- THIS ARTICLE
-
Abstract
- Full Text (PDF)
-
All Versions of this Article:
genetics.106.065185v1
175/1/21 most recent - Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Related articles in Genetics
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Pacher, M.
- Articles by Puchta, H.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Pacher, M.
- Articles by Puchta, H.
Originally published as Genetics Published Articles Ahead of Print on October 22, 2006.
Genetics, Vol. 175, 21-29, January 2007, Copyright © 2007
doi:10.1534/genetics.106.065185
Two Unlinked Double-Strand Breaks Can Induce Reciprocal Exchanges in Plant Genomes via Homologous Recombination and Nonhomologous End Joining
Michael Pacher, Waltraud Schmidt-Puchta and Holger Puchta1
Botany II, University of Karlsruhe, D-76128 Karlsruhe, Germany
1 Corresponding author: Botanisches Institut–Lehrstuhl II Fritz-Haber-Weg 4, Universität Karlsruhe, D-76128 Karlsruhe, Germany.
E-mail: holger.puchta{at}bio.uka.de
Using the rare-cutting endonuclease I-SceI we were able to demonstrate before that the repair of a single double-strand break (DSB) in a plant genome can be mutagenic due to insertions and deletions. However, during replication or due to irradiation several breaks might be induced simultaneously. To analyze the mutagenic potential of such a situation we established an experimental system in tobacco harboring two unlinked transgenes, each carrying an I-SceI site. After transient expression of I-SceI a kanamycin-resistance marker could be restored by joining two previously unlinked broken ends, either by homologous recombination (HR) or by nonhomologous end joining (NHEJ). Indeed, we were able to recover HR and NHEJ events with similar frequencies. Despite the fact that no selection was applied for joining the two other ends, the respective linkage could be detected in most cases tested, demonstrating that the respective exchanges were reciprocal. The frequencies obtained indicate that DSB-induced translocation is up to two orders of magnitude more frequent in somatic cells than ectopic gene conversion. Thus, DSB-induced reciprocal exchanges might play a significant role in plant genome evolution. The technique applied in this study may also be useful for the controlled exchange of unlinked sequences in plant genomes.
EFFICIENT repair of double-strand breaks (DSBs) in genomic DNA is important for the survival of all organisms. Basic mechanisms of DSB repair in somatic plant cells have been elucidated in recent years (for reviews see GORBUNOVA and LEVY 1999; REISS 2003; PUCHTA 2005; SCHUERMANN et al. 2005). DSBs are mainly repaired by nonhomologous end joining (NHEJ). The repair can be associated with deletions but also insertions due to copying genomic sequences from elsewhere into the break (GORBUNOVA and LEVY 1997; SALOMON and PUCHTA 1998). Species-specific differences of NHEJ have been reported and an inverse correlation of deletion size to genome size has been postulated, indicating that NHEJ might contribute significantly to the evolution of genome size (KIRIK et al. 2000). DSB repair by homologous recombination (HR) might influence genome organization as well. Whereas homology present in allelic (GISLER et al. 2002) or ectopic positions (SHALEV and LEVY 1997; PUCHTA 1999a) is hardly used for repair, the use of homologous sequences in close proximity to the break is frequent (OREL et al. 2003). Especially efficient is a "single-strand annealing" mechanism that leads to sequence deletions between direct repeats (XIAO and PETERSON 2000; SIEBERT and PUCHTA 2002).
For the study of the DSB repair consequences in recent years mainly experimental systems were used, which are based on the induction of a unique break at a specific genomic site. However, if cells are exposed to radiation more than one DSB might occur in the genome at a given time. Moreover, it is generally assumed that during a replication cycle of a eukaryotic genome a number of DSBs occur that have to be repaired. In such a situation several DNA ends are present in the nucleus, the repair of which might interfere with the others. An interesting question is whether the ends of the breaks could be joined vice versa, resulting in a reciprocal exchange of sequences. Alternatively further rearrangements of the genome might occur. Under certain circumstances reciprocal exchanges might be viable and transferred to the germ line. Indeed, recent genome analysis indicates that translocations occur regularly during the evolution of plant genomes (e.g., for Arabidopsis, ARABIDOPSIS GENOME INITIATIVE 2000; BLANC et al. 2000; for Brassica, UDALL et al. 2005). In this report we describe the setup of an experimental system that allowed us to directly demonstrate that reciprocal exchanges can be induced by unlinked DSBs in plant genomes.
DNA constructs:
The construction of plasmid pTS was described before (PUCHTA et al. 1996). For the construction of pTL the plasmid pUCPLBR+Z was used (PUCHTA et al. 1996). This plasmid contains, besides a pUC backbone within a polylinker, a bar gene next to the right border and the "overdrive" sequences of Agrobacterium strain C58. Using the oligonucleotides 5'-GCCGCCCGGGTATTACCCTGTTATCCCTAGTGCTGAAGTGCTT ATTATCTAAG-3' and 5'-GCCGCTCGAGTGGCAGGATATATTGTGGTGTAAACAATTCCCCATGGAGTCA AAGATTC-3' we amplified from the plasmid pTZAH271 (HROUDA and PASZKOWSKI 1994) a fragment containing an I-SceI recognition sequence next to the intron, the 5' exon, and the 35S promoter of the kanamycin-resistance gene, as well as a left border sequence, and we cloned the fragment into the SmaI and XhoI sites of pUCPLBR+Z. The resulting plasmid was cut by HpaI and the fragment carrying the marker genes was cloned into the PvuII site of a borderless derivative of pBin19 (BEVAN 1984). The resulting binary pTL was then electroporated into Agrobacterium for plant transformation.The I-SceI expression vector pCISceI (PUCHTA et al. 1996) contains a synthetic I-SceI ORF under the control of the cauliflower 35S promoter (PUCHTA et al. 1993) between T-DNA borders.
Plant transformation:
Molecular characterization of the transgenic line 1-12 was described before (PUCHTA 1999a). The line was produced from Nicotiana tabacum L. cv. Petite Havana line SR1 via Agrobacterium-mediated transformation with the plasmid pTS. Line 1-12 contains a single functional copy of the transgene in its genome. 1-12 seedlings homozygous for the transgene were retransformed with an Agrobacterium strain containing the vector pTL. Vacuum infiltration of tobacco seedlings and plant regeneration were done as described (SALOMON and PUCHTA 1998). Segregation of the selfed transformants was tested by germinating the seeds on MS medium supplemented with 20 µg phosphinotricin per milliliter.In a second series of experiments, F2 seedlings of the transgenic lines IRC1, -7, and -10 were inoculated with an Agrobacterium strain harboring the binary vector pCISceI as described (PUCHTA 1999b). A selection using 50 µg kanamycin per milliliter of medium was applied. The surviving calli were put on selective medium without hormones to induce shoot regeneration and the plants were regenerated.
Plant DNA extraction and Southern analysis:
DNA extraction from leaf tissues and calli was done as described (SALOMON and PUCHTA 1998). Southern blotting of HindIII- or EcoRV-digested DNA using the hybridization membrane "Hybond N+" (GE Healthcare Europe, Freiburg, Germany) was performed as described (SALOMON and PUCHTA 1998). The DNA probes were labeled using a random-priming labeling kit (Megaprime DNA labeling system RPN1607; GE Healthcare Europe) and [
-32P]dCTP (GE Healthcare Europe GmbH). As DNA template a kanamycin-specific probe was isolated as a 1.9-kb HindIII fragment from pCAH5 (HROUDA and PASZKOWSKI 1994), and a bar-specific probe was purified as a BglII fragment from p(UC)PCBR (PUCHTA et al. 1996).
PCR and sequence analysis:
Genomic DNA was analyzed via PCR using the primers KIH2 (5'-CGTGGCTGGCCTCCTTCAATGTAA-3') and KIR1 (5'-GTGACAACGTCGAGCACA GCTGCG-3') for detection of the junction A–D (Figure 1) and subsequent sequencing. Primers Hyg1 (5'-ATGTCCTGCGGGTAAATAGC-3') and BarS (5'-TACATCGAGACAA GCACGGT-3') were used to provide evidence for the junction C–B and sequencing reactions. Primers I-SceI-FW3 (5'-GATGCTTACATCCGTTCTC-3') and I-SceI-RV2 (5'-CAGGAAAGTTTCGGAGGAG-3') were used to analyze the recombinant lines regarding the presence of a functional I-SceI cassette. The PCR reactions and the direct sequencing of the amplification products were carried out as described (HARTUNG and PUCHTA 2000).
|
|
Experimental setup:
To characterize DSB-induced rearrangements in the genome we developed an experimental system that enabled us to address a number of questions with a single setup. The system is based on two independent T-DNAs, each carrying an I-SceI site (Figure 1). When both sites are present in the same genome and I-SceI is expressed, two breaks should be induced simultaneously. To detect the joining of unlinked DSB ends a selection marker was used. Close to the I-SceI sites of both constructs nonfunctional parts of a kanamycin resistance gene are cloned. This gene is split by an artificial intron into two exons (HROUDA and PASZKOWSKI 1994; PUCHTA et al. 1996). One T-DNA (pTL) contains the promoter with the 5' part of the gene and the intron whereas the other T-DNA (pTS) contains the same intron and the 3' end of the gene. After I-SceI expression the gene function can be restored (joining ends A and D in Figure 1) either by homologous recombination between the two intron sequences or by nonhomologous end joining in such a way that the two intron sequences are joined in tandem. Thus, a kanamycin-resistance gene with a bigger intron arises. Since this larger intron contains both functional donor and acceptor splicing sites—as in the case of the "original" intron—after splicing a functional neomycin phosphotransferase protein is produced. Thus, restoration of the kanamycin resistance can occur via HR or NHEJ, and due to the setup a direct comparison of the frequencies of both pathways is possible.Kanamycin resistance arises if the two unlinked ends A and D (Figure 1) are rejoined. It is, of course, important to know what happens to the two other ends (C and B in Figure 1). There are two possibilities: either the other ends are simultaneously joined in a reciprocal reaction (as shown in Figure 1) or further rearrangements occur at the broken ends. As there are no homologies between these ends, a direct linking can be achieved only via NHEJ. The newly produced junction C–B can easily be detected by PCR using primer-binding sites on the respective T-DNAs. In our previous studies on DSB repair by homologous recombination we used the transgenic tobacco line 1-12 that carries a single copy of the transgene pTS. In these studies homologous DNA repair was achieved using either the homology from an incoming T-DNA (PUCHTA et al. 1996; PUCHTA 1998; REISS et al. 2000) or that from an ectopic transgene (PUCHTA 1999). As 1-12 was well characterized and DSB induction could be performed reproducibly, we decided to use this line for the current study, too. Moreover, we could directly estimate the frequency of translocations in relation to ectopic gene conversion as determined in an earlier study using the same line (PUCHTA 1999a). Transgenic seedlings of the line 1-12, homozygous for a single-copy transgene of pTS, were transformed via Agrobacterium with the binary vector pTL. Plants were regenerated, and lines carrying one copy of the transgenic sequences at a single locus were identified by means of segregation analysis and Southern blotting. Three lines were chosen for further analysis: IRC1, IRC7, and IRC10.
Induction of recombination:
F2 seedlings of all three lines that were homozygous for pTS and hemizygous for pTL were inoculated with an Agrobacterium strain that harbored on its T-DNA an I-SceI-ORF under the control of a CaMV 35S promoter to achieve transient expression of the enzyme (PUCHTA 1999b). After 3 days, the seedlings were put on callus-inducing medium that contained kanamycin for the selection of cells with DSB-induced translocations. As a control, seedlings were inoculated with an Agrobacterium strain that did not contain the I-SceI ORF. Altogether 1000–2000 seedlings were inoculated with the I-SceI ORF per line, and 400–500 seedlings were used as controls. The results of the inoculation are depicted in Table 1.
|
We did not expect to obtain resistant calli for all lines. Depending on the orientation of the transgenes in the chromosomes to the centromeres, translocations between chromosome arms could lead to di- or acentric chromosomes. Such rearrangements might not be passed through cell division and thus would not result in viable calli. On the other hand, if the exchange is limited to chromosome ends or results in a sequence inversion within a chromosome, the recombined progeny might be viable. Indeed, calli arose from only one of the three lines (IRC1) after inoculation with the I-SceI ORF. No kanamycin-resistant calli arose in the controls. In total, 84 calli could be isolated from which DNA for PCR analysis was obtained.
PCR analysis of recombinant junctions:
In a first set of experiments we determined whether the restoration of the kanamycin-resistance gene was due to HR or due to NHEJ. Using the primers KIH2 and KIR1 (see Figure 1 and MATERIALS AND METHODS), amplification of a 1.2-kb band was indicative of HR, and a 2.0-kb band was indicative of NHEJ. In 33 cases the short and in 51 cases the longer band could be detected. Thus, in
40% of the cases the joining was mediated by HR. To further sustain the interpretation that the smaller PCR fragment arose indeed due to HR, six of the smaller PCR fragments were sequenced. All of them carried the same intron sequence without any mutations as expected for HR. We also sequenced seven longer PCR fragments. Here, in three cases the I-SceI site was conserved due to a simple ligation of the ends, and in the four other cases deletions of 2, 8, 12, and 28 nucleotides occurred during the joining process. In all cases the deletions were within or included the 18-mer I-SceI restriction site. To further analyze the recombination events at the molecular level we regenerated fertile plants from a row of calli. To determine if, in addition to the kanamycin-resistance gene (A and D in Figure 1), the other ends of the induced DSBs were also joined we tried to amplify putative junctions between C and B via PCR using the primers Hyg1 and BarS. Altogether 19 different recombinants were tested and we were able to obtain amplification products in 16 cases, which were all sequenced. Analysis demonstrated that in three lines (IRC1 7, IRC1 9, and IRC1 12) a functional I-SceI site was present at the new junction. Interestingly, in two of these cases the A–D junction also contained a functional I-SceI site (lines IRC1 9 and IRC1 12), demonstrating that in these cases both DSBs were rejoined by simple ligation with the respective other unlinked I-SceI half sites. In all other cases the new junction was formed by NHEJ. As the I-SceI expression cassette used for transient expression might have stably integrated in some lines we tested by PCR whether an I-SceI ORF was present in the respective recombinants. Indeed, in 11 of 16 lines tested this was the case. The continuous production of the restriction enzyme might have excluded the isolation of simple ligation events in these lines. Interestingly, both IRC1 9 and IRC1 12 indeed did not contain an I-SceI gene in their genome.
In 10 cases short deletions at the I-SceI site occurred from 2 to 38 bp. Figure 2 depicts several of the junctions. Microhomologies of one to five nucleotides could be identified at several of the junctions. In two cases insertions of 28 or 61 bp were found, accompanied by deletions of four and eight nucleotides within the I-SceI site, respectively. The 61-bp insert was copied into the break, using parts of the CaMV 35S terminator located 42 bp downstream of the DSB as a matrix (see Figure 2). The origin of the smaller insertion could not be elucidated as no clear homology to known sequences could be found in GenBank searches. For lines IRC1 14, 52, and 65 we were not able to detect a C–B-specific band.
|
Germinal transmission of the translocations:
To test the germinal transmissibility of the obtained genome rearrangements the seeds obtained from the regenerated recombinant plants were sown on MS medium containing kanamycin and checked for segregation. In 13 of 19 cases a Mendelian segregation of the kanamycin resistance was found (Table 2), indicating that the progeny inherited a single copy of the rejoined transgene. In two cases all seedlings were kanamycin resistant, indicating that apparently two independent translocations occurred within the respective genomes (IRC1 7 and 14). Such events were possible as besides the homozygous transgene C–D in a quarter of the inoculated seedlings the transgene A–B was also in a homozygous state. In four remaining cases half or less of the seedlings were kanamycin resistant (lines IRC1 18, 27, 47, and 65). We germinated individual seedlings of the respective lines without antibiotic selection and checked via PCR with the primers KIH2 and KIR1 if the lack of resistance was due to the absence of the kanamycin resistance gene or due to a silencing phenomenon. Indeed we obtained the kanamycin-resistance gene-specific fragment in three-quarters of the seedlings (
2-test, P = 0.05; data not shown), which demonstrates that the lack of resistance was not due to an aberrant segregation of the kanamycin-resistance gene but due to silencing phenomena.
|
To test if the newly formed junction C–B was also inherited in a Mendelian fashion we performed PCR with the primers Hyg1 and BarS on kanamycin-resistant seedlings of the lines IRC1 2, 4, 16, 21, 43, 47, and 73. In the case that both junctions were not linked genetically, we expected that three-quarters of the seedlings containing the A–D junction should also contain the C–B junction. For each recombinant line 20 seedlings were tested. Indeed, in all cases tested we detected the fragment as predicted for independent Mendelian segregation (
2-test). If we take into account that in all cases tested the reciprocal exchange of the broken ends led to the same kind of genome rearrangement, we will be able to pool the data (in total we obtained a PCR signal from 107 of 140 seedlings) and conclude that the two newly formed junctions are not linked and segregate independently with a 3:1 relation with very high probability (
2 = 0.152381).
Southern blot analysis:
For a more detailed analysis we performed Southern blots for a row of recombinants. For this purpose we used single plants originating from the selfed progeny of the recombinant lines. The analyzed plants contained the recombined fragments partly in the absence of the parental bands. In a first set of experiments we sustained our PCR data on the restoration of the kanamycin-resistance gene. After extraction DNA was digested by HindIII to easily discriminate between HR and NHEJ events. In the original line 1-12 (Figure 3A, lane 3) and parental line IRC1 (lane 4) a 3.4-kb kanamycin-intron-specific fragment can be cut out of the transgene of pTS. The parental line IRC1 contains also a 1.1-kb kanamycin-intron-specific fragment resulting from the transgene pTL (Figure 1; Figure 3A, lane 4). In the case that the broken ends A and D are joined by HR a new 1.9-kb fragment should arise, whereas in the case of NHEJ due to the presence of two intron sequences in tandem, a 2.7-kb fragment should be visible (Figure 1). In the case of lines ICR1 7-1 and 12-2 the digest of a progeny plant containing only the recombined junction results indeed in the expected 2.7-kb band indicative of NHEJ (Figure 3, lanes 5 and 7). As expected, in another plant of the progeny of the same line (ICR1 12-1), in which parental and recombined transgenes did not segregate (Figure 3, lane 6), in addition to the 2.7 kb, the 3.4- and the 1.1-kb band are visible as in the original line IRC1 (lane 4). In the case of the plants IRC1 25-1 and IRC1 52-1 (Figure 3, lanes 8 and 9, respectively) a 1.9-kb band was indicative of homologous recombination. The size was identical to a fragment of the line 1-12c (Figure 3, lane 2). Here the fragment arose due to restoration of a kanamycin-resistance gene by gene targeting after I-SceI expression in line1-12 (Figure 3, lane 3) (described in PUCHTA et al. 1996). In total, we tested 11 lines for restoration of the kanamycin-resistance gene via Southern blotting (data not shown) and in all cases the results (five HR and six NHEJ events) were in accordance with our previous PCR data.With a second set of blots we sustained our previous PCR findings that a new C–B junction was produced during the recombination reaction containing both bar and hygromycin-resistance genes. There are two EcoRV sites in pTL, one next to the right border (transgene half A) and one in the bar-resistance gene (Figure 1). In the case of an EcoRV digest probed with a bar-specific fragment, a 2.4-kb specific band can be seen on the blot (for IRC1, lane 4, Figure 3B). On the other hand, an EcoRV site is present in the genomic plant DNA in IRC1 close to the right border (RB) of pTS (transgene half C; Figure 1). If the two broken ends C and B are joined, a new 4.9-kb EcoRV-specific fragment should arise combined with the loss of the 2.4-kb fragment. Indeed, as shown in the blot for lines IRC1 7-1, IRC1 12-2, and IRC1 25-1 (Figure 3B, lanes 5, 6, and 8, respectively), this new 4.9-kb band can be detected in the recombinants. In the case of line IRC1 12-1 (lane 6) both the parental (2.4 kb) and the newly recombined (4.9 kb) bands are present. Interestingly we could not detect any bar-specific fragment in the case of line IRC1 52-1 (lane 9). This line is one of the three recombinants from which we were not able to obtain a PCR signal for the C–B junction. The absence of bar-specific sequences hints at the occurrence of a larger deletion event at the broken end B during the recombination reaction. In total, nine lines were tested that, according to our PCR analysis, carried a newly formed C–B junction. In all of them the 4.9-kb fragment could be detected.
40% of the events) found is reminiscent of a recent study we performed on the repair of a single DSB in tobacco (SIEBERT and PUCHTA 2002). In the latter study in almost half of the cases the breaks would be repaired by HR, if sufficient homology was available near the break site—an experimental situation similar to the one created in this study. In a recent study in mammalian cells the group of Maria Jasin was able to demonstrate for mouse cells that dependent on the number of mismatches within the homologous sequence the mode of linkage can be influenced. Whereas in the majority of cases in the presence of perfect homology HR was used, 20% of the divergence in sequences resulted almost exclusively in NHEJ (ELLIOTT et al. 2005). The fact that HR can be so efficient in our experimental set is most probably due the break being rejoined via a single-strand annealing (SSA) mechanism of recombination. The SSA model was first suggested for extrachromosomal recombination between plasmids in mammalian cells (LIN et al. 1984, 1990). After induction of a DSB, the free double-stranded ends are resected by a single-strand-specific exonuclease, leaving behind 3'-single-stranded overhangs. These single strands can anneal with each other at regions of complementarity, overhanging nonhomologous sequences are digested or alternatively single-stranded gaps could be refilled by means of repair synthesis, and in a last step the double strand is restored by religation of the remaining nicks. This model has been applied for describing extrachromosomal recombination in Xenopus oocytes (MARYON and CARROLL 1991a,b) and yeast (FISHMAN-LOBELL et al. 1992). In plants three different approaches unambiguously demonstrated that extrachromosomal recombination proceeds efficiently via single-strand annealing (PUCHTA and HOHN 1991; BILANG et al. 1992; DE GROOT et al. 1992; for review see PUCHTA and MEIER 1994). Our recent study demonstrated that SSA is also a major pathway for the repair of genomic DSBs (SIEBERT and PUCHTA 2002). Interestingly, a similar mechanism is used for NHEJ: the majority of junctions contain small patches of homologous nucleotides between reaction partners, which is best explained via the operation of a "SSA-like" mechanism (LEHMAN et al. 1994; NICOLAS et al. 1995; MASON et al. 1996; GORBUNOVA and LEVY 1997; SALOMON and PUCHTA 1998; for review see GORBUNOVA and LEVY 1999; see also Figure 2). Thus SSA and SSA-like mechanisms might be the most prominent mode for the rejoining of broken DNA molecules in higher eukaryotes irrespective of whether two closely linked or two unlinked break ends are joined.
Our results also demonstrate that two simultaneously induced DSBs can be repaired in the same genome by HR and NHEJ. This indicates that the same cell at a given time point is competent to repair DSBs by different pathways. Thus, different proteins required for HR and NHEJ might be recruited to break sites simultaneously.
Reciprocal exchanges:
Due to our experimental setup the rejoining of the two unlinked broken ends A and D resulting in kanamycin resistance was selected for (Figure 1). However, for most recombinants analyzed we could demonstrate that the two other ends C and B were also joined—independent of whether A and D were joined by NHEJ or by HR. In 16 of 19 recombinants tested a C–B fragment could be detected via PCR. We further analyzed a total of 9 of these lines via Southern blot and confirmed the reciprocal recombination reaction with the appearance of a new indicative 4.9-kb bar-specific band (Figure 3B). Thus, at least most events analyzed are reciprocal recombinants. Indeed, in the case of the recombinant line IRC1 52-1 we failed not only to detect a C–B junction via PCR, but also to demonstrate via Southern blot the presence of a bar-specific transgene sequence. As we obtained a hygromycin-specific signal (data not shown) it might well be that the joining of the transgene halves C and B resulted in a reciprocal recombination in which the bar-specific transgene sequences were lost before joining due to exonucleolytic degradation of the broken end B.However, it cannot be concluded from our study that the joining of two unlinked ends is always correlated with the rejoining of the two other ends. Although we were able to demonstrate this for at least most of the events analyzed, our study was based on the selection of events resulting in genomes that could proceed through mitosis. It might well be that other nonreciprocal events occurred; however, the resulting products could not be passed to the progeny. This might be true for lines IRC7 and IRC10, where transient expression of I-SceI did not result in kanamycin-resistant calli. Alternatively and more likely, reciprocal recombination occurred in these lines, too. However, di- and acentric chromosomes might be produced, which were not able to pass mitosis.
Whatever kind of repair occurs, one has to keep in mind that only events that can be transferred via meiosis to the next generation will be of importance for genome evolution. Under this premise one has to state that our study clearly indicates that reciprocal recombination occurs in plants and that at least in tobacco it can also be transferred to the next generation. However, due to experimental limitations we are not able to further characterize the nature of the induced translocations. Our segregation analysis clearly demonstrates that the rejoined transgene loci of pTS and pTL are not linked. This can be explained by a transgene integration on different chromosomes or on the same chromosome yet far apart. In the latter case a reciprocal translocation would result in an inversion within the same chromosome. As the tobacco genome consists of 48 chromosomes, it is, however, more probable that both transgenes were integrated in different chromosomes. Thus, an exchange of chromosome arms is the most likely outcome of the reaction induced in this study. This has been demonstrated for the mammalian and the Drosophila genome before (RICHARDSON and JASIN 2000; ELLIOTT et al. 2005; MAGGERT and GOLIC 2005), although an inversion was described for Drosophila, too (EGLI et al. 2004). Unfortunately, the tobacco genome has not been sequenced yet, so we are not able to determine the location of the integration sites for pTS and pTL in the transgenic lines. Another drawback preventing a more detailed analysis is the lack of chromosome-specific probes and the similar size of most chromosomes in tobacco. Therefore, no cytological analysis of the recombinants could be performed similar to the one applied in mouse (RICHARDSON and JASIN 2000).
Translocations in plant genome evolution:
Our analysis also hints at how often reciprocal translocations can occur in plants. Before, using the same transgene line 1-12 we were able to demonstrate that in
1 of 1000 cases a DSB could be repaired by the use of a homologous sequence in an ectopic position (PUCHTA 1999a). About 6000 seedlings were inoculated and four ectopic recombination events could be isolated in that study. Of these four events only one was a classical gene conversion. For line IRC1 <1200 seedlings were inoculated in this study, resulting in 84 recombination events—at least with this transgene combination. Thus, for the recombination substrate pTL used in this study, translocation occurs two orders of magnitude more often than ectopic gene conversions. As it was estimated that a DSB is repaired in 1 of 10,000 cases by ectopic homologies (SHALEV and LEVY 1997; PUCHTA 1999a), our study indicates that indeed in 1 of 100 cases two DSBs that occur simultaneously in a genome might be rejoined in the "wrong" way. In many cases the respective translocation might lead to dicentric or acentric chromosomes and thus will not be passed through cell division. However, in the case that an inversion within the same chromosome occurs or chromosome arms are exchanged, the new genotype could be transferred to the next generation. Thus, DSB-induced reciprocal exchanges might play a significant role in plant genome evolution. Indeed, translocation is a general mechanism in plant genome evolution and reciprocal exchanges have been found in the Arabidopsis genome (BLANC et al. 2000; ARABIDOPSIS GENOME INITIATIVE 2000).
Possible biotechnological applications:
Our results clearly demonstrate that reciprocal translocations can be induced in the plant genome after induction of two unlinked DSBs by means of a highly specific restriction endonuclease. We are convinced that the described technique has a high potential for biotechnological applications. Site-specific recombinases can be used to exchange DNA segments (for review see OW 2002). It has been demonstrated before that site-specific recombination between tobacco chromosomes could be achieved using the Cre recombinase, and the translocation could be transmitted through meiosis (QIN et al. 1994). However, chromosomal translocations between Arabidopsis and tobacco chromosomes could not be passed through the germ line (KOSHINSKY et al. 2000). Using site-specific recombination, recognition sites of the recombinases are left behind in the genome. Thus, for the performance of multiple genomic changes a combination of different site-specific recombination systems has to be applied. The development of alternative approaches for site-specific alterations of genomes is of great interest for biotechnology. A very promising approach would be the elimination of the respective recognition sequence during the genomic manipulation. Therefore, the use of highly specific restriction endonucleases for genome manipulations might be a useful, irreversible alternative to the established site-specific techniques. Endonucleases have already been applied for other kinds of plant genome manipulations: it has been demonstrated before that rare cutting restriction endonucleases can be used for the elimination of marker genes after transformation (SIEBERT and PUCHTA 2002; PUCHTA 2003) and for the induction of site-specific integration (PUCHTA et al. 1996). This might become even more feasible as new methods are developed for directed evolution of homing endonucleases (CHEN and ZHAO 2005). Recently, the introduction of mutations in genes of Arabidopsis has been demonstrated via the application of a sequence-specific zinc-finger nuclease (LLOYD et al. 2005). As zinc-finger nucleases can be developed for any recognition sequence required (CARROLL 2004; DURAI et al. 2005) and were shown to drastically increase the frequency of homologous recombination in plants (WRIGHT et al. 2005), one can expect that in the long run it will be possible to induce DSBs at any given site in the plant genome for various purposes, such as mutation, integration, excision, or translocation. Thus, endonucleases might become important tools for future plant gene technology.
ARABIDOPSIS GENOME INITIATIVE, 2000 Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408: 796–815.[CrossRef][Medline]
BEVAN, M., 1984 Agrobacterium vectors for plant transformation. Nucleic Acids Res. 12: 8711–8721.
BILANG, R., A. PETERHANS, A. BOGUCKI and J. PASZKOWSKI, 1992 Single-stranded DNA as recombination substrate in plants assessed by stable and transient expression. Mol. Cell. Biol. 12: 329–336.
BLANC, G., A. BARAKAT, R. GUYOT, R. COOKE and M. DELSENY, 2000 Extensive duplication and reshuffling in the Arabidopsis genome. Plant Cell 12: 1093–1101.
CARROLL, D., 2004 Using nucleases to stimulate homologous recombination. Methods Mol. Biol. 262: 195–207.[Medline]
CHEN, Z., and H. ZHAO, 2005 A highly sensitive selection method for directed evolution of homing endonucleases. Nucleic Acids Res. 33: 1–7.
DE GROOT, M. J. A., R. OFFRINGA, M. P. DOES, P. J. J. HOOYKAAS and P. J. M. VAN DEN ELZEN, 1992 Mechanisms of intermolecular homologous recombination in plants as studied with single- and double-stranded DNA molecules. Nucleic Acids Res. 20: 2785–2794.
DURAI, S., M. MANI, K. KANDAVELOU, J. WU, M. H. PORTEUS et al., 2005 Zinc finger nucleases: custom-designed molecular scissors for genome engineering of plant and mammalian cells. Nucleic Acids Res. 33: 5978–5990.
EGLI, D., E. HAFEN and W. SCHAFFNER, 2004 An efficient method to generate chromosomal rearrangements by targeted DNA double-strand breaks in Drosophila melanogaster. Genome Res. 14: 1382–1393.
ELLIOTT, B., C. RICHARDSON and M. JASIN, 2005 Chromosomal translocation mechanisms at intronic alu elements in mammalian cells. Mol. Cell 17: 885–894.[CrossRef][Medline]
FISHMAN-LOBELL, J., N. RUDIN and J. E. HABER, 1992 Two alternative pathways of double-strand break repair that are kinetically separable and independently modulated. Mol. Cell. Biol. 12: 1292–1303.
GISLER, B., S. SALOMON and H. PUCHTA, 2002 The role of double-strand break-induced allelic homologous recombination in somatic plant cells. Plant J. 32: 277–284.[CrossRef][Medline]
GORBUNOVA, V., and A. A. LEVY, 1997 Non-homologous DNA end joining in plant cells is associated with deletions and filler DNA insertions. Nucleic Acids Res. 25: 4650–4657.
GORBUNOVA, V., and A. A. LEVY, 1999 How plants make ends meet: DNA double-strand break repair. Trends Plant Sci. 4: 263–269.[CrossRef][Medline]
HARTUNG, F., and H. PUCHTA, 2000 Molecular characterization of two paralogous SPO11 homologues in Arabidopsis thaliana. Nucleic Acids Res. 28: 1548–1554.
HROUDA, M., and J. PASZKOWSKI, 1994 High fidelity extrachromosomal recombination and gene targeting in plants. Mol. Gen. Genet. 243: 106–111.[CrossRef][Medline]
KIRIK, A., S. SALOMON and H. PUCHTA, 2000 Species-specific double-strand break repair and genome evolution in plants. EMBO J. 19: 5562–5566.[CrossRef][Medline]
KOSHINSKY, H. A., E. LEE and D. W. OW, 2000 Cre-lox site-specific recombination between Arabidopsis and tobacco chromosomes. Plant J. 23: 715–722.[CrossRef][Medline]
LEHMAN, C. W., J. K. TRAUTMAN and D. CARROLL, 1994 Illegitimate recombination in Xenopus: characterization of end-joined junctions. Nucleic Acids Res. 22: 434–442.
LIN, F.-L., K. SPERLE and N. STERNBERG, 1984 Model for homologous recombination during transfer of DNA into mouse L cells: role for DNA ends in the recombination process. Mol. Cell. Biol. 4: 1020–1034.
LIN, F.-L., K. SPERLE and N. STERNBERG, 1990 Intermolecular recombination between DNAs introduced into mouse L cells is mediated by a nonconservative pathway that leads to crossover products. Mol. Cell. Biol. 10: 103–112.
LLOYD, A., C. L. PLAISIR, D. CARROLL and G. N. DREWS, 2005 Targeted mutagenesis using zinc-finger nucleases in Arabidopsis. Proc. Natl. Acad. Sci. USA 102: 2232–2237.
MAGGERT, K. A., and K. G. GOLIC, 2005 Highly efficient sex chromosome interchanges produced by I-CreI expression in Drosophila. Genetics 171: 1103–1114.
MARYON, E., and D. CARROLL, 1991a Involvement of single-stranded tails in homologous recombination of DNA injected into Xenopus laevis oocyte nuclei. Mol. Cell. Biol. 11: 3268–3277.
MARYON, E., and D. CARROLL, 1991b Characterization of recombination intermediates from DNA injected into Xenopus laevis oocytes: evidence for a nonconservative mechanism of homologous recombination. Mol. Cell. Biol. 11: 3268–3277.
MASON, R. M., J. THACKER and M. P. FAIRMAN, 1996 The joining of non-complementary DNA double-strand breaks by mammalian extracts. Nucleic Acids Res. 24: 4946–4953.
NICOLAS, A. L., P. L. MUNZ and C. S. YOUNG, 1995 A modified single-strand annealing model best explains the joining of DNA double-strand breaks in mammalian cells and cell extracts. Nucleic Acids Res. 23: 1036–1043.
OREL, N., A. KIRIK and H. PUCHTA, 2003 Different pathways of homologous recombination are used for the repair of double-strand breaks within tandemly arranged sequences in the plant genome. Plant J. 35: 604–612.[CrossRef][Medline]
OW, D. W., 2002 Recombinase-directed plant transformation for the post-genomic era. Plant Mol. Biol. 48: 183–200.[CrossRef][Medline]
PUCHTA, H., and B. HOHN, 1991 The mechanism of extrachromosomal homologous DNA recombination in plant cells. Mol. Gen. Genet. 230: 1–7.[CrossRef][Medline]
PUCHTA, H., 1998 Repair of genomic double-strand breaks in somatic plant cells by one-sided invasion of homologous sequences. Plant J. 13: 331–339.[CrossRef]
PUCHTA, H., 1999a DSB-induced recombination between ectopic homologous sequences in somatic plant cells. Genetics 152: 1173–1181.
PUCHTA, H., 1999b Use of I-SceI to induce double-strand breaks in Nicotiana. Methods Mol. Biol. 113: 447–451.[Medline]
PUCHTA, H., 2003 Marker-free transgenic plants. Plant Cell Tissue Organ Cult. 74: 123–134.[CrossRef]
PUCHTA, H., 2005 The repair of double-strand breaks in plants: mechanisms and consequences for genome evolution. J. Exp. Bot. 56: 1–14.
PUCHTA, H., B. DUJON and B. HOHN, 1993 Homologous recombination in plant cells is enhanced by in vivo induction of double-strand breaks into DNA by a site-specific endonuclease. Nucleic Acids Res. 21: 5034–5040.
PUCHTA, H., B. DUJON and B. HOHN, 1996 Two different but related mechanisms are used in plants for the repair of genomic double-strand breaks by homologous recombination. Proc. Natl. Acad. Sci. USA 93: 5055–5060.
QIN, M., C. BAYLEY, T. STOCKTON and D. W. OW, 1994 Cre recombinase-mediated site-specific recombination between plant chromosomes. Proc. Natl. Acad. Sci. USA 91: 1706–1710.
REISS, B., 2003 Homologous recombination and gene targeting in plant cells. Int. Rev. Cytol. 228: 85–139.[Medline]
REISS, B., I. SCHUBERT, K. KÖPCHEN, E WENDELER, J. SCHELL et al., 2000 RecA stimulates sister chromatid exchange and the fidelity of double-strand break repair, but not gene targeting, in plants transformed by Agrobacterium. Proc. Natl. Acad. Sci. USA 97: 3358–3363.
RICHARDSON, C., and M. JASIN, 2000 Frequent chromosomal translocations induced by DNA double-strand breaks. Nature 405: 697–700.[CrossRef][Medline]
SALOMON, S., and H. PUCHTA, 1998 Capture of genomic and T-DNA sequences during double-strand break repair in somatic plant cells. EMBO J. 17: 6086–6095.[CrossRef][Medline]
SCHUERMANN, D., J. MOLINIER, O. FRITSCH and B. HOHN, 2005 The dual nature of homologous recombination in plants. Trends Genet. 21: 172–181.[CrossRef][Medline]
SHALEV, G., and A. A. LEVY, 1997 The maize transposable element Ac induces recombination between the donor site and an homologous ectopic sequence. Genetics 146: 1143–1151.[Abstract]
SIEBERT, R., and H. PUCHTA, 2002 Efficient repair of genomic double-strand breaks via homologous recombination between directly repeated sequences in the plant genome. Plant Cell 14: 1121–1131.
UDALL, J. A., P. A. QUIJADA and T. C. OSBORN, 2005 Detection of chromosomal rearrangements derived from homeologous recombination in four mapping populations of Brassica napus L. Genetics 169: 967–979.
WRIGHT, D. A., J. A. TOWNSEND, R. J. WINFREY, JR., P. A. IRWIN, J. RAJAGOPAL et al., 2005 High-frequency homologous recombination in plants mediated by zinc-finger nucleases. Plant J. 44: 693–705.[CrossRef][Medline]
XIAO, Y. L., and T. PETERSON, 2000 Intrachromosomal homologous recombination in Arabidopsis induced by a maize transposon. Mol. Gen. Genet. 263: 22–29.[CrossRef][Medline]
YU, X., and A. GABRIEL, 2004 Reciprocal translocations in Saccharomyces cerevisiae formed by nonhomologous end joining. Genetics 166: 741–751.
Communicating editor: J. A. BIRCHLER
Related articles in Genetics:
ISSUE HIGHLIGHTS
Genetics 2007 175: NP.
This article has been cited by other articles:
![]() |
P. Zhang, W. Li, B. Friebe, and B. S. Gill The Origin of a "Zebra" Chromosome in Wheat Suggests Nonhomologous Recombination as a Novel Mechanism for New Chromosome Evolution and Step Changes in Chromosome Number Genetics, July 1, 2008; 179(3): 1169 - 1177. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. I. Boubriak, D. M. Grodzinsky, V. P. Polischuk, V. D. Naumenko, N. P. Gushcha, A. N. Micheev, S. J. McCready, and D. J. Osborne Adaptation and Impairment of DNA Repair Function in Pollen of Betula verrucosa and Seeds of Oenothera biennis from Differently Radionuclide-contaminated Sites of Chernobyl Ann. Bot., January 1, 2008; 101(2): 267 - 276. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
-
All Versions of this Article:
genetics.106.065185v1
175/1/21 most recent - Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Related articles in Genetics
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Pacher, M.
- Articles by Puchta, H.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Pacher, M.
- Articles by Puchta, H.




