IDT. Quality oligos. Every time.

Originally published as Genetics Published Articles Ahead of Print on March 4, 2007.

Genetics, Vol. 176, 139-150, May 2007, Copyright © 2007
doi:10.1534/genetics.107.070904

Transcriptional Control of Gluconeogenesis in Aspergillus nidulans

* Department of Genetics, University of Melbourne, Victoria, 3010 Australia and {dagger} Department of Biological Sciences, University of Hull, Hull HU6 7RX, England

1 Corresponding author: Department of Genetics, University of Melbourne, Victoria, 3010 Australia.
E-mail: mjhynes{at}unimelb.edu.au

Manuscript received January 13, 2007. Accepted for publication February 16, 2007.

ABSTRACT

Aspergillus nidulans can utilize carbon sources that result in the production of TCA cycle intermediates, thereby requiring gluconeogenesis. We have cloned the acuG gene encoding fructose-1,6 bisphosphatase and found that expression of this gene is regulated by carbon catabolite repression as well as by induction by a TCA cycle intermediate similar to the induction of the previously studied acuF gene encoding phosphoenolpyruvate carboxykinase. The acuN356 mutation results in loss of growth on gluconeogenic carbon sources. Cloning of acuN has shown that it encodes enolase, an enzyme involved in both glycolysis and gluconeogenesis. The acuN356 mutation is a translocation with a breakpoint in the 5' untranslated region resulting in loss of expression in response to gluconeogenic but not glycolytic carbon sources. Mutations in the acuK and acuM genes affect growth on carbon sources requiring gluconeogenesis and result in loss of induction of the acuF, acuN, and acuG genes by sources of TCA cycle intermediates. Isolation and sequencing of these genes has shown that they encode proteins with similar but distinct Zn(2) Cys(6) DNA-binding domains, suggesting a direct role in transcriptional control of gluconeogenic genes. These genes are conserved in other filamentous ascomycetes, indicating their significance for the regulation of carbon source utilization.


AN important feature of filamentous fungi in their role in the environment and as pathogens is their ability to metabolize a diverse range of organic molecules as carbon sources. Most filamentous fungi are saprophytes that grow on environmental compounds as nutrients. Growth on stored carbon sources is also important during various developmental stages and for the provision of substrates in the synthesis of secondary metabolites. The utilization of carbon sources during infection by fungal pathogens may have profound effects on pathogenicity (e.g., THINES et al. 2000; LORENZ and FINK 2002; WANG et al. 2003; BARELLE et al. 2006).

For a substrate serving as the sole carbon source, all cellular carbon components must be derived from this compound. Organisms rearrange the expression of genes encoding enzymes catalyzing the appropriate steps in metabolic pathways according to the substrates available usually by induction of enymes specific to the breakdown of the particular compound. It is also necessary to alter the central carbon metabolic pathways to enable the generation of essential carbon-containing biosynthetic intermediates and energy and reducing power to deal with metabolic stresses. This is clearly shown by comparing growth on sugars that feed into glycolysis with growth on compounds that result in tricarboxylic acid (TCA) cycle intermediates where there is a requirement for the net formation of sugars—i.e., gluconeogenesis, a reversal of glycolysis with oxaloacetate being converted to hexose sugars. Futile cycling between degradation and biosynthesis of sugars by glycolysis opposed by gluconeogenesis is avoided by appropriate regulation of the synthesis and activity of the relevant enzymes. The key enzymes specific for gluconeogenesis are phosphoenolpyruvate carboxykinase (PEPCK; E.C.4.1.1.32), which converts oxaloacetate to phosphoenolpyruvate, and fructose-1,6-bisphosphatase (FBP; E.C.3.1.3.11), which catalyzes the final step in hexose monophosphate formation—the hydrolysis of fructose-1,6-bisphosphate to fructose-6-phosphate and phosphate.

Saccharomyces cerevisiae has a strong preference for growth on fermentable monosaccharides, resulting in the production of ethanol. When glucose is exhausted, metabolism switches to a respiratory mode in which the ethanol is consumed by rearrangement of gene expression (DERISI et al. 1997; SCHULLER 2003; DARAN-LAPUJADE et al. 2004). In contrast to filamentous fungi, S. cerevisiae can use only a limited number of gluconeogenic substrates as the sole sources of carbon and energy. These include ethanol, acetate, and fatty acids, all of which result in the production of acetyl-CoA. The enzymes isocitrate lyase (ICL; E.C.4.1.3.1) and malate sythase (MAS; E.C.4.1.3.2), constituting the glyoxalate cycle, are necessary for the net conversion of acetyl-CoA to oxaloacetate, which is then used for gluconeogenesis. The Zn(2) Cys(6) binuclear (SCHJERLING and HOLMBERG 1996; TODD and ANDRIANOPOULOS 1997) proteins, Cat8 and Sip4 (RAHNER et al. 1996; HAURIE et al. 2001; SCHULLER 2003; ROTH et al. 2004), control the expression of the genes for the synthesis of acetyl-CoA and its metabolism by the glyoxalate bypass as well as gluconeogenesis. Some of the genes are also regulated by the Cys2His2 zinc-finger protein Adr1 (YOUNG et al. 2003). Therefore, growth on ethanol or acetate as sole carbon sources is dependent on the Cat8, Sip4, and Adr1 activators as well as on the Snf1 kinase (VINCENT and CARLSON 1998; YOUNG et al. 2003). In the presence of glucose, the Cys2His2 zinc-finger Mig1 protein represses the expression of gluconeogenic genes both directly and by repressing the expression of Cat8 (GANCEDO 1998; ZARAGOZA et al. 2001; reviewed in SCHULLER 2003). Single genes encode PEPCK (PCK1) and FBP (FBP1) and their transcription is dependent on Cat8/Sip4 activation. The levels of these enzymes are also regulated post-transcriptionally in response to glucose. The 5' regions of genes regulated by Cat8/Sip4 contain cis-acting elements (carbon source response elements) to which Cat8p and Sip4p bind (ZARAGOZA et al. 2001; SCHULLER 2003; ROTH et al. 2004). Therefore, in S. cerevisiae the expression of genes for both the glyoxalate cycle and gluconeogenesis is controlled by a single circuit that responds to a lack of the fermentable carbon source glucose. However, in Kluyveromyces lactis, regulation of both gluconeogenic genes KlFBP1 and KlPCK1 is independent of KlCat8p (GEORIS et al. 2000), indicating that the roles of Cat8/Sip4 as general regulators of gluconeogenesis are not conserved.

Filamentous fungi can grow at the expense of a great diversity of compounds that feed into the TCA cycle and therefore require gluconeogenesis (HONDMANN and VISSER 1994). These include not only sources of acetyl-CoA (ethanol, acetate, fatty acids) but also sources of 2-oxoglutarate (amino acids) and sources of both succinate and acetyl-CoA (aromatic acids and fatty acids containing odd numbers of carbon), which are not dependent on the glyoxalate cycle (ARST et al. 1975; KINGHORN and PATEMAN 1976; KUSWANDI and ROBERTS 1992; BROCK et al. 2000; BROCK 2005).

In Aspergillus nidulans, mutations in the facB gene result in an inability to grow on two-carbon compounds metabolized via acetyl-CoA (ARMITT et al. 1976; HYNES 1977; KATZ and HYNES 1989). FacB is a Zn(2) Cys(6) binuclear cluster protein with similarity to Cat8 and Sip4 of S. cerevisiae, and binding sites for this activator have been found in the 5' region of the acetate-induced genes acuD (ICL) and acuE (MAS) as well as facA (acetyl-CoA synthase) and facC (cytoplasmic acetyl carnitine transferase) genes, which are required for growth on acetate as a sole source of carbon (TODD et al. 1997, 1998; STEMPLE ET AL. 1998). facB mutants are unaffected in the utilization of other gluconeogenic carbon sources, clearly suggesting that FacB is a specific regulator of two-carbon metabolism and does not control gluconeogenesis (ARMITT et al. 1976). This contrasts with S. cerevisiae where both the glyoxalate cycle and gluconeogenesis are controlled by a single circuit.

Mutations in the acuF gene have been isolated by virtue of their leading to an inability to grow on acetate and found to specifically lack PEPCK activity (ARMITT et al. 1976). acuF mutants are also unable to grow on carbon sources requiring gluconeogenesis (Figure 1). PEPCK activity is induced not only by acetate but also by glutamate, proline, and other sources of TCA cycle intermediates, but is not strongly repressed by glucose (KELLY and HYNES 1981). Analysis of regulation of the acuF gene confirmed that expression is induced by sources of TCA cycle intermediates, and mutations preventing the metabolism of inducers to TCA cycle intermediates prevented induction. The pattern of regulation is not consistent wih direct regulation by FacB. Furthermore, deletion analysis of the 5' region of acuF showed that the region responsible for induction lacks FacB-binding sites (HYNES et al. 2002).


Figure 1
View larger version (92K):
In this window
In a new window
Download PPT slide
 
FIGURE 1.—

Growth of relevant mutants on carbon sources. The following carbon sources were added to minimal medium with 10 mM ammonium chloride as the nitrogen source: glucose (1%), glycerol (0.5%), acetate (50 mM), ethanol (0.5%), L-proline (50 mM), L-alanine (50 mM), malate (10 mM), quinate (0.2%), valerate (10 mM), butyrate (20 mM), and Tween 80 (0.2%). All acids were adjusted to a pH of ~6.5 with sodium hydroxide where necessary. Tween 80 is a source of the long-chain fatty acid oleate. Growth was for 2–3 days at 37° except for malate (6 days).

 
A. nidulans acuG mutants are unable to grow on acetate and specifically lack FBP activity (ARMITT et al. 1976) and, consistent with this, they are unable to utilize any gluconeogenic carbon sources, or glycerol (Figure 1). Here we report the isolation of the acuG gene and the study of its regulation. As for acuF, there is increased expression under conditions where TCA cycle intermediates accumulate, suggesting an induction mechanism, and there is no evidence for direct induction by FacB.

The acuN356 mutation (ARMITT et al. 1976) results in loss of growth on gluconeogenic carbon sources (Figure 1). Surprisingly, we have found that acuN encodes enolase (E.C.4.2.1.11), one of the reversible enzymes that are essential for both glycolysis and gluconeogenesis. The acuN356 mutation is due to a translocation with a breakpoint in the 5' region, resulting in the loss of expression in response to gluconeogenic carbon sources but not glycolytic carbon sources.

The acuK and acuM genes were identified in the original screen for acetate mutants (ARMITT et al. 1976). Mutations in these genes do not just affect growth on acetate but also on all carbon sources requiring gluconeogenesis (Figure 1). We have found that the acuK248 and acuM301 mutations each result in the loss of induction of the acuF, acuN, and acuG genes by sources of TCA cycle intermediates. A direct role for the products of acuK and acuM in transcriptional activation of gluconeogenic genes is indicated by the finding that these genes encode proteins with similar but distinct Zn(2) Cys(6) DNA-binding domains. Furthermore, these genes are conserved in other filamentous ascomycetes, indicating that this gluconeogenic control circuit is of broad significance for fungal biology.


MATERIALS AND METHODS

A. nidulans strains, media, enzyme assays, and transformation:

Media and conditions for growth of A. nidulans were as described by COVE (1966). Carbon and nitrogen sources were added as appropriate to minimal salts. The pH of these was adjusted to 6.5 where necessary. Mycelia for enzyme assays and RNA and DNA preparations were grown in 100 ml of medium in 250-ml Ehlenmeyer flasks at 37°. ß-Galactosidase assays were carried out by the method of DAVIS et al. (1988). All strains were derived from the original Glasgow strain and contained the velA1 mutation to promote uniform flat conidiation, and standard genetic manipulations were as previously described (CLUTTERBUCK 1974, 1994). Preparation of protoplasts and transformation were as described (TILBURN et al. 1983; ANDRIANOPOULOS and HYNES 1988).

Molecular techniques:

Standard methods for DNA manipulations, RNA isolation, nucleic acid blotting, and hybridization have been described (SAMBROOK et al. 1989; TODD et al. 2005; HYNES et al 2006).

Cloning and analysis of the acuN gene:

A strain containing the acuN356 mutation was crossed to a strain containing the pyrG89 mutation to generate an acuN356;pyrG89 double mutant. This strain was transformed with DNA of the genomic library in the autonomously replicating vector pRG3AMA1 (OSHEROV and MAY 2000) selecting for pyrimidine prototrophy. Plates containing transformants were velvet replicated to medium with 50 mM acetate as the sole carbon source, and complementing colonies growing on acetate were purified and genomic DNA prepared. Plasmid DNA was recovered by transforming this DNA into Escherichia coli selecting for ampicillin resistance. Extensive subcloning and further transformation experiments identified plasmid subclones capable of complementing the acuN356 mutation. DNA sequencing identified the complementing sequences as corresponding to the annotated gene AN5746.3 (http://www.broad.mit.edu/annotation/genome/aspergillus_nidulans/Home.html). Southern blot analysis confirmed that this was a unique gene.

Sequences flanking the proposed translocation breakpoint in the acuN356 mutant were cloned by inverse PCR. Genomic DNA of an acuN356 strain (G520, wA3;pyroA4;acuN356) was digested with HindIII, ligated, and used for the PCR with the primers inverse PCR-1 (CGTGGATCTTGGAGATAGGC) and inverse PCR-2 (CCCGCTCAGTCTACGACTCT). The resulting product was cloned into the EcoRV site of pBluescriptSK+ (Stratagene, La Jolla, CA) and sequenced. Comparison of this sequence with the A. nidulans genome sequence allowed the identification of the translocation breakpoint (see RESULTS).

To disrupt the acuN gene, a HindIII–SmaI fragment containing the riboB gene from plasmid pPL1 (OAKLEY et al 1987) was used to replace a HindIII–EcoRV fragment of acuN (coordinates –567 to +833) to generate the plasmid pSM5644. A linear NotI–XhoI fragment from this plasmid was gel purified and used to transform a diploid strain homozygous for the riboB2 mutation with selection for Ribo+ transformants. A transformant heterozygous for the predicted acuN::riboB gene replacement (acuN{Delta}) was detected by Southern blot analysis.

Promoter sequences of acuN used to construct lacZ fusions were generated by the PCR using the primers AcuNlacZ-2 (CTAGATCTTGAGAGGCATCAGCGAACTA, coordinates –721 to –701) and AcuNlacZ-3 (CTAGATCTGTCTCGATCCATCAGCGATT, coordinates –208 to –189), together with AcuNlacZ-1 (GAAGATCTGCGTGGATCTTGGAGATAGG, coordinates +4 to +23), incorporating BglII sites to allow insertion into the BamHI site of pAN923-42B with the argB+ gene mutated by end filling the unique BglII site with Klenow DNA polymerase and religating (VAN GORCOM et al. 1986; PUNT et al. 1995) The constructs were checked by sequencing and plasmids transformed into a strain of genotype yA2 pabaA1; argB1 selecting for ArgB+. Single-copy insertions at the argB locus were detected by Southern blotting.

Cloning and analysis of the acuG gene:

A BLAST search performed on the University of Oklahoma A. nidulans EST database (http://www.genome.ou.edu/fungal.html) revealed sequences (x8e05a1.f1, x8e05a1.r1, and g7g01a1.r1) with a high level of similarity to FBP-encoding genes from yeast species. The EST x8e05a1 clone was obtained from the Fungal Genetics Stock Center (http://www.fgsc.net/) and used to probe an A. nidulans BAC library (kindly provided by Ralph Dean, Clemson University), and three hybridizing clones were identified. Clones 4P22, 12H22, and 16D24 all showed an identical restriction pattern in the hybridizing region in Southern blots. Derivative acuG subclones from 16D24 in pBluescript SK(+) were used in acuG223 mutation complementation experiments and for further manipulations. Sequencing (accession no. AF525021) showed that the gene corresponded to AN5604.3 in the A. nidulans database.

An acuG::lacZ construct (pES4979) was created using a BglII–EcoRV fragment (coordinates –1546 to +61) of the acuG gene cloned into the unique BamHI–SmaI sites of the plasmid pAN923-43B (VAN GORCOM et al. 1986), generating an in-frame fusion of the predicted first 20 amino acids of acuG with the E. coli lacZ gene. The argB+ gene of the pAN923-43B plasmid was mutated by end filling the unique BglII site with Klenow DNA polymerase and religating, allowing the selection of argB+ transformants generated by crossing over with the argB1 mutation to produce single-copy insertions at the argB locus.

To disrupt the acuG gene, a 2.2-kb SmaI–ClaI fragment containing the A. nidulans pyrG cassette of pAB4342 (BORNEMAN et al. 2001) was cloned into the EcoRV–ClaI sites of pES5431. Insertion of the 1-kb ClaI fragment of pES4723 into the ClaI site of the latter plasmid created pES5397. A 7-kb NotI–ApaI fragment was transformed into a pyrG89 strain, and transformants were selected for PyrG+. One transformant (acuG{Delta}) with an AcuG phenotype was shown by Southern blotting to have the predicted restriction map for relacement of the wild-type gene with the disruption construct.

Cloning of acuK:

Pools of cosmids from the chromosome 4-specific pWE15 and pLORIST2 libraries (BRODY et al. 1991) were used together with a plasmid (pPL5) containing the riboB gene (OAKLEY et al. 1987) to cotransform strain H1579: yA2biA;acuK248;riboB2 and Ribo+ transformants were selected. The transformants were grown on glucose minimal medium and then replicated onto acetate medium. In this way, a positive pool was identified and individual cosmids were eventually identified (SW22F05 and SW04205) as clones containing a sequence that could complement acuK258. The cosmid SW04205 was completely digested with BamHI, EcoRI, HindIII, KpnI, SalI, NotI, and PstI and the individual digests were used in cotransformations with pPL5 of H1579. HindIII- and SalI-digested cosmid DNA gave transformants that were able to grow on acetate medium. The HindIII digest gave eight bands on digestion and DNA from each of the bands was used in cotransformations. One band of ~9 kb was identified as the acuK complementing sequence. This band was digested with SalI, and a HindIII–SalI fragment derived from the original band of 4.8 kb complemented the acuK containing strain. This fragment was sequenced (accession no. AY255811) and corresponds to AN7468.3 in the A. nidulans database.

Cloning of acuM:

Initially, a strategy similar to that described for the cloning of acuK was adopted using the chromosome 1-specific cosmid library but using strain H1576: biA1, acuM301;wA3; riboB2 in the cotransformations. No positive transformants were identified. The acuJ gene is located 6 cM from acuM and a clone of acuJ was obtained by cotransformation of strain H1572: yA2pabaA1acuJ217;riboB2 with pools derived from 29 cosmid clones from the left arm of chromosome 1. A cosmid clone, L7G03, was identified as complementing the lack of growth on acetate due to the acuJ217 mutation (ARMITT et al. 1976). Individual cosmids in close proximity to this clone were screened for a clone that could complement acuM, but none was found. The acuJ clone was used to probe a BAC library (kindly provided by Ralph Dean, Clemson University) and clones that hybridized to the acuJ cosmid clone were identified. Four of these were used to cotransform H1576 and one, 4D7, gave acetate+ transformants. The BAC clone was completely digested with EcoRI, HindIII, and BamHI and, when individual digests were transformed into the acuM recipient, all the digests gave positive colonies on acetate medium. Of seven HindIII bands, one fragment of ~4 kb complemented the acuM mutation in cotransformations. This fragment was entirely sequenced (accession no. AY256961) and corresponds to AN6293.3 in the A. nidulans database.

Sequencing of the acuK and acuM mutations:

DNA from the respective mutant strains (G0306: pabaA1yA2;acuK248 or G1101: acuM301;wA3;pyroA4) was made and PCR primers were designed to amplify overlapping sections of the entire coding region of the genes. The PCR products were then sequenced using the same primers for sequencing as those used for the original amplification. Additional primers were designed to fill any gaps, and the coding region of both genes was sequenced on both strands.


RESULTS

Analysis of the acuN gene:

The acuN gene was originally defined by a single mutant isolated as unable to use acetate (ARMITT et al. 1976). The acuN356 mutation was found to result in loss of growth on a wide range of carbon sources requiring gluconeogenesis but was able to utilize glycerol (Figure 1). In this respect, the phenotype was identical to that of acuF205 strains lacking PEPCK (ARMITT et al. 1976; HYNES et al. 2002). The acuN gene was cloned by complementation of the acuN356 mutation (see MATERIALS AND METHODS). Sequencing of insert DNA in the recovered plasmids showed that the acuN gene corresponded to AN5746.3 in the genome sequence (Figure 2A) and encoded enolase (E.C.4.2.1.11). This was a surprising result as this enzyme is regarded as reversible and essential for both glycolysis and gluconeogenesis.


Figure 2
View larger version (14K):
In this window
In a new window
Download PPT slide
 
FIGURE 2.—

Characterization of the acuN356 mutation. (A) Schematic of the acuN gene corresponding to AN5746.3 in the A. nidulans database. The positions of exons are shown as thick lines and the coordinates are relative to the position of the ATG start codon. An expanded view of the 5'-end of the gene shows the position of the HindIII and HaeIII restriction sites used to map the acuN356 translocation breakpoint by Southern blotting of genomic DNA. The position of the intron in the 5' untranslated region is shown (open box) and the position of 5' endpoints of sequenced cDNAs is indicated, as are the positions of primers (inverse PCR-1 and -2) used for cloning the acuN356 translocation region. (B) Schematic of the acuN356 translocation breakpoint showing the contig coordinates on chromosomes 1 and 5 and the position of the breakpoint relative to the genes AN10770.3 and AN5746.3 (acuN). (C) Deletion of the acuN gene by replacement with the A. nidulans riboB gene in a riboB2 homozygous diploid strain. The relevant genotypes on linkage groups V and VIII of the resulting diploid are shown and phenotypes of haploids are recovered by haploidizing this diploid. All haploids have the riboB2 mutation (linkage group VIII) but none were phenotypically Ribo+ and all were FacA+, indicating that no haploids with the acuN{Delta} were recovered.

 
Crosses with acuN356-containing strains yielded abnormal slow-growing colonies, a phenomenon commonly associated with duplication–deficiency segregants arising from chromosomal rearrangements. Therefore, a diploid between an acuN356 strain and the strain MSF with each linkage group genetically marked was constructed and subjected to haploidization analysis (MCCULLY and FORBES 1965). This revealed that the acuN356 strain contained a translocation event involving linkage groups I and V. Southern blot analysis of HindIII- and HaeIII-digested acuN356 DNA, using cloned acuN DNA as a probe, localized a translocation breakpoint to the 5' region of acuN ~150–300 bp upstream of the predicted enolase ATG (Figure 1 and data not shown). The breakpoint was precisely identified by designing primers for inverse PCR with circularized HindIII-digested DNA as a template, followed by cloning and sequencing (Figure 2A). Comparison with the genome sequence showed that the breakpoint was precise and resulted in truncation of the acuN promoter at –220 and fusion to the coding region of the annotated gene AN10770.3 on linkage group I (Figure 2B).

These results suggested that the acuN356 mutation resulted in abnormal regulation of enolase expression rather than a complete loss of function. Therefore, the acuN gene was inactivated by insertion of the riboB+ selectable marker (Figure 2C) and selection for Ribo+ transformants of a diploid strain homozygous for riboB2. Southern blot analysis confirmed the successful isolation of a diploid strain heterozygous for the acuN deletion (data not shown). Haploidization of this diploid yielded no Ribo+ haploids—only haploids containing the linkage group V facA+ marker in coupling with acuN+ (Figure 2C). In this experiment, haploids were isolated using glucose-containing media. A less extensive haploidization experiment using media with proline as the sole carbon source also failed to yield Ribo+ haploids. This confirmed that the acuN gene is essential for growth on either glycolytic or gluconeogenic carbon sources, consistent with a single enolase enzyme being essential for both pathways.

Expression of the acuN gene was studied by Northern blotting (Figure 3A). No transcript was detected after transfer to medium lacking a carbon source while similar levels were found with glucose or the gluconeogenic carbon sources, acetate, glutamate, or {gamma}-aminobutyric acid. The presence of both glucose and the gluconeogenic carbon sources did not result in additive expression. Under these circumstances, uptake and metabolism of these gluconeogenic substrates would be repressed by glucose. Fusions of acuN 5' sequences to the lacZ reporter gene were constructed and integrated in single copy at the argB locus. When the 5' sequence extended to –721, high-level expression of ß-galactosidase was observed in the presence of glucose and glycerol (glycolytic) or acetate, proline, and quinate (gluconeogenic). Expression was greatly reduced on the gluconeogenic carbon sources when the 5' sequence was shortened to –206 while expression on glucose and glycerol was affected by less than twofold (Figure 3B). Consistent with these data, the acuN transcript was present at low levels in mycelium transferred to acetate or proline-containing media in the acuN356 mutant (Figure 3C). This was strong evidence for separate controls of acuN expression. During glycolysis, sequences downstream of –207 (with perhaps some contribution from upstream sequences) are used for activation of transcription while during gluconeogenesis sequences upstream of –207 are required. In the acuN356 mutant, a reciprocal translocation between chromosomes 1 and 5 has resulted in loss of gluconeogenic regulation without eliminating glycolytic regulation, consistent with the phenotype of the acuN356 mutant. On the basis of EST sequences, a large intron is predicted to occur in the acuN 5' untranslated region and cDNA 5'-ends have been found at –426 and at –4 (http://www.broad.mit.edu/annotation/genome/aspergillus_nidulans/Home.html). Comparison of the A. nidulans sequence with the 5' sequences of the corresponding genes in Aspergillus oryzae and Aspergillus fumigatus (accession nos. BAE57291 and AAK49451) indicate conservation of splice sites for the 5' intron. Splicing of the 5' intron from RNA synthesized under gluconeogenic conditions is predicted to result in similarly sized transcripts under both glycolytic and gluconeogenic growth conditions as observed in Northern blot analysis.


Figure 3
View larger version (46K):
In this window
In a new window
Download PPT slide
 
FIGURE 3.—

Analysis of expression of acuN and the effects of the acuN356 mutation. (A) Northern blot analysis of expression in a wild-type strain. RNA was extracted from mycelium grown for 16 hr in 1% glucose–10 mM ammonium tartrate medium and then transferred to medium with or without glucose (1%) with ammonium chloride (10 mM) as the nitrogen source with the following additions as indicated: acetate (50 mM); L-glutamate (10 mM); and {gamma}-aminobutyric acid–GABA (10 mM) for 4 hr. acuN RNA was detected by hybridization with a 3.8-kb EcoRI fragment (coordinates –461 to +3376). Hybridization with the EcoRI fragment of the histone H3 gene (EHINGER et al. 1990) was used as a loading control. (B) Effects of acuN 5' sequences on expression of a lacZ reporter. Mycelium from strains with single copies of plasmids with the indicated 5' sequences driving lacZ expression were grown for 20–24 hr in medium containing one of the carbon sources: glucose (1%), glycerol (0.5%), acetate (50 mM), proline (50 mM), and quinate (0.5%) together with ammonium chloride (10 mM) as the nitrogen source before harvesting, extraction, and determination of ß-galactosidase activities. The specific activity is expressed as Miller units per minute per milligram of protein (DAVIS et al. 1988) and represents the average of three independent experiments. The bars show standard errors. (C) Effects of the acuN356 mutation on acuN expression. RNA was extracted from wild type and an acuN356 strain grown under the same conditions as described in A and the Northern blot hybridized as in A.

 

Analysis of the acuG gene:

Mutations in the acuG gene specifically lack FBP (ARMITT et al 1976). These mutations result in loss of growth on gluconeogenic carbon sources as well as on glycerol where FBP but not enolase or PEPCK are required (see Figure 1). Somewhat leaky growth on gluconeogenic carbon sources is thought to be due to the presence of a nonspecific phosphatase activity (ARMITT et al 1976).

A BLAST search performed on the A. nidulans EST database revealed sequences with a high level of similarity to FBP-encoding genes of other species. An EST clone was used to probe an A. nidulans BAC library (see MATERIALS AND METHODS). A DNA segment of 3.4 kb was sequenced and predicted to encode a polypeptide of 356 amino acids with extensive similarity to FBP enzymes from other fungi. Subsequently, this sequence was found to correspond to AN5603.3 in the A. nidulans database. Subclones were cotransformed with the riboB+-containing plasmid pPL3 (OAKLEY et al 1987) into a riboB2 acuG223 strain, and Ribo+ transformants were selected. A total of 44–72% of transformants with any of the subclones containing the full acuG coding region and at least 135 bp of 5' sequence were fully complemented for the AcuG phenotype in that they showed restoration of growth on acetate, proline, glutamate, or glycerol, confirming that the cloned DNA fragment contained the acuG gene. An acuG deletion mutation was made with the pyrG+ selectable marker, replacing the coding region corresponding to amino acids 21–348 (see MATERIALS AND METHODS). This resulted in a phenotype identical to that of the acuG223 mutant (Figure 1).

An acuG::lacZ fusion gene was constructed that encoded a fusion protein with the first 20 amino acids of AcuG fused to E. coli LacZ (see MATERIALS AND METHODS). This was inserted in single copy at the argB locus and used to investigate acuG regulation under various growth conditions and in various genetic backgrounds.

Expression of AcuG-LacZ was significantly higher with acetate and slightly higher with proline or glycerol in comparison to glucose-grown conditions (Figure 4A). Levels of expression were slightly higher on xylose or fructose in comparison to glucose. It should be noted that a significant level of expression of AcuG-LacZ (~50 units) was observed even under the most repressed conditions (glucose and sucrose). This might reflect a level of constitutive expression. An alternative explanation is that this is due to an artifact of insertion of the fusion gene at an ectopic location. Growth on decreasing concentrations of glucose for 20 hr resulted in increased expression (Figure 4B). The creA gene in A. nidulans encodes a repressor protein with two C2H2 zinc fingers similar to those of S. cerevisiae Mig1p and is required for carbon catabolite repression (DOWZER and KELLY 1991). The creA204 mutation in the DNA-binding domain results in loss of glucose repression (SHROFF et al. 1996). In a creA204 background, AcuG-LacZ expression was elevated about twofold in the presence of glucose and sucrose (Figure 4A). The effects of the nonmetabolizable analogs of glucose, 2-deoxy-D-glucose (2-DOG) and 3-O-methyl-D-glucose (3-MeGlc), able to bring about carbon catabolite repression in S. cerevisiae (GANCEDO and GANCEDO 1985), were also tested (Figure 4C). Both 2-DOG and 3-MeGlc resulted in levels of repression that were similar to glucose relative to incubation in media lacking a carbon source, and repression was relieved by the creA204 mutation (Figure 4C). These results provided strong evidence for acuG being subject to CreA-mediated carbon catabolite repression.


Figure 4
View larger version (32K):
In this window
In a new window
Download PPT slide
 
FIGURE 4.—

Regulation of expression of the acuG::lacZ fusion gene. (A) Expression in the presence of various carbon sources and in the creA204 mutant background. Mycelium was grown for 20–24 hr in minimal medium with 10 mM ammonium tartrate as the nitrogen source and the indicated carbon sources at 1% except for acetate and proline (50 mM). (B) Expression in mycelium grown for 20 hr in the indicated glucose concentrations with 10 mM ammonium tartrate as the nitrogen source. (C) Effects of nonmetabolizable glucose analogs on expression in the wild-type and creA204 strains. 2-DOG and 3-MeGlc were present at the indicated concentrations. Mycelia were grown in 1% glucose–10 mM ammonium tartrate medium for 16 hr and then transferred to the indicated media with 10 mM ammonium chloride present as the nitrogen source for a further 4 hr before harvesting. (D) Expression in various mutant backgrounds. Mycelia of strains carrying the acuG::lacZ fusion gene in the indicated genetic background were grown in 0.1% glucose-minimal media for 16 hr with 10 mM ammonium chloride as the nitrogen source. The indicated carbon sources were added and growth was continued for 8 hr before harvesting. Harvested mycelium was extracted and assayed for ß-galactosidase. The specific activity is expressed as for Figure 3.

 
The effects of carbon sources present during growth for 24 hr in a limiting concentration of glucose (0.1%) on expression were determined (Figure 4D). Glycerol, proline, or acetate addition had little effect in a wild-type background. The acuF205 mutation resulted in elevated expression under all conditions except in the presence of glycerol. These results were interpreted as indicating a significant influence of endogenous induction occurring due to metabolic turnover under carbon-limiting conditions, with the acuF205 mutant lacking PEPCK leading to inducer accumulation increasing this effect. A similar effect of the acuF205 mutation on induction of an acuF-lacZ reporter has been described (HYNES et al. 2002 and see below). The acuG{Delta} mutation resulted in elevated expression under all conditions, including in the presence of glycerol. Again, this is similar to results with the acuF-lacZ reporter where the acuG223 mutation was found to lead to increased expression (HYNES et al. 2002). In addition, metabolism of glycerol to hexose phosphates dependent on FBP might result in carbon catabolite repression both directly and indirectly by preventing inducer formation in the wild-type and acuF205 backgrounds, but not in the acuG{Delta} strain. Overall, the results suggested that acuG is subject to CreA-mediated repression as well as to induction by a TCA cycle intermediate.

Characterization of the acuK and acuM genes:

Mutations in the acuK and acuM genes result in a similar phenotype—loss of growth on gluconeogenic carbon sources. Growth on glycerol still occurs but is less than for wild-type strains (Figure 1). The acuK gene was cloned by complementation of the acuK248 mutation for growth on acetate using cosmid pools from chromosome 4 (see MATERIALS AND METHODS). This yielded a 4.8-kb complementing fragment, which was sequenced and found to correspond to AN7468.3 in the A. nidulans database. The acuM gene was isolated by first cloning the linked acuJ gene by complementation and using this sequence as a hybridization probe to isolate BAC clones. One of these complemented the acuM301 mutation for growth on acetate (see MATERIALS AND METHODS). From this BAC clone, a complementing 4-kb fragment was identified, sequenced, and found to correspond to AN6293.3 in the A. nidulans database. The acuK and acuM genes were predicted to encode related proteins (identity, 30.5%; similarity, 22.4%) with highly similar Zn(2) Cys(6) DNA-binding motifs (Figure 5A). Predicted introns were confirmed by sequencing DNA generated by reverse-transcription PCR. Sequencing of the acuK248 and acuM301 mutations showed that each resulted from the generation of a stop codon, consistent with these mutations resulting in a loss of function (Figure 5A). This has been confirmed by the generation of deletion mutations that show identical phenotypes to these mutants (Y. SUZUKI, unpublished results). Genes encoding proteins with highly similar Zn(2) Cys(6) DNA-binding domains were identified in other filamentous ascomycetes, indicating a conserved function for these genes (Figure 5B). Interestingly, an AcuM, but not an AcuK, homolog was found in Magnaporthe grisea.


Figure 5
View larger version (52K):
In this window
In a new window
Download PPT slide
 
FIGURE 5.—

The acuK and acuM genes. (A) The structure of the genes showing intron positions and the sequences coding for the indicated domains. The sequence changes and the resulting generation of stop codons in the acuK248 and acuM301 mutations are shown. (B) Comparison of the predicted Zn(2) Cys(6) domains of AcuK and AcuM homologs in filamentous ascomycetes. Sequences were aligned using Clustal W (THOMPSON et al. 1994) and visualized with Macboxshade (http://www.ch.embnet.org/software/BOX_form.html). Identical residues are indicated by a solid background and similar residues by a shaded background. Sequences were obtained from NCBI (http://www.ncbi.nlm.nih.gov/) and from the Broad Institute Fungal Genome Initiative (http://www.broad.mit.edu/annotation/fungi/fgi/). Species and accession numbers were the following: AcuK—A. nidulans (AN7468.3), A. oryzae (BAE57193), A. fumigatus (XP_749712), Neurospora crassa (XP_957577), and Gibberella zeae (XP_388802); and AcuM—A. nidulans (AN6293.3), A. oryzae (BAE59871), A. fumigatus (XP_755565), M. grisea (XP_360718), N. crassa (CAD37032), and G. zeae (XP_381738).

 
Expression of an AcuF-LacZ reporter (HYNES et al. 2002) was greatly reduced by the acuK248 and acuM301 mutations (Figure 6A). As previously shown, the acuF205 mutation resulted in high levels of expression, a result interpreted as due to inducer accumulation. Presence of the acuK248 mutation eliminated the effects of acuF205 (Figure 6A). Northern blot analysis supported these results with the acuK248 and acuM301 mutations showing low levels of acuF transcript (Figure 6C). These mutations also resulted in low levels of expression of the AcuG-LacZ reporter (Figure 4D and Figure 6B). A response to glucose repression was still observed in the mutants (Figure 6B). Expression of the acuG transcript was very low under carbon-starved conditions as well as in the presence of proline or acetate (Figure 6C). Expression of the acuN transcript in response to acetate or proline was also greatly reduced by the acuK248 and acuM301 mutations (Figure 6D). Therefore, these data were consistent with AcuK and AcuM being transcriptional activators of gluconeogenic genes.


Figure 6
View larger version (46K):
In this window
In a new window
Download PPT slide
 
FIGURE 6.—

Effects of the acuK248 and acuM301 mutations on gene expression. (A) Effects on AcuF-LacZ expression. Mycelia of acuF-lacZ-containing strains of the indicated relevant genotypes were grown for 16 hr in 1% glucose–10 mM ammonium tartrate and then transferred to the indicated media for 4 hr before harvesting, extraction, and assaying as described in the legends to Figure 3 and Figure 4. The nitrogen source was 10 mM ammonium chloride in all cases except for the glucose-plus-proline treatment where 10 mM proline was present as the sole nitrogen source. Carbon sources were glucose (1%), proline (50 mM), acetate (50 mM), and malate (10 mM). (B) Effect on AcuG-LacZ expression. Mycelia of strains carrying the acuG::lacZ fusion gene of the indicated relevant genotypes were grown for 16 hr in 1% glucose–10 mM ammonium tartrate and then transferred to the indicated media for 4 hr. Carbon sources were glucose (1%), glycerol (1%), proline (50 mM), and acetate (50 mM). Ammonium chloride (10 mM) was present as a nitrogen source. (C) Effects on acuF and acuG transcripts. RNA was extracted from the strains of the indicated relevant genotypes grown under the same conditions as indicated in A. The same Northern blot was hybridized sequentially to an acuF probe (a 2.3-kb PstI–XhoI fragment with coordinates –961 to +1359), an acuG probe (a 1.7-kb EcoRV fragment beginning at coordinate +58 and containing the rest of the coding region), and the EcoRI fragment of the histone H3 gene. (D) Effects on acuN transcripts. RNA was as for C with hybridization to the same probes as for Figure 3A.

 


DISCUSSION
In glycolysis, most enzymatic steps are reversible, thereby allowing gluconeogenesis to occur. In gluconeogenesis, two irreversible reactions of glycolysis are replaced by PEPCK and FBP. Consequently, regulation of the expression of the genes encoding these enzymes controls the utilization of carbon sources requiring gluconeogenesis. We have previously studied the regulation of PEPCK encoded by the acuF gene (KELLY and HYNES 1981; HYNES et al. 2002). Here we have extended this by studying the regulation of FBP, the product of the acuG gene. Unexpectedly, we have found that expression of the reversible glycolytic enzyme enolase is also subject to induction during growth on gluconeogenic carbon sources. This was discovered because of the unique nature of the single mutation defining the acuN gene. We have established that this gene encodes enolase and that the acuN356 mutation results from a translocation breakpoint in the 5' region separating glycolytic from gluconeogenic regulation, leading to loss of the ability to use gluconeogenic carbon sources while growth is unaffected on glycolytic carbon sources. Analysis of the 5' region of the enolase gene from A. oryzae showed transcription start points at –17, –38, and –45, and deletion analysis of the promoter indicated that a 100-bp sequence between –121 and –228 is necessary for expression on glucose (MACHIDA et al. 1996; TODA et al. 2001). This is consistent with our results indicating a downstream glycolytic control. A large intron in the 5' untranslated region appears to be conserved in Aspergillus spp. and we propose that gluconeogenic regulation occurs upstream of this, consistent with a EST 5'-end at –426. The dual regulation of a single enolase gene in A. nidulans contrasts with the presence of two genes in S. cerevisiae. ENO2 is 20-fold induced in the presence of glucose while ENO1 is equally expressed on glucose or gluconeogenic carbon sources (COHEN et al. 1987).

It remains to be determined whether other genes required for both glycolysis and gluconeogenesis are subject to similar dual transcriptional controls. This may not be evident in comparisons of transcript levels on glycolytic and gluconeogenic carbon sources if both give similar expression levels, as indicated by our data for acuN. This is supported by recent microarray data comparing glucose-, ethanol-, and glycerol-grown cultures where the expression of enolase and other glycolytic genes was not affected by the carbon source (DAVID et al. 2006). It will be necessary to investigate the promoters of glycolytic genes for different controlling sequences affecting gluconeogenic and glycolytic regulation. In addition, studies on gluconeogenic regulation of these genes in acuK and acuM mutants will be informative. The regulation of genes encoding glycolytic enzymes has been studied in the related species A. oryzae and it has been found that expression is generally high in the presence of glucose but low upon transfer to medium lacking a carbon source or to pyruvate, which was shown to be an extremely poor source of carbon (NAKAJIMA et al. 2000). Studies were not carried out using strong gluconeogenic carbon sources.

We have cloned the single acuG gene encoding fructose-1,6-bisphosphatase. The cloned DNA fragment was shown to complement the acuG223 mutation and the acuG{Delta} strain generated showed a phenotype similar to that of the acuG223 mutant. Overall, the observed pattern of acuG regulation suggests the presence of a significant constitutive level of acuG expression and CreA-mediated carbon catabolite repression. Several putative CreA-binding sites (CUBERO and SCAZZOCCHIO 1994) are detected in the promoter region with possible strong tandem sites at –805 and –435. In A. oryzae, the expression of the FBP-encoding gene has been shown to be glucose repressed (NAKAJIMA et al. 2000). In addition, there is a significant response of acuG-lacZ to induction by sources of TCA cycle intermediates as well as endogenous induction due to metabolic turnover under starvation conditions. This is evident in mutants lacking PEPCK (acuF) and FBP (acuG), suggesting the accumulation of inducer(s) in these strains blocked in gluconeogenesis. Glycerol brought about an increase in expression only in the acuG{Delta} mutant and did not have this effect in the acuF205 background. In this case, inducer accumulation might result from the accumulation of fructose-1,6-bisphosphate in the presence of acetate, proline, as well as glycerol with feedback inhibition resulting in accumulation of a TCA cycle intermediate. This pattern of regulation for acuG is similar to that previously described for acuF (HYNES et al. 2002) with the major difference being the presence of carbon catabolite repression for acuG. This likely reflects the fact that acuG but not acuF is required for glycerol utilization. The basal glucose-repressible level of expression would allow growth on glycerol without requiring induction. Recent microarray data generally support these results (DAVID et al. 2006). Growth on the gluconeogenic carbon source, ethanol, results in high-level expression of both acuG and acuF in comparison with glucose; acuF expression, but not acuG, is elevated in ethanol compared to glycerol while, interestingly, both genes are moderately elevated in glycerol compared to glucose.

Identification of the inducing metabolite(s) poses some difficulties because of the central pathways involved. Nevertheless, the acuF205 mutation leads to increased expression of both acuF-lacZ and acuG-lacZ reporters, indicating that the metabolite is before the PEPCK step. Malate, a weak inducer in wild type, is a much stronger inducer of acuF-lacZ in an acuF205 background (Figure 6A). This indicates that accumulation of either or both malate and oxaloacetate may result in induction. We cannot distinguish between these because malate dehydrogenase interconverts malate and oxaloacetate. Three malate dehydrogenase genes are present in the A. nidulans genome. One is predicted to be mitochondrial while the other two genes lack obvious targeting signals and may be cytoplasmic with essential or contributing roles during growth on gluconeogenic carbon sources in converting malate to oxaloacetate in the cytoplasm.

Regulation of gluconeogenesis is significantly different from that observed in S. cerevisiae where the PEPCK and FBP enzymes are strongly regulated at the transcriptional level by glucose-sensitive Cat8p and Sip4p activation. This reflects the specialized growth of S. cerevisiae, which has a strong preference for the fermentation of glucose over growth on carbon sources requiring gluconeogenesis and is unable to use amino acids as sole carbon sources. In contrast, A. nidulans and other filamentous fungi are able to use a wide variety of carbon sources, and induction of FBP and PEPCK allows gluconeogenesis to occur during growth on any carbon source metabolized via TCA cycle intermediates. The FacB activator, which is similar to the Cat8/Sip4 proteins, is specific for the regulation of genes required for acetate utilization. The enzymes of the glyoxalate cycle that are required for growth on both acetate and fatty acids are additionally controlled by fatty acid induction independently of FacB, and regulatory genes involved in this have been identified (HYNES et al. 2006). In S. cerevisiae, the glyoxalate cycle genes are not regulated by fatty acid induction but only by Cat8/Sip4 (HILTUNEN et al. 2003).

We have evidence that the transcription factors controlling the induction of enzymes for gluconeogenesis are encoded by the acuK and acuM genes, which were identified in the original screen for acetate mutants (ARMITT et al. 1976). However, in the initial limited testing and in our subsequent more extensive examination of carbon sources, it has been found that mutations in these genes affect not only growth on acetate but also growth on carbon sources metabolized via the TCA cycle. The acuK248 and acuM301 mutations each result in loss of induction of the PEPCK-encoding acuF gene by sources of TCA cycle intermediates. Similarly, activation of expression of the acuG and acuN genes has been found to be lost in these mutants. A direct role in transcriptional activation for the products of acuK and acuM is indicated by finding that the gene products contain Zn(2) Cys(6) binuclear cluster DNA-binding domains. It is clear that they encode related proteins with similar but distinct putative DNA-binding domains. Furthermore, database searches reveal that these genes are present in other filamentous ascomycetes, indicating that this control circuit is conserved. A previous suggestion (MCCULLOUGH and ROBERTS 1974; ARMITT et al. 1976) that AcuK and AcuM encode the NADP-malic enzyme (E.C. 1.1.1.40) is explained by these genes being required for expression of this enzyme. It has been been shown that gluconeogenic carbon sources can result in induction of this enzyme (KELLY and HYNES 1981). Furthermore, the gene encoding this enzyme has been identified (our unpublished data).

The phenotypes of acuK and acuM mutants are indistinguishable. Therefore, it is likely that they act together to regulate gene expression, possibly by forming an active heterodimer. An alternative possibility is that one of the genes is necessary for expression of the other. Pairs of related Zn(2) Cys(6) binuclear proteins acting together as transcriptional regulators are not uncommon in S. cerevisiae (MACPHERSON et al. 2006). It remains to be determined whether AcuK and AcuM act as direct activators of all of the gluconeogenic genes or indirectly by regulating the production of an inducing molecule. The conservation of these genes in other fungi indicates their importance for controlling carbon source utilization.


ACKNOWLEDGEMENTS
Assistance by Sophie Delimitrou and Khan Nguyen is gratefully acknowledged. This work was supported by a grant from the Australian Research Council.


FOOTNOTES
Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under accession nos. AY255811, AY256961, and AF525021.

2 Present address: Department of Molecular Genetics, Ohio State University, Columbus, OH 43210. Back


LITERATURE CITED

ANDRIANOPOULOS, A., and M. J. HYNES, 1988 Cloning and analysis of the positively acting regulatory gene amdR from Aspergillus nidulans. Mol. Cell. Biol. 8: 3532–3541.[Abstract/Free Full Text]

ARMITT, S., W. MCCULLOUGH and C. F. ROBERTS, 1976 Analysis of acetate non-utilizing (acu) mutants in Aspergillus nidulans. J. Gen. Microbiol. 92: 263–282.[Abstract/Free Full Text]

ARST, H. N., JR., A. A. PARBTANI and D. J. COVE, 1975 A mutant of Aspergillus nidulans defective in NAD-linked glutamate dehydrogenase. Mol. Gen. Genet. 138: 164–171.[Medline]

BARELLE, C. J., C. L. PRIEST, D. M. MACCALLUM, N. A. R. GOW, F. C. ODDS et al., 2006 Niche-specific regulation of central metabolic pathways in a fungal pathogen. Cell. Microbiol. 8: 961–971.[CrossRef][Medline]

BORNEMAN, A. R., M. J. HYNES and A. ANDRIANOPOULOS, 2001 An STE12 homolog from the asexual, dimorphic fungus Penicillium marneffei complements the defect in sexual development of an Aspergillus nidulans steA mutant. Genetics 157: 1003–1014.[Abstract/Free Full Text]

BROCK, M., 2005 Generation and phenotypic characterization of Aspergillus nidulans methylisocitrate lyase deletion mutants: methylisocitrate inhibits growth and conidiation. Appl. Environ. Microbiol. 71: 5465–5475.[Abstract/Free Full Text]

BROCK, M., R. FISCHER, D. LINDER and W. BUCKEL, 2000 Methylcitrate synthase from Aspergillus nidulans: implications for propionate as an antifungal agent. Mol. Microbiol. 35: 961–973.[CrossRef][Medline]

BRODY, H., J. GRIFFITH, A. J. CUTICCHIA, J. ARNOLD and W. E. TIMBERLAKE, 1991 Chromosome-specific recombinant DNA libraries from the fungus Aspergillus nidulans. Nucleic Acids Res. 19: 3105–3109.[Abstract/Free Full Text]

CLUTTERBUCK, A. J., 1974 Aspergillus nidulans genetics, pp. 447–510 in Handbook of Genetics, Vol. 1, edited by R. C. KING. Plenum Publishing, New York.

CLUTTERBUCK, A. J., 1994 Linkage map and locus list, pp. 791–795 in Aspergillus: 50 Years On, edited by S. D. MARTINELLI and J. R. KINGHORN. Elsevier, Amsterdam.

COHEN, R., T. YOKOI, J. P. HOLLAND, A. E. PEPPER and M. J. HOLLAND, 1987 Transcription of the constitutively expressed yeast enolase gene ENO1 is mediated by positive and negative cis-acting regulatory sequences. Mol. Cell. Biol. 7(8): 2753–2761.[Abstract/Free Full Text]

COVE, D. J., 1966 The induction and repression of nitrate reductase in the fungus Aspergillus nidulans. Biochim. Biophys. Acta 113: 51–56.[Medline]

CUBERO, B., and C. SCAZZOCCHIO, 1994 Two different, adjacent and divergent zinc finger binding sites are necessary for CreA mediated carbon catabolite repression in the proline gene cluster of Aspergillus nidulans. EMBO J. 13: 407–415.[Medline]

DARAN-LAPUJADE, P., M. L. A. JANSEN, J. DARAN, W. VAN GULIK, J. H. DE WINDE et al., 2004 Role of transcriptional regulation in controlling fluxes in central carbon metabolism of Saccharomyces cerevisiae. J. Biol. Chem. 279: 9125–9138.[Abstract/Free Full Text]

DAVID, H., G. HOFMANN, A. P. OLIVEIRA, H. JARMER and J. NIELSEN, 2006 Metabolic network driven analysis of genome-wide transcription data from Aspergillus nidulans. Genome Biol. 7: R108.[CrossRef][Medline]

DAVIS, M. A., C. S. COBBETT and M. J. HYNES, 1988 An amdS-lacZ fusion for studying gene regulation in Aspergillus. Gene 63: 199–212.[CrossRef][Medline]

DERISI, J. L., V. R. IYER and P. O. BROWN, 1997 Exploring the metabolic and genetic control of gene expression on a genomic scale. Science 278: 680–686.[Abstract/Free Full Text]

DOWZER, C. E., and J. M. KELLY, 1991 Analysis of the creA gene, a regulator of carbon catabolite repression in Aspergillus nidulans. Mol. Cell. Biol. 11: 5701–5709.[Abstract/Free Full Text]

EHINGER, A., S. H. DENISON and G. S. MAY, 1990 Sequence, organization and expression of the core histone genes of Aspergillus nidulans. Mol. Gen. Genet. 222: 416–424.[CrossRef][Medline]

GANCEDO, C., and J. M. GANCEDO, 1985 Phosphorylation of 3-O-methyl-D-glucose and catabolite repression in yeast. Eur. J. Biochem. 148: 593–597.[Medline]

GANCEDO, J. M., 1998 Yeast carbon catabolite repression. Microbiol. Mol. Biol. Rev. 62: 334–361.[Abstract/Free Full Text]

GEORIS, I., G. I. KRIJGER, J. J. BREUNIG and K. D. VANDENHAUTE, 2000 Differences in regulation of yeast gluconeogenesis revealed by Cat8p-independent activation of PCK1 and FBP1 genes in Kluyveromyces lactis. Mol. Gen. Genet. 264: 193–203.[CrossRef][Medline]

HAURIE, V., M. PERROT, T. MINI, P. JENO, F. SAGLIOCCO et al., 2001 The transcriptional activator Cat8p provides a major contribution to the reprogramming of carbon metabolism during the diauxic shift in Saccharomyces cerevisiae. J. Biol. Chem. 276: 76–85.[Abstract/Free Full Text]

HILTUNEN, J. K., A. M. MURSULA, H. ROTTENSTEINER, R. K. WIERENGA, A. J. KASTANIOTIS et al., 2003 The biochemistry of peroxisomal beta-oxidation in the yeast Saccharomyces cerevisiae. FEMS Microbiol. Rev. 27: 35–64.[CrossRef][Medline]

HONDMANN, D. H. A., and J. VISSER, 1994 Carbon metabolism, pp. 61–139 in Aspergillus: 50 Years On, edited by S. D. MARTINELLI and J. R. KINGHORN. Elsevier, Amsterdam.

HYNES, M. J., 1977 Induction of the acetamidase of Aspergillus nidulans by acetate metabolism. J. Bacteriol. 131: 770–775.[Abstract/Free Full Text]

HYNES, M. J., O. W. DRAHT and M. A. DAVIS, 2002 Regulation of the acuF gene, encoding phosphoenolpyruvate carboxykinase in the filamentous fungus Aspergillus nidulans. J. Bacteriol. 184: 183–190.[Abstract/Free Full Text]

HYNES, M. J., S. L. MURRAY, A. DUNCAN, G. S. KHEW and M. A. DAVIS, 2006 Regulatory genes controlling fatty acid catabolism and peroxisomal functions in the filamentous fungus, Aspergillus nidulans. Eukaryot. Cell 5: 794–805.[Abstract/Free Full Text]

KATZ, M. E., and M. J. HYNES, 1989 Isolation and analysis of the acetate regulatory gene, facB, from Aspergillus nidulans. Mol. Cell. Biol. 9: 5696–5701.[Abstract/Free Full Text]

KELLY, J. M., and M. J. HYNES, 1981 The regulation of phosphenolpyruvate carboxykinase and the NADP-linked malic enzyme in Aspergillus nidulans. J. Gen. Microbiol. 123: 371–375.[Abstract/Free Full Text]

KINGHORN, J. R., and J. A. PATEMAN, 1976 Mutants of Aspergillus nidulans lacking nicotinamide adenine dinucleotide-specific glutamate dehydrogenase. J. Bacteriol. 125: 42–47.[Abstract/Free Full Text]

KUSWANDI, and C. F. ROBERTS, 1992 Genetic control of the protocatechuic pathway in Aspergillus nidulans. J. Gen. Microbiol. 138: 817–823.[Abstract/Free Full Text]

LORENZ, M. C., and G. R. FINK, 2002 Life and death in a macrophage: role of the glyoxylate cycle in virulence. Eukaryot. Cell 1: 657–662.[Free Full Text]

MACHIDA, M., Y-C. CHANG, M. MANABE, M. YASUKAWA, S. KUNIHIRO et al., 1996 Molecular cloning of a cDNA encoding enolase from the filamentous fungus, Aspergillus oryzae. Curr. Genet. 30: 423–431.[CrossRef][Medline]

MACPHERSON, S., M. LAROCHELLE and B. TURCOTTE, 2006 A fungal family of transcriptional regulators: the zinc cluster proteins. Microbiol. Mol. Biol. Rev. 70: 583–604.[Abstract/Free Full Text]

MCCULLOUGH, W., and C. F. ROBERTS, 1974 The role of malic enzyme in Aspergillus nidulans. FEBS Lett. 41: 238–242.[CrossRef][Medline]

MCCULLY, K. S., and E. FORBES, 1965 The use of p-fluorophenylalanine with ‘master strains’ of Aspergillus nidulans for assigning genes to linkage groups. Genet. Res. 6: 352–359.[Medline]

NAKAJIMA, K., S. KUNIHIRO, M. SANO, Y. ZHANG, S. ETO et al., 2000 Comprehensive cloning and expression analysis of glycolytic genes from the filamentous fungus, Aspergillus oryzae. Curr. Genet. 37: 322–327.[CrossRef][Medline]

OAKLEY, C. E., C. F. WEIL, P. L. KRETZ and B. R. OAKLEY, 1987 Cloning of the riboB locus of Aspergillus nidulans. Gene 53: 293–298.[CrossRef][Medline]

OSHEROV, N., and G. MAY, 2000 Conidial germination in Aspergillus nidulans requires RAS signaling and protein synthesis. Genetics 155: 647–656.[Abstract/Free Full Text]

PUNT, P. J., A. KUYVENHOVEN and C. A. VAN DEN HONDEL, 1995 A mini-promoter lacZ gene fusion for the analysis of fungal transcription control sequences. Gene 158: 119–123.[CrossRef][Medline]

RAHNER, A., A. SCHOLER, E. MARTENS, B. GOLLWITZER and H. J. SCHULLER, 1996 Dual influence of the yeast Cat1p (Snf1p) protein kinase on carbon source-dependent transcriptional activation of gluconeogenic genes by the regulatory gene CAT8. Nucleic Acids Res. 24: 2331–2337.[Abstract/Free Full Text]

ROTH, S., J. KUMME and H-J. SCHÜLLER, 2004 Transcriptional activators Cat8 and Sip4 discriminate between sequence variants of the carbon source-responsive promoter element in the yeast Saccharomyces cerevisiae. Curr. Genet. 45: 121–128.[CrossRef][Medline]

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual, Ed. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SCHJERLING, P., and S. HOLMBERG, 1996 Comparative amino acid sequence analysis of the C6 zinc cluster family of transcriptional regulators. Nucleic Acids Res. 24: 4599–4607.[Abstract/Free Full Text]

SCHULLER, H. J., 2003 Transcriptional control of nonfermentative metabolism in the yeast Saccharomyces cerevisiae. Curr. Genet. 43: 139–160.[Medline]

SHROFF, R. A., R. A. LOCKINGTON and J. M. KELLY, 1996 Analysis of mutations in the creA gene involved in carbon catabolite repression in Aspergillus nidulans. Can. J. Microbiol. 42(9): 950–959.[Medline]

STEMPLE, C. J., M. A. DAVIS and M. J. HYNES, 1998 The facC gene of Aspergillus nidulans encodes an acetate-inducible carnitine acetyltransferase. J. Bacteriol. 180: 6242–6251.[Abstract/Free Full Text]

THINES, E., R. W. WEBER and N. J. TALBOT, 2000 MAP kinase and protein kinase A-dependent mobilization of triacylglycerol and glycogen during appressorium turgor generation by Magnaporthe grisea. Plant Cell 12: 1703–1718.[Abstract/Free Full Text]

THOMPSON, J. D., D. G. HIGGINS and T. J. GIBSON, 1994 CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22: 4673–4680.[Abstract/Free Full Text]

TILBURN, J., C. SCAZZOCCHIO, G. G. TAYLOR, A. UPSHALL, J. H. ZABICKY-ZISSMAN et al., 1983 Transformation by integration in Aspergillus nidulans. Gene 26: 205–221.[CrossRef][Medline]

TODA, T., M. SANO, M. HONDA, O. RIMOLDI, Y. YONG et al., 2001 Deletion analysis of the enolase gene (enoA) promoter from the filamentous fungus Aspergillus oryzae. Curr. Genet. 40: 260–267.[CrossRef][Medline]

TODD, R. B., and A. ANDRIANOPOULOS, 1997 Evolution of a fungal regulatory gene family: the Zn(II)2Cys6 binuclear cluster DNA binding motif. Fungal Genet. Biol. 21: 388–405.[CrossRef][Medline]

TODD, R. B., R. L. MURPHY, H. M. MARTIN, J. A. SHARP, M. A. DAVIS et al., 1997 The acetate regulatory gene facB of Aspergillus nidulans encodes a Zn(II)Cys6 transcriptional activator. Mol. Gen. Genet. 254: 495–504.[CrossRef][Medline]

TODD, R. B., A. ANDRIANOPOULOS, M. A. DAVIS and M. J. HYNES, 1998 FacB, the Aspergillus nidulans activator of acetate utilization genes, binds dissimilar DNA sequences. EMBO J. 17: 2042–2054.[CrossRef][Medline]

TODD, R. B., J. A. FRASER, K-H WONG, M. A. DAVIS and M. J. HYNES, 2005 Nuclear accumulation of the GATA factor AreA in response to complete nitrogen starvation by regulation of nuclear export. Eukaryot. Cell 4: 1646–1653.[Abstract/Free Full Text]

VAN GORCOM, R. F., P. J. PUNT, P. H. POUWELS and C. A. VAN DEN HONDEL, 1986 A system for the analysis of expression signals in Aspergillus. Gene 48: 211–217.[CrossRef][Medline]

VINCENT, O., and M. CARLSON, 1998 Sip4, a Snf1 kinase-dependent transcriptional activator, binds to the carbon source-responsive element of gluconeogenic genes. EMBO J. 17: 7002–7008.[CrossRef][Medline]

WANG, Z.Y., C.R. THORNTON, M.J. KERSHAW, L. DEBAO and N.J. TALBOT, 2003 The glyoxylate cycle is required for temporal regulation of virulence by the plant pathogenic fungus Magnaporthe grisea. Mol. Microbiol. 47: 1601–1612.[CrossRef][Medline]

YOUNG, E. T., K. M. DOMBEK, C. TACHIBANA and T. IDEKER, 2003 Multiple pathways are co-regulated by the protein kinase Snf1 and the transcription factors Adr1 and Cat8. J. Biol. Chem. 278: 26146–26158.[Abstract/Free Full Text]

ZARAGOZA, O., O. VINCENT and J. M. GANCEDO, 2001 Regulatory elements in the FBP1 promoter respond differently to glucose-dependent signals in Saccharomyces cerevisiae. Biochem. J. 359: 193–201.[CrossRef][Medline]

Communicating editor: M. S. SACHS




This article has been cited by other articles:


Home page
Eukaryot CellHome page
M. A. Ramirez and M. C. Lorenz
The Transcription Factor Homolog CTF1 Regulates {beta}-Oxidation in Candida albicans
Eukaryot. Cell, October 1, 2009; 8(10): 1604 - 1614.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
C. H. Sellem, E. Bovier, S. Lorin, and A. Sainsard-Chanet
Mutations in Two Zinc-Cluster Proteins Activate Alternative Respiratory and Gluconeogenic Pathways and Restore Senescence in Long-Lived Respiratory Mutants of Podospora anserina
Genetics, May 1, 2009; 182(1): 69 - 78.
[Abstract] [Full Text] [PDF]