| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Genetics, Vol. 176, 2139-2150, August 2007, Copyright © 2007
doi:10.1534/genetics.107.072835
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
* Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina 27710, Department of Biochemistry and Molecular Biology, Baylor College of Medicine, Houston, Texas 77030 and Department of Molecular Biology and Genetics, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21205
2 Corresponding author: Department of Molecular Genetics and Microbiology, Duke University Medical Center, 322 CARL Bldg., Box 3546, Research Dr., Durham, NC 27710.
E-mail: carde004{at}mc.duke.edu
 |
ABSTRACT |
|---|
 TOP ABSTRACT MATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
When yeast cells are grown in ample nutrient conditions, Tor activity promotes the expression of genes encoding tRNAs, ribosomal proteins, and rRNA, while inactivating genes required for utilization of poor nitrogen and carbon sources, and stress responses (ZARAGOZA et al. 1998; BECK and HALL 1999; CARDENAS et al. 1999; HARDWICK et al. 1999; POWERS and WALTER 1999; KOMEILI et al. 2000). Tor activity also supports translation, in large part by suppressing the general amino acid control response regulated by the Gcn2 kinase, and possibly by also affecting the stability of eIF4G (BERSET et al. 1998; VALENZUELA et al. 2001; CHERKASOVA and HINNEBUSCH 2003; KUBOTA et al. 2003; ROHDE et al. 2004). Inhibition of Tor by rapamycin elicits many of the cellular responses that are triggered by starvation for nutrients, such as inhibition of protein synthesis, downregulation of amino acid permeases, protein degradation, autophagy, and cell cycle arrest (reviewed by ROHDE et al. 2001; DE VIRGILIO and LOEWITH 2006).
Unlike most organisms that express only one Tor protein, Saccharomyces cerevisiae has two highly homologous Tor proteins, Tor1 and Tor2, which are thought to share all of the rapamycin-sensitive functions attributable to Tor signaling, while only Tor2 serves a unique and essential rapamycin-insensitive role (reviewed in CRESPO and HALL 2002). A recent study has suggested that Tor1 and Tor2 differ in providing a rapamycin-sensitive function in certain class C vps mutants (XIE et al. 2005); however, the exact nature of this function remains to be determined. The Tor proteins form two distinct multiprotein complexes: TORC1 and TORC2. Tor1 (and to a lesser extent Tor2) is a component of the TORC1 complex, which includes Lst8, Kog1, Tco89, and Bit61. TORC2 consists of Tor2, Lst8, and the Avo1, Avo2, and Avo3 proteins (LOEWITH et al. 2002; WEDAMAN et al. 2003; REINKE et al. 2004). FKBP12-rapamycin physically associates with TORC1 but not with TORC2, suggesting that this second complex mediates the rapamycin-insensitive Tor2 role in controlling polarization of the actin cytoskeleton (LOEWITH et al. 2002).
To understand why yeast cells express two functional Tor proteins, we sought to define novel Tor1- or Tor2-specific functions. Here we performed a genomewide screen searching for genes that when mutated in combination with tor1 reduce fitness or render cells inviable. These genes identified distinct functional networks including those involved in protein sorting, vacuolar inheritance, and microautophagy. In particular, we find that tor1 shows synthetic lethality or synthetic reduced fitness with mutations in different components of the class C Vps complex, which includes the Pep3, Pep5, Vps16, Vps33, Vps39, and Vps41 proteins (BANTA et al. 1988; RAYMOND et al. 1992; RIEDER and EMR 1997; WURMSER et al. 2000). The class C Vps complex plays a central role in protein sorting by regulating vesicle docking and fusion at the endosome and between the endosome and the vacuole (SRIVASTAVA et al. 2000; PETERSON and EMR 2001). Viability of the tor1 pep3 double mutant was restored by expression of Tor1 but not Tor2, indicating that the function linking Tor1 and the class C Vps complex is unique to the rapamycin-sensitive TORC1 complex. Mutants lacking components of the class C Vps complex fail to recover from rapamycin-induced growth arrest and to survive nitrogen starvation, have low levels of amino acids, in particular glutamate, and show growth defects at 37° (this study; KITAMOTO et al. 1988; ROBINSON et al. 1991). Remarkably, addition of glutamate or glutamine rescues the growth defect of class C single vps mutants and of a tor1 pep3ts conditional mutant at 37°. Our studies suggest that, in contrast to Tor2, Tor1 is specialized to support growth under conditions where intracellular amino acid concentrations are drastically reduced. We also conclude that an intact class C Vps complex is required to provide intracellular amino acid homeostasis for proper Tor1 signaling. These findings provide a physiological foundation to understand the duplication and divergence of Tor1 and Tor2 functions in S. cerevisiae.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
haploid strains, respectively. Strain SZY36 was obtained from strain BY4742 by deletion of the VPS33 gene with KanMX4. Strain SZY37 was constructed by replacing the URA3 gene in strain SZY25 with LEU2. Strain SZY40 was obtained by crossing strain SZY37 to the pep3 haploid mutant strain #14105 and the resulting diploid transformed with plasmid pBJ9113 expressing the pep3ts-108 (SRIVASTAVA et al. 2000) was sporulated and dissected to obtain strain SZY40-4. SZY43 is a meiotic segregant of strain SZY32. Strain SZY49 was constructed by crossing strains SZY25 and SZY36.
|
|
Plasmid pSZ12 (Hybrid 4) was created by gap repair; briefly, a 173-bp (from nucleotide 5316 to 5488 of TOR2) PCR product was generated with primers SZ167 5'–CATAATTGG GCCTTAGCTAATTTTGAAGTAATATCCATGCTAACATCTGTCTCTAAAAAGAAACAGGAAG–3' and SZ168 5'–GAAAAAAGCCCTTGATCGCTGGAACAACATGTCTTTGAATAAGATTAGAAGAGTAATGAACTTC–3' and plasmid pML40-3 as template. The PCR product was cotransformed with NcoI-digested pRS315-TOR1 into strain 16864. All hybrids were confirmed by sequencing. Plasmid pMEP2-GFP was kindly provided by J. Rutherford and will be published elsewhere. Plasmids pBJ9113 bearing the pep3ts-108 (SRIVASTAVA et al. 2000) and p188 containing the GCN4-lacZ reporter gene were provided by E. Jones and A. Hinnebusch, respectively.
Western blotting and -factor processing:
Cell extracts from exponentially growing cultures in YEPD were prepared as previously described except that the breakage buffer consisted of 100 mM Tris-HCl, 50 mM KCl, 1 mM EDTA, 5% glycerol, and the protease inhibitors leupeptin, aprotinin, and pepstatin added at 1 µg/ml and 0.5 mM phenylmethyl sulfonyl fluoride (ROHDE et al. 2004). Western blot analysis with 40 µg of protein for Ape1 and Alp1 and 10 µg for CpY was performed by standard techniques with antibodies specific for Ape1 and Alp1 (kindly provided by Y. Ohsumi) and CpY (Molecular Probes, Eugene, OR). The antisera recognizing amino acids 1–100 and 1–147 of Tor1 and Tor2, respectively, were previously described (CARDENAS and HEITMAN 1995; ALARCON et al. 1996). For metabolic labeling cultures were grown to early exponential phase in SC medium. Cells were washed and resuspended in SC without methionine medium and treated with drug vehicle alone or 100 nM rapamycin and incubated for 20 min. Metabolic labeling of yeast cells with Trans 35S-LABEL (ICN), pulse chase, cell extract preparation, immunoprecipitation with specific antibodies for -factor (a generous gift of T. Graham), and CpY were performed at 30° according to published protocols (GRAHAM 1998).
Amino acid determination, Northern blot analysis, and ß-galactosidase assays:
Amino acid extraction from exponentially growing cells in YPD medium was performed as described (CHEN and KAISER 2002). Amino acid analyses were carried out in duplicate by anion exchange chromatography employing a Beckman 6300 Li citrate-based analyzer followed by post-column ninhydrin reaction detection system at the Molecular Structure Facility, University of California at Davis. Northern blot analysis as well as ß-galactosidase assays to determine GCN4-lacZ reporter gene activity were previously described (CARDENAS et al. 1999; ROHDE et al. 2004).
Fluorescent microscopy:
Cells were collected, spotted onto microscope slides, and imaged in a Nikon Eclipse E400 microscope equipped for epifluorescence and with a Nikon DXM1200F digital camera.
|
RESULTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
2 (Table 2). Remarkably, this set of genes comprises distinct clusters that share common functions, including transcriptional regulation, mRNA processing, ribosomal and mitochondrial functions, vesicle docking and fusion, protein transport, microautophagy, and vacuolar inheritance (Table 2, Figure 1A, and data not shown).
|
|
2. On the basis of tetrad analysis, mutation of these vps genes in combination with tor1 also resulted in a synthetic reduced fitness phenotype (Figure 1C). These results validate the dSLAM screen and indicate that mutations in the class C VPS genes show a synthetic lethal interaction with tor1. For the remainder of this study, the focus is on understanding the basis for the synthetic lethality and reduced fitness defect exhibited by the tor1 class C vps double mutants.
Class C vps mutants fail to recover from rapamycin-induced growth arrest:
One hallmark of the genes linked to Tor signaling is that their mutation alters sensitivity to rapamycin. Mutation of 18 genes (including 14 involved in vacuolar functions and protein trafficking) out of the 62 shown in Table 2 resulted in rapamycin hypersensitivity as compared with the WT strain (Figure 2A) (CHAN et al. 2000; XIE et al. 2005). In particular, mutants lacking components of the protein-sorting apparatus, including the class C Vps complex, the pre-autophagosomal (PAS) complex, as well as the vac8 mutant, are all extremely sensitive to rapamycin as compared to either the WT or the tor1 strains (Figure 2A). In addition, the class C vps mutants were tested for their ability to resume growth after rapamycin exposure. Actively growing cells were treated with rapamycin for 6 hr, washed, and spotted on YPD medium without drug. In contrast to the WT or tor1 strains, which readily recovered from rapamycin-induced growth arrest, mutations in class C VPS genes abolished recovery (Figure 2B). Interestingly, a similar phenotype was observed with strains harboring mutations in the EGO/Gse protein complex (Figure 1A), which was shown recently to play a role in combination with TORC1 in exit from rapamycin-induced quiescence (DUBOULOZ et al. 2005).
|
|
Tor1 does not regulate the functions of the class C Vps complex:
To gain insight into the molecular mechanisms that underlie the synthetic lethal interaction between TOR1 and class C VPS genes, we considered the hypothesis that Tor1 regulates the functions of this complex. This model is particularly attractive since Tor1 has been localized to internal membranes that resemble those associated with the endocytic pathway (WEDAMAN et al. 2003). To test this hypothesis, we examined if Tor1 mutation confers defects in class C Vps complex functions. The class C Vps protein complex is required for non-endosomal Golgi-to-vacuole transport, cytoplasm-to-vacuole targeting (Cvt), recycling from endosomes back to the late Golgi, endocytosis, and autophagy. The tor1 mutant did not show defects in the maturation of the vacuolar hydrolases CpY, Ape1, or Alp1 as compared to the WT strain or the pep3 mutant, which is defective in the proteolytic processing of these proteins (Figure 4A). Furthermore, CpY, Ape1, and Alp1 maturation was not altered by rapamycin treatment (Figure 4A). Moreover, mutation of TOR1 did not have any effect on endocytosis of the ammonium permease Mep2 elicited by ammonium addition to cells growing in ammonium-limiting medium (Figure 4B). These results indicate that the endosomal-to-vacuole, the Cvt, and the non-endosomal-to-vacuole protein-sorting routes are not regulated by Tor signaling and that Tor1 does not regulate endocytosis. This result is in accord with a previous study that identified a rapamycin-insensitive role for Tor2, but not for Tor1, in regulating endocytosis (DEHART et al. 2003).
|
Synthetic lethal interaction can arise between two genes whose products act in parallel or compensating pathways. Accordingly, we considered the hypothesis that TOR1 regulates a pathway that functions in parallel with the class C complex for protein sorting. A prediction of this model is that key genes working within this pathway should be synthetically lethal in combination with a pep3 mutation. A dSLAM screen with pep3 revealed 38 genes that are known when mutated to alter the sensitivity of cells to rapamycin (Figure 5A, data not shown) (CHAN et al. 2000; XIE et al. 2005). Within this set, 13 genes share distinctive roles in protein trafficking between the ER to Golgi complex and protein cycling between the Golgi complex and endosomes (Figure 5A).
|
-factor maturation. The mating pheromone factor is synthesized as a precursor and subjected to extensive glycosylation as it transverses the ER and Golgi complex, and then is cleaved at the late Golgi complex by the Kex2 protease to produce mature pheromone. Importantly, Kex2 normally cycles between the late Golgi complex and endosomal compartments. Thus, -factor maturation serves as a reporter of protein trafficking between the ER to Golgi complex and protein cycling between the Golgi complex and endosomes. In this experiment we also monitored the processing of CpY in more detail. While mutation of PEP3 resulted in accumulation of glycosylated forms of factor in the Golgi complex, and also blocked CpY processing, neither mutation of TOR1 nor rapamycin treatment of the WT strain perturbed -factor or CpY processing to any significant extent (Figure 5B). Furthermore, rapamycin treatment in the pep3 strain did not alter the ratio of mature to immature -factor forms observed in the pep3 untreated cells (Figure 5B). In addition, mutation of TOR1 or rapamycin treatment had no effect on the normal cycling of the SNARE protein Snc1 from early endosomes to the Golgi compartment and back to the plasma membrane (data not shown). Collectively, these results exclude models that evoke a role for Tor1 in regulating the class C Vps complex, or acting in a parallel compensating pathway to provide a known class C Vps complex function.
The synthetic lethality between TOR1 and PEP3 mutations is suppressed by amino acids:
Next, we entertained a model in which the class C Vps complex promotes Tor activity. Because Tor signaling is activated by nutrients, we tested the ability of the class C vps mutants to respond to nitrogen starvation. In contrast to the WT and tor1 strains, which effectively survived a 10-day period of incubation on ammonium-starvation medium, the class C vps mutants failed to resume growth (Figure 6A).
Previous reports have shown that class C vps mutants contain severely fragmented vacuoles and are unable to store normal levels of basic amino acids in the vacuole (KITAMOTO et al. 1988; RAYMOND et al. 1992). Low levels of intracellular amino acids, or rapamycin exposure, are known to trigger the general amino acid control response by inactivation of eIF2, which results in a block to general protein synthesis and preferential translation of Gcn4. We examined if the low amino acid levels in class C vps mutants would suffice to activate Gcn4 translation. In accord with the above observation, pep3 or pep5 mutations resulted in robust Gcn4 translation, comparable to that observed in the WT strain treated with rapamycin (Figure 6B).
It has been proposed that glutamine and possibly glutamate, which are amino acids central to nitrogen metabolism, regulate nutrient signaling pathways, including the Tor pathway (CRESPO et al. 2002; reviewed by LIU and BUTOW 2006). These observations prompted us to examine in more detail the intracellular amino acid content in the class C vps mutants. Under the growth conditions analyzed (active growth in YPD medium) the pep3, pep5, and vps33 mutants showed a lower level of the basic amino acids lysine, histidine, and arginine than that detected in the WT strain, in accord with an earlier report (Table 3) (KITAMOTO et al. 1988). Remarkably, in contrast to the WT and tor1 strains, glutamate levels were significantly reduced (
1.5-fold) in the class C vps mutants. The class C Vps complex is also required to support growth at 37° (Figure 6C) (ROBINSON et al. 1991, KONING et al. 2002). We sought to test if this growth defect is linked to amino acid levels. Exponentially growing cultures of the different strains were shifted from 30° to 37° and the amino acid levels were determined. Interestingly, shift to 37° for 3 hr caused a modest decline in glutamate and a near twofold decrease in glutamine in both the WT and the tor1 strains. In the pep3, pep5, and vps33 mutants the concentration of these amino acids declined more markedly, two- to threefold depending on the strain, and glutamate reached a threefold lower level than the one observed in the WT strain under similar conditions (Table 3). Moreover, supplementation of the growth media with glutamate, or with glutamine and to lesser extent with arginine, restored growth of the pep3, pep5, vps33, vps39, and vps41 mutant strains at 37°. This effect was specific and was not observed when the individual basic amino acids lysine or histidine were added as supplements (Figure 6C). The vps16 strain has a more severe growth defect at 37° than the rest of the class C vps mutants and this is only marginally alleviated by glutamine supplementation (see below for discussion). Strikingly, glutamate or glutamine and less efficiently arginine also supported the growth of a tor1 pep3 double-mutant strain carrying a partial loss of function pep3ts allele on a plasmid (Figure 6C). In contrast, supplementation with glutamine or glutamate did not rescue the growth defect of the tor1 vac8, tor1 gtr1, or tor1 ego3 double mutants (Figure 6D). Finally, supplementation with glutamine, glutamate, arginine, lysine, and histidine partially rescued the viability of tor1 pep5 segregants; however, these segregants grew poorly and rapidly accumulated suppressor mutations (data not shown). These results argue that the synthetic lethality of the tor1 pep3 double mutant derives from the metabolic derangement that underlies the reduced amino acid concentrations observed in the class C vps mutants.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
Rapamycin exposure results in autophagy and thereby in a massive influx of membranes into the vacuolar membrane (NODA and OHSUMI 1998). In combination with TORC1, the EGO/Gse complex has been proposed to play a role in recovery from rapamycin-induced cell cycle arrest by enabling recycling of vacuolar membranes via microautophagy (DUBOULOZ et al. 2005). We have shown here that class C vps mutants are unable to recover from prolonged exposure to rapamycin. Although it is possible that the class C Vps complex is required for microautophagy, we were unable to address this question since class C vps mutants fail to complete autophagy and contain severely fragmented vacuoles.
We find that the structural difference between Tor1 and Tor2 to support viability of tor1 pep5 segregants maps to the C-terminal 788 amino acid region of Tor1. This result is in contrast with a previous study which concluded that the ability of a Tor1SR (rapamycin-resistant mutant) to confer rapamycin resistance in a vps16 mutant lies in the N-terminal 120 amino acid region of Tor1 (XIE et al. 2005). At present we do not have a good explanation for this discrepancy other than the biological assays to test for Tor1 function in the two studies were different.
Our screen also identified the Vps34 phosphatidylinositol 3-kinase and the Vps15 protein kinase, members of the PAS protein complex which functions in autophagy and protein sorting (STACK et al. 1995; KIHARA et al. 2001), and genes involved in vacuolar inheritance (Figure 1A). Taken together these results reveal a prominent link between Tor signaling and vacuolar function. This view is further underscored by studies that have localized different components of the Tor pathway to the vacuolar membrane, including Tor2, Kog1, and Tco89 (CARDENAS and HEITMAN 1995; REINKE et al. 2004; ARAKI et al. 2005). An important function of the vacuole is to preserve amino acid homeostasis by sequestering basic amino acids, which are toxic when present at high concentrations in the cytosol (reviewed by KLIONSKY et al. 1990).
Our results and those of others have shown that mutants lacking components of the class C Vps complex are unable to recover from ammonium starvation, they have low concentrations of intracellular amino acids, particularly glutamate and glutamine, and this concentration is further reduced upon shift of these mutants from 30° to 37°. Moreover, class C vps mutants have growth defects at 37° (Figure 6C) (ROBINSON et al. 1991, KONING et al. 2002). Remarkably, addition of glutamate or glutamine and to lesser extent arginine restored the growth at 37° of individual class C vps mutants and a tor1 pep3 mutant carrying a pep3ts allele, and partially rescued the viability of tor1 pep5 segregants. The effect of arginine could be explained by the ability of this amino acid to be converted into glutamate by the concerted actions of arginase and ornithine transaminase (reviewed by DAVIS 1986). We found that the vps16 strain was only marginally rescued by glutamine supplementation, suggesting that Vps16 has an additional function(s) different from that shared with the other members of the class C Vps complex. In this regard a role for Vps16 in regulating mRNA decapping and stability has been demonstrated (ZHANG et al. 1999). Interestingly, genes encoding two subunits of the cap-binding complex, CBC1 and CBC2, were also identified by the tor1 synthetic screen and a rapamycin-sensitive role for Tor in controlling mRNA stability has been described (ALBIG and DECKER 2001). Thus, it is possible that Tor1 function becomes compromised in the vps16 mutant via these activities independent of the class C Vps complex function.
In summary, our results indicate that the class C Vps complex is required to maintain amino acid homeostasis for effective Tor activity and lend further support to the proposal that glutamate/glutamine activates Tor signaling (CRESPO et al. 2002). These studies also demonstrate that Tor1 is more efficient than Tor2 at providing rapamycin-sensitive Tor signaling under conditions where intracellular amino acids are drastically reduced. In support of this model, whereas Tor1 is a bona fide member of the rapamycin-sensitive TORC1 complex, Tor2 weakly interacts with this complex only in cells lacking Tor1 and no stable association of Tor2 with TORC1 has been detected in wild-type cells (LOEWITH et al. 2002; REINKE et al. 2004).
Strikingly, although both humans and many fungi express a single Tor kinase, the Tor genes have been independently duplicated in both the budding yeast S. cerevisiae and the fission yeast Schizosaccharomyces pombe (reviewed by WEISMAN 2004). Interestingly, in both cases one of the two paralogs is essential (TOR2) and the other is not under standard conditions (TOR1). Early studies in S. pombe revealed a role for Tor1 in amino acid uptake (WEISMAN et al. 2005). A more recent study has proposed a shared function for Tor1 and Tor2 in enabling cell proliferation and survival under both normal and adverse conditions and a positive and negative role for Tor1 and Tor2, respectively, in regulating G1 arrest and sexual differentiation (URITANI et al. 2006). Taken together, our findings provide a physiological basis for understanding the functional differences that distinguish Tor1 and Tor2 in S. cerevisiae and yield insight as to why the two genes are among the few (2–8%) retained following the genome duplication and massive gene loss event that marked the evolution of hemiascomycetous yeasts.
|
ACKNOWLEDGEMENTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
factor processing experiments. We thank Todd Graham, Elizabeth Jones, Yoshinori Ohsumi, Alan Hinnebusch, and Julian Rutherford for generous gifts of plasmids and antisera and Joseph Heitman and John McCusker for critical reading of the manuscript. This work was supported by R01CA114107 from the National Cancer Institute (to M.E.C); Xuewen Pan was supported by the Leukemia and Lymphoma Society and by National Institute of Health grant HG-002432 (to J.D.B). |
FOOTNOTES |
|---|
|
LITERATURE CITED |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
ABELIOVICH, H., W. A. DUNN, JR., J. KIM and D. J. KLIONSKY, 2000 Dissection of autophagosome biogenesis into distinct nucleation and expansion steps. J. Cell Biol. 151: 1025–1034.
ALARCON, C. M., M. E. CARDENAS and J. HEITMAN, 1996 Mammalian RAFT1 kinase domain provides rapamycin-sensitive TOR function in yeast. Genes Dev. 10: 279–288.
ALARCON, C. M., J. HEITMAN and M. E. CARDENAS, 1999 Protein kinase activity and identification of a toxic effector domain of the target of rapamycin TOR proteins in yeast. Mol. Biol. Cell 10: 2531–2546.
ALBIG, A. R., and C. J. DECKER, 2001 The target of rapamycin signaling pathway regulates mRNA turnover in the yeast Saccharomyces cerevisiae. Mol. Biol. Cell 12: 3428–3438.
ARAKI, T., Y. UESONO, T. OGUCHI and E. A. TOH, 2005 LAS24/KOG1, a component of the TOR complex 1 (TORC1), is needed for resistance to local anesthetic tetracaine and normal distribution of actin cytoskeleton in yeast. Genes Genet. Syst. 80: 325–343.[CrossRef][Medline]
BANTA, L. M., J. S. ROBINSON, D. J. KLIONSKY and S. D. EMR, 1988 Organelle assembly in yeast: characterization of yeast mutants defective in vacuolar biogenesis and protein sorting. J. Cell Biol. 107: 1369–1383.
BECK, T., and M. N. HALL, 1999 The TOR signalling pathway controls nuclear localization of nutrient-regulated transcription factors. Nature 402: 689–692.[CrossRef][Medline]
BERSET, C., H. TRACHSEL and M. ALTMANN, 1998 The TOR (target of rapamycin) signal transduction pathway regulates the stability of translation initiation factor eIF4G in the yeast Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 95: 4264–4269.
CARDENAS, M. E., and J. HEITMAN, 1995 FKBP12-rapamycin target TOR2 is a vacuolar protein with an associated phosphatidylinositol-4 kinase activity. EMBO J. 14: 5892–5907.[Medline]
CARDENAS, M. E., N. S. CUTLER, M. C. LORENZ, C. J. DI COMO and J. HEITMAN, 1999 The TOR signaling cascade regulates gene expression in response to nutrients. Genes Dev. 13: 3271–3279.
CHAN, T. F., J. CARVALHO, L. RILES and X. F. ZHENG, 2000 A chemical genomics approach toward understanding the global functions of the target of rapamycin protein (TOR). Proc. Natl. Acad. Sci. USA 97: 13227–13232.
CHEN, E. J., and C. A. KAISER, 2002 Amino acids regulate the intracellular trafficking of the general amino acid permease of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 99: 14837–14842.
CHERKASOVA, V. A., and A. G. HINNEBUSCH, 2003 Translational control by TOR and TAP42 through dephosphorylation of eIF2alpha kinase GCN2. Genes Dev. 17: 859–872.
CRESPO, J. L., and M. N. HALL, 2002 Elucidating TOR signaling and rapamycin action: lessons from Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 66: 579–591.
CRESPO, J. L., T. POWERS, B. FOWLER and M. N. HALL, 2002 The TOR-controlled transcription activators GLN3, RTG1, and RTG3 are regulated in response to intracellular levels of glutamine. Proc. Natl. Acad. Sci. USA 99: 6784–6789.
DAVIS, R. H., 1986 Compartmental and regulatory mechanisms in the arginine pathways of Neurospora crassa and Saccharomyces cerevisiae. Microbiol. Rev. 50: 280–313.
DEHART, A. K., J. D. SCHNELL, D. A. ALLEN, J. Y. TSAI and L. HICKE, 2003 Receptor internalization in yeast requires the Tor2-Rho1 signaling pathway. Mol. Biol. Cell 14: 4676–4684.
DE VIRGILIO, C., and R. LOEWITH, 2006 Cell growth control: little eukaryotes make big contributions. Oncogene 25: 6392–6415.[CrossRef][Medline]
DUBOULOZ, F., O. DELOCHE, V. WANKE, E. CAMERONI and C. DE VIRGILIO, 2005 The TOR and EGO protein complexes orchestrate microautophagy in yeast. Mol. Cell 19: 15–26.[CrossRef][Medline]
GAO, M., and C. A. KAISER, 2006 A conserved GTPase-containing complex is required for intracellular sorting of the general amino-acid permease in yeast. Nat. Cell Biol. 8: 657–667.[CrossRef][Medline]
GIMENO, C. J., P. O. LJUNGDAHL, C. A. STYLES and G. R. FINK, 1992 Unipolar cell divisions in the yeast S. cerevisiae lead to filamentous growth: regulation by starvation and RAS. Cell 68: 1077–1090.[CrossRef][Medline]
GOLDSTEIN, A. L., and J. H. MCCUSKER, 1999 Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast 15: 1541–1553.[CrossRef][Medline]
GRAHAM, T. R., 1998 Metabolic labeling and immunoprecipitation of yeast proteins. John Wiley & Sons, New York.
HARDWICK, J. S., F. G. KURUVILLA, J. K. TONG, A. F. SHAMJI and S. L. SCHREIBER, 1999 Rapamycin-modulated transcription defines the subset of nutrient-sensitive signaling pathways directly controlled by the Tor proteins. Proc. Natl. Acad. Sci. USA 96: 14866–14870.
HEITMAN, J., N. R. MOVVA and M. N. HALL, 1991 Targets for cell cycle arrest by the immunosuppressant rapamycin in yeast. Science 253: 905–909.
KIHARA, A., T. NODA, N. ISHIHARA and Y. OHSUMI, 2001 Two distinct Vps34 phosphatidylinositol 3-kinase complexes function in autophagy and carboxypeptidase Y sorting in Saccharomyces cerevisiae. J. Cell Biol. 152: 519–530.
KITAMOTO, K., K. YOSHIZAWA, Y. OHSUMI and Y. ANRAKU, 1988 Mutants of Saccharomyces cerevisiae with defective vacuolar function. J. Bacteriol. 170: 2687–2691.
KLIONSKY, D. J., P. K. HERMAN and S. D. EMR, 1990 The fungal vacuole: composition, function, and biogenesis. Microbiol. Rev. 54: 266–292.
KOMEILI, A., K. P. WEDAMAN, E. K. O'SHEA and T. POWERS, 2000 Mechanism of metabolic control. Target of rapamycin signaling links nitrogen quality to the activity of the Rtg1 and Rtg3 transcription factors. J. Cell Biol. 151: 863–878.
KONING, A. J., L. L. LARSON, E. J. CADERA, M. L. PARRISH and R. L. WRIGHT, 2002 Mutations that affect vacuole biogenesis inhibit proliferation of the endoplasmic reticulum in Saccharomyces cerevisiae. Genetics 160: 1335–1352.
KUBOTA, H., T. OBATA, K. OTA, T. SASAKI and T. ITO, 2003 Rapamycin-induced translational derepression of GCN4 mRNA involves a novel mechanism for activation of the eIF2[] Kinase GCN2. J. Biol. Chem. 278: 20457–20460.
LIU, Z., and R. A. BUTOW, 2006 Mitochondrial retrograde signaling. Annu. Rev. Genet. 40: 159–185.[CrossRef][Medline]
LOEWITH, R., E. JACINTO, S. WULLSCHLEGER, A. LORBERG, J. L. CRESPO et al., 2002 Two TOR complexes, only one of which is rapamycin sensitive, have distinct roles in cell growth control. Mol. Cell 10: 457–468.[CrossRef][Medline]
LONGTINE, M. S., A. MCKENZIE, III, D. J. DEMARINI, N. G. SHAH, A. WACH et al., 1998 Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14: 953–961.[CrossRef][Medline]
LORENZ, M. C., and J. HEITMAN, 1995 TOR mutations confer rapamycin resistance by preventing interaction with FKBP12-rapamycin. J. Biol. Chem. 270: 27531–27537.
NODA, T., and Y. OHSUMI, 1998 Tor, a phosphatidylinositol kinase homologue, controls autophagy in yeast. J. Biol. Chem. 273: 3963–3966.
PAN, X., D. S. YUAN, D. XIANG, X. WANG, S. SOOKHAI-MAHADEO et al., 2004 A robust toolkit for functional profiling of the yeast genome. Mol. Cell 16: 487–496.[CrossRef][Medline]
PETERSON, M. R., and S. D. EMR, 2001 The class C Vps complex functions at multiple stages of the vacuolar transport pathway. Traffic 2: 476–486.[CrossRef][Medline]
POWERS, T., and P. WALTER, 1999 Regulation of ribosome biogenesis by the rapamycin-sensitive TOR-signaling pathway in Saccharomyces cerevisiae. Mol. Biol. Cell 10: 987–1000.
RAYMOND, C. K., I. HOWALD-STEVENSON, C. A. VATER and T. H. STEVENS, 1992 Morphological classification of the yeast vacuolar protein sorting mutants: evidence for a prevacuolar compartment in class E vps mutants. Mol. Biol. Cell 3: 1389–1402.[Abstract]
REINKE, A., S. ANDERSON, J. M. MCCAFFERY, J. YATES, III, S. ARONOVA et al., 2004 TOR complex 1 includes a novel component, Tco89p (YPL180w), and cooperates with Ssd1p to maintain cellular integrity in Saccharomyces cerevisiae. J. Biol. Chem. 279: 14752–14762.
RIEDER, S. E., and S. D. EMR, 1997 A novel RING finger protein complex essential for a late step in protein transport to the yeast vacuole. Mol. Biol. Cell 8: 2307–2327.
ROBINSON, J. S., T. R. GRAHAM and S. D. EMR, 1991 A putative zinc finger protein, Saccharomyces cerevisiae Vps18p, affects late Golgi functions required for vacuolar protein sorting and efficient alpha-factor prohormone maturation. Mol. Cell. Biol. 11: 5813–5824.
ROHDE, J., J. HEITMAN and M. E. CARDENAS, 2001 The TOR kinases link nutrient sensing to cell growth. J. Biol. Chem. 276: 9583–9586.
ROHDE, J. R., S. CAMPBELL, S. A. ZURITA-MARTINEZ, N. S. CUTLER, M. ASHE et al., 2004 TOR controls transcriptional and translational programs via Sap-Sit4 protein phosphatase signaling effectors. Mol. Cell. Biol. 24: 8332–8341.
SCHIESTL, R. H., and R. D. GIETZ, 1989 High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Curr. Genet. 16: 339–346.[CrossRef][Medline]
SHERMAN, F., 2002 Getting started with yeast. Methods Enzymol. 350: 3–41.[Medline]
SRIVASTAVA, A., C. A. WOOLFORD and E. W. JONES, 2000 Pep3p/Pep5p complex: a putative docking factor at multiple steps of vesicular transport to the vacuole of Saccharomyces cerevisiae. Genetics 156: 105–122.
STACK, J. H., B. HORAZDOVSKY and S. D. EMR, 1995 Receptor-mediated protein sorting to the vacuole in yeast: roles for a protein kinase, a lipid kinase and GTP-binding proteins. Annu. Rev. Cell Dev. Biol 11: 1–33.[Medline]
URITANI, M., H. HIDAKA, Y. HOTTA, M. UENO, T. USHIMARU et al., 2006 Fission yeast Tor2 links nitrogen signals to cell proliferation and acts downstream of the Rheb GTPase. Genes Cells 11: 1367–1379.
VALENZUELA, L., C. ARANDA and A. GONZALEZ, 2001 TOR modulates GCN4-dependent expression of genes turned on by nitrogen limitation. J. Bacteriol. 183: 2331–2334.
WEDAMAN, K. P., A. REINKE, S. ANDERSON, J. YATES, III, J. M. MCCAFFERY et al., 2003 Tor kinases are in distinct membrane-associated protein complexes in Saccharomyces cerevisiae. Mol. Biol. Cell 14: 1204–1220.
WEISMAN, R., 2004 The fission yeast TOR proteins and the rapamycin response: an unexpected tale. Curr. Top. Microbiol. Immunol. 279: 85–95.[Medline]
WEISMAN, R., I. ROITBURG, T. NAHARI and M. KUPIEC, 2005 Regulation of leucine uptake by tor1+ in Schizosaccharomyces pombe is sensitive to rapamycin. Genetics 169: 539–550.
WURMSER, A. E., T. K. SATO and S. D. EMR, 2000 New component of the vacuolar class C–Vps complex couples nucleotide exchange on the Ypt7 GTPase to SNARE-dependent docking and fusion. J. Cell Biol. 151: 551–562.
XIE, M. W., F. JIN, H. HWANG, S. HWANG, V. ANAND et al., 2005 Insights into TOR function and rapamycin response: chemical genomic profiling by using a high-density cell array method. Proc. Natl. Acad. Sci. USA 102: 7215–7220.
ZARAGOZA, D., A. GHAVIDEL, J. HEITMAN and M. C. SCHULTZ, 1998 Rapamycin induces the G0 program of transcriptional repression in yeast by interfering with the TOR signaling pathway. Mol. Cell. Biol. 18: 4463–4470.
ZHANG, S., C. J. WILLIAMS, K. HAGAN and S. W. PELTZ, 1999 Mutations in VPS16 and MRT1 stabilize mRNAs by activating an inhibitor of the decapping enzyme. Mol. Cell. Biol. 19: 7568–7576.
This article has been cited by other articles:
 |
|
 |
|
  J. C. Rutherford, G. Chua, T. Hughes, M. E. Cardenas, and J. Heitman A Mep2-dependent Transcriptional Profile Links Permease Function to Gene Expression during Pseudohyphal Growth in Saccharomyces cerevisiae Mol. Biol. Cell, July 1, 2008; 19(7): 3028 - 3039. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Puria, S. A. Zurita-Martinez, and M. E. Cardenas From the Cover: Nuclear translocation of Gln3 in response to nutrient signals requires Golgi-to-endosome trafficking in Saccharomyces cerevisiae PNAS, May 20, 2008; 105(20): 7194 - 7199. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. P. Mitchell A VAST staging area for regulatory proteins PNAS, May 20, 2008; 105(20): 7111 - 7112. [Full Text] [PDF]
|
|
| |||||
) and imaged for direct epifluorescence as indicated under experimental procedures. (C) Effects of TOR1 mutation in autophagy-mediated maturation of Ape1. The WT (BY4742), and the tor1 (#16864), pep3 (#14105), vac8 (#10253), and the tor1 vac8 (SZY43) mutant strains were grown and treated with rapamycin as indicated in A. Protein extracts were prepared and analyzed by Western blot with specific Ape1 antibodies.