| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Genetics, Vol. 176, 1511-1526, July 2007, Copyright © 2007
doi:10.1534/genetics.106.070177
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,1
* The Mitochondrial and Reproductive Genetics Group, The Medical School, University of Birmingham, Birmingham B15 2TT, United Kingdom, Animal Development and Biotechnology Group, University of Nottingham, School of Biosciences, Leicestershire LE12 5RD, United Kingdom and School of Biosciences, University of Birmingham, Birmingham B15 2TT, United Kingdom
3 Corresponding author: Mitochondrial and Reproductive Genetics Group, Room EF20A, The Medical School, The University of Birmingham, Edgbaston, Birmingham B15 2TT, UK.
E-mail: j.stjohn.1{at}bham.ac.uk
 |
ABSTRACT |
|---|
 TOP ABSTRACT MATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
The donor cell also contributes mitochondria to the reconstructed oocyte. Mitochondria, which reside in the cytoplasm of all eukaryotic cells, contain one or more copies of the double-stranded circular mitochondrial genome (mtDNA). mtDNA encodes 13 of the >70 subunits of the electron transfer chain (ETC), the intracellular apparatus that generates the vast majority of a cell's ATP through the process of oxidative phosphorylation (OXPHOS). The remainder of the subunits are encoded by chromosomal DNA (ANDERSON et al. 1981). During normal sexual reproduction, mtDNA is almost exclusively transmitted from the mtDNA present in the unfertilized oocyte and is therefore maternally inherited (GILES et al. 1980; BIRKY 1995). These mtDNA genomes originate from a few mitochondria segregated to each primordial germ cell shortly after the onset of gastrulation (JANSEN and DE BOER 1998). The mtDNA in these precursor germ cells are then clonally amplified during the later stages of oogenesis (HAUSWIRTH and LAIPIS 1982; POULTON et al. 1998). In the vast majority of cases, this process leads to the transmission of only a single type of mtDNA, a state known as homoplasmy. However, due to the donor cell contributing mtDNA to the reconstructed oocyte, mtDNA can be inherited either from the recipient oocyte only or from both the donor cell and recipient oocyte (heteroplasmy). Such transmission has been observed in both NT embryos (STEINBORN et al. 1998; LLOYD et al. 2006) and their offspring (EVANS et al. 1999; HIENDLEDER et al. 1999; MEIRELLES et al. 2001; STEINBORN et al. 2002; ST. JOHN and SCHATTEN 2004).
As NT has been used to generate intraspecific (MENG et al. 1997; WILMUT et al. 1997; CIBELLI et al. 1998; BAGUISI et al. 1999; POLEJAEVA et al. 2000), interspecific (LOI et al. 2001; MEIRELLES et al. 2001; STEINBORN et al. 2002; GOMEZ et al. 2004; JIANG et al. 2004), and intergeneric (CHEN et al. 2002; CHANG et al. 2003; YANG et al. 2003, 2004; LIU et al. 2004) embryos, the mixing of diverse nuclear and mtDNA fusion partners could compromise ETC function and be disadvantageous for preimplantation or fetal development and survival of the offspring. This is first reflected in mtDNA genomes from different breeds, which possess sequence variants in coding genes (HIENDLEDER et al. 1998). Heteroplasmy would lead to variable amino acid composition, as demonstrated in bovine (STEINBORN et al. 2002) and porcine (ST. JOHN et al. 2005) interspecific NT offspring, and thus potentially alter protein conformation of the components of the ETC. Furthermore, as both mitochondrial and chromosomal genes contribute proteins to the ETC, the genetic divergence between the gene products of these genomes could also affect ATP output. Such outcomes have been reported for more evolutionary divergent somatic cell cybrids generated by the fusion of an enucleated somatic cell with another somatic cell (MCKENZIE et al. 2003).
The chromosomal genome also encodes the mtDNA-specific transcription and replication factors. Two key factors are mitochondrial transcription factor A (TFAM) and the mitochondrial specific DNA polymerase, polymerase gamma (POLG). Initiation of mtDNA replication requires the transcription of an RNA primer precursor from a start site within the D-loop of mtDNA, enhanced by TFAM (FISHER and CLAYTON 1985, 1988). POLG then begins replication from the RNA primer and extends along the template (LEE and CLAYTON 1996; XU and CLAYTON 1996). For high fidelity polymerization, both the catalytic subunit (POLGA; GRAY and WONG 1992) and the accessory subunit (POLGB; GRAY and WONG 1992) are required.
In the fertilized mouse embryo, mtDNA replication is initiated at the late blastocyst stage (PIKO and MATSUMOTO 1976; PIKO and TAYLOR 1987). This marks the final stage of preimplantation development and is characterized by the blastomeres having differentiated into either the trophectoderm or the pluripotent inner cell mass cells (NAGY et al. 2003). This is morphologically distinct to the preceding stage, the morula. More recently, an early round of mtDNA replication was reported at the two-cell stage (MCCONNELL and PETRIE 2004), which coincides with activation of the murine embryonic genome (BOLTON et al. 1984). However, a subsequent report contended that mtDNA replication factors were not upregulated until the morula/blastocyst stages of in vitro fertilized (IVF) murine embryos and that there was no mtDNA replication during preimplantation development (THUNDATHIL et al. 2005). In bovine IVF embryos, TFAM activity is upregulated at the morula stage in readiness for the increased numbers of mtDNA copies observed at the blastocyst stage (MAY-PANLOUP et al. 2005). In contrast, initial observations have indicated premature expression of POLGA and TFAM in preimplantation ovine NT embryos when compared with IVF counterparts (LLOYD et al. 2006). In similar NT embryos, donor cell mtDNA persisted in blastocysts generated with donor cells containing both their full complement of mtDNA (mtDNA+) and those depleted to residual levels (mtDNAR) prior to reconstruction (LLOYD et al. 2006) suggesting that the donor cell was still expressing POLG and TFAM in the preimplantation embryo and thus preferentially replicating its own mtDNA population.
We hypothesize that mtDNA replication factors encoded by the donor cell are upregulated during preimplantation development of NT embryos. This is likely to be more so in embryos generated by mtDNAR cells where the donor nucleus would be attempting to restore its own mtDNA population. In a more diverse genetic model, this would result in either the premature replication of donor cell mtDNA in the preimplantation embryo due to the closer nucleo-mitochondrial genetic compatibility between the donor cell and its own mtDNA population or embryonic arrest due to the lack of compatibility between the donor cell and the recipient oocyte. We have therefore generated a series of IVF and NT (mtDNA+ and mtDNAR) ovine embryos, investigated their patterns of expression for PolG and TFAM, and also analyzed the donor cell prior to NT for expression of these genes. By performing intergeneric NT, we were able to compare the developmental competence between intra- and interspecific and intergeneric NT crosses and assess whether the genetic divergence between the donor cell and recipient oocyte mtDNA populations affects preimplantation development. Finally, we have determined whether upregulation of mtDNA replication factors during early preimplantation development mediated the preferential replication of donor cell mtDNA.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Production of cells depleted of mtDNA from primary culture:
Ovis aries (PDFF2 and SFF1) and Capra hircus (SFF2) fetal fibroblast primary cultures were depleted of mtDNA according to the protocol of KING and ATTARDI (1996). They were cultured in Dulbecco's modified Eagle's medium containing 4500 mg/liter glucose and 1 mM pyruvate, supplemented with 10% v/v fetal calf serum (FCS), 1 mM L-glutamine, 1% v/v penicillin–streptomycin solution, and 50 µg/ml uridine. Cells were cultured in the presence (depletion) or absence (Untr) of 50 ng/ml ethidium bromide (EtBr) to generate mtDNAR and mtDNA+ donor cells for NT, respectively.
Oocyte recovery and in vitro maturation (IVM):
Ovine ovaries were collected from a local slaughterhouse and transported to the laboratory in PBS at 25°. Cumulus–oocyte complexes (COCs) were obtained by aspiration of 3–8 mm follicles. COCs with dark evenly granulated cytoplasm and surrounded by 3–4 layers of cumulus cells were selected for in vitro maturation in culture medium TCM 199 (Gibco, Bristol, UK) supplemented with L-glutamine (100 mg/liter; Sigma Chemical, St. Louis), NaHCO3 (3 g/liter), Hepes (1400 mg/liter), pyruvate (250 mg/liter), L-lactic-Ca-salt (600 mg/liter), and gentamycin (55 mg/liter; Gibco). Groups of 35–40 oocytes were transferred to 4-well plates (Nunc, Roskilde, Denmark) with 400 µl culture medium containing 0.01 units b-FSH and b-LH supplemented with 10% FCS. After 17 hr maturation at 39° in 5% CO2 and maximum humidity, oocytes were stripped of their cumulus cells by incubation in hyaluronidase and vortexed for 4 min. Oocytes showing a dense cytoplasm and a well-extruded polar body were selected for NT.
The NT procedure was performed essentially as previously described by LEE and CAMPBELL (2006) with minor modifications. Briefly, oocytes were exposed for 15 min to 5 µg/ml cytochalasin B and 5 µg/ml Hoechst 33342. The metaphase chromosomes were removed within 1 hr in mPBS containing 5 µg/ml cytochalasin B and visualized under an epifluorescence microscope to confirm successful enucleation. Enucleated oocytes were maintained in maturation medium until transfer of the donor cell. For each experiment involving mtDNAR cells, the mtDNA+ cells were cultured to the same time point prior to use. Single serum starved donor cells were transferred into the perivitelline space of enucleated oocytes at 19–21 hr after maturation and the karyoplast–cytoplast complexes (KCCs) were exposed to a double electric pulse of 1.5 kV/cm for 25 µsec to initiate their fusion. KCCs were placed in the incubator in mSOF medium supplemented with 0.4% bovine serum albumin (BSA). Fusion rates were determined 30–60 min after the fusion pulse under a binocular microscope (Leica Microsystems, Buckinghamshire, UK).
Activation and embryo culture:
At 23–24 hr after in vitro maturation (2 hr postfusion), the fused KCCs were activated by a 5 min incubation in 7% ethanol followed by 5 hr culture in 10 µg/ml cycloheximide and 5 µg/ml cytochalasin B. Activated embryos were washed three times in culture medium before transfer into 100-µl drops of synthetic oviductal fluid (SOF) medium supplemented with 2% BME amino acids, 1% MEM nonessential amino acids, and 0.4% BSA, covered by paraffin oil, and cultured at 39° in a humidified atmosphere of 5% CO2, 5% O2, and 90% N2. At day 2, cleaved embryos were transferred to SOF medium supplemented with 10% FCS until day 7. For DNA analysis, if an embryo had not developed further after 24 hr it was then collected and stored for analysis. Those embryos used for the mRNA and protein analysis were collected as soon as they had reached the specific day of development required for analysis.
PCR amplification and DNA sequencing:
Total DNA was extracted from donor cells using the Puregene DNA isolation kit (Gentra Systems, Minneapolis) according to the manufacturer's cultured cells protocol. DNA was isolated from embryos by adding sterile ddH2O to a total of 4 µl followed by repeated freeze-thawing (LLOYD et al. 2006). PCR was performed in 20-µl reactions containing 2 µl oocyte DNA product or 200 ng whole cell DNA, 1x PCR buffer (Bioline, London), 1.5 mM MgCl2 (Bioline), 200 µM dNTPs (Bioline), 0.5 µM for each of the forward and reverse primers, and 2.5 units BioTaq DNA polymerase (Bioline). The ovine mtDNA D-loop was amplified with primers D1F (CTTCCCACTCCACAAGCC) and D4R (CCTCATGCATATAAGCACGTAC) to produce 543 bp; the ND1 gene was amplified with ND1F (CTCAACACTAGCAGAAACAA) and ND1R (TTAGTTGGTCGTAACGGAAT) to produce 295 bp; TFAM was amplified with ovTFAMF (GGCAGACTGGCAGGTATA) and ovTFAMR (CGAGGTCTTTTTGGTTTTCCA) to produce 164 bp; PolGA was amplified with ovPOLGAF (ACTGGCTGGACATCAGCAGT) and ovPOLGAR (GACAGTACTGCATCAGGTCC) to produce 194 bp; and PolGB with ovPOLGBF (GCCTTGGAGCACTATGTT) and ovPOLGBR (GAAGCTTCAGTCTTTTCACCG) to produce 148 bp; and inserts were ligated into the pCR4-TOPO cloning vector using primers M13F (TGTAAAACGACGGCCAGT) and M13R (CAGGAAACAGCTATGACC). Reactions were run on an MJ Research PTC-200 machine (GRI, Braintree, UK) at 95° for 5 min; followed by 35 cycles of 94° for 30 sec; annealing at 55° (D-loop), 51° (ND1), 54° (TFAM), 57° (PolGA), 53° (PolGB), and 55° (M13) for 30 sec; 72° for 30–90 sec; and a final 3 min at 72°. PCR products were resolved on 2% agarose gels (Gibco) at 100 V for 1 hr. Excised PCR product was purified using a QIAquick gel extraction kit (QIAGEN, London) according to the manufacturer's protocol. Purified PCR products were then sequenced according to the automated direct sequencing protocol (SULLIVAN et al. 1991) using a GeneAmp 9700 and the ABI PRISM BigDye terminator cycle sequencing ready reaction kit (Applied Biosystems, Foster City, CA) with the appropriate forward and reverse primers. Electrophoresis of cycle sequencing products was performed on an ABI PRISM 377 sequencer (Applied Biosystems).
Determination of evolutionary distance from sequence data:
Sequences were aligned using ClustalW (THOMPSON et al. 1994) following removal of singletons, i.e., those single nucleotide polymorphisms (SNPs) that arose in only one sequence. Aligned sequences were processed by the DNADIST program of the PHYLIP software version 3.6 (FELSENSTEIN 2004). Pairwise evolutionary distances based on sequence differences were calculated using the F84 model which accounts for differences in empirical base frequencies and transition/transversion ratios (FELSENSTEIN and CHURCHILL 1996).
Real-time PCR to determine mtDNA depletion and copy number:
mtDNA copy number was determined for each total DNA sample using a Rotorgene-3000 real-time PCR machine (Corbett Research, Mortlake, Australia) and the intercalator Sybr Green. Donor cell DNA was diluted to 10 ng/µl prior to amplification. ß-Actin (nuclear housekeeping gene) was amplified with ß-actinF (CATGTATGTGGCCATCCAGGCTG), ß-actinR (GACGCCGCAGTGGCCATCTC), and ND1 (mtDNA encoded) with NDF1 and NDR1 primers. Purified PCR product of the target gene of known concentration was used to produce standards consisting of 10-fold serial dilutions of the first standard. Each reaction contained 7.5 µl Sybr Green Absolute QPCR master mix (Abgene; Epsom, UK), 0.33 µM of each forward and reverse primer, and 2 µl DNA template at 10 ng/µl. Reaction conditions were 95° for 15 min followed by 50 cycles of 95° for 10 sec, annealing at 63° (ß-actin) or 51° (ND1) for 10 sec, and 72° for 20 sec. Fluorescence data were acquired in the FAM/Sybr channel during the extension phase. To eliminate the effects of primer dimerization, a further extension of 10 sec was included, just above the melting temperature, and fluorescence data were acquired. These values were subtracted from the first acquisition phase. Melt curve analysis was performed by ramping from 72 to 99° holding for 5 sec at each step and acquiring from the FAM/Sybr channel. The number of ND1 copies in a sample was divided by the number of cells present in the sample, as calculated from ß-actin, to give a value for mtDNA copy number per cell, as described by PONCHEL et al. (2003). For mtDNA analysis of embryos, half of the DNA content was used for allele-specific PCR and the remaining half used to determine the number of ND1 copies or to sequence the mtDNA D-loop.
Preparation of plasmids for standards:
To generate standards for real-time PCR, purified PCR product was ligated into a pCR4-TOPO cloning vector (Invitrogen, Paisley, UK) and then replicated in Escherichia coli according to the manufacturer's protocol. TOP10 E. coli (Invitrogen) were transformed, plated, and cultured at 37° before selection of a single colony and further amplification and extraction. The bacterial plasmids were extracted from E. coli using a QIAprep miniprep kit (QIAGEN) as per the manufacturer's protocol. Plasmids were amplified with M13F and -R primers as these bind to sites either side of the insert site in the cloning vector. This allowed amplification and sequencing of the entire insert.
Allele-specific (AS) real-time PCR analysis of NT embryos:
Following DNA sequencing of the mitochondrial ND1 gene from both C. hircus (donor) and O. aries (recipient), SNPs were identified and species-specific primers were designed for each allele. Two microliters of DNA extracted from a single embryo was amplified by conventional PCR using the primers ND1F and ND1R and purified to provide the template for AS real-time PCR analysis. Purified ND1 PCR product (2 ng/µl) was used in each 20-µl reaction, which also contained 1x buffer (Bioline); 1.5 mM MgCl2 (Bioline); 800 µM dNTPs (Chemicon International, Temecula, CA); 0.5 µM of each AS primer tagged with a sequence specific to either Amplifluor SNP FAM (donor cell, capasND1: GAAGGTGACCAAGTTCATGCTATAGGGCAAATGGCCCTGCG) or JOE (recipient oocyte, ovasND1: GAAGGTCGGAGTCAACGGATTATAGGGCGAATGGTCCGGCA) and 5 µM common reverse primer (ND1F2: GCAGAAACAAACCGAGCACC); 0.5 µl of each of the 20x Amplifluor SNP FAM and JOE primers (Chemicon International) and 1 unit Thermostart DNA polymerase (Abgene). Reactions were pipetted using a CAS1200 liquid handling system (Corbett Research). Real-time PCR was performed using the Rotorgene-3000 real-time PCR machine and software (Corbett Research). Reaction conditions were 8 cycles of 95° for 120 sec, 60° for 15 sec, and 72° for 15 sec; followed by 50 cycles of 95° for 20 sec, 60° for 15 sec, and 72° for 15 sec. Fluorescence was detected in the FAM and JOE channels during the annealing phase. Samples were run alongside two sets of 10-fold dilution standards, one for each allele. Reaction sensitivity was determined by preparing a number of reactions using different proportions (100:0; 50:50; 95:5; 99:1; 99.9:0.1; and 99.99:0.01%) of SFF1 and SFF2 ND1 purified PCR product inserted into plasmids. Each sample was quantified in both the FAM and JOE channels to allow the percentage of donor mtDNA present to be calculated.
RT–PCR analysis of donor cells and embryos:
The DNA-free RNA isolation kit for RT–PCR (Ambion, TX) was used to extract RNA from the collected donor cells. Extraction was performed according to the manufacturer's protocol using the instructions for mammalian cells with a microcentrifuge. RNA was extracted from embryos in pools of five using an RNAqueous-Micro Scale RNA isolation kit (Ambion) as per the manufacturer's protocol. RNA was incubated with DNaseI to ensure removal of contaminating DNA. Extracted RNA from cells was reverse transcribed to produce copy DNA (cDNA) using the reverse transcription system (Promega, Southampton, UK). Each reaction contained 800 ng RNA, 5 mM MgCl2, 1x RT buffer, 1 mM dNTPs, 12.5 µg/ml of each primer, 1 unit/µl RNAsin, and 0.75 unit/µl AMV reverse transcriptase. This was made up to a total volume of 20 µl sterile ddH2O. In addition, a set of reaction tubes contained all other reagents but no enzyme (no enzyme control), to control for contaminating DNA, or no RNA (no template control). The reaction was carried out at 42° for 2 hr using a MJ Research PTC-200 PCR machine. The cDNA was diluted to 10 ng/µl for use in PCR. RNA extracted from embryos was reverse transcribed using the Absolute 2-step QRT–PCR SYBR Green kit (Abgene) according to the manufacturer's protocol. The resulting cDNA was then diluted 1 in 10 in sterile ddH2O before analysis. Real-time PCR was performed using the same Sybr Green method described above for TFAM using primers ovTFAMF and ovTFAMR, PolGA with ovPOLGAF and ovPOLGAR, PolGB with ovPOLGBF and ovPOLGBR, and ß-actin with ß-actinF and ß-actinR. For each reaction, activation was at 95° for 15 min followed by 50 cycles of 95° for 10 sec, annealing at 63° (ß-actin), 54° (TFAM), 57° (PolGA), and 53° (PolGB) for 10–15 sec and an extension of 72° for 10–15 sec. A further extension for 10 sec, just above the melting temperature, acquired fluorescence data for primer dimers. This allowed fluorescence derived from primer dimers to be excluded from the mRNA values. Comparative quantitative analysis was conducted on cDNA from cells at various time points throughout EtBr depletion. For each sample, TFAM, PolGA, PolGB, and ß-actin were quantified and values for PolGA, PolGB, and TFAM were normalized to ß-actin to control for variations in cDNA concentration. This was achieved by incorporating the reaction efficiencies into an equation with the experimental Ct values from real-time PCR for each target gene (PolGA, PolGB, or TFAM) and the control gene (ß-actin), as described by PFAFFL (2001). This therefore gave a value for relative change in a target gene concentration between each sample and the initial untreated sample.
Immunocytochemistry:
Donor cells and embryos were analyzed using specific antibodies for expression of a mitochondrial-encoded subunit of cytochrome oxidase (COX) I (Molecular Probes, Invitrogen, Paisley, UK), and the nuclear-encoded POLG (Abcam, Cambridge, UK) and TFAM (Santa Cruz Biotechnologies, Santa Cruz, CA), factors involved in mtDNA replication and transcription. Cells and embryos were fixed in 2% formaldehyde for 1 hr, permeabilized with 1% (v/v) Triton X-100 for 30 min, and blocked in PBS containing 200 mM glycine and 2 mg/ml BSA for 30 min. For donor cells, primary antibody was added and incubated for 1 hr at 37°. Primary incubation was increased to 2 hr for embryos. Cells were then washed for 30 min in 0.1% Triton X-100 and labeled with the appropriate Alexa Fluor 488 anti-mouse (COXI), 488 anti-rabbit (POLG), or 594 anti-goat (TFAM) secondary antibody (Molecular Probes). Cells and embryos were washed and then counterstained with DAPI (Vectorshield, Vector Laboratories, Burlingame, CA). Slides were viewed using an Axioplan 2 imaging system, HBO100 (Zeiss, Hertfordshire, UK), and images were captured using an AxioCam HR digital camera (Zeiss) and the Axiovision LE Rel 4.2 program (Zeiss). In addition, embryos were viewed using a Leica DM IRE2 confocal microscope with Leica TCS SP2 scanner (Leica Microsystems) and data were collected by the Leica confocal software (Leica Microsystems). For fluorescence microscopy, DAPI was excited at 395 nm and detected at 420 nm; FITC was excited at 488 nm and detected between 515 and 565 nm; and rhodamine was excited at 450 nm and detected between 580 and 590 nm. To allow comparative analysis, images of samples and negative (secondary antibody only, –2° only) controls were captured using the same gain settings, as described previously in LLOYD et al. (2006). Images of samples were then compared against the respective 2° only control. For confocal microscopy, FITC was excited at 488 nm and detected between 500 and 535 nm, and rhodamine was excited at 594 nm and detected between 600 and 700 nm. Comparative analysis of protein expression in embryos through confocal microscopy was performed as described in LLOYD et al. (2006). Briefly, the auto gain function was switched off and the same gain and photomultiplier settings were used for each embryo analyzed so that the fluorescence intensity reflected true protein levels. Furthermore, channels were adjusted to remove any bleed before the images were taken. FITC and rhodamine images were acquired at the same time so each pair of images corresponded to the same section.
Statistical analysis:
Embryo RT–PCR analysis:
A one-way ANOVA with Bonferroni's post hoc tests was performed to test for significance in levels of mRNA expression between IVF embryos of different developmental stages for each gene. A two-way ANOVA with Bonferroni's post hoc tests was performed for each gene to determine whether differences in levels of mRNA expression were significant for embryos generated by IVF or NT using either mtDNA+ or mtDNAR donor cells at each developmental stage. Both tests were performed using GraphPad Prism version 4.0. Corrected values are presented where a value of P < 0.05 was deemed to be significant.
Donor cell RT–PCR analysis:
For each donor cell line, a one-way ANOVA test with Bonferroni's post hoc test was performed using GraphPad Prism version 4.0 to test for significance in levels of mRNA expression between samples. Corrected values of P < 0.05 were deemed significant.
Embryo development:
Differences in the frequencies of embryos undergoing cleavage or developing to each developmental stage between the mtDNA+- and mtDNAR-generated embryos were determined using a Fisher's exact test. A Bonferroni correction was applied and consequently P < 0.0125 was deemed to be significant. The difference between the ability of ovine and intergeneric embryos to reach blastocyst was determined using a chi-square test, where P < 0.05 was deemed significant.
Analysis of evolutionary distance:
The relationship between evolutionary distance and the ability of embryos to reach the blastocyst stage was analyzed using logistic regression using the statistical package R. P < 0.05 was deemed significant.
|
RESULTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
|
The expression of mtDNA replication factors in NT-derived embryos:
As donor cell mtDNA still persists throughout preimplantation development of mtDNA+ and mtDNAR embryos (LLOYD et al. 2006) and the donor cell is not fully reprogrammed prior to or following NT, we hypothesized that mtDNA replication factors would be upregulated in these preimplantation embryos. mRNA expression for PolGA for all IVF, mtDNA+, and mtDNAR-generated embryos was highly significantly different throughout preimplantation development (P < 0.0001). Furthermore, at the 2-cell stage, mRNA expression was significantly higher for the mtDNA+ (P < 0.001) and mtDNAR (P < 0.01) embryos when compared with the IVF embryos and was significantly lower at the morula stage (mtDNA+, P < 0.01; mtDNAR, P < 0.001; Figure 2A). The major difference between mtDNA+ and mtDNAR embryos was at the 16-cell stage. At this stage, PolGA mRNA expression was significantly higher in mtDNAR embryos compared to both mtDNA+ (P < 0.001) and IVF (P < 0.001) embryos. ICC analysis revealed that both sets of NT embryos expressed more POLGA protein between the 4-cell and 16-cell stages of preimplantation development (Figure 2B) than had been detected in IVF embryos (Figure 1B).
|
As TFAM has been proposed as a regulator of mtDNA copy number (EKSTRAND et al. 2004), we hypothesized that variable mRNA expression for POLGA and POLGB would alter TFAM expression. TFAM mRNA expression was highly significantly different throughout preimplantation development between each of the three sets of embryos (P < 0.0001). TFAM was also significantly upregulated in the mtDNA+ embryos at the 2-, 4-, and 8-cell stages (P < 0.001) in comparison to their IVF counterparts. Between the IVF and the mtDNAR embryos, mRNA expression was significantly higher for the mtDNAR embryos at the 2-cell and 8-cell stages (P < 0.001). A large increase in TFAM mRNA expression was also observed at the 16-cell stage in mtDNAR embryos when compared with IVF embryos (P < 0.001), although this was not significantly different from mtDNA+ embryos (P > 0.05). This was followed by a significant reduction at the morula stage when compared with both IVF and mtDNA+ embryos (P < 0.001). The upregulation in mRNA expression is matched by the persistence of TFAM protein between the 4-cell and 16-cell stages in mtDNA+ (Figure 2C) and mtDNAR (data not shown) embryos, unlike their IVF counterparts (Figure 1B). PolGA, PolGB, and TFAM mRNA expression was similar at the blastocyst stage for each of the three embryo groups (P >0.05) as was protein expression for POLGA (Figure 2B).
Influence of mtDNA genetic divergence on development of NT embryos:
As mtDNA replication factors are upregulated in NT-derived preimplantation embryos, we hypothesized that the genetic divergence between the mtDNA haplotype of the donor cell and that of the recipient oocyte would affect development to blastocyst. Therefore, we randomly selected 58 previously generated ovine embryos consisting of 22 that arrested prior to the blastocyst stage and 36 blastocysts. These embryos were generated from two separate donor cell lines (PDFF2 and SFF1; see LLOYD et al. 2006), which had a genetic divergence of 0.0134% on the basis of mtDNA sequencing of their respective D-loops and pairwise analysis of aligned sequences in DNADIST. By measuring the mtDNA genetic distance between the donor cell and the recipient oocyte in each case, we were able to standardize the distance analyzed. Blastocysts were generated up to 0.0391% difference from the donor cell line, as determined by pairwise analysis of aligned sequences (range: 0.0022–0.0391%), while for those embryos arresting prior to the blastocyst stage the evolutionary distance ranged from 0.0112 to 0.0272%. However, logistic regression analysis determined that there was no significance difference in terms of the evolutionary distance between the donor cell line and recipient oocyte and development to blastocyst (Figure 3; embryos arresting prior to blastocyst: mean = 0.0186 ± SEM = 0.0010%; blastocyst: 0.0162 ± 0.0012%; 
2 = 1.02; P > 0.05). Consequently, failure to develop to blastocyst and the upregulation of PolGA, PolGB, and TFAM was not a result of a greater genetic divergence between some of the more distant fusion partners.
|
|
The effects of a more diverse donor nucleus on mtDNA replication:
As mtDNA replication factors are expressed during preimplantation development following NT, we hypothesized that they would be capable of mediating mtDNA replication. In this instance, we chose a more diverse genetic model where the mtDNA divergence between the donor cell and recipient oocyte would be outside the tested range (0.0391%) for successful development to blastocyst (Figure 3). In turn, we determined whether the donor cell would attempt to rescue its own mtDNA population, especially in mtDNAR embryos generated with low levels of donor mtDNA. To this extent, we chose a C. hircus fetal fibroblast cell line (SFF2), which we depleted with EtBr.
Unexpectedly, the untreated SFF2 cells increased mtDNA copy number throughout depletion from 1129 ± 173.5 copies at day 8 to 4276 ± 158.8 copies by day 112 (Table 1). This is in contrast to the untreated SSF1 cells where mtDNA copy number decreased from 4241 ± 411 copies per cell after 3 days to 896 ± 54.7 copies at day 95. While depletion of SFF2 cells was gradual with 361 ± 22.6 copies being present after 74 days and 152 ± 9.5 copies after 90 days, no detectable mtDNA was present after 112 days in EtBr. In contrast, mtDNA copy number decreased rapidly in SFF1 cells to 464 ± 41.6 copies after 3 days. This was further reduced to 40 ± 0.5 copies after 14 days followed by more gradual depletion (Table 1).
|
|
|
2 = 50.8; P < 1 x 10–12). To determine whether POLG persisted throughout early preimplantation development of these embryos, we analyzed mtDNAR and mtDNA+ embryos for protein expression (Figure 6). Both sets of embryos expressed POLGA from the 1- to 12-cell stages (Figure 6: mtDNA+, x–xii; mtDNAR, xxi–xxiii), although levels appeared to be slightly higher in the mtDNA+ embryos from the 5- to 12-cell stages (Figure 6, xi and xii) than in the mtDNAR embryos (Figure 6, xxii and xxiii). Similar outcomes were observed for COXI (Figure 6: mtDNA+, ii and iii; mtDNAR, xiv and xv), demonstrating that the mtDNA was being transcribed and synthesized into protein.
|
|
|
|
DISCUSSION |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Unlike IVF embryos, the NT embryos generated with both mtDNA+ and mtDNAR cells were unable to tightly regulate mtDNA replication factor expression. In NT embryos, TFAM, PolGA, and PolGB were all being transcribed at significantly higher levels at the 2-cell stage for both mtDNA+ and mtDNAR embryos and that protein synthesized for POLGA and TFAM at this stage persisted through to the 16-cell stage. This most likely accounts for the persistence of the donor mtDNA identified in blastocysts, which would otherwise be diluted out (STEINBORN et al. 1998). This is especially so as the somatic donor cell would contribute up to 
4000 mtDNA copies (see Table 1) compared with a minimum of 100,000 oocyte copies required to support fertilization and early preimplantation embryonic division (EL SHOURBAGY et al. 2006). Furthermore, the significantly greater expression of TFAM and PolGA mRNA in mtDNAR embryos at the 16-cell stage most likely promotes the persistence of residual levels of donor cell mtDNA that was previously reported for mtDNAR-derived blastocysts (LLOYD et al. 2006). This early burst of mtDNA replication is not just limited to somatic cell nuclear transfer. Indeed, other oocyte reconstruction protocols, such as the transfer of murine zygotic karyoplasts into enucleated oocytes, have demonstrated increasing levels of donor mtDNA throughout preimplantation development (MEIRELLES and SMITH 1998). Furthermore, sperm mtDNA, which contributed to the donor blastomere used to derive cloned non-human primates, was also detected in such offspring (ST. JOHN and SCHATTEN 2004).
The role of donor cell mtDNA replication factors:
It is unlikely that the mRNA and protein expression for the mtDNA replication factors observed in NT embryos originated from the oocyte prior to NT. Several factors support this hypothesis. First, PolGA, PolGB, and TFAM are all downregulated during the final stages of oocyte maturation in those oocytes that are capable of fertilization, unlike those that fail to fertilize (SPIKINGS et al. 2007). Second, mRNA for PolGA, PolGB, and TFAM were not present at the 2-cell stage in our ovine IVF embryos (Figure 1A), although some protein expression was present at the 2-cell stage (Figure 1B) but not at the 4-cell stage (LLOYD et al. 2006). Third, mtDNA copy number is considerably reduced throughout early preimplantation development and returns to prefertilization levels only at the morula and blastocyst stages (MAY-PANLOUP et al. 2005; SPIKINGS et al. 2007). Consequently, the expression of the mtDNA replication factors observed in the donor cells prior to NT (Figures 4 and 5) most likely accounts for the continued expression during early preimplantation development.
Interestingly, though, the use of donor cells from varying time points during the culturing process may have induced other patterns of expression in the NT embryos. The SFF1 cell line showed marked changes in the expression of mtDNA replication factors, especially for PolGA and PolGB. However, long-term culture appeared to not have an effect on the expression of TFAM for either cell line while undergoing depletion (SFF1, Figure 4; SFF2, Figure 5) or for PolGA in SFF2 cells (Figure 5). While we have not observed significant changes in TFAM, others have, for example, observed compensatory mechanisms that either upregulated mRNA levels for TFAM in cells of patients with a mitochondrial disorder (JOSEPH et al. 2004) or reduced TFAM protein in mtDNA-depleted cells (SEIDEL-ROGOL and SHADEL 2002; JOSEPH et al. 2004). However, in accordance with our observations, PolG has been previously demonstrated to persist in cells completely depleted of their mtDNA copy (DAVIS et al. 1996).
The effects of genetic diversity on replication of donor cell mtDNA:
Although from our intergeneric model both mtDNA+ and mtDNAR embryos expressed mtDNA replication factors, it is evident that the vast majority of embryos failed to replicate their donor mtDNA population. Consequently, these embryos were homoplasmic for recipient oocyte mtDNA or exhibited levels of heteroplasmy below the limit of detection (0.01%). However, in a few embryos, some donor mtDNA was detected at considerably increased levels, clearly indicating the occurrence of premature mtDNA replication. While this could result from the close proximity of the somatic mtDNA to the nucleus (DAVIS and CLAYTON 1996), this is likely to have occurred only prior to the first cleavage stage, as the donor mtDNA will have dispersed to varying regions of the cytoplasm in the newly formed blastomeres (FULKA 2004). Consequently, in these exceptional cases, it is more likely that the nuclear-encoded replication factors interacted with their own mtDNA more efficiently and hence replicated it preferentially, especially as POLG was expressed throughout early development for both mtDNA+ and mtDNAR embryos (see Figure 6).
Development of intergeneric embryos:
The fusion of caprine donor cells with ovine recipient oocytes resulted in no embryos progressing through to blastocyst, which matched the outcomes for some intergeneric NT derivations (CHANG et al. 2003; JIANG et al. 2004, 2005) but not for others (CHEN et al. 2002; YANG et al. 2003; LIU et al. 2004). However, those embryos derived from mtDNAR donor cells persisted to the >16-cell stage to a significantly greater extent than the mtDNA+ embryos. The importance of this outcome is twofold. First, the mtDNAR embryos appeared to more readily complete EGA, unlike the mtDNA+ populations. Second, it has been demonstrated that somatic cell mtDNA can impair embryonic development while supplemented ooplasm containing mitochondria does not (TAKEDA et al. 2005). Consequently, the elimination of the vast majority of the donor mtDNA reduced the potential competition between the two populations of mtDNA, suggesting that the caprine mtDNA replication factors would need to transcribe and synthesize mainly ovine mtDNA to generate sufficient protein to contribute to the ETC. This is most likely to occur at the post-16-cell stage when transcription and protein synthesis of mtDNA replication factors normally take place in IVF embryos, i.e., post-EGA. As mtDNA replication and embryonic arrest coincide here, it suggests that nucleo-mitochondrial incompatibility between the mtDNA replication factors and the mtDNA genome could have accounted for subsequent failure to blastocyst.
The effects of evolutionary divergence on embryo development:
By analyzing three sets of embryos, two generated with one of two ovine donor cell lines with randomly selected ovine recipient oocytes and one with a caprine donor cell line and ovine oocytes, we were further able to determine that evolutionary distance influences embryonic development. The inability of the caprine–ovine embryos to reach blastocyst exemplified the incompatibility between the caprine nucleus and ovine oocyte mitochondria, which probably arose from the continuous decline in OXPHOS function as divergence increased (MCKENZIE et al. 2003). Indeed, it is evident that crosses within a certain genus are potentially within an acceptable evolutionary distance as evidenced by the live birth following the fusion of an O. musimon donor cell with an O. aries oocyte (LOI et al. 2001). In this instance, the evolutionary distance was <2 million years (HIENDLEDER et al. 1998). However, by increasing the evolutionary distance to 5–7 million years, as reported between Ovis and Capra (RANDI et al. 1991), it was unlikely that this intergeneric combination would yield complete preimplantation development, especially as the interspecific fusion between C. ibex donor cells and C. hircus oocytes resulted in development to only the morula stage (JIANG et al. 2004).
The effects of evolutionary divergence on function:
Embryos derived from genetically divergent fusion partners are likely to be compromised by (i) the compatibility of the two mitochondrial populations, where sequence variants between subspecies can encode for different amino acids (STEINBORN et al. 2002; ST. JOHN et al. 2005); and (ii) the potential incompatibility between the nuclear-encoded proteins of the ETC and the mtDNA-encoded genes that contribute proteins to each of the complexes except complex II. Indeed, the restrictions on nucleo-mitochondrial divergence are perhaps best exemplified by fusion of an enucleated somatic cell with another somatic cell to generate cybrids. The ability of nuclei from Homo sapiens to transcribe and replicate mtDNA from Gorilla gorilla, Pan troglodytes, and P. paniscus in cybrid cell lines verified a level of compatibility between these species (KENYON and MORAES 1997). However, resultant lines demonstrated decreases in both oxygen consumption and complex I activity of the ETC (BARRIENTOS et al. 1998). Similar outcomes have been observed for Mus musculus cybrids containing Rattus norvegicus mtDNA. These exhibited slower growth and respiratory rates than the parental cell lines or those cybrids containing M. spretus mtDNA (DEY et al. 2000). To this extent, complexes I and IV of the ETC had a 50% reduction in activity in these cell lines, clearly demonstrating OXPHOS disassembly and dysfunction. In the case of the more divergent mtDNA from Pongo pygmaeus under the control of a nucleus from H. sapiens, evolutionary distance was too great to support cybrid formation and mtDNA replication (KENYON and MORAES 1997).
In conclusion, we have demonstrated the strict regulation of mtDNA replication factors during preimplantation development of IVF embryos. However, NT embryos abnormally express such replication factors due to the continued expression of mtDNA replication factors by the donor cell during preimplantation development. This would account for the premature replication of donor mtDNA prior to the blastocyst stage of development in intra- and interspecific crosses. It is evident that, while crosses between different species or haplotypes of the same species can be achieved in some but not all cases, nucleo-mitochondrial interactions become suboptimal once a certain evolutionary distance is exceeded. This affects development to blastocyst and, in the vast majority of cases, results in the elimination of donor cell mtDNA, although those embryos generated with mtDNAR cells are more likely to reach the 16+-cell stage.
|
FOOTNOTES |
|---|
2 Present address: Institute of Zoology, Zoological Society of London, Regents Park, London NW1 4RY, UK.
|
LITERATURE CITED |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
ANDERSON, S., A. T. BANKIER, B. G. BARRELL, M. H. DE BRUIJN, A. R. COULSON et al., 1981 Sequence and organization of the human mitochondrial genome. Nature 290: 457–465.[CrossRef][Medline]
BAGUISI, A., E. BEHBOODI, D. T. MELICAN, J. S. POLLOCK, M. M. DESTREMPES et al., 1999 Production of goats by somatic cell nuclear transfer. Nat. Biotechnol. 17: 456–461.[CrossRef][Medline]
BARRIENTOS, A., L. KENYON and C. T. MORAES, 1998 Human xenomitochondrial cybrids. Cellular models of mitochondrial complex I deficiency. J. Biol. Chem. 273: 14210–14217.
BIRKY, JR., C. W., 1995 Uniparental inheritance of mitochondrial and chloroplast genes: mechanisms and evolution. Proc. Natl. Acad. Sci. USA 92: 11331–11338.
BOLTON, V. N., P. J. OADES and M. H. JOHNSON, 1984 The relationship between cleavage, DNA replication, and gene expression in the mouse 2-cell embryo. J. Embryol. Exp. Morphol. 79: 139–163.[Medline]
BORTVIN, A., K. EGGAN, H. SKALETSKY, H. AKUTSU, D. L. BERRY et al., 2003 Incomplete reactivation of Oct4-related genes in mouse embryos cloned from somatic nuclei. Development 130: 1673–1680.
CALARCO, P. G., and A. MCLAREN, 1976 Ultrastructural observations of preimplantation stages of the sheep. J. Embryol. Exp. Morphol. 36: 609–622.[Medline]
CAMPBELL, K. H., J. MCWHIR, W. A. RITCHIE and I. WILMUT, 1996 Sheep cloned by nuclear transfer from a cultured cell line. Nature 380: 64–66.[CrossRef][Medline]
CHANG, K. H., J. M. LIM, S. K. KANG, B. C. LEE, S. Y. MOON et al., 2003 Blastocyst formation, karyotype, and mitochondrial DNA of interspecies embryos derived from nuclear transfer of human cord fibroblasts into enucleated bovine oocytes. Fertil. Steril. 80: 1380–1387.[CrossRef][Medline]
CHEN, D. Y., D. C. WEN, Y. P. ZHANG, Q. Y. SUN, Z. M. HAN et al., 2002 Interspecies implantation and mitochondria fate of panda-rabbit cloned embryos. Biol. Reprod. 67: 637–642.
CIBELLI, J. B., S. L. STICE, P. J. GOLUEKE, J. J. KANE, J. JERRY et al., 1998 Cloned transgenic calves produced from nonquiescent fetal fibroblasts. Science 280: 1256–1258.
DAVIS, A. F., and D. A. CLAYTON, 1996 In situ localization of mitochondrial DNA replication in intact mammalian cells. J. Cell. Biol. 135: 883–893.
DAVIS, A. F., P.A. ROPP, D. A. CLAYTON and W. C. COPELAND, 1996 Mitochondrial DNA polymerase gamma is expressed and translated in the absence of mitochondrial DNA maintenance and replication. Nucleic Acids Res. 24: 2753–2759.
DEY, R., A. BARRIENTOS and C. T. MORAES, 2000 Functional constraints of nuclear-mitochondrial DNA interactions in xenomitochondrial rodent
