help button home button Genetics Mol Pharm
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Originally published as Genetics Published Articles Ahead of Print on March 4, 2007.

Genetics, Vol. 176, 703-709, May 2007, Copyright © 2007
doi:10.1534/genetics.106.070201

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
genetics.106.070201v1
176/1/703    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boerckel, J.
Right arrow Articles by Ahmed, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boerckel, J.
Right arrow Articles by Ahmed, S.

The Caenorhabditis elegans Rad17 Homolog HPR-17 Is Required for Telomere Replication

Julie Boerckel*, Dana Walker{dagger} and Shawn Ahmed*,{dagger},1

* Department of Biology and {dagger} Department of Genetics, University of North Carolina, Chapel Hill, North Carolina 27599-3280

1 Corresponding author: Department of Genetics, Coker Hall, University of North Carolina, Chapel Hill, NC 27599-3280.
E-mail: shawn{at}med.unc.edu

Manuscript received December 22, 2006. Accepted for publication February 22, 2007.


    ABSTRACT
 TOP
 ABSTRACT
 ACKNOWLEDGEMENTS
 LITERATURE CITED
 
Subunits of the Rad9/Rad1/Hus1 (9-1-1) proliferating cell nuclear antigen (PNCA)-like sliding clamp are required for DNA damage responses and telomerase-mediated telomere replication in the nematode Caenorhabditis elegans. PCNA sliding clamps are loaded onto DNA by a replication factor C (RFC) clamp loader. The C. elegans Rad17 RFC clamp loader homolog, hpr-17, functions in the same pathway as the 9-1-1 complex with regard to both the DNA damage response and telomerase-mediated telomere elongation. Thus, hpr-17 defines an RFC-like complex that facilitates telomerase activity in vivo in C. elegans.


TELOMERES, the ends of linear chromosomes, are typically composed of short repetitive sequences that are G-rich on the strand that runs 5'–3' to the chromosome terminus (BLACKBURN and GALL 1978). Double-stranded telomeric DNA terminates in 3' single-stranded overhangs that can loop back and invade the telomere duplex, forming a T-loop that may protect chromosome ends from degradation and suppress DNA damage signaling (GRIFFITH et al. 1999; KARLSEDER et al. 1999). Telomeric termini can shorten as a consequence of nucleolytic degradation, oxidative damage, or incomplete terminal replication by the lagging DNA strand synthesis machinery. The loss of telomeric sequence can be combated by telomerase, a ribonucleoprotein that adds telomere repeats to chromosome termini de novo. A number of proteins aside from the telomerase holoenzyme play roles in telomere maintenance (COLLINS 2006). Some of these proteins also respond to DNA damage, suggesting dual roles in preserving the integrity of the genome (D'ADDA DI FAGAGNA et al. 2004).

The Rad9/Rad1/Hus1 (9-1-1) proliferating cell nuclear antigen (PCNA)-like sliding clamp is an example of a DNA damage response complex that interacts with telomeres. The 9-1-1 complex was genetically identified in yeast as being required for checkpoint control in response to DNA damage (AL-KHODAIRY and CARR 1992; ROWLEY et al. 1992; CASPARI et al. 2000). Deletion of 9-1-1 complex subunits in yeast also results in short, stable telomeres (DAHLEN et al. 1998; LONGHESE et al. 2000; NAKAMURA et al. 2002). Chromatin immunoprecipitation analysis in Schizosaccharomyces pombe and mammals indicates that the 9-1-1 complex interacts with telomeric DNA (NAKAMURA et al. 2002; FRANCIA et al. 2006; VERDUN and KARLSEDER 2006). Additionally, in vitro telomerase activity was impaired by a mutation of HUS1 in mouse cells and by RNAi-mediated knockdown of HUS1 or RAD9 in human cells, suggesting that the mammalian 9-1-1 complex may play a direct role in telomere repeat addition (FRANCIA et al. 2006; PANDITA et al. 2006; VERDUN and KARLSEDER 2006). However, mammalian cells deficient for RAD9, HUS1, or RAD1 are inviable and exhibit various chromosomal abnormalities, including a dramatic reduction in telomere length (WEISS et al. 2000; BAO et al. 2004; FRANCIA et al. 2006; PANDITA et al. 2006). These severe effects preclude genetic pathway analysis from the perspective of telomerase because they are strikingly different from the comparatively mild telomere attrition observed when telomerase is deficient (FENG et al. 1995). In contrast, Caenorhabditis elegans 9-1-1 complex mutants are viable and display progressive telomere shortening phenotypes similar to those of telomerase mutants, allowing for genetic pathway studies to be conducted (MEIER et al. 2006).

Structural analysis of the yeast and mammalian 9-1-1 complex revealed that it resembles the PCNA sliding clamp, which is a DNA polymerase processivity factor that is loaded onto single-stranded DNA by a replication factor C (RFC) polymerase clamp loader (VENCLOVAS and THELEN 2000; GRIFFITH et al. 2002; BERMUDEZ et al. 2003). RFC clamp loaders are heteropentamers composed of four small constitutive subunits, RFC2–5, and one of four large RFC-like subunits. Three RFC subunits participate in both DNA metabolism and telomere maintenance: Rad17, Ctf18, and Elg1 (SMOLIKOV et al. 2004; AROYA and KUPIEC 2005; HIRAGA et al. 2006). Rad17 defines the large RFC subunit that can load the 9-1-1 PCNA-like sliding clamp onto single-stranded DNA at sites of damage (VOLKMER and KARNITZ 1999; GRIFFITH et al. 2002; BERMUDEZ et al. 2003; MAJKA and BURGERS 2003; MEISTER et al. 2003; YANG and ZOU 2006). In yeast, mutants deficient for Rad17 have short, stable telomeres. In addition, Rad17 associates weakly with telomeric DNA and has been suggested to act in the same telomere maintenance pathway as the 9-1-1 complex (DAHLEN et al. 1998; LONGHESE et al. 2000; NAKAMURA et al. 2002).

Given that Rad17 loads the 9-1-1 complex onto sites of DNA damage in yeast and mammals (VOLKMER and KARNITZ 1999; BERMUDEZ et al. 2003; YANG and ZOU 2006), and given that subunits of the 9-1-1 complex are essential for telomere maintenance in C. elegans (AHMED and HODGKIN 2000; HOFMANN et al. 2002), we asked if the C. elegans Rad17 homolog, hpr-17, is required for the 9-1-1 complex to function during telomere replication. Analysis of strains deficient for hpr-17 confirms that it functions in the same cell cycle arrest and apoptotic DNA damage response pathways as the C. elegans 9-1-1 complex subunits mrt-2 and hus-1. Additionally, HPR-17 acts in the same telomere maintenance pathway as the 9-1-1 complex and facilitates telomerase-mediated telomere replication.

hpr-17 mutants display DNA damage response defects:
The C. elegans Rad17 homolog, hpr-17, is predicted to encode a protein that is orthologous to Rad17 proteins ranging from yeast to mammals (data not shown). The HPR-17 protein contains an AAA ATPase domain (Figure 1A) that is essential for its ability to bind to DNA in an ATP-dependent manner (VENCLOVAS and THELEN 2000; LINDSEY-BOLTZ et al. 2001; BERMUDEZ et al. 2003; MAJKA and BURGERS 2003). tm1579 is a 738-bp deletion in the C. elegans hpr-17 gene that is predicted to confer an in-frame deletion that would eliminate 37 amino acids of the HPR-17 protein product, including a significant portion of the AAA ATPase domain, which may abrogate conformational changes that facilitate loading of the 9-1-1 complex onto single-stranded DNA (Figure 1A) (S. MITANI, personal communication). Strains homozygous for the hpr-17(tm1579) deletion were viable but displayed a decrease in brood size and a weak high incidence of males (Him) phenotype (data not shown). XO males arise as a consequence of loss of an X chromosome, suggesting a defect in chromosome stability (HODGKIN et al. 1979). Similar chromosome instability phenotypes have been observed for strains deficient for C. elegans 9-1-1 complex subunits (AHMED and HODGKIN 2000; GARTNER et al. 2000; AHMED et al. 2001; HOFMANN et al. 2002), with which hpr-17 is predicted to interact (BOULTON et al. 2002).


Figure 1
View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
FIGURE 1.— hpr-17 mutants are hypersensitive to ionizing radiation. (A) The C. elegans hpr-17 gene is located on chromosome II between rol-6 and unc-52. Boxes represent exons in a schematic representation of the genomic structure of hpr-17. Also shown are the locations of the AAA ATPase motif and the tm1579 mutation. To confirm that the tm1579 deletion was responsible for the Rad phenotype hpr-17(tm1579) mutant hermaphrodites were crossed with rol-6(e187),unc-52(e444)/+ males and F2 Rol-non-Unc recombinants were isolated. F3 progeny homozygous for each recombination event were tested for hypersensitivity to IR and propagated to determine if they displayed end-to-end chromosome fusion-mediated sterility. Additionally, arrows on the schematic indicate the location of PCR primers used to create the gene fragment for cosuppression-mediated gene silencing. The hpr-17 cosuppression PCR product includes the promoter region and five exons of a neighboring gene, F32A11.1. RNAi knockdown of F32A11.1 results in embryonic lethality and maternal-effect sterility (MAEDA et al. 2001; SONNICHSEN et al. 2005). Although some lethality was observed, this is consistent with reports of other 9-1-1 complex subunits (HOFMANN et al. 2002), and the hpr-17 cosuppression strains did not display maternal-effect sterility. Thus, expression of F32A11.1 is unlikely to be significantly affected in hpr-17 cosuppression strains. (B) Average levels of embryonic lethality (±SD) in response to different doses of IR for four independent lines of hpr-17(tm1579), mrt-2(e2663), and hus-1(op244) and their respective double mutants. To construct double mutants, standard genetic crosses were conducted utilizing visible markers adjacent to or flanking each gene: rol-6(e187),unc-52(e444) for hpr-17(tm1579); unc-11(e47) for hus-1(op244); dpy-18(e364),unc-64(e246) for mrt-2(e2663). Visible markers were selected against and the genotypes of all homozygous double-mutant lines were confirmed via PCR. The L4 assay was performed as previously described (AHMED and HODGKIN 2000). (C) Cosuppression lines, ypEx3 and ypEx4, display the same levels of embryonic lethality as hpr-17 in response to IR, whereas their non-Rol siblings, lacking the extrachromosomal arrays, mimic wild type. Averages of two independent experiments ±SD are shown. For cosuppression, PCR with primers hpr17cr (GCACACGAGAACGATTTTTCAAGC) and hpr17cf (ATCGCCTCCAGCTTCCTCTCC) was performed using N2 genomic DNA as a template. Mixtures of 24 ng/µl of rol-6 plasmid pCes1943 and 4 ng/µl of hpr-17 PCR product were injected into N2 Bristol wild-type hermaphrodites. Rol and non-Rol siblings for two independent lines {ypEx3 [hpr-17 rol-6(su1006)] and ypEx4 [hpr-17 rol-6(su1006)]} were propagated in parallel and tested for IR hypersensitivity, progressive sterility, and the presence of end-to-end chromosome fusions. (D) Germline sterility in response to increasing doses of IR for hpr-17(tm1279), mrt-2(e2663), and hus-1(op244) single mutants and their respective double mutants. Ten plates with pools of L1 larvae were tested for sterility and averages for two independent mutant lines per strain are shown. For L1 assays, six L1 larvae were picked to a single NGM plate, irradiated at the indicated dose, and scored for complete sterility after 1 week. Gamma irradiation was performed in a Shepherd Marc IV Cs137 irradiator at a dose rate of 430 Rad/min.

 
The C. elegans 9-1-1 complex mutants, mrt-2 and hus-1, are highly sensitive to ionizing radiation (IR), which causes various forms of DNA damage including double-strand breaks (AHMED and HODGKIN 2000; HOFMANN et al. 2002). A quantitative C. elegans assay for hypersensitivity to IR involves irradiation of L4 larvae, which contain many germ cells, and analysis of their progeny for embryonic lethality that occurs as a consequence of unrepaired DNA double-strand breaks and chromosome missegregation (CLEJAN et al. 2006). When subjected to moderate doses of ionizing radiation, mrt-2, hus-1, and hpr-17 strains displayed significant increases in levels of embryonic lethality when compared with irradiated wild-type controls (Figure 1B) (AHMED and HODGKIN 2000; AHMED et al. 2001; HOFMANN et al. 2002). To determine if the observed radiation hypersensitivity (Rad) phenotype of the hpr-17 strain cosegregated with the hpr-17(tm1579) deletion, three-factor crosses were conducted using rol-6 and unc-52 mutations, which map to +0.9 and +23.4 on chromosome II, respectively, and flank the hpr-17 locus at +14.8 (Figure 1A). Twelve of 20 (60%) Rol-non-Unc recombinants displayed the Rad phenotype, agreeing with an expected recombination frequency of 65%. To further confirm that hpr-17 might be responsible for the Rad phenotype of strains carrying the tm1579 deletion, the hpr-17 gene was silenced in germ cells of the N2 Bristol wild-type C. elegans strain by cosuppression-mediated gene silencing. To accomplish hpr-17 cosuppression, extrachromosomal arrays carrying a high copy number of a PCR product corresponding to the promoter and first 3.5 exons of hpr-17 (Figure 1A) were created in a wild-type background (DERNBURG et al. 2000), which should eliminate endogenous hpr-17 transcripts via a process that depends on components of the RNAi machinery (KETTING and PLASTERK 2000). Germlines of wild-type strains carrying either of two independent hpr-17 extrachromosomal arrays, ypEx3 or ypEx4, displayed Rad phenotypes that mimicked those of the hpr-17 deletion mutant (Figure 1C). Thus, cosuppression-mediated gene silencing of hpr-17 and analysis of the hpr-17 deletion tm1579 indicated that hpr-17 is required for responding to ionizing radiation in C. elegans, in agreement with a previously observed weak Rad phenotype induced by RNAi of hpr-17 and with a genomewide RNAi screen that suggested that hpr-17 may play a role in ensuring genome stability (BOULTON et al. 2002; POTHOF et al. 2003).

To determine if hpr-17 and subunits of the 9-1-1 complex act in the same pathway to facilitate the response to IR, double mutants were constructed. Progeny of IR-treated L4 larvae of hus-1 or mrt-2 single mutants and the hus-1;mrt-2 double mutant displayed levels of embryonic lethality that were not significantly different from one another, which agrees with data that these genes may physically interact (BOULTON et al. 2002), that the HUS-1 protein is mislocalized in mrt-2 mutants (HOFMANN et al. 2002), and with genetic and biochemical analysis of 9-1-1 complex subunits in yeast and mammals (AL-KHODAIRY and CARR 1992; ROWLEY et al. 1992; VOLKMER and KARNITZ 1999; CASPARI et al. 2000; GRIFFITH et al. 2002; BERMUDEZ et al. 2003; MAJKA and BURGERS 2003; MEISTER et al. 2003; YANG and ZOU 2006). Furthermore, hpr-17 single mutants and hpr-17;mrt-2 and hus-1;hpr-17 double mutants displayed similar levels of radiation hypersensitivity at the L4 stage, suggesting that they may act in the same DNA damage response pathway (Figure 1B). Additive or synergistic effects on IR sensitivity would have been expected if these mutations acted in different DNA damage response pathways. To further confirm these results, an irradiation assay was conducted using L1 larvae, an early C. elegans larval stage that harbors few germ cells. The dose at which L1 larvae of hpr-17, mrt-2, or hus-1 single mutants, as well as those of all respective double mutants, gave fully penetrating sterile phenotypes was 60 Gy (Figure 1D). Thus, independent radiation hypersensitivity assays using L1 or L4 larvae indicated that the 9-1-1 complex and the hpr-17 clamp loader act in the same DNA damage response pathway.

The 9-1-1 complex facilitates cell cycle arrest or apoptotic responses to damaged DNA that can be observed in C. elegans adult hermaphrodite germlines, which are composed of mitotic cells and cells at various stages of meiosis and gametogenesis. In wild-type C. elegans hermaphrodites, at a given moment, germ cells in the late pachytene stage of meiosis display a low level of apoptosis, which increases three- to fourfold in response to high doses of IR (Figure 2A) (GARTNER et al. 2000). mrt-2, hus-1, and hpr-17 mutants failed to initiate an apoptotic response to gamma irradiation (Figure 2A and data not shown) (GARTNER et al. 2000; HOFMANN et al. 2002), as previously suggested by a weak apoptosis defect observed upon RNAi of C. elegans hpr-17 (BOULTON et al. 2002). We observed a complete apoptosis defect for hpr-17, as expected if it functioned in the same DNA damage signaling pathway as the 9-1-1 complex. In wild-type germlines, cell cycle arrest occurs in mitotic germ cells in response to IR or to the ribonucleotide reductase inhibitor hydroxyurea (HU) (GARTNER et al. 2000; AHMED et al. 2001). The magnitude of a cell cycle arrest defect can be assessed by quantifying the relative change in the number of mitotic germ cells in response to genotoxic stress (GARTNER et al. 2004), and additive effects can be observed in double mutants that function in different cell cycle arrest pathways. In response to IR or HU, mrt-2, hus-1, and hpr-17 single mutants and hpr-17;mrt-2, hus-1;hpr-17, and hus-1;mrt-2 double mutants displayed cell cycle arrest defects that were significantly different from wild type (P < 0.01 and P < 0.04 for IR and HU treatment, respectively) but not from one another (Figure 2B). Our genetic studies indicate that the C. elegans Rad17 homolog may function in the same pathway as the 9-1-1 complex with regard to repair of IR-induced DNA double-strand breaks (Figure 1) and with regard to eliciting cell cycle arrest or apoptosis upon genotoxic stress (Figure 2). Thus, Rad17 may act via the 9-1-1 complex to initiate similar DNA damage signaling responses in vertebrates (WEISS et al. 2003; KOBAYASHI et al. 2004).


Figure 2
View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
FIGURE 2.— hpr-17(tm1579) is defective for apoptosis and cell cycle arrest in response to DNA damage. (A) mrt-2(e2663) and hpr-17(tm1579) mutants do not display an apoptotic response to IR. Each bar represents the average number of corpses counted for 20 germline arms ±SD. For analysis, L4 larvae were irradiated (120 Gy) and stained 24 hr post-IR with Acridine Orange (Molecular Probes, Eugene, OR) as described (GARTNER et al. 2004). Corpses were counted using a green fluorescent protein filter set at 40x magnification. (B) Levels of cell cycle arrest response are shown, as determined by comparing the number of mitotic cells in a germline arm with or without genotoxic stress (25 mM HU, solid bar, or 100 Gy IR, shaded bar). For all strains, the average based on four independent experiments ± SD is shown. IR and HU assays were based on previous experiments (AHMED et al. 2001). Late L4 larvae were picked and either irradiated (100 Gy) or placed on NGM plates containing hydroxyurea (25 mM). After 14 hr of HU treatment or 12 hr post-IR, animals were stained with 4',6-diamidino-2-phenylindole (DAPI) (Molecular Probes) as described (AHMED and HODGKIN 2000). All mitotic cells from the distal tip to the transition zone of the germline were counted using a Nikon E800 fluorescence microscope at 100x magnification, using a DAPI filter set.

 
HPR-17 may facilitate telomerase activity at telomeres:
Aside from their role in responding to DNA damage, subunits of the C. elegans 9-1-1 complex are required to maintain telomere length (AHMED and HODGKIN 2000; HOFMANN et al. 2002). As these mutants are propagated for multiple generations, fertility decreases as a consequence of telomere erosion and the formation of end-to-end chromosome fusions, which result in aneuploidy and sterility (AHMED and HODGKIN 2000; HOFMANN et al. 2002). Propagation of hpr-17 mutants for multiple generations resulted in progressive sterility (data not shown). In contrast to the normal complement of six bivalents observed in wild-type oocytes, chromosomes of late-generation hpr-17 oocytes had fused together, as observed in late-generation mrt-2, hus-1, or trt-1 mutants (Figure 3A and data not shown) (AHMED and HODGKIN 2000; HOFMANN et al. 2002; MEIER et al. 2006). Thus, fluorescence microscopy suggested that the progressive sterility observed in hpr-17 mutants may occur as a consequence of end-to-end chromosome fusions.


Figure 3
View larger version (57K):
[in this window]
[in a new window]
[Download PPT slide]
 
FIGURE 3.— hpr-17 is required for telomerase-mediated telomere repeat addition. (A) Oocyte nuclei from DAPI-stained adult hermaphrodites. Wild-type N2 Bristol strain displays six bivalent chromosomes (enclosed with a dashed line) whereas hpr-17(tm1579), trt-1(ok410), and mrt-2(e2663) mutants display chromosome fusions as a result of telomere dysfunction. (B) Progressive telomere shortening was observed for successive generations of trt-1(ok410), hpr-17(tm1579), mrt-2(e2663), or hus-1(op244)1 single mutants and the indicated double mutants. Southern blot analysis was performed using a (TTAGGC)n probe as described (AHMED and HODGKIN 2000). Marker positions (kilobases) are shown to the left of the blot. To construct the trt-1(ok410);hpr-17(tm1579) double mutants, standard genetic crosses were conducted utilizing visible markers adjacent to or flanking each gene: rol-6(e187),unc-52(e444) for hpr-17(tm1579) and unc-29(e193) for trt-1(ok410). Visible markers were selected against and the genotypes of all homozygous double-mutant lines were confirmed via PCR. (C) Telomere shortening rates. Changes in telomere length were calculated for multiple telomeres per strain. Average rates of telomere shortening per generation are shown (±SD).

 
When X–autosome end-to-end chromosome fusions are heterozygous, a dominant nondisjunction phenotype occurs that can be mapped to the left or the right end of the X chromosome (AHMED and HODGKIN 2000; MEIER et al. 2006). To determine if the chromosome fusions visible in late-generation hpr-17 mutant lines were end-to-end fusions, late-generation hpr-17 hermaphrodites were crossed with wild-type males and F1 cross-progeny were identified that displayed a dominant chromosome loss phenotype. Two independent X–autosome fusions were isolated from hpr-17 mutants in this manner, both of which displayed breakpoints that mapped to the right end of the X chromosome (data not shown). In addition, the hpr-17 cosuppression lines ypEx3 and ypEx4 became progressively sterile and displayed chromosome fusions, as observed by DAPI staining (data not shown). Confirmation of the presence of end-to-end chromosome fusions was obtained by isolating an X–autosome chromosome fusion from ypEx4, whose X-linked fusion breakpoint mapped to the right end of the X chromosome (data not shown).

The above results indicate that strains deficient for hpr-17 become progressively sterile as a consequence of end-to-end chromosome fusions, which can result from progressive telomere erosion, as observed in C. elegans mutants deficient for telomerase-mediated telomere replication (MEIER et al. 2006). Southern blotting revealed that hpr-17 mutants displayed progressive telomere shortening (Figure 3B). Previously, the mrt-2 9-1-1 complex subunit was shown to act in the same telomere replication pathway as trt-1, the telomerase reverse transcriptase, as double mutants displayed the same rate of telomere shortening (MEIER et al. 2006). To show that hpr-17 acts in the same pathway as trt-1 and the 9-1-1 complex subunits mrt-2 and hus-1, double mutants were constructed, and DNA was prepared from both single and double mutants that were propagated for multiple generations (n > 4 independent strains for each genotype). Southern blot analysis of hpr-17, mrt-2, or hus-1 single mutants revealed rates of telomere shortening similar to those of trt-1 (P > 0.3) (Figure 3, B and C). Additionally, double mutants of hpr-17 with mrt-2, hus-1, or trt-1 displayed rates of telomere shortening that were not significantly different from those of the single mutants (P > 0.6) (Figure 3, B and C). Thus, hpr-17 acts in the same pathway as mrt-2 and hus-1 with respect to telomerase-mediated telomere elongation.

Studies in yeast, nematodes, and humans suggest that the 9-1-1 complex and Rad17 may play a variable role at chromosome ends. Yeast 9-1-1 complex and Rad17 mutants display short telomeres, indicating that telomerase is functional but may be impaired (DAHLEN et al. 1998; LONGHESE et al. 2000; NAKAMURA et al. 2002). In contrast, C. elegans 9-1-1 complex and hpr-17 mutants display progressive telomere shortening phenotypes that result in sterility, suggesting a complete loss of telomerase activity in these mutants (Figure 3) (AHMED and HODGKIN 2000; HOFMANN et al. 2002). Furthermore, our genetic studies indicated that hpr-17 acts in the same telomere maintenance pathway as both the 9-1-1 complex and telomerase in vivo (Figure 3). In agreement with our genetic evidence, biochemical analysis from mammalian cells has shown that members of the 9-1-1 complex and RAD17 can bind telomeric DNA and facilitate in vitro telomerase activity (FRANCIA et al. 2006; VERDUN and KARLSEDER 2006). However, deficiency for the mammalian RAD17 and the 9-1-1 complex subunits causes immediate and severe rather than progressive effects on telomere length, suggesting that it may play an additional role at mammalian telomeres (FRANCIA et al. 2006; VERDUN and KARLSEDER 2006). Metaphase spreads of both human and mouse cells lacking RAD9, RAD1, or HUS1 display increased levels of chromosome abnormalities such as chromatid breaks, aneuploidy, dicentrics, and telomere loss, and multiple abnormalities are observed within a single cell (WEISS et al. 2000; BAO et al. 2004; PANDITA et al. 2006). Thus, the chromosomal dysfunction observed in mammalian cells deficient for the 9-1-1 complex or RAD17 may produce indirect effects on telomere stability, perhaps as a consequence of recruitment of DNA damage response proteins that facilitate telomere capping to unrepaired sites of endogenous DNA damage (D'ADDA DI FAGAGNA et al. 2004). Alternatively, the mammalian 9-1-1 complex may play an additional telomerase-independent function in telomere length homeostasis. We conclude that the 9-1-1 complex and its RFC clamp loader, Rad17, are likely to play a conserved essential role in facilitating telomerase activity in multicellular organisms, which may be masked as a consequence of neofunctionalization in mammals.

The DNA damage response phenotypes of yeast, nematodes, and mammalian cells deficient for the 9-1-1 complex and Rad17 suggest that they may be recruited to chromosome ends as a consequence of a telomeric structure that resembles damaged DNA. Given that mrt-2 is defective for repair of IR-induced double-strand breaks (CLEJAN et al. 2006), telomeric termini may trigger a double-strand break DNA damage response via hpr-17 and the 9-1-1 complex when they unfold during S phase. This hypothesis is supported by the localization of other double-strand break repair proteins such as Ku and the MRN complex to telomeres (SONG et al. 2000; ZHU et al. 2000; BERTUCH and LUNDBLAD 2003). Further, the absence of TRF2 results in unprotected telomeres that trigger a DNA damage response via ATM, a double-strand break sensing kinase (KARLSEDER et al. 2004; CELLI and DE LANGE 2005). However, C. elegans mrt-2, hus-1, and hpr-17 mutants are also defective in initiating cell cycle arrest in response to HU (Figure 2), which results in stalled replication forks. The replication of highly repetitive telomeric DNA sequences may yield slipped DNA structures that cause replication fork arrest, which may be sufficient to recruit the 9-1-1 complex to telomeres during S phase (FOUCHE et al. 2006). Evidence for this hypothesis in mammalian cells shows that ATR, which responds primarily to replication-associated repair, is recruited to telomeric DNA in late S phase where it phosphorylates RAD17 (VERDUN and KARLSEDER 2006). It is also possible that the unraveling of chromatin or telomere-binding proteins at the T-loop, which resembles a recombination intermediate, might be sufficient to trigger a DNA damage response. In this context, deficiency for the 9-1-1 complex subunit mrt-2 has been shown to result in aberrant homologous recombination events (HARRIS et al. 2006). In addition, mrt-2 suppresses chromosome rearrangements that flank G-rich DNA tracts, which may resemble the G-rich strand of telomeric DNA in their ability to form noncanonical G quadruplex structures (HARRIS et al. 2006). Once bound to telomeric DNA, the 9-1-1 complex may facilitate the recruitment of telomerase to chromosome ends, perhaps by modulating processing of the chromosome terminus or by acting to tether telomerase during telomere repeat addition (FRANCIA et al. 2006; VERDUN and KARLSEDER 2006), as might be expected for a protein complex homologous to the PCNA polymerase clamp.


    ACKNOWLEDGEMENTS
 TOP
 ABSTRACT
 ACKNOWLEDGEMENTS
 LITERATURE CITED
 
We apologize to members of the field whose work was not discussed due to space considerations. We thank the National Bioresource Project for Experimental Animal C. elegans (Shohei Mitani) for providing the deletion mutant hpr-17(tm1579); the Caenorhabditis Genetics Center for providing strains; members of the Ahmed lab for discussion, technical assistance, and critical reading of the manuscript; and the Triangle Worm Group for discussion. J.B., D.W., and S.A. were supported by National Institutes of Health grant GM066228.


    LITERATURE CITED
 TOP
 ABSTRACT
 ACKNOWLEDGEMENTS
 LITERATURE CITED
 

AHMED, S., and J. HODGKIN, 2000 MRT-2 checkpoint protein is required for germline immortality and telomere replication in C. elegans. Nature 403: 159–164.[CrossRef][Medline]

AHMED, S., A. ALPI, M. O. HENGARTNER and A. GARTNER, 2001 C. elegans RAD-5/CLK-2 defines a new DNA damage checkpoint protein. Curr. Biol. 11: 1934–1944.[CrossRef][Medline]

AL-KHODAIRY, F., and A. M. CARR, 1992 DNA repair mutants defining G2 checkpoint pathways in Schizosaccharomyces pombe. EMBO J. 11: 1343–1350.[Medline]

AROYA, S. B., and M. KUPIEC, 2005 The Elg1 replication factor C-like complex: a novel guardian of genome stability. DNA Repair 4: 409–417.[Medline]

BAO, S., T. LU, X. WANG, H. ZHENG, L. E. WANG et al., 2004 Disruption of the Rad9/Rad1/Hus1 (9–1-1) complex leads to checkpoint signaling and replication defects. Oncogene 23: 5586–5593.[CrossRef][Medline]

BERMUDEZ, V. P., L. A. LINDSEY-BOLTZ, A. J. CESARE, Y. MANIWA, J. D. GRIFFITH et al., 2003 Loading of the human 9–1-1 checkpoint complex onto DNA by the checkpoint clamp loader hRad17-replication factor C complex in vitro. Proc. Natl. Acad. Sci. USA 100: 1633–1638.[Abstract/Free Full Text]

BERTUCH, A. A., and V. LUNDBLAD, 2003 The Ku heterodimer performs separable activities at double-strand breaks and chromosome termini. Mol. Cell. Biol. 23: 8202–8215.[Abstract/Free Full Text]

BLACKBURN, E. H., and J. G. GALL, 1978 A tandemly repeated sequence at the termini of the extrachromosomal ribosomal RNA genes in Tetrahymena. J. Mol. Biol. 120: 33–53.[CrossRef][Medline]

BOULTON, S. J., A. GARTNER, J. REBOUL, P. VAGLIO, N. DYSON et al., 2002 Combined functional genomic maps of the C. elegans DNA damage response. Science 295: 127–131.[Abstract/Free Full Text]

CASPARI, T., M. DAHLEN, G. KANTER-SMOLER, H. D. LINDSAY, K. HOFMANN et al., 2000 Characterization of Schizosaccharomyces pombe Hus1: a PCNA-related protein that associates with Rad1 and Rad9. Mol. Cell. Biol. 20: 1254–1262.[Abstract/Free Full Text]

CELLI, G. B., and T. DE LANGE, 2005 DNA processing is not required for ATM-mediated telomere damage response after TRF2 deletion. Nat. Cell Biol. 7: 712–718.[CrossRef][Medline]

CLEJAN, I., J. BOERCKEL and S. AHMED, 2006 Developmental modulation of nonhomologous end joining in Caenorhabditis elegans. Genetics 173: 1301–1317.[Abstract/Free Full Text]

COLLINS, K., 2006 The biogenesis and regulation of telomerase holoenzymes. Nat. Rev. Mol. Cell. Biol. 7: 484–494.[CrossRef][Medline]

D'ADDA DI FAGAGNA, F., S. H. TEO and S. P. JACKSON, 2004 Functional links between telomeres and proteins of the DNA-damage response. Genes Dev. 18: 1781–1799.[Abstract/Free Full Text]

DAHLEN, M., T. OLSSON, G. KANTER-SMOLER, A. RAMNE and P. SUNNERHAGEN, 1998 Regulation of telomere length by checkpoint genes in Schizosaccharomyces pombe. Mol. Biol. Cell 9: 611–621.[Abstract/Free Full Text]

DERNBURG, A. F., J. ZALEVSKY, M. P. COLAIACOVO and A. M. VILLENEUVE 2000 Transgene-mediated cosuppression in the C. elegans germ line. Genes Dev. 14: 1578–1583.[Abstract/Free Full Text]

FENG, J., W. D. FUNK, S. S. WANG, S. L. WEINRICH, A. A. AVILION et al., 1995 The RNA component of human telomerase. Science 269: 1236–1241.[Abstract/Free Full Text]

FOUCHE, N., S. OZGUR, D. ROY and J. D. GRIFFITH, 2006 Replication fork regression in repetitive DNAs. Nucleic Acids Res. 34: 6044–6050.[Abstract/Free Full Text]

FRANCIA, S., R. S. WEISS, M. P. HANDE, R. FREIRE and F. D'ADDA DI FAGAGNA, 2006 Telomere and telomerase modulation by the mammalian Rad9/Rad1/Hus1 DNA-damage-checkpoint complex. Curr. Biol. 16: 1551–1558.[CrossRef][Medline]

GARTNER, A., S. MILSTEIN, S. AHMED, J. HODGKIN and M. O. HENGARTNER, 2000 A conserved checkpoint pathway mediates DNA damage–induced apoptosis and cell cycle arrest in C. elegans. Mol. Cell 5: 435–443.[CrossRef][Medline]

GARTNER, A., A. J. MACQUEEN and A. M. VILLENEUVE, 2004 Methods for analyzing checkpoint responses in Caenorhabditis elegans. Methods Mol. Biol. 280: 257–274.[Medline]

GRIFFITH, J. D., L. COMEAU, S. ROSENFIELD, R. M. STANSEL, A. BIANCHI et al., 1999 Mammalian telomeres end in a large duplex loop. Cell 97: 503–514.[CrossRef][Medline]

GRIFFITH, J. D., L. A. LINDSEY-BOLTZ and A. SANCAR, 2002 Structures of the human Rad17-replication factor C and checkpoint Rad 9–1-1 complexes visualized by glycerol spray/low voltage microscopy. J. Biol. Chem. 277: 15233–15236.[Abstract/Free Full Text]

HARRIS, J., M. LOWDEN, I. CLEJAN, M. TZONEVA, J. H. THOMAS et al., 2006 Mutator phenotype of Caenorhabditis elegans DNA damage checkpoint mutants. Genetics 174: 601–616.[Abstract/Free Full Text]

HIRAGA, S., E. D. ROBERTSON and A. D. DONALDSON, 2006 The Ctf18 RFC-like complex positions yeast telomeres but does not specify their replication time. EMBO J. 25: 1505–1514.[CrossRef][Medline]

HODGKIN, J., H. R. HORVITZ and S. BRENNER, 1979 Nondisjunction mutants of the nematode Caenorhabditis elegans. Genetics 91: 67–94.[Abstract/Free Full Text]

HOFMANN, E. R., S. MILSTEIN, S. J. BOULTON, M. YE, J. J. HOFMANN et al., 2002 Caenorhabditis elegans HUS-1 is a DNA damage checkpoint protein required for genome stability and EGL-1-mediated apoptosis. Curr. Biol. 12: 1908–1918.[CrossRef][Medline]

KARLSEDER, J., D. BROCCOLI, Y. DAI, S. HARDY and T. DE LANGE, 1999 p53- and ATM-dependent apoptosis induced by telomeres lacking TRF2. Science 283: 1321–1325.[Abstract/Free Full Text]

KARLSEDER, J., K. HOKE, O. K. MIRZOEVA, C. BAKKENIST, M. B. KASTAN et al., 2004 The telomeric protein TRF2 binds the ATM kinase and can inhibit the ATM-dependent DNA damage response. PLoS Biol. 2: E240.[CrossRef][Medline]

KETTING, R. F., and R. H. PLASTERK, 2000 A genetic link between co-suppression and RNA interference in C. elegans. Nature 404: 296–298.[CrossRef][Medline]

KOBAYASHI, M., A. HIRANO, T. KUMANO, S. L. XIANG, K. MIHARA et al., 2004 Critical role for chicken Rad17 and Rad9 in the cellular response to DNA damage and stalled DNA replication. Genes Cells 9: 291–303.[Abstract/Free Full Text]

LINDSEY-BOLTZ, L. A., V. P. BERMUDEZ, J. HURWITZ and A. SANCAR, 2001 Purification and characterization of human DNA damage checkpoint Rad complexes. Proc. Natl. Acad. Sci. USA 98: 11236–11241.[Abstract/Free Full Text]

LONGHESE, M. P., V. PACIOTTI, H. NEECKE and G. LUCCHINI, 2000 Checkpoint proteins influence telomeric silencing and length maintenance in budding yeast. Genetics 155: 1577–1591.[Abstract/Free Full Text]

MAEDA, I., Y. KOHARA, M. YAMAMOTO and A. SUGIMOTO, 2001 Large-scale analysis of gene function in Caenorhabditis elegans by high-throughput RNAi. Curr. Biol. 11: 171–176.[CrossRef][Medline]

MAJKA, J., and P. M. BURGERS, 2003 Yeast Rad17/Mec3/Ddc1: a sliding clamp for the DNA damage checkpoint. Proc. Natl. Acad. Sci. USA 100: 2249–2254.[Abstract/Free Full Text]

MEIER, B., I. CLEJAN, Y. LIU, M. LOWDEN, A. GARTNER et al., 2006 trt-1 is the Caenorhabditis elegans catalytic subunit of telomerase. PLoS Genet. 2: e18.[CrossRef][Medline]

MEISTER, P., M. POIDEVIN, S. FRANCESCONI, I. TRATNER, P. ZARZOV et al., 2003 Nuclear factories for signalling and repairing DNA double strand breaks in living fission yeast. Nucleic Acids Res. 31: 5064–5073.[Abstract/Free Full Text]

NAKAMURA, T. M., B. A. MOSER and P. RUSSELL, 2002 Telomere binding of checkpoint sensor and DNA repair proteins contributes to maintenance of functional fission yeast telomeres. Genetics 161: 1437–1452.[Abstract/Free Full Text]

PANDITA, R. K., G. G. SHARMA, A. LASZLO, K. M. HOPKINS, S. DAVEY et al., 2006 Mammalian Rad9 plays a role in telomere stability, S- and G2-phase-specific cell survival, and homologous recombinational repair. Mol. Cell. Biol. 26: 1850–1864.[Abstract/Free Full Text]

POTHOF, J., G. VAN HAAFTEN, K. THIJSSEN, R. S. KAMATH, A. G. FRASER et al., 2003 Identification of genes that protect the C. elegans genome against mutations by genome-wide RNAi. Genes Dev. 17: 443–448.[Abstract/Free Full Text]

ROWLEY, R., S. SUBRAMANI and P. G. YOUNG, 1992 Checkpoint controls in Schizosaccharomyces pombe: rad1. EMBO J. 11: 1335–1342.[Medline]

SMOLIKOV, S., Y. MAZOR and A. KRAUSKOPF, 2004 ELG1, a regulator of genome stability, has a role in telomere length regulation and in silencing. Proc. Natl. Acad. Sci. USA 101: 1656–1661.[Abstract/Free Full Text]

SONG, K., D. JUNG, Y. JUNG, S. G. LEE and I. LEE, 2000 Interaction of human Ku70 with TRF2. FEBS Lett. 481: 81–85.[CrossRef][Medline]

SONNICHSEN, B., L. B. KOSKI, A. WALSH, P. MARSCHALL, B. NEUMANN et al., 2005 Full-genome RNAi profiling of early embryogenesis in Caenorhabditis elegans. Nature 434: 462–469.[CrossRef][Medline]

VENCLOVAS, C., and M. P. THELEN, 2000 Structure-based predictions of Rad1, Rad9, Hus1 and Rad17 participation in sliding clamp and clamp-loading complexes. Nucleic Acids Res. 28: 2481–2493.[Abstract/Free Full Text]

VERDUN, R. E., and J. KARLSEDER, 2006 The DNA damage machinery and homologous recombination pathway act consecutively to protect human telomeres. Cell 127: 709–720.[CrossRef][Medline]

VOLKMER, E., and L. M. KARNITZ, 1999 Human homologs of Schizosaccharomyces pombe rad1, hus1, and rad9 form a DNA damage-responsive protein complex. J. Biol. Chem. 274: 567–570.[Abstract/Free Full Text]

WEISS, R. S., T. ENOCH and P. LEDER, 2000 Inactivation of mouse Hus1 results in genomic instability and impaired responses to genotoxic stress. Genes Dev. 14: 1886–1898.[Abstract/Free Full Text]

WEISS, R. S., P. LEDER and C. VAZIRI, 2003 Critical role for mouse Hus1 in an S-phase DNA damage cell cycle checkpoint. Mol. Cell. Biol. 23: 791–803.[Abstract/Free Full Text]

YANG, X. H., and L. ZOU, 2006 Recruitment of ATR-ATRIP, Rad17, and 9–1-1 complexes to DNA damage. Methods Enzymol. 409: 118–131.[Medline]

ZHU, X. D., B. KUSTER, M. MANN, J. H. PETRINI and T. DE LANGE, 2000 Cell-cycle-regulated association of RAD50/MRE11/NBS1 with TRF2 and human telomeres. Nat. Genet. 25: 347–352.[CrossRef][Medline]

Communicating editor: D. I. GREENSTEIN




This article has been cited by other articles:


Home page
GeneticsHome page
J. L. Yanowitz
Genome Integrity Is Regulated by the Caenorhabditis elegans Rad51D Homolog rfs-1
Genetics, May 1, 2008; 179(1): 249 - 262.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
genetics.106.070201v1
176/1/703    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boerckel, J.
Right arrow Articles by Ahmed, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boerckel, J.
Right arrow Articles by Ahmed, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Copyright © 2007 by the Genetics Society of America.