- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Data Supplement
-
All Versions of this Article:
genetics.106.064212v1
175/4/1707 most recent - Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Grieder, N. C.
- Articles by Gehring, W. J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Grieder, N. C.
- Articles by Gehring, W. J.
Originally published as Genetics Published Articles Ahead of Print on December 18, 2006.
Genetics, Vol. 175, 1707-1718, April 2007, Copyright © 2007
doi:10.1534/genetics.106.064212
Misexpression Screen in Drosophila melanogaster Aiming to Reveal Novel Factors Involved in Formation of Body Parts
Nicole C. Grieder*,1,
Ilias Charlafti*,
Urs Kloter*,
Herbert Jäckle
,
Ulrich Schäfer
and
Walter J. Gehring*
* Biozentrum der Universität Basel, Abteilung Zellbiologie, CH-4056 Basel, Switzerland and
Max-Planck Institut für Biophysikalische Chemie, Abteilung Molekulare Entwicklungsbiologie, D-37077 Göttingen, Germany
1 Corresponding author: Biozentrum der Universität Basel, Abteilung Zellbiologie, Klingelbergstrasse 50-70, CH-4056 Basel, Switzerland.
E-mail: nicole.grieder{at}unibas.ch
To identify novel factors that lead a fly imaginal disc to adopt its developmental fate, we carried out a modular dominant misexpression screen in imaginal discs. We have identified two factors that appear to change the fate of the respective body structure and appear to lead to the transformation of a body part. In one mutant line, notum tissue, normally derived from wing imaginal tissue, formed close to the site of the sternopleural bristles, which are leg disc derivatives. In the other line, the arista is transformed into a tubular structure, resembling an abnormal leg. We found that ectopic expression of abrupt was responsible for this potential transformation of the arista.
IN Drosophila melanogaster, a considerable number of mutant flies, which lack a certain body structure or display a body structure at an ectopic position of the body, have been discovered. With the help of such mutants, key factors involved in the formation of specific body parts have been identified. For example, through powerful genetic screening procedures, mutants in the bithorax complex, which display transformations of body segments, have been recovered (LEWIS 1978). Their molecular identification has led to the discovery of the Hox gene family and the homeobox (reviewed in GEHRING 1993). In these mutants, the phenotype was mostly due to the loss of a certain homeotic gene activity. However, ectopic body structures can also be obtained by ectopic expression of those key genes (reviewed in GEHRING 1993). Such examples are the fortuitous dominant mutation Nasobemia or Antennapedia73b (Antp73b), both of which are alleles of Antp and display the antenna-to-leg transformations (GEHRING 1966; GARBER et al. 1983). Molecular analysis of Antp73b indicates that this phenotype is due to the misexpression of Antp (SCHNEUWLY et al. 1987a). Ectopic or overexpression of a gene can be achieved by introducing in vitro-designed constructs into the fly. Ectopic body structures have also been gained in this way; for example, by heat-shock-mediated overexpression of Antp an antenna-to-leg transformation has been obtained (SCHNEUWLY et al. 1987b). In recent years, the Gal4-UAS system has become the method of choice to force expression of genes and of in vitro-modified constructs, as it allows turning on transcription units in defined patterns and at defined times in development (BRAND and PERRIMON 1993). In this way, it has been possible to induce the formation of ectopic eyes in several locations of the fly body by inappropriate expression of the eyeless gene (HALDER et al. 1995). KIM et al. (1996) have recovered wing tissue at several locations by forcing ectopic expression of vestigial (vg), a key gene in wing formation. Genomewide over- and misexpression screening procedures have only recently become feasible in Drosophila. These techniques rely on modified P-element transposons, like the EP element, the GS element, or the Mae-UAS.6.11 element (CRISP and MERRIAM 1997; RØRTH et al. 1998; TOBA et al. 1999). In these vectors, UAS-dependent transcription is directed outward from these P elements and into the neighboring genomic region in the presence of Gal4, leading to an overexpression of the gene in the vicinity of the P-element insertion site (e.g., see Figure 1A). As P elements typically insert into the 5' region of genes (SPRADLING et al. 1995), a random collection of such P elements will frequently allow overexpressing full-length coding sequences. Alternatively, antisense transcripts of neighboring genes are produced.
|
How a tissue acquires the identity of a limb or of a trunk region is a fundamental question in development. In D. melanogaster, the fly exoskeleton and its appendages derive from primordial groups of cells called imaginal discs, which are set aside during embryogenesis for later development during the larval and pupal stages. The way in which imaginal discs give rise to appendages (e.g., legs and wings) and trunk regions (body wall) has become an experimental system, allowing the study of the establishment of fate determination. A tremendous amount of knowledge has accumulated about how the antero-posterior axis is subdivided and how the diversity of the fly segments is achieved in the embryo (reviewed in COHEN 1993; GEHRING 1993; MANN and MORATA 2000). However, there still must be unidentified key genes that contribute to the determination of body structures. Among them, there should be factors that relate the appendage-determining genes to the Hox selector genes, which are responsible for the antero-posterior diversity of the adult segments. Such links are only now being discovered (GEBELEIN et al. 2004). These selector genes also need to cooperate with signaling factors (GRIEDER et al. 1997; reviewed in AFFOLTER and MANN 2001). For example, this was revealed in experiments identifying Notch, a prominent signaling molecule implicated in growth and differentiation, as a factor involved in appendage determination (KURATA et al. 1999).
Experiments, presented by KURATA et al. (1999) and subsequently by KATSUYAMA et al. (2005), have also shown that factors with a transdetermination potential can be discovered in ectopic expression screens. Such factors either are directly responsible for the change of cell identity or render cells capable of changing their identity (KURATA et al. 1999; KATSUYAMA et al. 2005). The transdetermination phenomenon was discovered by HADORN (1963). He has shown that, following transplantation, predetermined imaginal disc cells spontaneously change their state of determination such that the transplanted discs develop different structures, which no longer correspond to their initial specification. Transdetermination is associated with tissue regeneration, dedifferentiation, and growth of the transplanted disc (SCHUBIGER 1971). The mechanism underlying dedifferentiation has not yet been discovered. However, several more factors have been found to play a role in transdetermination. For example, a crucial role for intercellular signaling—mediated by factors like wingless (wg) and decapentaplegic (dpp), Drosophila Wnt and BMP2/4 homologs, respectively—is emerging from genetic studies and from transdetermination experiments (KIM et al. 1996; MAVES and SCHUBIGER 1998). It has been shown that ectopic expression of the signaling molecule wg in predetermined leg discs (during late third instar larval development) induces the formation of wing tissue, an experimental condition recapitulating in many ways the events associated with a classical transdetermination experiment (SUSTAIR and SCHUBIGER 2005). Recently, it has been shown that this transdetermination event is dependent on Jun kinase (JNK)-signaling-mediated regulation of the polycomb group genes, genes that are involved in gene silencing and maintenance of homeotic gene activity (LEE et al. 2005). A role for chromatin-interacting proteins has also emerged in a study investigating transdetermination of the eye (KATSUYAMA et al. 2005). Interestingly, many of these factors are also important for the specification of identity, as it occurs during development (reviewed in MAVES and SCHUBIGER 2003). This raises the question of whether transdetermination and developmental determination are related.
In summary, it is likely that a number of unidentified factors that are involved in fate determination and in transdetermination still exist. To elucidate the mechanisms of these processes at the cellular and molecular level, it is necessary that the function of such novel factors be revealed. To find novel factors, which confer identity to fly appendages and trunk regions, we embarked upon a genetic screen. Ectopic expression of selector genes leads to a transformation of the body. Therefore, novel factors that have potential as tissue- or appendage-defining factors should become immediately apparent in a dominant genetic misexpression screen in imaginal discs of D. melanogaster. They will be revealed as mutants displaying transformed body parts, since such factors will redirect the development of an imaginal disc into an allotypic structure.
In this article, we present a misexpression screen aiming at identifying novel factors that lead a fly imaginal disc to adopt its developmental fate. Among
2800 independent P-element insertions, we found two lines that exhibited apparently transformed body structures. In one mutant, the dorsal part of the leg disc appeared dorsalized and a notum-like outgrowth was formed at the site of the sternopleura. In the other line, the arista appeared transformed into a tubular structure, resembling an abnormal leg.
Drosophila strains:
The y w; P{w+ dppdisc-Gal4}/TM6B, Hu e Tb line is described in STAEHLING-HAMPTON et al. (1994). The strains used to generate new P{Mae-UAS.6.11} insertions (CRISP and MERRIAM 1997) were described in BEINERT et al. (2004). The y w; P{w+ UAS-argos.M}30-102-1; P{w+ UAS-argos.M}30-85-1 (donation to the Bloomington Stock Center by A. Michelson), the y w ; P{w+ UAS-fringe.K}JK1 (KIM et al. 1995), and the FM6, y1 w1 dm+ balancer stocks were obtained from the Bloomington Stock Center. The P{w+ UASp-lacZ}1399-4 line (RØRTH 1998) was obtained from Pernille Rørth. The y w; P{y+, UAS- GFP} stock (GERLITZ et al. 2002) was obtained from Konrad Basler. Generation of y w; P{w+ UAST- abrupt}42-6/TM6B and y w; P{w+ UAST- abrupt}42-2/CyO is described below. The homothorax (hth)-lacZ line is described in PAI et al. (1998). The vgB-lacZ line is described in KIM et al. (1996).
Crossing scheme:
In a cross, typically three virgins of a y w; P{w+ dppdisc-Gal4}/TM6B, Hu e Tb stock were mated to one to three males of independent y w P{Mae-UAS.6.11} insertions (see Figure 1A) provided by BEINERT et al. (2004). At least 20 flies of the F1 y+ w+ progeny were scored for mutant phenotypes in adults or in late pupal stages. Candidate P-element insertions were retested and balanced using the FM6, y1 w1 dm+ or a y w; KrIf/CyOblue; TM6B, Hu e Tb/MKRS balancers. Mutant flies were stored in acetic acid/glycerol (4 + 1). They were washed in 1x PBS before dissection and mounted in Faure's for image preparation. Due to storage in acetic acid/glycerol, the red eye color often faded. For the "abrupt" control crosses, virgins of the w; wgSp/CyO; P{w+ dppdisc-Gal4}/TM6B, Hu e Tb genotype were crossed to y w/Y; P{w+ UAST- abrupt}42-6/TM6B or y w/Y; P{w+ UAST- abrupt}42-2/(CyO) males to obtain abrupt-overexpressing progeny; for some of the antibody-staining experiments, UAS-GFP (GERLITZ et al. 2002) was crossed into the B2149 background. Similarly, hth-lacZ (PAI et al. 1998) was crossed into a B2149 background, and vgB-lacZ (KIM et al. 1996) was crossed into the dppdisc-Gal4 background.
Molecular analysis:
P{Mae-UAS.6.11}-element insertions were mapped by iPCR as described in BEINERT et al. (2004). Alternatively, a modification of the Exelixis inverse polymerase chain reaction (iPCR) method (THIBAULT et al. 2004) was employed. In this protocol, genomic DNA was digested with either RsaI or MspI restriction enzymes. After religation, the following primers were used for amplification of the insertion site fragments: primers TGGGAATTCGTTAACAGATCCAC (reverse), CAGCTGCGCTTGTTTATTTG (forward), ACACAACCTTTCCTCTCAACAA (Sp1), and GAATTGTCGCTCCGTAGACGA (5'P forward2) for the 5'-end and primers CAATCATATCGCTGTCTCACTCA (ry4), CCTTAGCATGTCCGTGGGGTTTGAAT (ry1), GCGAGTACGCAAAGCTTGGC (Sp6), and TCAATACGACACTCAGAATACTATTC (Spep4) for the 3'-end. The obtained DNA fragments were sequenced on an ABI Prism 310 Genetic Analyzer using primers TAAGTGTATACTTCGGTAAGCT (5'P) and GCATACGTTAAGTGGATGTCTCT (3'P), and the obtained sequences were BLASTed (ALTSCHUL et al. 1997) against the genomic Drosophila sequence (ADAMS et al. 2000; CELNIKER et al. 2002) and submitted to the EBI database. More detailed protocols are available upon request.
Antibody staining:
Antibody stainings were carried out as described in GRIEDER et al. (2005). The following antibody concentrations were used: rat monoclonal antibody 7E8A10 anti-Embryonic Lethal, Abnormal Vision (Elav) [Developmental Studies Hybridoma Bank (DSHB)], 1:30; rabbit anti-Abrupt (HU et al. 1995; a gift from Stephen Crews), 1:500; the monoclonal antibody 4D4 anti-Wg, 1:50 (DSHB); rat anti-Distal antenna (Dan), 1:30 (EMERALD et al. 2003; a gift from Steve Cohen); guinea pig anti-Eyegone (Eyg), 1:200 (ALDAZ et al. 2003; a gift from Natalia Azpiazu), rabbit anti-Spalt Major (Salm), 1:30 (KÜHNLEIN et al. 1994; a gift from Reinhard Schuh), rabbit anti-Hth, 1:400 (PAI et al. 1998; a gift from Y. Henry Sun). The goat anti-mouse Alexa488 or Alexa568 antibody (Molecular Probes, Eugene, OR) was used at 1:400; donkey anti-rat or mouse Cy5 Fab fragments (Jackson ImmunoResearch, West Grove, PA) were used at 1:400.
In situ hybridization:
In situ hybridizations on whole-mount imaginal discs and on chromosomes were carried out as described in GRIEDER et al. (2005).
Transgenes:
To generate pPUAST-abrupt (ab), the ab coding sequence was recovered as a MfeI–Asp718 fragment from cDNA clone RE25924 (BACPAC Resource Center) and cloned into the EcoRI and Asp718 site of pPUAST (BRAND and PERRIMON 1993). This pPUAST-abrupt construct 42 was introduced into y w flies by P-element transformation (RUBIN and SPRADLING 1982).Design of the screen:
When CZERNY et al. (1995) carried out misexpression studies in imaginal discs using UAS-eyeless and UAS-twin of eyeless lines, they found that the dppdisk-enhancer-driven Gal4 line (STAEHLING-HAMPTON et al. 1994) was one of the most suitable driver lines to obtain ectopic eye structures. This Gal4 line is expressed during the larval stages of Drosophila development in a subset of imaginal disc cells (STAEHLING-HAMPTON et al. 1994; Figure 5, B and C). Using this line, disc transformations can be obtained in a highly reproducible fashion and at high frequency. We tested this line by combining it with UAS constructs forcing expression of several Hox genes. The results of these experiments confirmed that the expected transformations are obtained (data not shown). Thus, we considered this line well suited to be used in our screen for transformation phenotypes. We carried out a modular dominant misexpression screen in imaginal discs utilizing the P-element collection generated by BEINERT et al. (2004), which employs the P{Mae-UAS.6.11} element (CRISP and MERRIAM 1997; Figure 1A; MATERIALS AND METHODS). The P{Mae-UAS.6.11} element has the advantage of being marked with yellow+. As our driver Gal4 line is marked with mini-white+ and the responding P{Mae-UAS.6.11} fly collection is in a y w mutant background (BEINERT et al. 2004), progeny containing both lines can be easily identified among y w flies, as they appear y+ w+; [they can be discriminated from nonexpressing flies, which are y w+ (containing dppdisc-Gal4) or y+ w (containing the P{Mae-UAS.6.11} element; Figure 1A]. To our convenience, the dppdisc-Gal4 line was located on the third chromosome and was balanced over a chromosome marked with the Tb mutation (MATERIALS AND METHODS); this allowed unequivocal separation of late pupae and pharate adults in expressing (Tb+) and nonexpressing (Tb–) populations.
|
The screen reveals two lines with a potential transformation phenotype:
The y w P{Mae-UAS.6.11} collection had been assembled aiming to target X chromosomal genes (BEINERT et al. 2004). However, we also screened P-element insertions on autosomes; a total of 2810 lines were screened (MATERIALS AND METHODS). We found 2 lines that showed potential transformation phenotypes (2/2810 or 0.7%): line B1164 and line B2149 (Figure 1, B–E, G). Line B1164 consistently displayed an outgrowth at the position of the sternopleura (Figure 1B). Morphologically, this outgrowth looked like notum tissue. In addition, this mutant had abnormal legs, as well as abnormal wings (Figure 1B; Figure 2.12). In particular, the proximal parts of the wings and the legs were shortened. The other line (B2149) displayed an apparently transformed arista (Figure 1, C and G). The arista was growing out as a short tube-like structure (Figure 1G). Morphologically, it resembled the legs of this mutant, which were also abnormal (Figure 1D). As this mutant did not eclose, we did not score the wing phenotype.
Destructive phenotypes were about nine times more frequent than the potential transformation phenotypes:
Among the screened P{Mae-UAS.6.11} lines, we observed other mutant phenotypes, which could be termed "destructive." These lines appeared not to transform the tissue into another tissue characteristic of another location, e.g., a wing into a leg; rather, they displayed abnormal structures, e.g., loss of veins. Nevertheless, it cannot be determined a priori whether these lines cause a gain or a loss of structure or function, respectively. First, the P element may produce an antisense message of a given gene and cause a loss-of-function phenotype. Second, a loss of structure, e.g., a loss of vein, could also be an indication of a gain of another structure, e.g., intervein tissue. Of all the lines screened, 170 lines (170/2810 or 6%) produced mutant phenotypes. We scored mainly abnormalities on the wings, the legs, and the antennae, but not on eyes or the fly trunk. The abnormalities that we observed ranged from subtle disturbances of the wing venation pattern to the inability to open wings and early pupal lethality. The insertion site of some lines could not be determined; other lines got lost during the rescreening procedure. All the lines for which the inserts were sequenced are listed in supplemental Table 1 (http://www.genetics.org/supplemental/). Examples of the mutant phenotypes are shown in Figures 2–4
|
|
|
Mutant phenotypes are reproduced in independent hits:
Although we were looking mainly for ectopic formation of body structures, the lines displaying abnormal body structures were useful in estimating the general reproducibility of the P{Mae-UAS.6.11}-induced phenotypes and thus served as a control for our screening procedure. We expected that insertions into the same loci would lead to similar if not identical phenotypes. To find out whether this was indeed the case, we determined the insertion sites of all lines possible (MATERIALS AND METHODS; supplemental Table 1 at http://www.genetics.org/supplemental/). Sequencing of the P{Mae-UAS.6.11} element flanking sequences readily revealed that several genes were hit more than once. The associated phenotypes were alike or similar in the sense of allelic series. For example, lines containing a P element that had inserted upstream and in a position driving transcription of broad were found three times to exhibit similar shortening of legs (Figure 3.15). As another example, independent lines containing an insertion at 8F9 close to nej and CG15321, showed similar truncations of legs (Figure 3.36; supplemental Table 1 at http://www.genetics.org/supplemental/). In the third example, the P-element insertions were associated with strange phenotypes, such as problems in unfolding the wings, and were isolated several times in connection with CG14628 (supplemental Table 1 at http://www.genetics.org/supplemental/). In addition, this analysis confirmed that most of these P{Mae-UAS.6.11} elements were inserted upstream of known transcripts and led to overexpression of the respective gene. As expected, some P{Mae-UAS.6.11} lines seemed to be associated with putative antisense transcripts. This was the case, e.g., for line B1509, in which antisense transcripts of CG2023 appear to be made. PUAST transgenes should also confirm that the insertion in the respective gene was sufficient to cause the observed mutant phenotypes. We used transgenic lines for fringe and argos in a control experiment (MATERIALS AND METHODS). When crossed to the dppdisc-Gal4, their progeny showed very similar mutant phenotypes like the genomic P{Mae-UAS.6.11} insertions [Figure 2.6 (UAS-argos); Figure 2.2 (B0915); Figure 2.31 (UAS-fringe); and two examples for B0538 in Figure 2.23 and 2.27; supplemental Table 1 at http://www.genetics.org/supplemental/]. Insertions in genes that have never been targeted by a P element were not recovered. However, some that have rarely been hit or not been hit with a UAS-tagged construct have been found. One example of such a case is line B0729. Considering the large number of P-element screens that have been carried out, and considering the fact that P elements show insertion site preferences, this is not surprising (see SPRADLING et al. 1999).
In line B2149, the P{Mae-UAS.6.11} element is inserted upstream of abrupt:
Since the potential transformation phenotype was due to Gal4 expression in the B1164 and the B2149 flies, the gene of interest would have to be in the neighborhood of Gal4-binding sites, and hence of the P{Mae-UAS.6.11}-element insertion sites. The P elements present in B1164 and B2149 mapped genetically to chromosome 2. Therefore, to find out which genes were causing the transformation phenotypes, the P{Mae-UAS.6.11} insertion sites were determined. We found that the P element in line B2149 was inserted just a few nucleotides upstream of the first exon of the abrupt gene (Figure 5A; supplemental Table 1 at http://www.genetics.org/supplemental/), encoding for a nuclear BTB–zinc-finger protein (HU et al. 1995). The P element was inserted such that the 5'-end of the P element was oriented toward the abrupt gene. Thus Gal4 activation should lead to overexpression of abrupt and, consequently, the potential transformation of the arista might be induced through overexpression of abrupt. The insertion site at 32C was also confirmed by in situ hybridization to salivary gland chromosomes (Figure 1J). Chromosome in situ hybridization to salivary gland chromosomes of line B1164 revealed two P-element insertion sites, one at 35D and the other at 32F (Figure 1, K and L). iPCR reactions on line B1164 were not straightforward; a sequence for only one of the P-element insertion sites was obtained by iPCR; that site was found in a nonannotated 3S18/Belsazar element on chromosome 2 (data not shown). B1164's molecular analysis will be presented elsewhere (N. C. GRIEDER and W. J. GEHRING, unpublished results).
abrupt is overexpressed in Gal4-expressing B2149 discs:
Our iPCR analysis suggested that abrupt should be overexpressed in B2149 discs when combined with a Gal4 line, in our case, dppdisc-Gal4. To find out whether abrupt was indeed overexpressed in a dpp-like pattern of such discs, we carried out whole-mount in situ hybridizations (MATERIALS AND METHODS). To this end, we used a digoxigenin-labeled abrupt antisense riboprobe and a sense control probe on imaginal discs of genotype B2149; dppdisc-Gal4 as well as on control y w discs (Figure 5; MATERIALS AND METHODS; data not shown). As already shown by HU et al. (1995), abrupt is widely expressed in wild-type imaginal discs (also see Figure 5, D and E; data not shown); interestingly, abrupt expression seems confined to the region anterior to the morphogenetic furrow in the eye disc (Figure 5D; HU et al. 1995). In discs of individuals containing both dppdisc-Gal4 and B2149, abrupt was found to be overexpressed in a dpp-like expression pattern (Figure 5, G and H), whereas the control sense probe did not show any pattern (data not shown). The Abrupt protein pattern was similar to the abrupt transcript pattern (HU et al. 1995; Figure 5, I and J, red); Abrupt protein also was excluded from cells posterior to the morphogenetic furrow, as confirmed by double staining with an antibody against Elav (Figure 5I, green) and was readily expressed in a dpp-like pattern in B2149; dppdisc-Gal4 discs (Figure 5, L and M).
abrupt expression is sufficient for the potential arista transformation:
We wanted to find out whether the insertion of the P{Mae-UAS.6.11} into the abrupt locus and consequently the abrupt misexpression was sufficient to cause the potential arista transformation. To this end, we cloned an abrupt cDNA into PUAST (BRAND and PERRIMON 1993) and generated transgenic lines (MATERIALS AND METHODS). A UAS-abrupt transgene on both the second and the third chromosome yielded transformed aristae when crossed to the dppdisc-Gal4 line (Figure 1, H and I). Therefore, abrupt is accountable for the change of the arista into a tube-like structure.
Antennal markers are suppressed in abrupt-overexpressing antennal discs:
If abrupt expression transforms the antenna to a leg-like structure, then antennal markers should be suppressed in these antennal discs. Therefore we analyzed B2149; dppdisc-Gal4/UAS-GFP-expressing eye-antennal discs for the expression of the antennal markers Spalt Major (Salm) (WAGNER-BERNHOLZ et al. 1991), Eyegone (Eyg) (JANG et al. 2003), and Dan (EMERALD et al. 2003). Indeed, the expression of all three markers was absent in the abrupt-overexpressing antennal tissue (Figure 5, N and O). This supports the idea that this tissue no longer has an antennal identity. A change in identity from antenna to leg is observed in the case of homothorax (hth) expression being compromised in antennal disc cells (CASARES and MANN 1998; PAI et al. 1998). To find out whether a change of Hth expression could be accountable for the observed arista transformation, expression of a hth-lacZ line and localization of the Hth protein was analyzed in control and abrupt-overexpressing antennal discs (Figure 5, P–S). These experiments indeed revealed that Hth was not appropriately expressed in a subset of abrupt-misexpressing cells, which are part of the distal hth expression domain, but was normal in the more proximal hth expression domain (Figure 5, P and Q). In addition, in these experiments it is also clearly visible that it is the most central domain of the antennal discs that is predominantly changed in response to abrupt overexpression, as the domain expressing GFP (due to dppdisc-Gal4), but not hth, is larger than in control antennal discs (Figure 5, P and Q). Although these findings are well in line with the idea that a transformation might take place due to a potential relative distal reduction of the hth expression domain (EMERALD and COHEN 2001), a clear transformation to leg identities could not be confirmed independently by other molecular markers, since unambiguous distal leg markers are not available. Therefore, it is not entirely clear whether this tissue truly acquired a leg identity, either by morphological criteria or by molecular criteria, albeit the transformed aristae resemble the malformed legs of the same genotype. For example, Antp, which is renowned for its capacity for promoting the transformation of the antenna to a leg (reviewed in GEHRING 1993), was not ectopically expressed in these antennal discs (data not shown).
The notum phenotype of the abrupt-overexpressing flies resembles a Delta loss-of-function phenotype:
We observed that B2149; dppdisc-Gal4 flies not only display a potentially transformed arista and abnormal legs, but also display supernumery macrocheates on the notum (Figure 1E). This phenotype is reminiscent of a conditional Delta loss-of-function phenotype (PARKS and MUSKAVITCH 1993). Delta is a ligand of the Notch-signaling pathway (reviewed in GREENWALD 2006). To find out whether abrupt overexpression can also mimic loss of Notch signaling in other tissues, we looked at the expression of wg in the wing blade primordium of the wing disc (Figure 5, F and K). It has been shown that wg expression in the wing blade margin is dependent on Notch signaling (DIAZ-BENJUMEA and COHEN 1995; DOHERTY et al. 1996). Whereas dppdisc-Gal4-mediated expression of a constitutively active Notch leads to ectopic expression of wg (DIAZ-BENJUMEA and COHEN 1995), dppdisc-Gal4-mediated expression of abrupt suppresses wg expression (Figure 5K). Similarly, we found that the expression of the Notch-signaling-dependent vgB-lacZ reporter (KIM et al. 1996 and Figure 5T) was compromised in abrupt-overexpressing wing discs (Figure 5, U and V). These results could indicate that abrupt can delimit Notch signaling in the wing blade tissue and suggests the possibility that abrupt is antagonizing or limiting Notch signaling. Alternatively, it could also indicate that the abrupt-overexpressing cells are incapable of expressing these genes.
94%). This indicates that transformations of the body are generally not easily obtained and that overexpression of many genes is not detrimental to development. Also, few factors may have the potential to spatially allocate a body part, which in turn suggests that the observed phenotypes are significant. In this respect, it is noteworthy that both candidate genes of our screen, which cause the potential transformations, code for putative transcription factors (see below). The mutant phenotypes observed in abnormal legs, wings, or antennae were reproducible and characteristic of the respective gene, which was overexpressed by the respective insertion. This was verified in a few control crosses but also became clear by identifying several hits in the same locus. Finding such characteristic phenotypes among those lines poses the question of whether insertions, which show a similar wing or leg phenotype, genetically and molecularly interact with each other. Therefore, it will be interesting to test whether insertion lines that share a similar loss-of-structure phenotype as that of the two potential transformation lines act downstream of these genes or affect similar pathways. For example, two lines [G1365 (Figure 2.16) and G1430 (Figure 2.20)] expose a wing phenotype similar to that of the transforming insertion line B1164. All of them display a proximal shortening of the wing blade. In one of these lines, wg signaling, which has a demonstrated role in determination and transdetermination events (reviewed in MAVES and SCHUBIGER 2003), might be affected. One line (B2037, Figure 3.29) displayed a leg phenotype similar to that of B1164: the proximal part of the leg was reduced and not shapely. One of the lines, which led to a transformation phenotype, was B1164. It displayed notum tissue at the site of the sternopleura. The notum is a derivative of the wing imaginal disc (BRYANT 1970) and the sternopleura, a derivative of the mesothoracic leg discs (STEINER 1976). Therefore, a transformation of the ventro-lateral body wall to the dorsal body wall seemed to have occurred in this mutant. The molecular analysis of this line was not straightforward, as it contains two P insertion sites. Its characterization will be presented elsewhere (N. C. GRIEDER and W. J. GEHRING, unpublished results). Our unpublished results indicate, however, that the gene responsible for this transformation corresponds to the putative transcription factor Spalt Major, which is expressed at the right time in development of the wing imaginal disc to accomplish the proposed function in determination of dorsal tissue. It is interesting that the transformed part of the fly in B1164 fate maps onto the upper medial quarter of the leg disc, the region of the disc with highest regeneration and transdetermination potential (SCHUBIGER 1971). Therefore, in future transdetermination experiments it will be tested whether it also represents a transdetermination factor.
In the second line (B2149), the arista was potentially transformed due to expression of abrupt, a BTB–zinc-finger protein putatively involved in gene regulation (HU et al. 1995). Morphologically, the transformed arista looked like an abnormal leg, similar to the ones present in these mutant flies. Since both the legs and the transformed arista looked rather abnormal, it could not be unambiguously determined whether a true transformation was present in this line. However, this seems possible on the basis of our molecular analysis: The three antennal markers Eyg, Salm, and Dan were absent in abrupt-expressing cells of the antennal disc. Also expression of Hth was slightly compromised at the distal edges of its expression domain, which might be sufficient to explain the observed potential transformation (CASARES and MANN 1998; PAI et al. 1998; EMERALD and COHEN 2001). Alternatively, it is possible that the tissue was not entirely transformed but rather was incapable of differentiating properly and so developed into a strange outgrowth, due to the failure to turn on the appropriate differentiation pathways. Such a function seems not impossible and would be expected of some factors involved in transdetermination. It has been shown that tissue regeneration is required prior to tissue transformation in the process of transdetermination (SCHUBIGER 1971). Therefore, factors that promote or reverse the status of differentiation must exist. For example, cells that constitutively overexpress Notch overproliferate and are delayed in their differentiation (KURATA et al. 1999). Indeed, the notum phenotype of abrupt-overexpressing flies was strongly reminiscent of a partial Delta loss-of-function phenotype (PARKS and MUSKAVITCH 1993). This may indicate that abrupt can delimit Notch signaling in the wing disc and suggests the possibility that abrupt is antagonizing or limiting Notch-Delta signaling. It has been shown that Delta-mediated activation of the Notch-signaling pathway is required for allocation of the correct number of macrochaetes (PARKS and MUSKAVITCH 1993). This Delta-signaling event involves the transport of the Delta protein along filopodia (DE JOUSSINEAU et al. 2003). In this context, it is interesting that a function for abrupt in endowment of the characteristics of dendritic morphology in class I neurons has been shown (SUGIMURA et al. 2004). In the absense of abrupt, the dendritic morphology in these neurons is more elaborate than it normally would be: more and more complex dendrites are forming. Ectopic expression of abrupt in class II–IV neurons led to a size reduction of their respective dendrites (SUGIMURA et al. 2004). Therefore, it is tempting to speculate that in abrupt-overexpressing wing discs, Notch signaling gets dampened by a shortening effect of Abrupt on filopodia, which are required for Delta's function in long-range lateral inhibition. Interestingly, Abrupt expression is elevated in the wing margin of developing wing discs where Notch signaling is required for wg and vgB-lacZ activation, albeit through Serrate (DIAZ-BENJUMEA and COHEN 1995; KIM et al. 1996; NEUMANN and COHEN 1996; Figure 5K). Whether abrupt represents a true transdetermination factor and plays a role in differentiation, and whether it interacts molecularly with the Notch-signaling pathway, will be analyzed in future experiments.
ADAMS, M. J., S. E. CELNIKER, R. A. HOLT, C. A. EVANS, J. D. GOCAYNE et al., 2000 The genome sequences of Drosophila melanogaster. Science 287: 2185–2195.
AFFOLTER, M., and R. MANN, 2001 Legs, eyes, or wings-selectors and signals make the difference. Science 292: 1080–1081.
ALDAZ, A., G. MORATA and N. AZPIAZU, 2003 The PAX-homeobox gene eyegone is involved in the subdivision of the thorax of Drosophila. Development 130: 4473–4482.
ALTSCHUL, S. F., T. L. MADDEN, A. A. SCHÄFFER, Z. ZHANG, W. MILLER et al., 1997 Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25: 3389–3402.
BEINERT, N., M. WERNER, G. DOWE, H.-R. CHUNG, H. JÄCKLE et al., 2004 Systematic gene targeting on the X chromosome of Drosophila melanogaster. Chromosoma 113: 271–275.[CrossRef][Medline]
BRAND, A. H., and N. PERRIMON, 1993 Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118: 401–415.[Abstract]
BRYANT, P. J., 1970 Cell lineage relationships in the imaginal wing disc of Drosophila melanogaster. Dev. Biol. 22: 389–411.[CrossRef][Medline]
CASARES, F., and R. MANN, 1998 Control of antennal versus leg development in Drosophila. Nature 392: 723–726.[CrossRef][Medline]
CELNIKER, S. E., D. A. WHEELER, B. KRONMILLER, J. W. CARLSON, A. HALPERN et al., 2002 Finishing a whole-genome shotgun: release 3 of the Drosophila melanogaster euchromatic genome sequence. Genome Biol. 3: 1–20.[Medline]
COHEN, S. M., 1993 Imaginal disc development, pp. 747–841 in The Development of Drosophila melanogaster, edited by M. BATE and A. MARTINEZ-ARIAS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
CRISP, J., and J. MERRIAM, 1997 Efficiency of an F1 selection screen in a pilot two-component mutagenesis involving Drosophila melanogaster misexpression phenotypes. Dros. Inf. Serv. 80: 90–92.
CZERNY, T., G. HALDER, U. KLOTER, A. SOUABNI, W. J. GEHRING et al., 1995 twin of eyeless, a second Pax-6 Gene of Drosophila, acts upstream of eyeless in the control of eye development. Mol. Cell 3: 297–307.[CrossRef]
DE JOUSSINEAU, C., J. SOULÉ, M. MARTIN, C. ANGUILLE, P. MONTCOURRIER et al., 2003 Delta-promoted filopodia mediate long-range lateral inhibition in Drosophila. Nature 426: 555–559.[CrossRef][Medline]
DIAZ-BENJUMEA, F. J., and S. M. COHEN, 1995 Serrate signals through Notch to establish a Wingless-dependent organizer at the dorsal/ventral compartment boundary of the Drosophila wing. Development 121: 4215–4225.[Abstract]
DOHERTY, D., G. FEGER, S. YOUNGER-SHEPHERD, L. Y. JAN and Y. N. JAN, 1996 Delta is a ventral to dorsal signal complementary to Serrate, another Notch ligand, in Drosophila wing formation. Genes Dev. 10: 421–434.
EMERALD, B. S, and S. M. COHEN, 2001 Limb development: getting down the ground state. Curr. Biol. 11: R1025–R1027.[CrossRef][Medline]
EMERALD, B. S., J. CURTISS, M. MLODZIK and S. M. COHEN, 2003 distal antenna and distal antenna related encode nuclear proteins containing pipsqueak motifs involved in antenna development in Drosophila. Development 130: 1171–1180.
GARBER, R. L., A. KUROIWA and W. J. GEHRING, 1983 Genomic and cDNA clones of the homeotic locus Antennapedia in Drosophila. EMBO J. 2: 2027–2036.[Medline]
GEBELEIN, B., D. J. MCKAY and R. S. MANN, 2004 Direct integration of Hox and segmentation gene inputs during Drosophila development. Nature 431: 653–659.[CrossRef][Medline]
GEHRING, W. J., 1966 Bildung eines vollständigen Mittelbeines mit Sternopleura in der Antennenregion bei der Mutante Nasobemia (Ns) von Drosophila melanogaster. Jul. Klaus Arch. 41: 44–45.
GEHRING, W. J., 1993 Exploring the homeobox. Gene 135: 215–221.[CrossRef][Medline]
GERLITZ, O., D. NELLEN, M. OTTIGER and K. BASLER, 2002 A screen for genes expressed in Drosophila imaginal discs. Int. J. Dev. Biol. 46: 173–176.[Medline]
GREENWALD, I., 2006 LIN-12/Notch signaling: lessons form worms and flies. Genes Dev. 12: 1751–1762.[CrossRef]
GRIEDER, N. C., T. MARTY, H.-D. RYOO, R. S. MANN and M. AFFOLTER, 1997 Synergistic activation of a Drosophila enhancer by Hom/Exd and Dpp signalling. EMBO J. 16: 7402–7410.[CrossRef][Medline]
GRIEDER, N. C., U. KLOTER and W. J. GEHRING, 2005 Expression of COPI components during development of Drosophila melanogaster. Gene Expr. Patterns 6: 11–21.[CrossRef][Medline]
HADORN, E., 1963 Differenzierungsleistungen wiederholt fragmentierter Teilstücke männlicher Genitalscheiben von Drosophila melanogaster nach Kultur in vivo. Dev. Biol. 7: 617–629.[CrossRef]
HALDER, G., P. CALLAERTS and W. J. GEHRING, 1995 Induction of ectopic eyes by targeted expression of the eyeless gene in Drosophila. Science 267: 1788–1792.
HU, S., D. FAMBROUGH, J. R. ATASHI and C. S. GOODMAN, 1995 The Drosophila abrupt gene encodes a BTB-zinc finger regulatory protein that controls the specificity of neuromuscular junctions. Genes Dev. 9: 2936–2948.
JANG, C.-C., J.-L. CHAO, N. JONES, L.-C. YAO, D. A. BESSARAB et al., 2003 Two Pax genes, eye gone and eyeless, act cooperatively in promoting Drosophila eye development. Development 130: 2939–2951.
KATSUYAMA, T., T. SUGAWARA, M. TATSUMI, W. J. OSHIMA, T. AIGAKI et al., 2005 Involvement of winged eye encoding a chromatin associated bromo-adjacent homology domain protein in disc specification. Proc. Natl. Acad. Sci. USA 102: 15918–15923.
KIM, J., K. D. IRVINE and S. B. CARROLL, 1995 Cell recognition, signal induction, and symmetrical gene activation at the dorsal-ventral boundary of the developing Drosophila wing. Cell 82: 795–802.[CrossRef][Medline]
KIM, J., A. SEBRING, J. J. ESCH, M. E. KRAUS, K. VORWERK et al., 1996 Integration of positional signals and regulation of wing formation and identity by Drosophila vestigial gene. Nature 382: 133–138.[CrossRef][Medline]
KÜHNLEIN, R. P., G. FROMMER, M. FRIEDRICH, M. GONZALEZ-GAITAN, M. WEBER et al., 1994 spalt encodes an evolutionarily conserved zinc finger protein of novel structure which provides homeotic gene function in the head and the tail region of the Drosophila embryo. EMBO J. 13: 168–179.[Medline]
KURATA, S., M. J. GO, S. ARTAVANIS-TSAKONAS and W. J. GEHRING, 1999 Notch signalling and the determination of appendage identity. Proc. Natl. Acad. Sci. USA 97: 2117–2122.[CrossRef]
LEE, N., C. MAURANGE, L. RINGROSE and R. PARO, 2005 Suppression of polycomb group proteins by JNK signalling induces transdetermination in Drosophila imaginal discs. Nature 438: 234–237.[CrossRef][Medline]
LEWIS, E. B., 1978 A gene complex controlling segmentation in Drosophila. Nature 276: 565–570.[CrossRef][Medline]
MANN, R. S., and G. MORATA, 2000 The developmental and molecular biology of genes that subdivide the body of Drosophila. Annu. Rev. Cell Dev. Biol. 16: 243–271.[CrossRef][Medline]
MAVES, L., and G. SCHUBIGER, 1998 A molecular basis for transdetermination in Drosophila imaginal discs: interactions between wingless and decapentaplegic signaling. Development 125: 115–124.[Abstract]
MAVES, L., and G. SCHUBIGER, 2003 Transdetermination in Drosophila imaginal discs: a model understanding pluripotency and selector gene maintenance. Curr. Opin. Genet. Dev. 13: 472–479.[CrossRef][Medline]
NEUMANN, C. J., and S. M. COHEN, 1996 A hierarchy of cross-regulation involving Notch, wingless, vestigial and cut organizes the dorsal/ventral axis of the Drosophila wing. Development 122: 3477–3485.[Abstract]
PAI, C.-Y., T.-S. KUO, T. J. JAW, E. KURANT, C.-T. CHEN et al., 1998 The Homothorax homeoprotein activates the nuclear localization of another hoemoprotein, Extradenticle, and suppresses eye development in Drosophila. Genes Dev. 12: 435–446.
PARKS, A. L., and M. A. T. MUSKAVITCH, 1993 Delta function is required for bristle organ determination and morphogenesis in Drosophila. Dev. Biol. 157: 484–496.[CrossRef][Medline]
RØRTH, P., 1998 Gal4 in the Drosophila female germline. Mech. Dev. 78: 113–118.[CrossRef][Medline]
RØRTH, P., K. SZABO, A. BAILEY, T. LAVERTY, J. REHM et al., 1998 Systematic gain-of-function genetics in Drosophila. Development 125: 1049–1057.[Abstract]
RUBIN, G. M., and A. C. SPRADLING, 1982 Transposition of cloned P elements into Drosophila germ line chromosomes. Science 218: 341–347.
SCHNEUWLY, S., A. KUROIWA and W. J. GEHRING, 1987a Molecular analysis of the dominant homeotic Antennapedia phenotype. EMBO J. 6: 201–206.[Medline]
SCHNEUWLY, S., R. KLEMENZ and W. J. GEHRING, 1987b Redesigning the body plan of Drosophila by ectopic expression of the homeotic gene Antennapedia. Nature 325: 816–818.[CrossRef][Medline]
SCHUBIGER, G., 1971 Regeneration, duplication and transdetermination in fragments of the leg disc of Drosophila melanogaster. Dev. Biol. 26: 277–295.[CrossRef][Medline]
SPRADLING, A. C., D. M. STERN, I. KISS, J. ROOTE, T. LAVERTY et al., 1995 Gene disruption using P transposable elements: an integral component of the Drosophila genome project. Proc. Natl. Acad. Sci. USA 92: 10824–10830.
SPRADLING, A. C., D. M. STERN, A. BETON, T. LAVERTY, N. MOZDEN et al., 1999 The Berkeley Drosophila Genome Project gene disruption project: single P-element insertions mutating 25% of vital Drosophila genes. Genetics 153: 135–177.
STAEHLING-HAMPTON, K., P. D. JACKSON, M. J. CLARK, A. H. BRAND and F. M. HOFFMANN, 1994 Specificity of bone morphogenetic protein-related factors: cell fate and gene expression changes in Drosophila induced by decapentaplegic but not 60A. Cell Growth Diff. 5: 585–593.[Abstract]
STEINER, E., 1976 Establishment of compartments in the developing leg imaginal discs of Drosophila melanogaster. Rouxs Arch. Dev. Biol. 180: 9–30.[CrossRef]
SUGIMURA, K., D. SATOH, P. ESTES, S. CREWS and T. UEMURA, 2004 Development of morphological diversity of dendrites in Drosophila by the BTB-zinc finger protein Abrupt. Neuron 43: 809–822.[CrossRef][Medline]
SUSTAIR, A., and G. SCHUBIGER, 2005 A transient cell cycle shift in Drosophila imaginal disc cells precedes multipotency. Cell 120: 383–393.[CrossRef][Medline]
THIBAULT, S. T., M. A. SINGER, W. Y. MIYAZAKI, B. MILASH, N. A. DOMPE et al., 2004 A complementary transposon tool kit for Drosophila melanogaster using P and piggyBac. Nat. Genet. 36: 283–287.[CrossRef][Medline]
TOBA, G., T. OHSAKO, N. MIYATA, T. OHTSUKA, K.-H. SEONG et al., 1999 The gene search system: a method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster. Genetics 151: 725–737.
WAGNER-BERNHOLZ, J. T., C. WILSON, G. GIBSON, R. SCHUH and W. J. GEHRING, 1991 Identification of target genes of the homeotic gene Antennapedia by enhancer detection. Genes Dev. 5: 2467–2480.
Communicating editor: T. SCHÜPBACH
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Data Supplement
-
All Versions of this Article:
genetics.106.064212v1
175/4/1707 most recent - Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Grieder, N. C.
- Articles by Gehring, W. J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Grieder, N. C.
- Articles by Gehring, W. J.




