- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Kirchner, J.
- Articles by Alphey, L.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Kirchner, J.
- Articles by Alphey, L.
Genetics, Vol. 176, 273-281, May 2007, Copyright © 2007
doi:10.1534/genetics.106.069914
Essential, Overlapping and Redundant Roles of the Drosophila Protein Phosphatase 1
and 1ß Genes
Jasmin Kirchner*,
Sascha Gross*,1,
Daimark Bennett* and
Luke Alphey*,
,2
* Department of Zoology, University of Oxford, Oxford OX1 3PS, United Kingdom and
Oxitec, Oxford OX14 4RX, United Kingdom
2 Corresponding author: Department of Zoology, University of Oxford, South Parks Rd., Oxford OX1 3PS, United Kingdom.
E-mail: luke.alphey{at}zoo.ox.ac.uk
Protein serine/threonine phosphatase type 1 (PP1) has been found in all eukaryotes examined to date and is involved in the regulation of many cellular functions, including glycogen metabolism, muscle contraction, and mitosis. In Drosophila, four genes code for the catalytic subunit of PP1 (PP1c), three of which belong to the PP1
subtype. PP1ß9C (flapwing) encodes the fourth PP1c gene and has a specific and nonredundant function as a nonmuscle myosin phosphatase. PP1
87B is the major form and contributes
80% of the total PP1 activity. We describe the first mutant alleles of PP1
96A and show that PP1
96A is not an essential gene, but seems to have a function in the regulation of nonmuscle myosin. We show that overexpression of the PP1
isozymes does not rescue semilethal PP1ß9C mutants, whereas overexpression of either PP1
96A or PP1ß9C does rescue a lethal PP1
87B mutant combination, showing that the lethality is due to a quantitative reduction in the level of PP1c. Overexpression of PP1ß9C does not rescue a PP1
87B, PP1
96A double mutant, suggesting an essential PP1
-specific function in Drosophila.
ONE of the most widespread mechanisms of post-translational regulation of proteins is the addition of phosphate by protein kinases; this phosphorylation is antagonized by protein phosphatases. Reversible phosphorylation of proteins can regulate their activity, cellular location, or binding affinity. The antagonistic actions of protein kinases and protein phosphatases are of equal importance in determining the degree of phosphorylation of each substrate protein. Among the serine/threonine protein phosphatases, serine threonine protein phosphatase type 1 (PP1) forms a major class and is highly conserved among all eukaryotes examined to date (LIN et al. 1999). PP1 is involved in the regulation of many cellular functions, including glycogen metabolism, muscle contraction, and mitosis (reviewed in BOLLEN 2001; COHEN 2002; CEULEMANS and BOLLEN 2004).
In Drosophila melanogaster, as in mammals, two PP1 subtypes exist: PP1
(homologous to mammalian PP1
and PP1
) and PP1ß (homologous to mammalian PP1
, also known as PP1ß). Three genes code for the PP1
isozyme and are named after their respective chromosomal location: PP1
13C (FlyBase: Pp1-13C), PP1
87B (Pp1-87B), and PP1
96A (Pp1
-96A). Only one gene, PP1ß9C (flapwing, flw), encodes the PP1ß type. The protein sequences of PP1
and PP1ß are extremely similar (88% identity over the first 300 amino acids), yet the PP1
/ß subtype difference is conserved in mammals (DOMBRÁDI et al. 1993).
In vitro, the catalytic subunit of PP1 (PP1c) dephosphorylates a wide variety of substrates, but in vivo it is found complexed to a number of different proteins that modify its substrate activity and specificity and target it to specific locations. Such targeting and regulatory proteins are therefore key to investigating the role of PP1 in specific subcellular processes [e.g., glycogen metabolism through PTG (PRINTEN et al. 1997) or Dpp receptor type 1 deactivation through Sara (BENNETT and ALPHEY 2002)]. In a yeast two-hybrid assay for PP1c-binding proteins in Drosophila, we found that the large majority of PP1c-binding proteins bind all four PP1c isozymes (BENNETT et al. 2006). Very few proteins have been identified that specifically bind some PP1c isozymes but not others. These include mammalian Neurabin I and Neurabin II/Spinophilin, which bind PP1
and PP1
, but not PP1
(MACMILLAN et al. 1999; TERRY-LORENZO et al. 2002), and Drosophila MYPT-75D, which binds PP1ß, but not PP1
(VERESHCHAGINA et al. 2004).
PP1
87B is the most abundant PP1c isozyme in Drosophila. In third instar larvae, PP1
87B contributes
80% of the total PP1 activity (DOMBRÁDI et al. 1990). In PP1
87B heterozygous mutants, the total PP1 activity is decreased by 40% but viability is not affected (DOMBRÁDI et al. 1990). PP1
87B homozygotes are lethal and show suppression of position-effect variegation, chromosome hypercondensation, and abnormal spindle structure (AXTON et al. 1990; DOMBRÁDI et al. 1990; BAKSA et al. 1993).
PP1
13C is located within intron 4 of the gene abnormal chemosensory jump 6 (acj6). A loss-of-function deletion of part of acj6, which also removes PP1
13C, is homozygous viable. PP1
13C is therefore not an essential gene and has no unique essential function that is not redundant with the other PP1c genes. Deletion of acj6 affects the sensilla, maxillary palp sense organs, and the laminar plexus, causing chemosensitive behavior defects. These visual and behavioral defects of the acj6 deletion are not complemented by overexpression of PP1
13C cDNA (CLYNE et al. 1999) and may therefore be entirely due to the deletion of acj6.
All mammalian PP1c proteins have a 25- to 27-amino acid C-terminal region that contains a cdk phosphorylation motif (T P P/Q R) (ISHII et al. 1996), the threonine residue of which (T320 in human PP1
) has been shown to be important for G1 progression in cell cycle (BERNDT et al. 1997). In Drosophila PP1
, this region is retained in PP1
96A, but lost from PP1
87B and PP1
13C (Figure 1). This is the first study that genetically characterizes PP1
96A by mutational analysis, revealing a function in nonmuscle myosin regulation (see RESULTS).
|
Strong alleles of PP1ß9C (PP1ß9C6 and PP1ß9C7) show failure in maintaining larval muscle attachment, have crumpled or blistered wings, and lack indirect flight muscles (IFMs). The weak and viable allele PP1ß9C1 is flightless due to disorganized IFMs, but otherwise appears normal (RAGHAVAN et al. 2000). The nonmuscle myosin phosphatase-targeting subunit MYPT-75D binds PP1ß and targets it to its substrate, nonmuscle myosin regulatory light chain (Spaghetti squash, Sqh). Dephosphorylation of Sqh inhibits contraction mediated by the nonmuscle myosin heavy chain (nmmHC; Zipper, Zip). PP1ß9C6 mutant clones have elevated levels of phospho-Sqh and presumably hyperactivated nmmHC. Mutations in genes that lead to downregulation of nmmHC activity, e.g., nmmHC, Rho, and RhoGEF2, rescue the semilethality of PP1ß9C6, showing that regulation of nonmuscle myosin activity is the single essential function of PP1ß9C (VERESHCHAGINA et al. 2004). In contrast to most PP1c-binding proteins, MYPT-75D binds specifically to PP1ß and not to PP1
(VERESHCHAGINA et al. 2004), which may account for the specificity of the PP1ß9C phenotypes and the genetic interactions between PP1ß9C and genes involved in the regulation and function of cytoplasmic myosin.
In this study, we describe the first mutant alleles of PP1
96A and show that the gene is not essential. However, PP1
96A mutants enhance the weak, viable allele PP1ß9C1 through nonmuscle myosin heavy chain, indicating that PP1
96A has a role in the regulation of nonmuscle myosin. We tested for redundancy between PP1
and PP1ß by ubiquitously expressing PP1c in PP1ß9C and PP1
87B mutant backgrounds, respectively. We show that overexpression of PP1
does not rescue the semilethality of PP1ß9C6, whereas overexpression of PP1ß does rescue the lethality of a PP1
87B mutant, showing that the lethality of PP1
87B is due to a quantitative reduction in the level of PP1c, rather than a PP1
87B-specific function in the development of Drosophila. However, expression of PP1ß does not rescue a PP1
87B, PP1
96A mutant combination, which suggests that at least one essential process, possibly late metamorphosis, depends on PP1
function specifically.
Fly strains and genetics:
pUAS-HA-PP1c constructs were as previously described (BENNETT et al. 2003). UAS-HA-PP1c insertions on the third chromosome were recombined with either arm-Gal4 or PP1
87B87Bg-3. w; arm-Gal4, UAS-HA-PP1c males were crossed to w, PP1ß9C6/FM7c virgin females to test for complementation of PP1ß9C. w; PP1
87B87Bg-3, UAS-HA-PP1c/TM6B males were crossed to w; arm-Gal4; PP1
87B1/TM6B virgin females to test for complementation of PP1
87B. The PP1
87B1 chromosome is marked with e. PP1
96A1 was generated by the Drosophila Gene Search Project (TOBA et al. 1999) and has a P{GSV6} insertion in the 5'-UTR of PP1
96A (line GS11179). The PP1
96A2 null mutant was generated by imprecise excision of PP1
96A1 with P{
2-3} transposase (LASKI et al. 1986). The original PP1
96A1 chromosome was found to have at least one lethal mutation outside of the 96A region, which was removed by recombining it to ru, h, st, ry, e prior to the excision experiments, so the complete genotypes for PP1
96A1 and PP1
96A2 are ru, h, st, ry, e, PP1
96A1 and ru, h, st, ry, e, PP1
96A2, respectively.
Fly extracts and immunoblotting:
Flies were taken up and homogenized in 2x SDS sample buffer (100 mm TrisHCl, pH 6.8, 200 mm dithiothreitol, 4% SDS, 20% glycerol, bromophenol blue) and the proteins were separated by SDSpolyacrylamide gel electrophoresis (SAMBROOK et al. 1989). Separated proteins were transferred onto an Immobilon-P PVDF membrane (Millipore, Bedford, MA). The membrane was blocked with 5% nonfat powdered milk in PBST (137 mm NaCl, 3 mm KCl, 10 mm Na2HPO4, 2 mm KH2PO4, 0.1% Tween 20) and incubated with 1:1000 anti-HA 12CA5 (F. Hoffmann La-Roche) or 1:2000 anti-
-tubulin T9026 (Sigma, St. Louis) as a primary and 1:10,000 horseradish peroxidase (HRP)-conjugated anti-mouse IgG (Sigma) as a secondary antibody. HRP was detected with Supersignal West Pico (Pierce, Rockford, IL) and blue-sensitive X-ray film (GRI).
Preparation of cDNA and RTPCR:
Total RNA from third instar larvae or adult flies was extracted using Trizol (Invitrogen, San Diego) according to the manufacturer's instructions. cDNA was prepared using the SuperScript first-strand synthesis system for RTPCR kit (Invitrogen) according to the manufacturer's instructions. The PP1
96A RTPCR primers (CTGCGGGGAATTCGACAACG and TGTGTGTGTGGCCGTTTGTAG) anneal at the C terminus of PP1
96A, which is not deleted in PP1
96A2. Mutagenesis and analysis of PP1
96A:
PP1
96A is not an essential gene:
The role of PP1
96A has remained unclear because no mutants have been described. Therefore, we decided to generate mutants for this gene and found that one of the P{GSV6} elements from the Drosophila Gene Search Project (TOBA et al. 1999) was inserted in the 5'-UTR of PP1
96A (Figure 2A). We named this allele PP1
96A1. The original PP1
96A1 chromosome was homozygous lethal; however, PP1
96A1/Df(3R)crb87-5 flies were viable and without phenotype even though Df(3R)crb87-5 completely deletes PP1
96A (WUSTMANN et al. 1989; KELLERMAN and MILLER 1992; our own molecular analysis, not shown). This suggested that the PP1
96A1 chromosome contained at least one additional and lethal mutation, but that PP1
96A1 itself might be viable. We exchanged the majority of the chromosome by generating a ru, h, st, ry, e, PP1
96A1 recombinant chromosome. This recombinant was homozygous viable and exhibited no obvious mutant phenotype apart from the markers, showing that we had removed a lethal mutation unrelated to PP1
96A1. P insertions in 5'-UTRs often reduce the transcription level of the respective gene. We therefore used RTPCR to assess the transcript levels of PP1
96A in PP1
96A1 homozygous and heterozygous third instar larvae and found that the level of PP1
96A transcript was greatly reduced in PP1
96A1 homozygotes (Figure 2B).
|
We generated several deletion derivatives by imprecise excision of PP1
96A1 and molecularly analyzed their breakpoints. We found that one of these, PP1
96A2, was a deletion of 1.7 kb, which removed the proximal promoter region, transcription start, and exons 13 of PP1
96A, but not the adjacent gene CG13617 (Figure 2A). RTPCR on extracts from PP1
96A2 homozygous and heterozygous flies failed to detect PP1
96A transcript in the homozygotes (Figure 2C); taking this with the molecular analysis of the deletion, we concluded that PP1
96A2 is a null allele for PP1
96A. PP1
96A2 is homozygous viable, fertile, and without any obvious phenotype, showing that PP1
96A is not an essential gene. Unlike PP1
87B, PP1
96A is not a suppressor of position-effect variegation (not shown).
Genetic interactions between PP1
96A and PP1
87B mutants:
We assume that PP1
96A contributes at most 10% of the total PP1 activity in Drosophila, as PP1
87B and PP1ß9C contribute
80 and 10%, respectively (DOMBRÁDI et al. 1990; VERESHCHAGINA et al. 2004). Therefore, we wondered whether PP1
96A2 homozygotes might show a phenotype in a background of reduced total PP1c. We introduced PP1
87B87Bg-3/+, which lowers the total PP1 activity by 40%, into a PP1
96A2 background, but found that adult flies heterozygous for PP1
87B and homozygous for PP1
96A (PP1
87B87Bg-3, PP1
96A2/PP1
87B+, PP1
96A2) have normal viability and appearance (not shown). PP1
87B87Bg-3/PP1
87B1 trans-heterozygotes (which lack
80% of total PP1 activity) die during pupariation and, until pupariation, do not lag behind in development compared to their heterozygous siblings. We also examined flies lacking wild-type copies of both PP1
87B and PP1
96A (PP1
87B87Bg-3, PP1
96A2/PP1
87B1, and PP1
96A2). These mutants, which might lack as much as 90% of total PP1 activity, died slightly earlier than PP1
87B87Bg-3/PP1
87B1 and pupariated 12 days later than their siblings. This suggests a weak enhancement of PP1
87B by PP1
96A, although a possible effect of genetic background cannot be ruled out. The pupal lethality of PP1
87B mutants, with or without PP1
96A2, could indicate a high requirement for total PP1 or PP1
during metamorphosis.
PP1
96A enhances PP1ß9C through zip:
Of the three PP1
genes in Drosophila, PP1
96A is the only one that has the conserved final 2527 amino acids at its C terminus (Figure 1), but a related sequence is also present in PP1ß9C. We therefore wondered whether a mutation in PP1
96A would genetically interact with PP1ß9C. To test this, we used the weak allele PP1ß9C1, which is viable but flightless due to defects in the indirect flight muscles (RAGHAVAN et al. 2000). PP1ß9C1/Y ; PP1
96A1/+ and PP1ß9C1/Y ; Df(3R)crb87-5/+ were viable and do not exhibit any phenotype apart from rare defects in the posterior part of the wing (not shown). PP1ß9C1/Y ; PP1
96A1/Df(3R)crb87-5, however, was completely lethal (Table 1), showing that PP1
96A indeed interacts genetically with PP1ß9C. The enhancement of PP1ß9C1 by PP1
96A is specific to PP1
96A and not due to an overall reduction of PP1 activity, because PP1ß9C1/Y; PP1
87B87Bg-3/+ is viable (not shown).
|
Genetic interaction between different mutants often indicates that the genes act in the same pathway. Since PP1ß9C has a single essential and nonredundant function as a nonmuscle myosin phosphatase, we wondered whether the lethality of PP1ß9C1/Y; PP1
96A1/Df(3R)crb87-5 is due to a failure in nonmuscle myosin regulation and possibly to hyperactivation of nmmHC. To test this, we introduced the mutant zip1 into a PP1ß9C1/Y; PP1
96A1/Df(3R)crb87-5 background and found that this rescued the lethality (Table 2), suggesting that the genetic interaction between PP1ß9C and PP1
96A is indeed related to the role of PP1ß9C in the regulation of nonmuscle myosin.
|
Redundancy between PP1
and PP1ß:
Overexpression of PP1
87B or PP1
96A does not complement PP1ß9C:
Although the protein sequences of PP1
and PP1ß are extremely similar (DOMBRÁDI et al. 1993), they show structural differences that are also conserved in humans. This suggests that the two subtypes might have differential, nonredundant functions. To test for redundancy of PP1ß, we expressed PP1
using the UAS/Gal4 system (BRAND and PERRIMON 1993) to see whether this would rescue the semilethal missense mutant PP1ß9C6. The altered amino acid of PP1ß9C6, Y133, is thought to form a hydrogen bond to the peptide backbone of the substrate (EGLOFF et al. 1997); PP1ß9C6 protein is therefore likely to bind its substrates with lower affinity.
w PP1ß9C6/FM7c virgin females were crossed to males of the genotype w; arm-Gal4, UAS-HA-PP1c/TM6B. The presence of arm-Gal4 induces expression of UAS-HA-PP1c constructs throughout the fly and does not cause a phenotype. The expression level of UAS-HA-PP1
13C with arm-Gal4 was extremely low (<40 times lower than arm-Gal4, UAS-HA-PP1
87B, not shown); therefore, UAS-HA-PP1
13C was not included in the complementation analysis. As expected, expressing HA-PP1ß9C completely restored the viability (Table 3) as well as the wing phenotype (RAGHAVAN et al. 2000) of PP1ß9C6/Y males. However, PP1ß9C6/Y could not be rescued by expression of HA-PP1
87B or HA-PP1
96A (Table 3, summarized in Table 5). Western Blots with
-HA showed clear expression of HA-PP1ß9C and slightly lower levels of HA-PP1
87B and HA-PP1
96A (Figure 3). We subsequently found that the expression levels of HA-PP1
96A and HA-PP1ß9C with arm-Gal4 were sufficient to complement a PP1
87B mutant, which showed that the expressed proteins are functional (see below).
|
|
|
Overexpression of PP1
96A and PP1ß9C can rescue PP1
87B:
PP1
87B is the major PP1c isozyme in Drosophila and contributes
80% of the total PP1 activity (DOMBRÁDI et al. 1990). We wondered whether PP1
87B has a specific and nonredundant role in the development of Drosophila, which cannot be performed by another PP1c. We tested this by expressing PP1
96A and PP1ß9C in a PP1
87B mutant background, using the alleles PP1
87B1 and PP1
87B87Bg-3. PP1
87B1 is an EMS-induced hypomorphic point mutant with a single amino acid replacement (G220S) in a residue that is conserved in all protein serine/threonine phosphatases of the PP1/PP2A/PP2B family (DOMBRÁDI and COHEN 1992). PP1
87B87Bg-3 is an amorphic mutant resulting from DNA rearrangement in the 5'-end of PP1
87B (AXTON et al. 1990). PP1
87B1/PP1
87B87Bg-3 trans-heterozygotes are lethal. w; arm-Gal4; PP1
87B1/TM6B female virgins were crossed to w; PP1
87B87Bg-3, UAS-HA-PP1c/TM6B males to generate flies that express HA-PP1c in a PP1
87B mutant background.
PP1
87B1/PP1
87B87Bg-3 was rescued by overexpression of UAS-HA-PP1
87B with arm-Gal4, as expected, but also by overexpression of HA-PP1
96A or HA-PP1ß9C (Table 4, summarized in Table 5). The rescued flies had a normal appearance (not shown). This indicated that PP1
96A and PP1ß9C can substitute for PP1
87B in its absence and suggests that the lethality of PP1
87B mutants is due to a reduction of overall PP1 activity and not to an essential and nonredundant function of PP1
87B.
|
Overexpression of PP1ß9C does not rescue PP1
87B, PP1
96A double mutants:
As shown above, expression of PP1ß9C rescues a PP1
87B mutant. However, the presence of wild-type PP1
96A (and/or PP1
13C) in this background could mask an essential requirement for PP1
that PP1ß could not perform. Therefore, we expressed PP1ß9C in a PP1
87B, PP1
96A double-mutant background, by crossing w; arm-Gal4, PP1
87B87Bg-3, PP1
96A2/TM6B to w; UAS-HA-PP1ß9C, PP1
87B1, PP1
96A2/TM6B. We found that overexpression of PP1ß9C did not rescue the lethality of PP1
87B, PP1
96A double mutants (Table 6), indicating that Drosophila PP1
has at least one essential function that PP1ß9C cannot perform, possibly during late metamorphosis, as PP1
87B, PP1
96A double mutants with arm-Gal4, PP1ß9C die as late pupae.
|
/PP1ß subtype difference, is highly conserved between Drosophila and mammals. Humans have three PP1 genes: PP1
and PP1
are homologs of the Drosophila PP1
genes, and PP1
(also known as PP1ß) corresponds to PP1ß.
We show here that expression of HA-PP1
87B and HA-PP1
96A does not rescue a semilethal allele of PP1ß, which further supports our previous conclusion that PP1ß9C has an essential function that cannot be performed by PP1
(VERESHCHAGINA et al. 2004). It also allows us to rule out an alternative explanation for the PP1ß9C mutant phenotypethat PP1ß9C, but none of the PP1
forms, is expressed in a specific subset of cells during fly development. The data above rule out this possibility, as overexpression of PP1
87B and PP1
96A did not rescue strong PP1ß9C alleles, while expression of PP1ß9C, under the control of the same driver, fully rescued the phenotype of PP1ß9C6. The specific, nonredundant function of PP1ß has been identified as regulation of nonmuscle myosin activity, possibly through the PP1ß-specific interactor MYPT-75D (VERESHCHAGINA et al. 2004). MYPT-75D is the fly homolog of mammalian MYPT3 (myosin phosphatase-targeting subunit) and is related to Mbs (myosin-binding subunit), which is the homolog of mammalian MYPT1 and MYPT2. Mbs regulates myosin activity by targeting PP1c to its substrate myosin regulatory light chain (MIZUNO et al. 1999). Recently, it was shown that human MYPT3 co-immunoprecipitated with PP1
, and phosphorylation of MYPT3 by protein kinase A activated PP1
toward cytoplasmic myosin regulatory light chain (YONG et al. 2006).
Of the four Drosophila PP1c genes, PP1
87B, PP1
13C, and PP1ß9C have been previously characterized by mutational analysis (AXTON et al. 1990; CLYNE et al. 1999; RAGHAVAN et al. 2000). By generating a viable and fertile null allele of PP1
96A, we found that PP1
96A is not an essential gene. It does, however, have an essential function in the PP1ß9C1 mutant background, and this function probably relates to the regulation of nonmuscle myosin. PP1
96A, but not PP1
87B or PP1
13C, was able to bind to a fragment of MYPT-75D that lacked the N terminus in the yeast two-hybrid system (L. ALPHEY, unpublished results) although it did not bind to the whole MYPT-75D protein, whereas PP1ß did (VERESHCHAGINA et al. 2004). Thus, it is possible that PP1
96A may have a weak affinity to bind MYPT-75D and enhances PP1ß by being partly redundant with it. Alternatively, PP1
96A could be partially redundant with PP1ß9C through binding to Mbs. Studies on the crystal structure of the vertebrate PP1
-MYPT1 complex suggest that the tyrosine residues Y305 and Y307 at the C terminus of chicken PP1
are particularly important for its binding to the second ankyrin repeat of MYPT1 (TERRAK et al. 2004). Y305 and Y307 are in the C-terminal part that PP1
87B and PP1
13C lack and are conserved in Drosophila PP1ß (Y304 and Y306). PP1
96A has only one tyrosine residue at Y304, shifted by one amino acid compared to PP1ß (Figure 1). The mammalian Mbs homologs MYPT1/2 seem to bind specifically to mammalian PP1ß in vivo (HARTSHORNE 1998). Thus, even though all four Drosophila PP1c isozymes bind Mbs in the yeast two-hybrid system (VERESHCHAGINA et al. 2004), it may be that the majority of nonmuscle myosin phosphatase complexes in vivo consist of PP1ß9C/Mbs and a minority of PP1
96A/Mbs (Figure 4). Both models would explain why PP1
96A and not, for example, PP1
87B, enhance PP1ß9C1: in a weak PP1ß9C mutant background, PP1
96A would be able to compensate for partial loss of PP1ß9C activity, but not in the strong and semilethal background of PP1ß9C6.
|
Even though PP1 is involved in the regulation of numerous cellular processes, relatively little is known about specific and nonredundant functions of the different PP1c isozymes. In mice, PP1
(probably the testis-specific splice variant PP1
2) has a nonredundant function in spermatogenesis, as PP1
knockout male mice are viable but sterile with defects in spermatogenesis, while knockout female mice are viable and fertile (VARMUZA et al. 1999). Presumably, the somatic and female germline functions of PP1
are redundant with PP1
and/or PP1
. No knockout analysis exists for the other PP1c genes, although PP1
was shown to have a specific function in murine lung growth and morphogenesis (HORMI-CARVER et al. 2004).
The conservation of the PP1
/ß difference between flies and mammals suggests an ancient qualitative difference between the two subtypes. This raises the question of whether a PP1
-specific function exists that PP1ß cannot perform. We found that expression of PP1
96A and PP1ß9C could complement a lethal PP1
87B mutant, suggesting that the role of PP1
87B is essential because of its high expression levels rather than structural differences with the other PP1c isozymes. However, expression of PP1ß9C did not rescue a PP1
87B, PP1
96A double mutant, suggesting that at least one developmental process in Drosophila depends on PP1
specifically.
Mammalian PP1
, PP1
1, and PP1
localize to distinct subcellular locations in mammalian cells (ANDREASSEN et al. 1998; TRINKLE-MULCAHY et al. 2001, 2003; LESAGE et al. 2005). It is thought that such specific localization and function is mediated by regulators that bind the PP1c isozymes with different affinities. Neurabin I and Neurabin II/Spinophilin were identified to bind PP1
1 and PP1
, but not PP1
(MACMILLAN et al. 1999; TERRY-LORENZO et al. 2002), and several PP1
- and PP1
1-specific regulators have been identified in mouse fetal lung epithelial cells (FLORES-DELGADO et al. 2005). In Drosophila, even though the majority of PP1c regulatory subunits seem to bind all four PP1c isozymes in the yeast two-hybrid system (BENNETT et al. 2006), we identified three interactors that bind PP1
specifically or with greatly increased affinity compared to PP1ß (L. ALPHEY, unpublished results). One of them, CG11416 (uri), is essential for viability (J. KIRCHNER and L. ALPHEY, unpublished results) and could mediate an essential requirement for PP1
.
In this study we show that PP1
96A is not an essential gene, but has an essential function in nonmuscle myosin regulation in a weak PP1ß9C mutant background. Furthermore, we demonstrate by complementation analysis that PP1ß9C has an essential function that is nonredundant with PP1
, while PP1
87B is essential only because of its high expression levels. Overexpressing PP1ß9C does not rescue a PP1
87B, PP1
96A double mutant, indicating a PP1
-specific developmental function. Together, this sheds new light on the essential, redundant, and overlapping functions of the PP1c genes in Drosophila.
ANDREASSEN, P. R., F. B. LACROIX, E. VILLA-MORUZZI and R. L. MARGOLIS, 1998 Differential subcellular localization of protein phosphatase-1 alpha, gamma1, and delta isoforms during both interphase and mitosis in mammalian cells. J. Cell. Biol. 141: 12071215.
AXTON, J. M., V. DOMBRADI, P. T. COHEN and D. M. GLOVER, 1990 One of the protein phosphatase 1 isoenzymes in Drosophila is essential for mitosis. Cell 63: 3346.[CrossRef][Medline]
BAKSA, K., H. MORAWIETZ, V. DOMBRADI, M. AXTON, H. TAUBERT et al., 1993 Mutations in the protein phosphatase 1 gene at 87B can differentially affect suppression of position-effect variegation and mitosis in Drosophila melanogaster. Genetics 135: 117125.[Abstract]
BENNETT, D., and L. ALPHEY, 2002 PP1 binds dSARA to antagonise Dpp signalling. Nat. Genet. 31: 419423.[CrossRef][Medline]
BENNETT, D., B. SZOOR, S. GROSS, N. VERESHCHAGINA and L. ALPHEY, 2003 Ectopic expression of inhibitors of protein phosphatase type 1 (PP1) can be used to analyze roles of PP1 in Drosophila development. Genetics 165: 235245.
BENNETT, D., E. LYULCHEVA and L. ALPHEY, 2006 Towards a comprehensive analysis of the protein phosphatase 1 interactome in Drosophila. J. Mol. Biol. 364: 196212.[CrossRef][Medline]
BERNDT, N., M. DOHADWALA and C. W. LIU, 1997 Constitutively active protein phosphatase 1alpha causes Rb-dependent G1 arrest in human cancer cells. Curr. Biol. 7: 375386.[CrossRef][Medline]
BOLLEN, M., 2001 Combinatorial control of protein phosphatase-1. Trends Biochem. Sci. 26: 426431.[CrossRef][Medline]
BRAND, A. H., and N. PERRIMON, 1993 Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118: 401415.[Abstract]
CEULEMANS, H., and M. BOLLEN, 2004 Functional diversity of protein phosphatase-1, a cellular economizer and reset button. Physiol. Rev. 84: 139.
CLYNE, P. J., S. J. CERTEL, M. DE BRUYNE, L. ZASLAVSKY, W. A. JOHNSON et al., 1999 The odor specificities of a subset of olfactory receptor neurons are governed by Acj6, a POU-domain transcription factor. Neuron 22: 203204.[CrossRef][Medline]
COHEN, P. T. W., 2002 Protein phosphatase 1targeted in many directions. J. Cell Sci. 115: 241256.
DOMBRÁDI, V., and P. T. W. COHEN, 1992 Protein phosphorylation is involved in the regulation of chromatin condensation during interphase. FEBS Lett. 312: 2126.[CrossRef][Medline]
DOMBRÁDI, V., J. M. AXTON, H. M. BARKER and P. T. COHEN, 1990 Protein phosphatase 1 activity in Drosophila mutants with abnormalities in mitosis and chromosome condensation. FEBS Lett. 275: 3943.[CrossRef][Medline]
DOMBRÁDI, V., D. J. MANN, R. D. C. SAUNDERS and P. T. W. COHEN, 1993 Cloning of the fourth functional gene for protein phosphatase 1 in Drosophila melanogaster from its chromosomal location. Eur. J. Biochem. 212: 177183.[Medline]
EGLOFF, M. P., D. F. JOHNSON, G. MOORHEAD, P. T. COHEN, P. COHEN et al., 1997 Structural basis for the recognition of regulatory subunits by the catalytic subunit of protein phosphatase 1. EMBO J. 16: 18761887.[CrossRef][Medline]
FLORES-DELGADO, G., C. W. LIU, R. SPOSTO and N. BERNDT, 2007 A limited screen for protein interactions reveals new roles for protein phosphatase 1 in cell cycle control and apoptosis. J. Proteome Res. 6(3): 11651175.
HARTSHORNE, D. J., 1998 Myosin phosphatase: subunits and interactions. Acta Physiol. Scand. 164: 483493.[CrossRef][Medline]
HORMI-CARVER, K.-K., W. SHI, C. W. Y. LIU and N. BERNDT, 2004 Protein phosphatase 1alpha is required for murine lung growth and morphogenesis. Dev. Dyn. 229: 797801.
ISHII, K., K. KUMADA, T. TODA and M. YANAGIDA, 1996 Requirement for PP1 phosphatase and 20S cyclosome/APC for the onset of anaphase is lessened by the dosage increase of a novel gene sds23+. EMBO J. 15: 66296640.[Medline]
KELLERMAN, K. A., and K. G. MILLER, 1992 An unconventional myosin heavy chain gene from Drosophila melanogaster. J. Cell Biol. 119: 823834.
LASKI, F. A., D. C. RIO and G. M. RUBIN, 1986 Tissue specificity of Drosophila P element transposition is regulated at the level of mRNA splicing. Cell 44: 719.[CrossRef][Medline]
LESAGE, B., M. BEULLENS, H. CEULEMANS, B. HIMPENS and M. BOLLEN, 2005 Determinants of the nucleolar targeting of protein phosphatase-1. FEBS Lett. 579: 56265630.[Medline]
LIN, Q., E. S. BUCKLER, S. V. MUSE and J. C. WALKER, 1999 Molecular evolution of type 1 serine/threonine protein phosphatases. Mol. Phylogenet. Evol. 12: 5766.[CrossRef][Medline]
MACMILLAN, L. B., M. A. BASS, N. CHENG, E. F. HOWARD, M. TAMURA et al., 1999 Brain actin-associated protein phosphatase 1 holoenzymes containing spinophilin, neurabin, and selected catalytic subunit isoforms. J. Biol. Chem. 274: 3584535854.
MIZUNO, T., M. AMANO, K. KAIBUCHI and Y. NISHIDA, 1999 Identification and characterization of Drosophila homolog of Rho-kinase. Gene 238: 437444.[CrossRef][Medline]
PRINTEN, J. A., M. J. BRADY and A. R. SALTIEL, 1997 PTG, a protein phosphatase 1-binding protein with a role in glycogen metabolism. Science 275: 14751478.
RAGHAVAN, S., I. WILLIAMS, H. ASLAM, D. THOMAS, B. SZOOR et al., 2000 Protein phosphatase 1beta is required for the maintenance of muscle attachments. Curr. Biol. 10: 269272.[CrossRef][Medline]
SAMBROOK, J., E. F. FRITISCH and T. M. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
TERRAK, M., F. KERFF, K. LANGSETMO, T. TAO and R. DOMINGUEZ, 2004 Structural basis of protein phosphatase 1 regulation. Nature 429: 780784.[CrossRef][Medline]
TERRY-LORENZO, R. T., L. C. CARMODY, J. W. VOLTZ, J. H. CONNOR, S. LI et al., 2002 The neuronal actin-binding proteins, neurabin I and neurabin II, recruit specific isoforms of protein phosphatase-1 catalytic subunits. J. Biol. Chem. 277: 2771627724.
TOBA, G., T. OHSAKO, N. MIYATA, T. OHTSUKA, K. H. SEONG et al., 1999 The gene search system: a method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster. Genetics 151: 725737.
TRINKLE-MULCAHY, L., J. E. SLEEMAN and A. I. LAMOND, 2001 Dynamic targeting of protein phosphatase 1 within the nuclei of living mammalian cells. J. Cell Sci. 114: 42194228.
TRINKLE-MULCAHY, L., P. D. ANDREWS, S. WICKRAMASINGHE, J. SLEEMAN, A. PRESCOTT et al., 2003 Time-lapse imaging reveals dynamic relocalisation of PP1gamma throughout the mammalian cell cycle. Mol. Biol. Cell 14: 107117.
VARMUZA, S., A. JURISICOVA, K. OKANO, K. BOEKELHEIDE and E. B. SHIPP, 1999 Spermiogenesis is impaired in mice bearing a targeted mutation in protein phosphatase 1cgamma gene. Dev. Biol. 205: 98110.[CrossRef][Medline]
VERESHCHAGINA, N., D. BENNETT, B. SZOOR, J. KIRCHNER, S. GROSS et al., 2004 The essential role of PP1beta in Drosophila is to regulate non-muscle myosin. Mol. Biol. Cell 15: 43954405.
WUSTMANN, G., J. SZIDONYA, H. TAUBERT and G. REUTER, 1989 The genetics of position-effect variegation modifying loci in Drosophila melanogaster. Mol. Gen. Genet. 217: 520527.[CrossRef][Medline]
YONG, J., I. TAN, L. LIM and T. LEUNG, 2006 Phosphorylation of myosin phosphatase targeting subunit 3 (MYPT3) and regulation of protein phosphatase 1 by protein kinase A. J. Biol. Chem. 281: 3120231211.
Communicating editor: T. SCHÜPBACH
This article has been cited by other articles:
![]() |
S. Tan, E. Lyulcheva, J. Dean, and D. Bennett Mars promotes dTACC dephosphorylation on mitotic spindles to ensure spindle stability J. Cell Biol., July 14, 2008; 182(1): 27 - 33. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Kirchner, J.
- Articles by Alphey, L.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Kirchner, J.
- Articles by Alphey, L.



