 10 µl. Next, 150 µl of PLATE solution was added (40% PEG 3350, 0.1 M lithium acetate, 10 mM TRIS–HCl, pH 8.0, 1 mM EDTA) and the plate was vortexed and incubated at room temperature (1 hr to overnight). Cells were heat-shocked for 15 min at 42°, pelleted, resuspended in 10 µl water, spotted on SC–URA, and incubated for 5 days at 30° to select for transformants. Transformants were then replica plated onto SC–HIS and incubated for 3 days at 30° to identify genes that suppress the his3-nonstop phenotype. Most strains yielded URA+ transformants on the first attempt. For those strains where the first transformation failed, a second attempt to transform was made. Overall, 99% of strains were successfully transformed.
|
Serial dilutions were done by growing liquid cultures of transformants in SC–URA overnight at 30°. The following day, cells were diluted in SC–URA to a starting OD of 0.2. Cultures were grown until they reached an OD of 0.8. Cells were serially diluted in 96-well plates by a factor of 5 and spotted onto SC–HIS. These plates were then incubated for 3 days at 30° to qualitatively assay growth relative to wild-type and ski7
mutants. These experiments were repeated in triplicate.
Confirmation that the His+ phenotype is linked to the deletion:
To ensure that the suppression of his3-nonstop was indeed caused by the annotated deletion, we PCR amplified the disrupted gene from the knockout strain, using primers 500 nt on either side of the open reading frame (ORF) (primer sequences available upon request). The resulting PCR products were used to knock out the genes in BY4741. Although similar analysis on >30 strains indicated that the right gene had indeed been deleted, we identified two strains that were mislabeled in the collection obtained from Open Biosystems. The two knockouts that were mislabeled were identified by PCR amplifying and sequencing of the "molecular barcodes" included in the knockout cassettes. We also identified three cases in which the his3-nonstop suppression was not recreated, presumably because the phenotype of the knockout strain was caused by an unlinked mutation.
Stability of Protein A-nonstop mRNA:
To determine the half-life of the Protein A-nonstop mRNA reporter, each strain was transformed with pAV184. Transformants were grown overnight in 20 ml of SC–URA+2% galactose to induce expression of the Protein A-nonstop reporter. The following day, strains were diluted in 50 ml of SC–URA+2% galactose to a starting OD of 0.2 and grown to a final OD of 0.8. Cells were then pelleted and resuspended in 20 ml of SC–URA (no sugar). A 2-ml sample from each strain was taken and pelleted and stored immediately on dry ice. The remaining liquid culture was incubated on a shaker at 30°. A total of 2 ml of 40% dextrose was added to each strain and 2-ml samples were taken (as above) at the 1-, 2-, 3-, 4-, 6-, 8-, 10-, 15-, 30-, and 60-min time points. Next, RNA was isolated from each sample and Northern blot analysis was performed.
Stability of Protein A-nonstop protein:
To determine the half-life of the Protein A-nonstop protein, wild-type (yAV670) and proteasome-defective (pre9, yAV720) yeast strains transformed with pAV184 were grown to midlog phase in media containing galactose. At this point, transcription and translation were terminated by replacement with media containing 4% glucose and 100 µg/ml cycloheximide, respectively. Aliquots were taken at the times indicated and total protein was isolated. Western blot analysis was performed with antibodies specific for Protein A (Sigma, St. Louis) and Pgk1p (Molecular Probes, Eugene, OR). Signals were detected by chemiluminescence (Amersham, Piscataway, NJ), scanned using a Phosphoimager (Amersham), and quantitated using ImageQuant software.
Creation of the ski7 pre9 and ipk1 ipk2 double mutant:
yAV987 (ski7::HygMX4) (Table 1) and yAV1052 (ipk1::HygMX4) were created as previously described (GOLDSTEIN and MCCUSKER 1999). yAV720 (pre9::KanMX4) was mated with yAV987, and yAV1054 (ipk2::KanMX4) was mated with yAV1052. Haploid progeny spores were obtained by the hydrophobic spore isolation method essentially as described (ROCKMILL et al. 1991) and plated on YPD. Double-mutant strains were identified by replica plating on YPD+geneticin and YPD+hygromycin.
Creation of dcp2-7ts double mutants:
Although DCP2 is annotated as an essential gene (http://www.yeastgenome.org), this annotation is incorrect. This conclusion is based on our unpublished observation that the heterozygous diploid dcp2 strain 22958 (Open Biosystems) gives two wild-type and two very slow-growing dcp2 spores per tetrad. To introduce the dcp2-7ts temperature-sensitive allele into the same genetic background as the knockout collection, strain 22958 was transformed with pRP989 (DUNCKLEY and PARKER 2001). The resulting URA+ geneticin-sensitive strain was sporulated to yield yAV747 (Table 1). Strain yAV747 was crossed with Y3656 (TONG et al. 2001) to give yAV760.
To create yeast deletions strains that also contained a temperature-sensitive mutation in the decapping machinery, we mated the yeast deletion strains with strain yAV760. Haploid progeny spores were obtained by the hydrophobic spore isolation method essentially as described by ROCKMILL et al. (1991) and plated on CSM –Arg –Ura –His plus canavanine at 23° to select for MATa dcp2-7ts progeny. MATa dcp2-7ts progeny were then replica plated to YPD+geneticin to identify progeny that also contained the deletion of interest.
To determine whether the strains that we identified in our screen control exosome function, strains that were dcp2-7ts and deleted for an ORF of interest were grown in YPD overnight at 23°. The following day, cells were diluted to an OD of 0.2 and grown to an OD of 0.8. Cells were then serially diluted in 96-well plates by a factor of 5 and spotted onto YPD media plates and grown for 3 days at 23°, 30°, and 37°. These experiments were done in triplicate.
Other methods:
Western and Northern blotting were done according to standard methods. Western blots were probed with an antibody against Protein A (Sigma) or the loading control Pgk1p (molecular probes). Northern blots were probed for Protein A using oligo oAV72 (tctactttcggcgcctgagcatcattt) and for the 7S RNA subunit of the signal recognition particle using oRP100 (gtctagccgcgaggaagg).
|
RESULTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
mutant containing the same his3-nonstop allele is no longer auxotrophic for histidine, presumably because the his3-nonstop mRNA is stabilized and produces enough His3p for histidine biosynthesis (VAN HOOF et al. 2002). With this knowledge, and to expand our understanding of nonstop mRNA decay, a genetic screen utilizing a deletion collection of almost 5000 nonessential open reading frames in S. cerevisiae was used to identify additional genes involved in the nonstop mRNA decay pathway. These strains contained null mutations in the URA3 and HIS3 genes and a complete deletion in a nonessential open reading frame. Each strain from the collection was individually transformed with a plasmid containing a selectable URA3 gene and a his3-nonstop reporter. Transformants were selected by growth in the absence of uracil and replica plated onto media lacking histidine. Potential genes involved in nonstop mRNA decay were identified on the basis of the ability of the mutant to grow on media lacking histidine. To eliminate false positives, we restreaked each strain on media lacking uracil and selected single colonies. These strains were placed in 96-well plates with fivefold serial dilutions and plated onto media lacking histidine or uracil. The transformation was then repeated using a high-efficiency transformation protocol to eliminate additional false positives. This screen yielded a number of mutants that reproducibly suppressed the his3-nonstop phenotype to varying extents. Here, we concentrated on the mutants that increased his3-nonstop expression approximately as much as a ski7 mutant. In addition to these, we isolated several mutants that showed small increases in growth, but grew significantly slower than the ski7 control (data not shown).
The his3-nonstop suppression phenotype is tightly linked to the deletion:
During creation and maintenance of the deletion collection, some strains may have been mislabeled or may have accumulated unlinked mutations (e.g., HUGHES et al. 2000). Therefore, to ensure that the observed his3-nonstop suppression phenotype was indeed caused by the deletion, we recreated each of the newly identified mutants in the wild-type strain BY4741. As controls, we included the ski3, ski7, and ski8 mutants. Indeed, this analysis identified two strains that were mislabeled in the knockout collection and three strains where the original his3-nonstop suppression phenotype was not tightly linked to the deletion. Presumably, these latter three strains from the collection contain an unlinked mutation that suppressed the his3-nonstop phenotype. However, for 15 genes that were initially identified in our screen, the his3-nonstop suppression phenotype was indeed linked to their deletion mutants (Figure 1 and Table 2).
|
|
controls (Figure 2). This experiment showed that deletion of 11 of the 15 mutants tested also increased the abundance of our Protein A-nonstop mRNA (Figure 2 and data not shown). Importantly, these data showed that suppression in these 11 strains was not specific to the his3-nonstop reporter, but was most likely due to a general defect in the nonstop mRNA decay pathway.
|
To further characterize the effects of the PRE9, UMP1, and YMR247C genes on protein levels encoded from nonstop reporter transcripts, we examined the levels of Protein A-nonstop protein. Interestingly, far more Protein A-nonstop protein was present in extracts made from the pre9, ump1, and ymr247c mutants compared to extracts from wild-type cells (Figure 3). This occurred despite the relatively low nonstop mRNA levels in these mutants. Therefore, mutations affecting proteasome function most likely suppressed the his3-nonstop phenotype because they stabilize the His3-nonstop protein.
|
|
suppressed the his3-nonstop phenotype by inactivating the cytoplasmic exosome and stabilizing the nonstop mRNA, and pre9 suppressed his3-nonstop phenotype by inactivating the proteasome and stabilizing the nonstop protein, a pre9 ski7 double mutant might exhibit an additive effect on the suppression phenotype. This was indeed the case since the ski7 pre9 double mutant grew better in the absence of histidine than either the ski7 or pre9 single mutants when all contained the his3-nonstop reporter (Figure 5A). We also noted that the ski7 pre9 double mutant grew slower in the presence of histidine than either single mutant. This genetic interaction was consistent with the hypothesis that SKI7 and PRE9 genes may act in pathways that are functionally related. In addition, Northern and Western blot analysis of the ski7 pre9 double mutant showed that while Protein A-nonstop mRNA levels are not significantly increased, it accumulated more Protein A-nonstop protein than either single mutant alone (Figure 5, B and C). We conclude that ski7 and pre9 suppressed the his3-nonstop phenotype by independent mechanisms (see DISCUSSION).
|
We directly measured Protein A-nonstop mRNA decay rates to distinguish between increased transcription and increased mRNA stability in all mutants that did not implicate proteasome function. In this experiment, mRNA was isolated at various time points after transcription of the Protein A-nonstop reporter was repressed by the addition of glucose and the half-life of the transcript was determined by Northern blot analysis. These measurements were repeated three or four times and the average is plotted in Figure 6. As expected, the decay rate of Protein A-nonstop mRNA was about threefold slower in ski3, ski7, and ski8 strains than in wild-type cells. Interestingly, the eight other mutants isolated in our genomic screen also increased the stability of the Protein A-nonstop mRNA, although to a lesser extend than the ski deletions. The largest increase in Protein A-nonstop half-life (approximately twofold) was observed for the deletion of yLR021w, an uncharacterized open reading frame of unknown function. These data are consistent with the hypothesis that the deletions that we identified indeed increased the half-life of nonstop reporter mRNAs rather than increased transcription.
|
|
. The IPK1 gene encodes the enzyme inositol 1,3,4,5,6-pentakisphosphate 2-kinase that produces inositol 1,2,3,4,5,6-hexakisphosphate (IP6) from inositol 1,3,4,5,6-pentakisphosphate (IP5) (YORK et al. 1999). IP6 has known roles in regulating RNA metabolism. Yeast mutants lacking IP6 accumulate poly(A)+ RNAs in the nucleus and have defects in tRNA modification (YORK et al. 1999; MACBETH et al. 2005). To investigate whether the role of Ipk1p in his3-nonstop suppression was related to these previously known functions of Ipk1p, we analyzed other mutants lacking IP6. IP6 production is a four-step metabolic pathway (Figure 8A) that also requires phospholipase C (Plc1p) and Ipk2p. Strikingly, plc1 and ipk2 mutations were not identified in our genomic screen and, upon direct testing, had no effect on his3-nonstop expression. In contrast, all other known defects of ipk1 mutants are shared with ipk2 and plc1. Thus, the effect of ipk1 on his3-nonstop expression is not due to a lack of IP6.
|
affects his3-nonstop expression is that the mutant accumulates IP5, which may inhibit nonstop mRNA decay (YORK et al. 1999). This hypothesis predicts that Ipk1p can no longer affect his3-nonstop expression if IP5 accumulation is prevented by a mutation in IPK2. A third possibility is that Ipk1p is a bifunctional protein with completely separate roles in IP6 production and his3-nonstop suppression. Under this hypothesis, we predict that Ipk1p can still affect his3-nonstop expression in an ipk2 strain. To distinguish between these latter two possibilities, we tested suppression of the his3-nonstop phenotype in an ipk1 ipk2 double mutant (Figure 8). We observed that the double mutant does not suppress the his3-nonstop phenotype. Therefore, these results suggest that the suppression phenotype that we observed in an ipk1 strain is a result of the accumulation of IP5 and not a second, unrelated function of Ipk1p. To our knowledge, this is the first result that implicates IP5 as a regulatory molecule.
Some mutations affect nonstop mRNA decay without affecting other cytoplasmic exosome functions:
Mutations such as a ski7 that inactivate the cytoplasmic exosome stabilize nonstop mRNAs (VAN HOOF et al. 2002). Thus, at least two classes of mutants might be expected in our screen. One class would have defects in cytoplasmic exosome function (e.g., ski7), while a second class of mutants might have specific defects in the recognition of nonstop mRNAs (e.g., ski7C; VAN HOOF et al. 2002). Mutations disrupting cytoplasmic exosome function exhibit synthetic lethality with decapping defects, while nonstop mRNA recognition mutants would not be expected to exhibit a genetic interaction with decapping defects (JOHNSON and KOLODNER 1995; JACOBS ANDERSON and PARKER 1998; VAN HOOF et al. 2002). We therefore tested whether the new mutants that we identified were synthetically lethal with a decapping defect.
Each of the mutants was crossed with a temperature-sensitive decapping mutant (dcp2-7ts), and double mutants were isolated. At 37°, the dcp2-7ts allele inactivates the decapping enzyme and thereby inactivates the 5'–3' mRNA degradation pathway. Importantly, dcp2-7ts strains are still able to grow at 37°, because the alternative 3'–5' decay pathway is intact and sufficient for viability. However, when the dcp2-7ts allele is combined with a mutation inactivating the 3'–5' decay pathway, both pathways are nonfunctional at 37°, and therefore such a strain cannot grow at 37°. Thus, an inability to grow at the nonpermissive temperature (37°) would suggest that the gene is required for general exosome-mediated decay of mRNAs. Strikingly, most of the genes that we identified in our genetic screen did not have growth defects at the nonpermissive temperature when combined with the decapping mutant (data not shown). This observation suggests that these genes are not required for general cytoplasmic exosome activity.
Although most of the genes tested did not show a synthetic lethal interaction with dcp2-7ts, three deletions did significantly reduce growth of the dcp2-7ts strain and thus may disrupt the activity of the exosome (i.e., nup2, htz1, and ylr021w). As shown in Figure 9, at the nonpermissive temperature, these cells were either synthetically sick or lethal when combined with the decapping mutation. One explanation for these findings is that their function is not limited to nonstop mRNA decay, but that they have a more general function in cytoplasmic exosome function. To more directly determine whether NUP2, HTZ1, and YLR021W genes function in exosome-mediated decay of all mRNAs, we assayed their effects on stability of the GAL7 and GAL10 mRNAs. We grew the dcp2-7ts double mutants in YEP+galactose to induce expression of the GAL7 and GAL10 mRNAs. We then incubated the cells at 37° for 1 hr to inactivate the decapping enzyme and then added glucose to shut off transcription of the GAL7 and GAL10 mRNAs. Under these conditions, cytoplasmic mRNA decay is solely carried out by the exosome (JACOBS ANDERSON and PARKER 1998). As expected, the GAL7 and GAL10 mRNAs were stabilized in the ski7 dcp2-7 double mutant, when compared to the dcp2-7 single mutant (Figure 9B). The nup2, htz1, and ylr021w mutants did not have this same effect, suggesting that these three genes were not required for exosome-mediated decay of the GAL7 and GAL10 mRNAs. However, the ylr021w mutant appeared to have a minor defect in that the GAL7 mRNA decayed with biphasic kinetics. Approximately half of the GAL7 mRNA decayed with normal kinetics (half-life of 8 min), while the other half was stabilized (half-life >20 min). While the significance of this biphasic decay is not understood, we conclude that these three genes are not required for all functions of the cytoplasmic exosome. Overall, analysis of dcp2-7ts double mutants suggests that we have identified a number of proteins that are required for exosome-mediated decay of his3-nonstop mRNA and Protein A-nonstop mRNA, but not for all exosome-mediated mRNA decay.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
The one possible exception to the observation that the newly identified genes do not affect other exosome functions may be yLR021w. Unlike most of the newly identified genes, ylr021w is synthetically lethal with decapping defects and has a small effect on the degradation of GAL7 mRNA. ylr021w also had the largest effect on Protein A-nonstop mRNA stability and thus may encode a regulator of the cytoplasmic exosome. The function of yLR021w is completely uncharacterized; the protein encoded by yLR021w is not similar to any protein with a known function.
Our results suggest a role for genes encoding functions for the eukaryotic proteasome in nonstop mRNA surveillance. The proteasome was implicated three times in our genetic screen, which strongly suggests that it may be involved in degrading the his3-nonstop protein. The PRE9 gene encodes a subunit of the 20S proteasome and is the only nonessential proteasome gene (EMORI et al. 1991; GIAEVER et al. 2002). The UMP1 gene encodes a chaperone required for 20S proteasome assembly (RAMOS et al. 1998). The YMR247C ORF encodes a protein that copurifies with the proteasome and has very recently been identified as a RING domain containing ubiquitin-conjugating enzyme (VERMA et al. 2000; BRAUN et al. 2007). Deletions in these genes do not cause increased abundance of nonstop transcripts but instead cause increased levels of the nonstop protein product. Consistent with our conclusion that the his3-nonstop protein is normally degraded by the proteasome, ITO-HARASHIMA et al. 2007 very recently published that addition of eight or more lysine residues could target His3p to proteasome-mediated degradation and that this proteolysis contributes to the reduced expression of nonstop reporter genes.
In Eubacteria, the signal that identifies a transcript as nonstop is thought to arise from the stalled ribosome (KEILER et al. 1996; UEDA et al. 2002). When this occurs, an RNP composed of tmRNA and SmpB recognizes the stalled ribosome and this recognition adds a C-terminal peptide tag to the protein encoded by the nonstop mRNA (KEILER et al. 1996; KARZAI et al. 1999; HALLIER et al. 2004). The addition of this tag targets the protein encoded by the nonstop mRNA for rapid proteolysis. Our identification of three mutants that implicate the proteasome in the degradation of the his3-nonstop and Protein A-nonstop proteins suggests the possibility that eukaryotes may also actively recognize and degrade proteins encoded by nonstop mRNAs. There are several ways in which the proteins encoded by the his3-nonstop and Protein A-nonstop mRNAs might be targeted to the proteasome. Analogous to the prokaryotic system, the stalled ribosome at the end of an mRNA could target the encoded protein for degradation. However, two lines of evidence do not support this idea. First, Ski7p most likely plays a central role in recognizing the stalled ribosome, and analysis of a ski7 pre9 double mutant clearly shows that even in the absence of the Ski7p, the his3-nonstop and Protein A-nonstop proteins are still targeted to the proteasome (Figure 5C). Second, direct measurement of Protein A-nonstop protein stability indicates that Pre9p acts post-translationally, rather than cotranslationally (Figure 4). Future experiments are required to understand the physiological significance of the proteasome in degrading proteins encoded by nonstop mRNAs.
Another unexpected finding in our genetic screen is the identification of the IPK1 gene, which is involved in cellular signaling and nuclear transport. The IPK1 gene encodes the enzyme inositol 1,3,4,5,6-pentakisphosphate 2-kinase that produces IP6 from IP5. (YORK et al. 1999). Analysis of other mutants in the IP6 pathway implicated IP5 as an inhibitor of his3-nonstop expression. Most importantly, when IP5 production in the ipk1 strain was inhibited by also deleting IPK2, the his3-nonstop suppression was reversed. To our knowledge, this is the only known role of IP5. In contrast, IP6 has been implicated in several aspects of RNA metabolism: ipk1, ipk2, and plc1 mutants accumulate polyadenylated RNA in the nucleus, and thus IP6 may have a role in nuclear export of poly(A)+ mRNAs (YORK et al. 1999). Interestingly, exosome mutants also accumulate polyadenylated RNA in the nucleus, suggesting the possibility that both IP5 and IP6 regulate diverse exosome functions. In addition, IP6 is an important component of adenine deaminases that act on mRNA and tRNA (ADARs and ADATs, respectively), and mutants lacking IP6 have defects in tRNA modification (MACBETH et al. 2005). Overall, these results suggest that phosphoinositides might regulate diverse aspects of RNA processing and degradation.
|
ACKNOWLEDGEMENTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
|
LITERATURE CITED |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
ARAKI, Y., S. TAKAHASHI, T. KOBAYASHI, H. KAJIHO, S. HOSHINO et al., 2001 Ski7p G protein interacts with the exosome and the Ski complex for 3'- to 5'- mRNA decay in yeast. EMBO J. 20: 4684–4693.[CrossRef][Medline]
BEELMAN, C. A., A. STEVENS, G. CAPONIGRO, T. E. LAGRANDEUR, L. HATFIELD et al., 1996 An essential component of the decapping enzyme required for normal rates of mRNA turnover. Nature 382: 642–646.[CrossRef][Medline]
BENARD, L., K. CARROLL, R. C. VALLE, D. C. MASISON and R. B. WICKNER, 1999 The ski7 antiviral protein is an EF1-alpha homolog that blocks expression of non-Poly(A) mRNA in Saccharomyces cerevisiae. J. Virol. 73: 2893–2900.
BRAUN, M. A., P. J. COSTA, E. M. CRISUCCI and K. M. ARNDT, 2007 Identification of Rkr1, a nuclear RING domain protein with functional connections to chromatin modification in Saccharomyces cerevisiae. Mol. Cell. Biol. 27: 2800–2811.
DECKER, C. J., and R. PARKER, 1993 A turnover pathway for both stable and unstable mRNAs in yeast: evidence for a requirement for deadenylation. Genes Dev. 7: 1632–1643.
DUNCKLEY, T., and R. PARKER, 1999 The DCP2 protein is required for mRNA decapping in Saccharomyces cerevisiae and contains a functional MutT motif. EMBO J. 18: 5411–5422.[CrossRef][Medline]
DUNCKLEY, T., and R. PARKER, 2001 Yeast mRNA decapping enzyme. Methods Enzymol. 342: 226–233.[Medline]
EMORI, Y., T. TSUKAHARA, H. KAWASAKI, S. ISHIURA, H. SUGITA et al., 1991 Molecular cloning and functional analysis of three subunits of yeast proteasome. Mol. Cell. Biol. 11: 344–353.
FLANAGAN, P. M., R. J. KELLEHER, III, M. H. SAYRE, H. TSCHOCHNER and R. D. KORNBERG, 1991 A mediator required for activation of RNA polymerase II transcription in vitro. Nature 350: 436–438.[CrossRef][Medline]
FRISCHMEYER, P. A., and H. C. DIETZ, 1999 Nonsense-mediated mRNA decay in health and disease. Hum. Mol. Genet. 8: 1893–1900.
FRISCHMEYER, P. A., A. VAN HOOF, K. O'DONNELL, A. L. GUERRERIO, R. PARKER et al., 2002 An mRNA surveillance mechanism that eliminates transcripts lacking termination codons. Science 295: 2258–2261.
GIAEVER, G., A. M. CHU, L. NI, C. CONNELLY, L. RILES et al., 2002 Functional profiling of the Saccharomyces cerevisiae genome. Nature 418: 387–391.[CrossRef][Medline]
GIETZ, R. D., and R. A. WOODS, 2002 Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method. Methods Enzymol. 350: 87–96.[CrossRef][Medline]
GOLDSTEIN, A. L., and J. H. MCCUSKER, 1999 Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast 15: 1541–1553.[CrossRef][Medline]
HALLIER, M., N. IVANOVA, A. RAMETTI, M. PAVLOV, M. EHRENBERG et al., 2004 Pre-binding of small protein B to a stalled ribosome triggers trans-translation. J. Biol. Chem. 279: 25978–25985.
HE, F., S. W. PELTZ, J. L. DONAHUE, M. ROSBASH and A. JACOBSON, 1993 Stabilization and ribosome association of unspliced pre-mRNAs in a yeast upf1- mutant. Proc. Natl. Acad. Sci. USA 90: 7034–7038.
HSU, C. L., and A. STEVENS, 1993 Yeast cells lacking 5'
3' exoribonuclease 1 contain mRNA species that are poly(A) deficient and partially lack the 5' cap structure. Mol. Cell. Biol. 13: 4826–4835.
HUGHES, T. R., C. J. ROBERTS, H. DAI, A. R. JONES, M. R. MEYER et al., 2000 Widespread aneuploidy revealed by DNA microarray expression profiling. Nat. Genet. 25: 333–337.[CrossRef][Medline]
HUH, W. K., J. V. FALVO, L. C. GERKE, A. S. CARROLL, R. W. HOWSON et al., 2003 Global analysis of protein localization in budding yeast. Nature 425: 686–691.[CrossRef][Medline]
INADA, T., and H. AIBA, 2005 Translation of aberrant mRNAs lacking a termination codon or with a shortened 3'-UTR is repressed after initiation in yeast. EMBO J. 24: 1584–1595.[CrossRef][Medline]
ITO-HARASHIMA, S., K. KUROHA, T. TATEMATSU and T. INADA, 2007 Tanslation of the poly(A) tail plays crucial roles in nonstop mRNA surveillance via translation repression and protein destabilization by proteasome in yeast. Genes Dev. 21: 519–524.
JACOBS ANDERSON, J. S., and R. PARKER, 1998 The 3' to 5' degradation of yeast mRNAs is a general mechanism for mRNA turnover that requires the SKI2 DEVH box protein and 3' to 5' exonucleases of the exosome complex. EMBO J. 17: 1497–1506.[CrossRef][Medline]
JOHNSON, A. W., and R. D. KOLODNER, 1995 Synthetic lethality of sep1 (xrn1) ski2 and sep1 (xrn1) ski3 mutants of Saccharomyces cerevisiae is independent of killer virus and suggests a general role for these genes in translation control. Mol. Cell. Biol. 15: 2719–2727.[Abstract]
KARZAI, A. W., M. M. SUSSKIND and R. T. SAUER, 1999 SmpB, a unique RNA-binding protein essential for the peptide-tagging activity of SsrA (tmRNA). EMBO J. 18: 3793–3799.[CrossRef][Medline]
KEILER, K. C., P. R. WALLER and R. T. SAUER, 1996 Role of a peptide tagging system in degradation of proteins synthesized from damaged messenger RNA. Science 271: 990–993.[Abstract]
KELLEHER, R. J., III, P. M. FLANAGAN and R. D. KORNBERG, 1990 A novel mediator between activator proteins and the RNA polymerase II transcription apparatus. Cell 61: 1209–1215.[CrossRef][Medline]
LARIMER, F. W., C. L. HSU, M. K. MAUPIN and A. STEVENS, 1992 Characterization of the XRN1 gene encoding a 5'3' exoribonuclease: sequence data and analysis of disparate protein and mRNA levels of gene-disrupted yeast cells. Gene 120: 51–57.[CrossRef][Medline]
LIU, H. Y., Y. C. CHIANG, J. PAN, J. CHEN, C. SALVADORE et al., 2001 Characterization of CAF4 and CAF16 reveals a functional connection between the CCR4-NOT complex and a subset of SRB proteins of the RNA polymerase II holoenzyme. J. Biol. Chem. 276: 7541–7548.
LYDALL, D., and T. WEINERT, 1997 G2/M checkpoint genes of Saccharomyces cerevisiae: further evidence for roles in DNA replication and/or repair. Mol. Gen. Genet. 256: 638–651.[CrossRef][Medline]
MACBETH, M. R., H. L. SCHUBERT, A. P. VANDEMARK, A. T. LINGAM, C. P. HILL et al., 2005 Inositol hexakisphosphate is bound in the ADAR2 core and required for RNA editing. Science 309: 1534–1539.
MAYER, S. A., and C. L. DIECKMANN, 1991 Yeast CBP1 mRNA 3' end formation is regulated during the induction of mitochondrial function. Mol. Cell. Biol. 11: 813–821.
MUHLRAD, D., and R. PARKER, 1992 Mutations affecting stability and deadenylation of the yeast MFA2 transcript. Genes Dev. 6: 2100–2111.
MUHLRAD, D., and R. PARKER, 1994 Premature translational termination triggers mRNA decapping. Nature 370: 578–581.[CrossRef][Medline]
MUHLRAD, D., and R. PARKER, 1999 Recognition of yeast mRNAs as "nonsense containing" leads to both inhibition of mRNA translation and mRNA degradation: implications for the control of mRNA decapping. Mol. Biol. Cell 10: 3971–3978.
MUHLRAD, D., C. J. DECKER and R. PARKER, 1995 Turnover mechanisms of the stable yeast PGK1 mRNA. Mol. Cell. Biol. 15: 2145–2156.[Abstract]
PULAK, R., and P. ANDERSON, 1993 mRNA surveillance by the Caenorhabditis elegans smg genes. Genes Dev. 7: 1885–1897.
RAMOS, P. C., J. HOCKENDORFF, E. S. JOHNSON, A. VARSHAVSKY and R. J. DOHMEN, 1998 Ump1p is required for proper maturation of the 20S proteasome and becomes its substrate upon completion of the assembly. Cell 92: 489–499.[CrossRef][Medline]
ROCKMILL, B., E. J. LAMBIE and G. S. ROEDER, 1991 Spore enrichment. Methods Enzymol. 194: 146–149.[CrossRef][Medline]
SEMINARA, S. B., S. MESSAGER, E. E. CHATZIDAKI, R. R. THRESHER, J. S. ACIERNO, JR. et al., 2003 The GPR54 gene as a regulator of puberty. N. Engl. J. Med. 349: 1614–1627.
SHYU, A. B., J. G. BELASCO and M. E. GREENBERG, 1991 Two distinct destabilizing elements in the c-fos message trigger deadenylation as a first step in rapid mRNA decay. Genes Dev. 5: 221–231.
SIKORSKI, R. S., and P. HIETER, 1989 A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122: 19–27.
SPARKS, K. A., and C. L. DIECKMANN, 1998 Regulation of poly(A) site choice of several yeast mRNAs. Nucleic Acids Res. 26: 4676–4687.
STEIGER, M., A. CARR-SCHMID, D. C. SCHWARTZ, M. KILEDJIAN and R. PARKER, 2003 Analysis of recombinant yeast decapping enzyme. RNA 9: 231–237.
TANIGUCHI, A., M. HAKODA, H. YAMANAKA, C. TERAI, K. HIKIJI et al., 1998 A germline mutation abolishing the original stop codon of the human adenine phosphoribosyltransferase (APRT) gene leads to complete loss of the enzyme protein. Hum. Genet. 102: 197–202.[CrossRef][Medline]
THOMPSON, C. M., A. J. KOLESKE, D. M. CHAO and R. A. YOUNG, 1993 A multisubunit complex associated with the RNA polymerase II CTD and TATA-binding protein in yeast. Cell 73: 1361–1375.[CrossRef][Medline]
TONG, A. H., M. EVANGELISTA, A. B. PARSONS, H. XU, G. D. BADER et al., 2001 Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science 294: 2364–2368.
TUCKER, M., M. A. VALENCIA-SANCHEZ, R. R. STAPLES, J. CHEN, C. L. DENIS et al., 2001 The transcription factor associated Ccr4 and Caf1 proteins are components of the major cytoplasmic mRNA deadenylase in Saccharomyces cerevisiae. Cell 104: 377–386.[CrossRef][Medline]
UEDA, K., Y. YAMAMOTO, K. OGAWA, T. ABO, H. INOKUCHI et al., 2002 Bacterial SsrA system plays a role in coping with unwanted translational readthrough caused by suppressor tRNAs. Genes Cells 7: 509–519.[Abstract]
VAN HOOF, A., P. A. FRISCHMEYER, H. C. DIETZ and R. PARKER, 2002 Exosome-mediated recognition and degradation of mRNAs lacking a termination codon. Science 295: 2262–2264.
VERMA, R., S. CHEN, R. FELDMAN, D. SCHIELTZ, J. YATES et al., 2000 Proteasomal proteomics: identification of nucleotide-sensitive proteasome-interacting proteins by mass spectrometric analysis of affinity-purified proteasomes. Mol. Biol. Cell 11: 3425–3439.
YORK, J. D., A. R. ODOM, R. MURPHY, E. B. IVES and S. R. WENTE, 1999 A phospholipase C-dependent inositol polyphosphate kinase pathway required for efficient messenger RNA export. Science 285: 96–100.
ZARET, K. S., and F. SHERMAN, 1984 Mutationally altered 3' ends of yeast CYC1 mRNA affect transcript stability and translational efficiency. J. Mol. Biol. 177: 107–135.[CrossRef][Medline]
Communicating editor: S. GOTTESMAN
