Protein serine/threonine phosphatase type 1 (PP1) has been found in all eukaryotes examined to date and is involved in the regulation of many cellular functions, including glycogen metabolism, muscle contraction, and mitosis. In Drosophila, four genes code for the catalytic subunit of PP1 (PP1c), three of which belong to the PP1 subtype. PP1ß9C (flapwing) encodes the fourth PP1c gene and has a specific and nonredundant function as a nonmuscle myosin phosphatase. PP187B is the major form and contributes 80% of the total PP1 activity. We describe the first mutant alleles of PP196A and show that PP196A is not an essential gene, but seems to have a function in the regulation of nonmuscle myosin. We show that overexpression of the PP1 isozymes does not rescue semilethal PP1ß9C mutants, whereas overexpression of either PP196A or PP1ß9C does rescue a lethal PP187B mutant combination, showing that the lethality is due to a quantitative reduction in the level of PP1c. Overexpression of PP1ß9C does not rescue a PP187B, PP196A double mutant, suggesting an essential PP1-specific function in Drosophila.

---

ONE of the most widespread mechanisms of post-translational regulation of proteins is the addition of phosphate by protein kinases; this phosphorylation is antagonized by protein phosphatases. Reversible phosphorylation of proteins can regulate their activity, cellular location, or binding affinity. The antagonistic actions of protein kinases and protein phosphatases are of equal importance in determining the degree of phosphorylation of each substrate protein. Among the serine/threonine protein phosphatases, serine threonine protein phosphatase type 1 (PP1) forms a major class and is highly conserved among all eukaryotes examined to date (LIN et al. 1999). PP1 is involved in the regulation of many cellular functions, including glycogen metabolism, muscle contraction, and mitosis (reviewed in BOLLEN 2001; COHEN 2002; CEULEMANS and BOLLEN 2004).

In Drosophila melanogaster, as in mammals, two PP1 subtypes exist: PP1 (homologous to mammalian PP1 and PP1) and PP1ß (homologous to mammalian PP1, also known as PP1ß). Three genes code for the PP1 isozyme and are named after their respective chromosomal location: PP113C (FlyBase: Pp1-13C), PP187B (Pp1-87B), and PP196A (Pp1-96A). Only one gene, PP1ß9C (flapwing, flw), encodes the PP1ß type. The protein sequences of PP1 and PP1ß are extremely similar (88% identity over the first 300 amino acids), yet the PP1/ß subtype difference is conserved in mammals (DOMBRÁDI et al. 1993).

In vitro, the catalytic subunit of PP1 (PP1c) dephosphorylates a wide variety of substrates, but in vivo it is found complexed to a number of different proteins that modify its substrate activity and specificity and target it to specific locations. Such targeting and regulatory proteins are therefore key to investigating the role of PP1 in specific subcellular processes [e.g., glycogen metabolism through PTG (PRINTEN et al. 1997) or Dpp receptor type 1 deactivation through Sara (BENNETT and ALPHEY 2002)]. In a yeast two-hybrid assay for PP1c-binding proteins in Drosophila, we found that the large majority of PP1c-binding proteins bind all four PP1c isozymes (BENNETT et al. 2006). Very few proteins have been identified that specifically bind some PP1c isozymes but not others. These include mammalian Neurabin I and Neurabin II/Spinophilin, which bind PP1 and PP1, but not PP1 (MACMILLAN et al. 1999; TERRY-LORENZO et al. 2002), and Drosophila MYPT-75D, which binds PP1ß, but not PP1 (VERESHCHAGINA et al. 2004).

PP187B is the most abundant PP1c isozyme in Drosophila. In third instar larvae, PP187B contributes 80% of the total PP1 activity (DOMBRÁDI et al. 1990). In PP187B heterozygous mutants, the total PP1 activity is decreased by 40% but viability is not affected (DOMBRÁDI et al. 1990). PP187B homozygotes are lethal and show suppression of position-effect variegation, chromosome hypercondensation, and abnormal spindle structure (AXTON et al. 1990; DOMBRÁDI et al. 1990; BAKSA et al. 1993).

PP113C is located within intron 4 of the gene abnormal chemosensory jump 6 (acj6). A loss-of-function deletion of part of acj6, which also removes PP113C, is homozygous viable. PP113C is therefore not an essential gene and has no unique essential function that is not redundant with the other PP1c genes. Deletion of acj6 affects the sensilla, maxillary palp sense organs, and the laminar plexus, causing chemosensitive behavior defects. These visual and behavioral defects of the acj6 deletion are not complemented by overexpression of PP113C cDNA (CLYNE et al. 1999) and may therefore be entirely due to the deletion of acj6.

All mammalian PP1c proteins have a 25- to 27-amino acid C-terminal region that contains a cdk phosphorylation motif (T P P/Q R) (ISHII et al. 1996), the threonine residue of which (T320 in human PP1) has been shown to be important for G₁ progression in cell cycle (BERNDT et al. 1997). In Drosophila PP1, this region is retained in PP196A, but lost from PP187B and PP113C (Figure 1). This is the first study that genetically characterizes PP196A by mutational analysis, revealing a function in nonmuscle myosin regulation (see RESULTS).

View larger version (6K): In this window In a new window Download PPT slide   FIGURE 1.— Multiple-sequence alignment of the C termini of Drosophila PP1c and human PP1ß (hPP1ß). The amino acid sequences for PP1c are extremely conserved between the Drosophila PP1c proteins as well as Drosophila PP1c compared to human PP1 (DOMBRÁDI et al. 1993). PP187B and PP113C have lost the C terminus, which contains a Cdk phosphorylation site (T P P/Q R).

 
Strong alleles of PP1ß9C (PP1ß9C⁶ and PP1ß9C⁷) show failure in maintaining larval muscle attachment, have crumpled or blistered wings, and lack indirect flight muscles (IFMs). The weak and viable allele PP1ß9C¹ is flightless due to disorganized IFMs, but otherwise appears normal (RAGHAVAN et al. 2000). The nonmuscle myosin phosphatase-targeting subunit MYPT-75D binds PP1ß and targets it to its substrate, nonmuscle myosin regulatory light chain (Spaghetti squash, Sqh). Dephosphorylation of Sqh inhibits contraction mediated by the nonmuscle myosin heavy chain (nmmHC; Zipper, Zip). PP1ß9C⁶ mutant clones have elevated levels of phospho-Sqh and presumably hyperactivated nmmHC. Mutations in genes that lead to downregulation of nmmHC activity, e.g., nmmHC, Rho, and RhoGEF2, rescue the semilethality of PP1ß9C⁶, showing that regulation of nonmuscle myosin activity is the single essential function of PP1ß9C (VERESHCHAGINA et al. 2004). In contrast to most PP1c-binding proteins, MYPT-75D binds specifically to PP1ß and not to PP1 (VERESHCHAGINA et al. 2004), which may account for the specificity of the PP1ß9C phenotypes and the genetic interactions between PP1ß9C and genes involved in the regulation and function of cytoplasmic myosin.

In this study, we describe the first mutant alleles of PP196A and show that the gene is not essential. However, PP196A mutants enhance the weak, viable allele PP1ß9C¹ through nonmuscle myosin heavy chain, indicating that PP196A has a role in the regulation of nonmuscle myosin. We tested for redundancy between PP1 and PP1ß by ubiquitously expressing PP1c in PP1ß9C and PP187B mutant backgrounds, respectively. We show that overexpression of PP1 does not rescue the semilethality of PP1ß9C⁶, whereas overexpression of PP1ß does rescue the lethality of a PP187B mutant, showing that the lethality of PP187B is due to a quantitative reduction in the level of PP1c, rather than a PP187B-specific function in the development of Drosophila. However, expression of PP1ß does not rescue a PP187B, PP196A mutant combination, which suggests that at least one essential process, possibly late metamorphosis, depends on PP1 function specifically.

Fly strains and genetics:

pUAS-HA-PP1c constructs were as previously described (BENNETT et al. 2003). UAS-HA-PP1c insertions on the third chromosome were recombined with either arm-Gal4 or PP187B^87Bg-3. w; arm-Gal4, UAS-HA-PP1c males were crossed to w, PP1ß9C⁶/FM7c virgin females to test for complementation of PP1ß9C. w; PP187B^87Bg-3, UAS-HA-PP1c/TM6B males were crossed to w; arm-Gal4; PP187B¹/TM6B virgin females to test for complementation of PP187B. The PP187B¹ chromosome is marked with e. PP196A¹ was generated by the Drosophila Gene Search Project (TOBA et al. 1999) and has a P{GSV6} insertion in the 5'-UTR of PP196A (line GS11179). The PP196A² null mutant was generated by imprecise excision of PP196A¹ with P{2-3} transposase (LASKI et al. 1986). The original PP196A¹ chromosome was found to have at least one lethal mutation outside of the 96A region, which was removed by recombining it to ru, h, st, ry, e prior to the excision experiments, so the complete genotypes for PP196A¹ and PP196A² are ru, h, st, ry, e, PP196A¹ and ru, h, st, ry, e, PP196A², respectively.

Fly extracts and immunoblotting:

Flies were taken up and homogenized in 2x SDS sample buffer (100 mm Tris–HCl, pH 6.8, 200 mm dithiothreitol, 4% SDS, 20% glycerol, bromophenol blue) and the proteins were separated by SDS–polyacrylamide gel electrophoresis (SAMBROOK et al. 1989). Separated proteins were transferred onto an Immobilon-P PVDF membrane (Millipore, Bedford, MA). The membrane was blocked with 5% nonfat powdered milk in PBST (137 mm NaCl, 3 mm KCl, 10 mm Na₂HPO₄, 2 mm KH₂PO₄, 0.1% Tween 20) and incubated with 1:1000 anti-HA 12CA5 (F. Hoffmann La-Roche) or 1:2000 anti--tubulin T9026 (Sigma, St. Louis) as a primary and 1:10,000 horseradish peroxidase (HRP)-conjugated anti-mouse IgG (Sigma) as a secondary antibody. HRP was detected with Supersignal West Pico (Pierce, Rockford, IL) and blue-sensitive X-ray film (GRI).

Preparation of cDNA and RT–PCR:

Total RNA from third instar larvae or adult flies was extracted using Trizol (Invitrogen, San Diego) according to the manufacturer's instructions. cDNA was prepared using the SuperScript first-strand synthesis system for RT–PCR kit (Invitrogen) according to the manufacturer's instructions. The PP196A RT–PCR primers (CTGCGGGGAATTCGACAACG and TGTGTGTGTGGCCGTTTGTAG) anneal at the C terminus of PP196A, which is not deleted in PP196A².

Mutagenesis and analysis of PP196A:

PP196A is not an essential gene:

The role of PP196A has remained unclear because no mutants have been described. Therefore, we decided to generate mutants for this gene and found that one of the P{GSV6} elements from the Drosophila Gene Search Project (TOBA et al. 1999) was inserted in the 5'-UTR of PP196A (Figure 2A). We named this allele PP196A¹. The original PP196A¹ chromosome was homozygous lethal; however, PP196A¹/Df(3R)crb87-5 flies were viable and without phenotype even though Df(3R)crb87-5 completely deletes PP196A (WUSTMANN et al. 1989; KELLERMAN and MILLER 1992; our own molecular analysis, not shown). This suggested that the PP196A¹ chromosome contained at least one additional and lethal mutation, but that PP196A¹ itself might be viable. We exchanged the majority of the chromosome by generating a ru, h, st, ry, e, PP196A¹ recombinant chromosome. This recombinant was homozygous viable and exhibited no obvious mutant phenotype apart from the markers, showing that we had removed a lethal mutation unrelated to PP196A¹. P insertions in 5'-UTRs often reduce the transcription level of the respective gene. We therefore used RT–PCR to assess the transcript levels of PP196A in PP196A¹ homozygous and heterozygous third instar larvae and found that the level of PP196A transcript was greatly reduced in PP196A¹ homozygotes (Figure 2B).

View larger version (47K): In this window In a new window Download PPT slide   FIGURE 2.— (A) PP196A gene structure and mutants. Coding regions (black) and untranslated regions are indicated. The direction of transcription for CG13617 and PP196A is from left to right. PP196A1 is due to an insertion in the 5'-UTR of PP196A. PP196A2 is a 1.7-kb deletion that deletes the proximal promoter region, transcription start, and exons 1–3 of PP196A, but not the adjacent gene CG13617. (B) The level of PP196A transcript is reduced in PP196A1 homozygotes. (C) No PP196A transcript can be detected in PP196A2 homozygotes. M, marker (200-bp band).

 
We generated several deletion derivatives by imprecise excision of PP196A¹ and molecularly analyzed their breakpoints. We found that one of these, PP196A², was a deletion of 1.7 kb, which removed the proximal promoter region, transcription start, and exons 1–3 of PP196A, but not the adjacent gene CG13617 (Figure 2A). RT–PCR on extracts from PP196A² homozygous and heterozygous flies failed to detect PP196A transcript in the homozygotes (Figure 2C); taking this with the molecular analysis of the deletion, we concluded that PP196A² is a null allele for PP196A. PP196A² is homozygous viable, fertile, and without any obvious phenotype, showing that PP196A is not an essential gene. Unlike PP187B, PP196A is not a suppressor of position-effect variegation (not shown).

Genetic interactions between PP196A and PP187B mutants:

We assume that PP196A contributes at most 10% of the total PP1 activity in Drosophila, as PP187B and PP1ß9C contribute 80 and 10%, respectively (DOMBRÁDI et al. 1990; VERESHCHAGINA et al. 2004). Therefore, we wondered whether PP196A² homozygotes might show a phenotype in a background of reduced total PP1c. We introduced PP187B^87Bg-3/+, which lowers the total PP1 activity by 40%, into a PP196A² background, but found that adult flies heterozygous for PP187B and homozygous for PP196A (PP187B^87Bg-3, PP196A²/PP187B⁺, PP196A²) have normal viability and appearance (not shown). PP187B^87Bg-3/PP187B¹ trans-heterozygotes (which lack 80% of total PP1 activity) die during pupariation and, until pupariation, do not lag behind in development compared to their heterozygous siblings. We also examined flies lacking wild-type copies of both PP187B and PP196A (PP187B^87Bg-3, PP196A²/PP187B¹, and PP196A²). These mutants, which might lack as much as 90% of total PP1 activity, died slightly earlier than PP187B^87Bg-3/PP187B¹ and pupariated 1–2 days later than their siblings. This suggests a weak enhancement of PP187B by PP196A, although a possible effect of genetic background cannot be ruled out. The pupal lethality of PP187B mutants, with or without PP196A², could indicate a high requirement for total PP1 or PP1 during metamorphosis.

PP196A enhances PP1ß9C through zip:

Of the three PP1 genes in Drosophila, PP196A is the only one that has the conserved final 25–27 amino acids at its C terminus (Figure 1), but a related sequence is also present in PP1ß9C. We therefore wondered whether a mutation in PP196A would genetically interact with PP1ß9C. To test this, we used the weak allele PP1ß9C¹, which is viable but flightless due to defects in the indirect flight muscles (RAGHAVAN et al. 2000). PP1ß9C¹/Y ; PP196A¹/+ and PP1ß9C¹/Y ; Df(3R)crb87-5/+ were viable and do not exhibit any phenotype apart from rare defects in the posterior part of the wing (not shown). PP1ß9C¹/Y ; PP196A¹/Df(3R)crb87-5, however, was completely lethal (Table 1), showing that PP196A indeed interacts genetically with PP1ß9C. The enhancement of PP1ß9C¹ by PP196A is specific to PP196A and not due to an overall reduction of PP1 activity, because PP1ß9C¹/Y; PP187B^87Bg-3/+ is viable (not shown).

View this table: In this window In a new window   TABLE 1 PP196A is an enhancer of PP1ß9C1 (from cross PP1ß9C1/FM7 ; Df(3R)crb87-5/TM6B x PP196A1/PP196A1)

 
Genetic interaction between different mutants often indicates that the genes act in the same pathway. Since PP1ß9C has a single essential and nonredundant function as a nonmuscle myosin phosphatase, we wondered whether the lethality of PP1ß9C¹/Y; PP196A¹/Df(3R)crb87-5 is due to a failure in nonmuscle myosin regulation and possibly to hyperactivation of nmmHC. To test this, we introduced the mutant zip¹ into a PP1ß9C¹/Y; PP196A¹/Df(3R)crb87-5 background and found that this rescued the lethality (Table 2), suggesting that the genetic interaction between PP1ß9C and PP196A is indeed related to the role of PP1ß9C in the regulation of nonmuscle myosin.

View this table: In this window In a new window   TABLE 2 nmmHC (zip) suppresses the enhancement of PP1ß9C1 by PP196A (from cross PP1ß9C1/FM7 ; Df(3R)crb87-5/TM6B x zip1/CyO ; PP196A1/PP196A1)

 

Redundancy between PP1 and PP1ß:

Overexpression of PP187B or PP196A does not complement PP1ß9C:

Although the protein sequences of PP1 and PP1ß are extremely similar (DOMBRÁDI et al. 1993), they show structural differences that are also conserved in humans. This suggests that the two subtypes might have differential, nonredundant functions. To test for redundancy of PP1ß, we expressed PP1 using the UAS/Gal4 system (BRAND and PERRIMON 1993) to see whether this would rescue the semilethal missense mutant PP1ß9C⁶. The altered amino acid of PP1ß9C⁶, Y¹³³, is thought to form a hydrogen bond to the peptide backbone of the substrate (EGLOFF et al. 1997); PP1ß9C⁶ protein is therefore likely to bind its substrates with lower affinity.

w PP1ß9C⁶/FM7c virgin females were crossed to males of the genotype w; arm-Gal4, UAS-HA-PP1c/TM6B. The presence of arm-Gal4 induces expression of UAS-HA-PP1c constructs throughout the fly and does not cause a phenotype. The expression level of UAS-HA-PP113C with arm-Gal4 was extremely low (<40 times lower than arm-Gal4, UAS-HA-PP187B, not shown); therefore, UAS-HA-PP113C was not included in the complementation analysis. As expected, expressing HA-PP1ß9C completely restored the viability (Table 3) as well as the wing phenotype (RAGHAVAN et al. 2000) of PP1ß9C⁶/Y males. However, PP1ß9C⁶/Y could not be rescued by expression of HA-PP187B or HA-PP196A (Table 3, summarized in Table 5). Western Blots with -HA showed clear expression of HA-PP1ß9C and slightly lower levels of HA-PP187B and HA-PP196A (Figure 3). We subsequently found that the expression levels of HA-PP196A and HA-PP1ß9C with arm-Gal4 were sufficient to complement a PP187B mutant, which showed that the expressed proteins are functional (see below).

View this table: In this window In a new window   TABLE 3 Expressing HA-PP1c in a PP1ß9C (PP1ß9C6) mutant background (from cross w, PP1ß9C6/FM7c x w ; arm-Gal4, UAS-HA-PP1c/TM6B)

 

View this table: In this window In a new window   TABLE 5 Summary of overexpression experiments

 

View larger version (20K): In this window In a new window Download PPT slide   FIGURE 3.— Expression levels of UAS-HA-PP1c with arm-Gal4 in the progeny of the crosses PP1ß9C6/FM7c x arm-Gal4, UAS-HA-PP1c. Expressed levels of HA-PP1c were detected with anti-HA. The amount of expressed HA-PP113C is below detection levels. HA-PP187B has slightly higher mobility because of its shortened C terminus (see Figure 1). -tub, -tubulin.

 

Overexpression of PP196A and PP1ß9C can rescue PP187B:

PP187B is the major PP1c isozyme in Drosophila and contributes 80% of the total PP1 activity (DOMBRÁDI et al. 1990). We wondered whether PP187B has a specific and nonredundant role in the development of Drosophila, which cannot be performed by another PP1c. We tested this by expressing PP196A and PP1ß9C in a PP187B mutant background, using the alleles PP187B¹ and PP187B^87Bg-3. PP187B¹ is an EMS-induced hypomorphic point mutant with a single amino acid replacement (G220S) in a residue that is conserved in all protein serine/threonine phosphatases of the PP1/PP2A/PP2B family (DOMBRÁDI and COHEN 1992). PP187B^87Bg-3 is an amorphic mutant resulting from DNA rearrangement in the 5'-end of PP187B (AXTON et al. 1990). PP187B¹/PP187B^87Bg-3 trans-heterozygotes are lethal. w; arm-Gal4; PP187B¹/TM6B female virgins were crossed to w; PP187B^87Bg-3, UAS-HA-PP1c/TM6B males to generate flies that express HA-PP1c in a PP187B mutant background.

PP187B¹/PP187B^87Bg-3 was rescued by overexpression of UAS-HA-PP187B with arm-Gal4, as expected, but also by overexpression of HA-PP196A or HA-PP1ß9C (Table 4, summarized in Table 5). The rescued flies had a normal appearance (not shown). This indicated that PP196A and PP1ß9C can substitute for PP187B in its absence and suggests that the lethality of PP187B mutants is due to a reduction of overall PP1 activity and not to an essential and nonredundant function of PP187B.

View this table: In this window In a new window   TABLE 4 Expressing HA-PP1c in a PP187B (PP187B1/PP187B87Bg-3) mutant background (from cross w ; arm-Gal4 ; PP187B1/TM6B x w ; PP187B87Bg-3, [UAS-HA-PP1c]/TM6B)

 

Overexpression of PP1ß9C does not rescue PP187B, PP196A double mutants:

As shown above, expression of PP1ß9C rescues a PP187B mutant. However, the presence of wild-type PP196A (and/or PP113C) in this background could mask an essential requirement for PP1 that PP1ß could not perform. Therefore, we expressed PP1ß9C in a PP187B, PP196A double-mutant background, by crossing w; arm-Gal4, PP187B^87Bg-3, PP196A²/TM6B to w; UAS-HA-PP1ß9C, PP187B¹, PP196A²/TM6B. We found that overexpression of PP1ß9C did not rescue the lethality of PP187B, PP196A double mutants (Table 6), indicating that Drosophila PP1 has at least one essential function that PP1ß9C cannot perform, possibly during late metamorphosis, as PP187B, PP196A double mutants with arm-Gal4, PP1ß9C die as late pupae.

View this table: In this window In a new window   TABLE 6 Expressing HA-PP1ß in a PP187B, PP196A mutant background (from cross w ; arm-Gal4 ; PP187B87Bg-3, PP196A2/TM6B x w ; UAS-HA-PP1ß9C, PP187B1, PP196A2/TM6B)

 

Protein phosphatase 1, as well as the PP1/PP1ß subtype difference, is highly conserved between Drosophila and mammals. Humans have three PP1 genes: PP1 and PP1 are homologs of the Drosophila PP1 genes, and PP1 (also known as PP1ß) corresponds to PP1ß.

We show here that expression of HA-PP187B and HA-PP196A does not rescue a semilethal allele of PP1ß, which further supports our previous conclusion that PP1ß9C has an essential function that cannot be performed by PP1 (VERESHCHAGINA et al. 2004). It also allows us to rule out an alternative explanation for the PP1ß9C mutant phenotype—that PP1ß9C, but none of the PP1 forms, is expressed in a specific subset of cells during fly development. The data above rule out this possibility, as overexpression of PP187B and PP196A did not rescue strong PP1ß9C alleles, while expression of PP1ß9C, under the control of the same driver, fully rescued the phenotype of PP1ß9C⁶. The specific, nonredundant function of PP1ß has been identified as regulation of nonmuscle myosin activity, possibly through the PP1ß-specific interactor MYPT-75D (VERESHCHAGINA et al. 2004). MYPT-75D is the fly homolog of mammalian MYPT3 (myosin phosphatase-targeting subunit) and is related to Mbs (myosin-binding subunit), which is the homolog of mammalian MYPT1 and MYPT2. Mbs regulates myosin activity by targeting PP1c to its substrate myosin regulatory light chain (MIZUNO et al. 1999). Recently, it was shown that human MYPT3 co-immunoprecipitated with PP1, and phosphorylation of MYPT3 by protein kinase A activated PP1 toward cytoplasmic myosin regulatory light chain (YONG et al. 2006).

Of the four Drosophila PP1c genes, PP187B, PP113C, and PP1ß9C have been previously characterized by mutational analysis (AXTON et al. 1990; CLYNE et al. 1999; RAGHAVAN et al. 2000). By generating a viable and fertile null allele of PP196A, we found that PP196A is not an essential gene. It does, however, have an essential function in the PP1ß9C¹ mutant background, and this function probably relates to the regulation of nonmuscle myosin. PP196A, but not PP187B or PP113C, was able to bind to a fragment of MYPT-75D that lacked the N terminus in the yeast two-hybrid system (L. ALPHEY, unpublished results) although it did not bind to the whole MYPT-75D protein, whereas PP1ß did (VERESHCHAGINA et al. 2004). Thus, it is possible that PP196A may have a weak affinity to bind MYPT-75D and enhances PP1ß by being partly redundant with it. Alternatively, PP196A could be partially redundant with PP1ß9C through binding to Mbs. Studies on the crystal structure of the vertebrate PP1-MYPT1 complex suggest that the tyrosine residues Y305 and Y307 at the C terminus of chicken PP1 are particularly important for its binding to the second ankyrin repeat of MYPT1 (TERRAK et al. 2004). Y305 and Y307 are in the C-terminal part that PP187B and PP113C lack and are conserved in Drosophila PP1ß (Y304 and Y306). PP196A has only one tyrosine residue at Y304, shifted by one amino acid compared to PP1ß (Figure 1). The mammalian Mbs homologs MYPT1/2 seem to bind specifically to mammalian PP1ß in vivo (HARTSHORNE 1998). Thus, even though all four Drosophila PP1c isozymes bind Mbs in the yeast two-hybrid system (VERESHCHAGINA et al. 2004), it may be that the majority of nonmuscle myosin phosphatase complexes in vivo consist of PP1ß9C/Mbs and a minority of PP196A/Mbs (Figure 4). Both models would explain why PP196A and not, for example, PP187B, enhance PP1ß9C¹: in a weak PP1ß9C mutant background, PP196A would be able to compensate for partial loss of PP1ß9C activity, but not in the strong and semilethal background of PP1ß9C⁶.

View larger version (46K): In this window In a new window Download PPT slide   FIGURE 4.— Model for PP196A function in nonmuscle myosin regulation. Dephosphorylation of the nonmuscle myosin regulatory light chain (Sqh, Spaghetti Squash) inhibits the ATPase activity of nonmuscle myosin heavy chain (Zip, Zipper) and subsequent contraction. The major Sqh phosphatase PP1ß9C is targeted to nonmuscle myosin by the nonmuscle myosin phosphatase-targeting subunits Mbs and MYPT-75D. MYPT-75D is prenylated and probably membrane associated. PP196A might have a weak affinity to Mbs and/or MYPT-75D and be partly redundant with PP1ß9C. CM, cytoplasmic membrane.

 
Even though PP1 is involved in the regulation of numerous cellular processes, relatively little is known about specific and nonredundant functions of the different PP1c isozymes. In mice, PP1 (probably the testis-specific splice variant PP12) has a nonredundant function in spermatogenesis, as PP1 knockout male mice are viable but sterile with defects in spermatogenesis, while knockout female mice are viable and fertile (VARMUZA et al. 1999). Presumably, the somatic and female germline functions of PP1 are redundant with PP1 and/or PP1. No knockout analysis exists for the other PP1c genes, although PP1 was shown to have a specific function in murine lung growth and morphogenesis (HORMI-CARVER et al. 2004).

The conservation of the PP1/ß difference between flies and mammals suggests an ancient qualitative difference between the two subtypes. This raises the question of whether a PP1-specific function exists that PP1ß cannot perform. We found that expression of PP196A and PP1ß9C could complement a lethal PP187B mutant, suggesting that the role of PP187B is essential because of its high expression levels rather than structural differences with the other PP1c isozymes. However, expression of PP1ß9C did not rescue a PP187B, PP196A double mutant, suggesting that at least one developmental process in Drosophila depends on PP1 specifically.

Mammalian PP1, PP11, and PP1 localize to distinct subcellular locations in mammalian cells (ANDREASSEN et al. 1998; TRINKLE-MULCAHY et al. 2001, 2003; LESAGE et al. 2005). It is thought that such specific localization and function is mediated by regulators that bind the PP1c isozymes with different affinities. Neurabin I and Neurabin II/Spinophilin were identified to bind PP11 and PP1, but not PP1 (MACMILLAN et al. 1999; TERRY-LORENZO et al. 2002), and several PP1- and PP11-specific regulators have been identified in mouse fetal lung epithelial cells (FLORES-DELGADO et al. 2005). In Drosophila, even though the majority of PP1c regulatory subunits seem to bind all four PP1c isozymes in the yeast two-hybrid system (BENNETT et al. 2006), we identified three interactors that bind PP1 specifically or with greatly increased affinity compared to PP1ß (L. ALPHEY, unpublished results). One of them, CG11416 (uri), is essential for viability (J. KIRCHNER and L. ALPHEY, unpublished results) and could mediate an essential requirement for PP1.

In this study we show that PP196A is not an essential gene, but has an essential function in nonmuscle myosin regulation in a weak PP1ß9C mutant background. Furthermore, we demonstrate by complementation analysis that PP1ß9C has an essential function that is nonredundant with PP1, while PP187B is essential only because of its high expression levels. Overexpressing PP1ß9C does not rescue a PP187B, PP196A double mutant, indicating a PP1-specific developmental function. Together, this sheds new light on the essential, redundant, and overlapping functions of the PP1c genes in Drosophila.

The authors thank Karen Clifton for technical assistance and the Bloomington and Kyoto stock centers for providing the mutant fly strains. We also thank Helen White-Cooper for helpful discussion. This work was supported by grants from the United Kingdom Biotechnology and Biological Sciences Research Council and the United Kingdom Medical Research Council. D.B. is a Todd Bird Research Fellow at New College, Oxford.

¹ Present address: Abbott Laboratories, Global Pharmaceutical Regulatory Affairs, Abbott Park, IL 60064-6157.

ANDREASSEN, P. R., F. B. LACROIX, E. VILLA-MORUZZI and R. L. MARGOLIS, 1998 Differential subcellular localization of protein phosphatase-1 alpha, gamma1, and delta isoforms during both interphase and mitosis in mammalian cells. J. Cell. Biol. 141: 1207–1215.[Abstract/Free Full Text]

AXTON, J. M., V. DOMBRADI, P. T. COHEN and D. M. GLOVER, 1990 One of the protein phosphatase 1 isoenzymes in Drosophila is essential for mitosis. Cell 63: 33–46.[CrossRef][Medline]

BAKSA, K., H. MORAWIETZ, V. DOMBRADI, M. AXTON, H. TAUBERT et al., 1993 Mutations in the protein phosphatase 1 gene at 87B can differentially affect suppression of position-effect variegation and mitosis in Drosophila melanogaster. Genetics 135: 117–125.[Abstract]

BENNETT, D., and L. ALPHEY, 2002 PP1 binds dSARA to antagonise Dpp signalling. Nat. Genet. 31: 419–423.[CrossRef][Medline]

BENNETT, D., B. SZOOR, S. GROSS, N. VERESHCHAGINA and L. ALPHEY, 2003 Ectopic expression of inhibitors of protein phosphatase type 1 (PP1) can be used to analyze roles of PP1 in Drosophila development. Genetics 165: 235–245.[Abstract/Free Full Text]

BENNETT, D., E. LYULCHEVA and L. ALPHEY, 2006 Towards a comprehensive analysis of the protein phosphatase 1 interactome in Drosophila. J. Mol. Biol. 364: 196–212.[CrossRef][Medline]

BERNDT, N., M. DOHADWALA and C. W. LIU, 1997 Constitutively active protein phosphatase 1alpha causes Rb-dependent G1 arrest in human cancer cells. Curr. Biol. 7: 375–386.[CrossRef][Medline]

BOLLEN, M., 2001 Combinatorial control of protein phosphatase-1. Trends Biochem. Sci. 26: 426–431.[CrossRef][Medline]

BRAND, A. H., and N. PERRIMON, 1993 Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118: 401–415.[Abstract]

CEULEMANS, H., and M. BOLLEN, 2004 Functional diversity of protein phosphatase-1, a cellular economizer and reset button. Physiol. Rev. 84: 1–39.[Abstract/Free Full Text]

CLYNE, P. J., S. J. CERTEL, M. DE BRUYNE, L. ZASLAVSKY, W. A. JOHNSON et al., 1999 The odor specificities of a subset of olfactory receptor neurons are governed by Acj6, a POU-domain transcription factor. Neuron 22: 203–204.[CrossRef][Medline]

COHEN, P. T. W., 2002 Protein phosphatase 1—targeted in many directions. J. Cell Sci. 115: 241–256.[Abstract/Free Full Text]

DOMBRÁDI, V., and P. T. W. COHEN, 1992 Protein phosphorylation is involved in the regulation of chromatin condensation during interphase. FEBS Lett. 312: 21–26.[CrossRef][Medline]

DOMBRÁDI, V., J. M. AXTON, H. M. BARKER and P. T. COHEN, 1990 Protein phosphatase 1 activity in Drosophila mutants with abnormalities in mitosis and chromosome condensation. FEBS Lett. 275: 39–43.[CrossRef][Medline]

DOMBRÁDI, V., D. J. MANN, R. D. C. SAUNDERS and P. T. W. COHEN, 1993 Cloning of the fourth functional gene for protein phosphatase 1 in Drosophila melanogaster from its chromosomal location. Eur. J. Biochem. 212: 177–183.[Medline]

EGLOFF, M. P., D. F. JOHNSON, G. MOORHEAD, P. T. COHEN, P. COHEN et al., 1997 Structural basis for the recognition of regulatory subunits by the catalytic subunit of protein phosphatase 1. EMBO J. 16: 1876–1887.[CrossRef][Medline]

FLORES-DELGADO, G., C. W. LIU, R. SPOSTO and N. BERNDT, 2007 A limited screen for protein interactions reveals new roles for protein phosphatase 1 in cell cycle control and apoptosis. J. Proteome Res. 6(3): 1165–1175.

HARTSHORNE, D. J., 1998 Myosin phosphatase: subunits and interactions. Acta Physiol. Scand. 164: 483–493.[CrossRef][Medline]

HORMI-CARVER, K.-K., W. SHI, C. W. Y. LIU and N. BERNDT, 2004 Protein phosphatase 1alpha is required for murine lung growth and morphogenesis. Dev. Dyn. 229: 797–801.

ISHII, K., K. KUMADA, T. TODA and M. YANAGIDA, 1996 Requirement for PP1 phosphatase and 20S cyclosome/APC for the onset of anaphase is lessened by the dosage increase of a novel gene sds23+. EMBO J. 15: 6629–6640.[Medline]

KELLERMAN, K. A., and K. G. MILLER, 1992 An unconventional myosin heavy chain gene from Drosophila melanogaster. J. Cell Biol. 119: 823–834.[Abstract/Free Full Text]

LASKI, F. A., D. C. RIO and G. M. RUBIN, 1986 Tissue specificity of Drosophila P element transposition is regulated at the level of mRNA splicing. Cell 44: 7–19.[CrossRef][Medline]

LESAGE, B., M. BEULLENS, H. CEULEMANS, B. HIMPENS and M. BOLLEN, 2005 Determinants of the nucleolar targeting of protein phosphatase-1. FEBS Lett. 579: 5626–5630.[Medline]

LIN, Q., E. S. BUCKLER, S. V. MUSE and J. C. WALKER, 1999 Molecular evolution of type 1 serine/threonine protein phosphatases. Mol. Phylogenet. Evol. 12: 57–66.[CrossRef][Medline]

MACMILLAN, L. B., M. A. BASS, N. CHENG, E. F. HOWARD, M. TAMURA et al., 1999 Brain actin-associated protein phosphatase 1 holoenzymes containing spinophilin, neurabin, and selected catalytic subunit isoforms. J. Biol. Chem. 274: 35845–35854.[Abstract/Free Full Text]

MIZUNO, T., M. AMANO, K. KAIBUCHI and Y. NISHIDA, 1999 Identification and characterization of Drosophila homolog of Rho-kinase. Gene 238: 437–444.[CrossRef][Medline]

PRINTEN, J. A., M. J. BRADY and A. R. SALTIEL, 1997 PTG, a protein phosphatase 1-binding protein with a role in glycogen metabolism. Science 275: 1475–1478.[Abstract/Free Full Text]

RAGHAVAN, S., I. WILLIAMS, H. ASLAM, D. THOMAS, B. SZOOR et al., 2000 Protein phosphatase 1beta is required for the maintenance of muscle attachments. Curr. Biol. 10: 269–272.[CrossRef][Medline]

SAMBROOK, J., E. F. FRITISCH and T. M. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

TERRAK, M., F. KERFF, K. LANGSETMO, T. TAO and R. DOMINGUEZ, 2004 Structural basis of protein phosphatase 1 regulation. Nature 429: 780–784.[CrossRef][Medline]

TERRY-LORENZO, R. T., L. C. CARMODY, J. W. VOLTZ, J. H. CONNOR, S. LI et al., 2002 The neuronal actin-binding proteins, neurabin I and neurabin II, recruit specific isoforms of protein phosphatase-1 catalytic subunits. J. Biol. Chem. 277: 27716–27724.[Abstract/Free Full Text]

TOBA, G., T. OHSAKO, N. MIYATA, T. OHTSUKA, K. H. SEONG et al., 1999 The gene search system: a method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster. Genetics 151: 725–737.[Abstract/Free Full Text]

TRINKLE-MULCAHY, L., J. E. SLEEMAN and A. I. LAMOND, 2001 Dynamic targeting of protein phosphatase 1 within the nuclei of living mammalian cells. J. Cell Sci. 114: 4219–4228.[Abstract/Free Full Text]

TRINKLE-MULCAHY, L., P. D. ANDREWS, S. WICKRAMASINGHE, J. SLEEMAN, A. PRESCOTT et al., 2003 Time-lapse imaging reveals dynamic relocalisation of PP1gamma throughout the mammalian cell cycle. Mol. Biol. Cell 14: 107–117.[Abstract/Free Full Text]

VARMUZA, S., A. JURISICOVA, K. OKANO, K. BOEKELHEIDE and E. B. SHIPP, 1999 Spermiogenesis is impaired in mice bearing a targeted mutation in protein phosphatase 1cgamma gene. Dev. Biol. 205: 98–110.[CrossRef][Medline]

VERESHCHAGINA, N., D. BENNETT, B. SZOOR, J. KIRCHNER, S. GROSS et al., 2004 The essential role of PP1beta in Drosophila is to regulate non-muscle myosin. Mol. Biol. Cell 15: 4395–4405.[Abstract/Free Full Text]

WUSTMANN, G., J. SZIDONYA, H. TAUBERT and G. REUTER, 1989 The genetics of position-effect variegation modifying loci in Drosophila melanogaster. Mol. Gen. Genet. 217: 520–527.[CrossRef][Medline]

YONG, J., I. TAN, L. LIM and T. LEUNG, 2006 Phosphorylation of myosin phosphatase targeting subunit 3 (MYPT3) and regulation of protein phosphatase 1 by protein kinase A. J. Biol. Chem. 281: 31202–31211.[Abstract/Free Full Text]

Communicating editor: T. SCHÜPBACH

This article has been cited by other articles:

				S. Tan, E. Lyulcheva, J. Dean, and D. Bennett Mars promotes dTACC dephosphorylation on mitotic spindles to ensure spindle stability J. Cell Biol., July 14, 2008; 182(1): 27 - 33. [Abstract] [Full Text] [PDF]

International Access Link

Online ISS 1091-6490
Copyright 2008 by the Genetics Society of America
phone: 412-268-1812   fax: 412-268-1813   email: genetics-gsa{at}andrew.cmu.edu