- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Data Supplement
-
All Versions of this Article:
genetics.106.057455v1
173/2/943 most recent - Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Ghazalpour, A.
- Articles by Mehrabian, M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Ghazalpour, A.
- Articles by Mehrabian, M.
Originally published as Genetics Published Articles Ahead of Print on April 19, 2006.
Genetics, Vol. 173, 943-951, June 2006, Copyright © 2006
doi:10.1534/genetics.106.057455
Complex Inheritance of the 5-Lipoxygenase Locus Influencing Atherosclerosis in Mice
Anatole Ghazalpour*,
Xuping Wang
,
Aldons J. Lusis*,
,
,
and
Margarete Mehrabian
,1
Department of Human Genetics,
Department of Medicine and * Department of Microbiology Immunology and Molecular Genetics and
Molecular Biology Institute, University of California, Los Angeles, California 90095-1679
1 Corresponding author: David Geffin School of Medicine at UCLA, Department of Medicine/Cardiology, 3-220 MRL, Charles Young Dr., Los Angeles, CA 90095-1679.
Manuscript received February 21, 2006. Accepted for publication April 7, 2006.We previously mapped a locus on chromosome 6 with a large effect (LOD > 6) on aortic lesion size in a (C57BL/6J x CAST/Ei) F2 cross and identified arachidonate 5-lipoxygenase (5LO) as a candidate gene in this region. Subsequent studies with the 5LO knockout model showed effects on atherosclerosis and aortic aneurysms. We now report detailed genetic analysis of the chromosome 6 locus. We created a panel of overlapping and reciprocal subcongenic lines from the B6.CAST Ldlr/ chromosome 6 congenic strain (CON6.Ldlr/) and analyzed aortic lesion size in different subcongenic lines. Our results revealed that there are at least two subregions, designated as Ath37 and Ath38 that affect the size of aortic lesions independently of 5LO. We also showed that homozygote 5LO null mice develop smaller atherosclerotic lesions. We conclude that the relation between the mouse chromosome 6 locus and atherosclerosis is complex and is due to at least two genes with large effects within this region. This complexity should be considered when interpreting results of knockout studies.
ATHEROSCLEROSIS is a chronic inflammatory disease, which is influenced by a large number of environmental and genetic factors (LUSIS 2000). ROBERTS and THOMPSON (1976) originally showed that inbred mouse strains differ in susceptibility to atherosclerosis, and subsequently PAIGEN et al. (1987, 1989) mapped the first genomic regions linked to atherosclerosis development in mice (Ath1, Ath2, and Ath3). At present, >20 loci contributing to atherosclerosis susceptibility have been identified in crosses between various strains of mice (ALLAYEE et al. 2003; WANG et al. 2005a). Recently, Tnfsf4 was identified as the gene underlying the Ath1 locus and polymorphisms of this gene were found to be associated with myocardial infarction in humans (WANG et al. 2005b).
Several years ago, we reported the presence of linkage between the middle/distal segment of chromosome 6 and the size of atheroma (LOD = 6.7) in 250 F2 mice generated from the athero-susceptible C57BL/6J (B6) and athero-resistant CAST/Ei (CAST) parental strains (MEHRABIAN et al. 2001). In this cross, the CAST allele was associated with decreased aortic lesions. The genetic effect of the chromosome 6 locus on lesion size was subsequently confirmed by introgressing this locus from CAST onto the B6 background and analyzing the lesion area in the congenic strain (CON6). Similarly, when CON6 mice on the low-density receptor null background (Ldlr/) were fed with a high-fat diet, they had reduced lesion size compared with the B6.Ldlr/ mice despite hypercholesterolemia, suggesting that this locus influences lesion development by a mechanism distinct from lipid metabolism (MEHRABIAN et al. 2001).
Arachidonate 5-lipoxygenase (5LO) is an enzyme that converts arachidonic acid to various leukotrienes, which are potent proinflammatory mediators (MEHRABIAN and ALLAYEE 2003). The 5LO gene is located within the CON6 locus, and our results showed that the CAST allele of 5LO exhibits decreased levels of both 5LO mRNA and protein (MEHRABIAN et al. 2002). Furthermore, 5LO+/ Ldlr/ mice fed with a Western-type diet developed significantly smaller lesions compared to the B6 Ldlr/ mice. Moreover, resistance to atherosclerosis by the chromosome 6 congenic region or the 5LO knockout was mediated, in part, by bone-marrow-derived cells as judged by bone marrow transplantation experiments, consistent with a role for 5LO (MEHRABIAN et al. 2001, 2002). From this work, we concluded that 5LO is a primary candidate gene in the CON6 locus (MEHRABIAN et al. 2002).
Other studies have confirmed that the 5LO pathway plays a critical role in atherosclerosis. In two separate mouse studies with 5LO inhibitors, it was shown that blocking the 5LO pathway results in reduced atherosclerosis (AIELLO et al. 2002), especially during early lesion development (SUBBARAO et al. 2004). In humans, there is an abundance of cells expressing 5LO in the atherosclerotic lesions (SPANBROEK et al. 2003). We also found significant association between promoter variants of 5LO and intima-media thickness of the carotid artery (DWYER et al. 2004). Similarly, variants of the 5LO activating protein (FLAP) and LTA4 hydrolase (LTA4H) genes were found to be associated with the risk of stroke and myocardial infarction (HELGADOTTIR et al. 2004, 2005, 2006). Recently, HAKONARSON et al. 2005 showed that short-term treatment of coronary artery disease patients with a FLAP inhibitor significantly reduced the levels of biomarkers associated with the risk of myocardial infarction, and CIPOLLONE et al. (2005) found that the expression level of 5LO is elevated in symptomatic compared to asymptomatic plaques and is associated with acute ischemic syndromes.
Despite the mounting evidence favoring the hypothesis that 5LO pathway plays a role in atherosclerosis, a recent study by ZHAO et al. (2004) observed little or no effect of a 5LO knockout on atherosclerosis when studied on either Ldlr/ or apolipoprotein E null (Apoe/) backgrounds. However, they observed that 5LO/apoE/ mice developed fewer aneurysms than Apoe/ mice. In light of the supporting evidence favoring the role of the 5LO pathway in atherosclerosis from both mouse and human studies, we reasoned that the differing conclusions drawn from this study may be due to the complexity of the 5LO locus. If the chromosome 6 region flanking the 5LO gene contains other genes that influence atherosclerosis or aneurysm development, then studies of the 5LO knockout mice could be complicated by variations between the knockout and the control mice in the flanking region of 5LO, unrelated to the 5LO gene itself. That is, since the knockout was created on the strain 129 genetic background and then backcrossed to a B6 background by a series of crosses, the region around 5LO will retain genes derived from strain 129 rather than from B6.
In addition to 5LO, there are other genes in the chromosome 6 locus, such as PPAR-gamma (PPAR
), CD163, and
-2-macroglobulin (A2m), which have been previously associated with atherosclerosis and other known risk factors for cardiovascular disease in humans or animals (LI et al. 2000; CHAWLA et al. 2001; CHEN et al. 2001; KRIMBOU et al. 2001; SCHAER 2002). This, coupled with the growing evidence that some of the QTL for complex traits consist of multiple closely linked causal genes (LEGARE and FRANKEL 2000; ROGNER et al. 2001; LIU et al. 2002; DIAMENT and WARDEN 2004; YALCIN et al. 2004; FLINT et al. 2005), lead us to hypothesize that the chromosome 6 locus may also represent such a multigenic region. To examine this, we created a panel of overlapping and reciprocal subcongenic lines from CON6.Ldlr/ mice and characterized each line for development of atheroma in the proximal aorta. Our results showed that the chromosome 6 locus contains at least two genes influencing atherosclerosis.
Animals, diets, and markers:
Strain C57BL/6J Ldlr/ mice were obtained from the Jackson Laboratory (Bar Harbor, ME). The housing and care of mice were performed according to the approved institutional guidelines. All mice were housed in groups of five or fewer animals per cage and maintained on a 12-hr lightdark cycle at an ambient temperature of 23°. The subcongenic mice were fed on a standard rodent chow containing 4% fat (Ralston-Purina) until 12 weeks of age. At 12 weeks of age, female mice on the Ldlr/ background were started on an adjusted, Western-type diet containing 42% fat, 0.15% cholesterol, and 19.5% casein without sodium cholate (TD 88137; Food-Tek) and maintained on this diet for 8 weeks. 5LO null mice on the B6 background were fed a standard rodent chow containing 4% fat (Ralston-Purina) until 8 weeks of age. At 8 weeks of age, female mice were placed on a cholic-acid-containing atherogenic diet (HFA) (TD 90221; Food-Tek) and maintained on this diet for 18 weeks or for other times indicated.To generate chromosome 6 subcongenic Ldlr/ mice, B6.CAST chromosome 6 congenic mice containing the low-density-lipoprotein-receptor null mutation (referred to here as "CON6.Ldlr/") (MEHRABIAN et al. 2001) were crossed to C57BL/6J.Ldlr/ mice. The resulting (B6.Ldlr/ x CON6.Ldlr/) F1 animals were then either backcrossed or intercrossed to B6 Ldlr/. The resulting (B6.Ldlr/ x CON6.Ldlr/) F2 and [(B6.Ldlr/ x CON6 Ldlr/)F1 x B6.Ldlr/] N2 mice were then genotyped for 10 microsatellite markers (D6Mit152, D6Mit123, D6Mit102, D6Mit104, D6Mit44, D6Mit193, D6Mit61, D6Mit111, D6Mit198, and D6Mit14) in the CON6 region. F2 mice exhibiting recombination within the interval were then bred to produce homozygous subcongenic strains.
The primer sequences for microsatellite markers used in this study were obtained from the Broad Institute at http://www.broad.mit.edu/resources. The physical location of each marker was obtained from the Ensemble mouse genome database (build 33) at http://www.ensembl.org/Mus_musculus with the exception of the D6Mit14 marker. The approximate physical location of D6Mit14 was estimated by first finding the location of this marker relative to D6Mit198, the most distal marker on our map, using T31 radiation hybrid panel, followed by converting the centiray distance obtained from radiation hybrid mapping to a megabase distance using information available on The Jackson Laboratory T31 Mouse Radiation Hybrid Database.
For each subcongenic mouse, the genotype of two candidate genes, 5LO and PPAR
, were determined using primers designed to amplify the nearby microsatellite markers located at 115.7 and 116.7 Mb, respectively. The primer located at 115.7 is named D6UCLA3 and the sequences of the forward and reverse primers are GAATCCAGCACCCTCTTCTG and TGTACTGTGCTGGGCAAGTT. The primer located at 116.7 Mb is named D6UCLA5 and the sequences of the forward and reverse primers are GTTTGCATGTGTGTGTGTGC and GAACAAAGGAAGAAGATTCCCTAA. For D6UCLA3, the C57BL/6J and CAST/Ei PCR-amplified product sizes are 149 and 161 bp, respectively. For D6UCLA5, the C57BL/6J and CAST/Ei PCR-amplified product sizes are 156 and 160 bp, respectively.
Aortic lesion and aneurysm analysis:
Methods for the quantification of atherosclerotic lesions in the aortic root have previously been reported (MEHRABIAN et al. 2002). In brief, the heart and proximal aorta were dissected, washed with phosphate-buffered saline, embedded in optimal cutting temperature compound (Tissue-Tek), and then frozen on dry ice. Serial 10-µm-thick cryosections from the middle portion of the ventricle to the aortic arch were collected on superfrost/plus microscope slides (Fisher no. 12550-15). In the region beginning at the aortic valves, every other section was collected. In all other regions, every fifth section was collected. Sections were then stained with Oil red-O and hematoxylin and counterstained with Fast Green. Lesion areas were quantified by light microscopy.To determine the percentage of incidence and degree of severity of aneurysms in aortic sections, we used a semiquantitative method that took into account the extent of medial destruction as well as the number of sections in which aneurysms occurred (SHI et al. 2003). With this method, each section examined received a score between 0 and 6, with 0 being no aneurysm (no disruption of the media) and 6 being complete destruction of the media with the elastin layer being disrupted for >2 µm and the aortic lesion being protruded into the adventitia. More details on quantitation and representative figure of each score (16) is provided in supplemental Figure 1 at http://www.genetics.org/supplemental/. The "relative score" for aneurysms was calculated by summing over all the scores of the aortic sections examined for each mouse.
Statistical analysis:
The lesion data are presented as a scattergram with the mean for each group indicated on the graph. The results mentioned in the text are the means and the standard errors. The ANOVA t-test was performed using Statview (version 5.0) (Abacus Concepts, Berkeley, CA) to compare differences among groups in atherosclerotic lesions. The chi-square test was implemented to compare the difference in the frequency of occurrence of aneurysms between the subcongenics with B6 5LO and the subcongenics with CAST 5LO. In all the tests applied, differences were considered statistically significant at P < 0.05.Construction of CON6 subcongenic lines:
To analyze the effect of chromosome 6 locus on lesion size and refine this genetic region, we created a panel of overlapping and reciprocal subcongenic lines. Overall, a total of 16 lines were constructed (Figure 1A). This was achieved by intercrossing (B6.Ldlr/ x CON6 Ldlr/) F1 mice and genotyping the F2 progeny for nine microsatellite markers across the CON6 locus (for details of markers and their corresponding physical location, see MATERIALS AND METHODS). These markers span
43 cM covering the middle and distal section of mouse chromosome 6. Recombinant mice were then selected and intercrossed to produce a series of homozygous subcongenic lines. Each subcongenic line is genetically distinct from the others in terms of the length and the boundaries of the CAST introgressed region.
|
The chromosome 6 locus contains more than one gene affecting atherosclerosis:
To investigate if the genetic effect of the CON6 locus on atherosclerosis is due to one or multiple genes, we compared the size of aortic lesions in two subcongenics that divided the CON6 locus into two nonoverlapping halves (lines 3 and 10). In subcongenic line 3, the proximal region is derived from CAST strain, with the proximal recombination breakpoint located between D6Mit152 and D6Mit123 and the distal recombination breakpoint located between D6Mit44 and D6Mit193 (Figure 1A). In subcongenic line 10, the distal region of the CON6 locus is derived from the CAST strain. In this line, the proximal recombination breakpoint is located between D6Mit193 and D6Mit61 and the distal recombination breakpoint is located between D6Mit14 and the end of the chromosome 6 (Figure 1A). Since these two subcongenic lines retained no overlapping CAST region, we were able to study the effect of each region on atherosclerosis independently of the other.After feeding each line and the parental strains with a high-fat Western-type diet for 8 weeks, the size of the atherosclerotic lesions was quantified in Oil red-O-stained ascending aortic sections (see MATERIALS AND METHODS). In subcongenic line 3, the size of the lesions was significantly smaller than that in the B6.Ldlr/ mice (P < 0.0001) (Figure 1B). Likewise, line 10 developed smaller atheroma compared to the B6.Ldlr/ mice (P < 0.0001) (Figure 1B). There was no significant difference between the size of the lesions in lines 3 and 10. When compared to the lesion size of the CON6.Ldlr/ mice, both subcongenic lines had slightly higher average lesion size values (CON6.Ldlr/ = 57,000 µm2/section ± 39,000 vs. line 3 = 81,000 µm2/section ± 46,000 and line 10 = 78,000 µm2/section ± 36,000). However, these differences were not statistically significant for either line 3 (P = 0.16) or line 10 (P = 0.19). These results show that the effect of the CON6 locus on atherosclerosis could be attributed to at least two subregions. The first subregion (referred to here as the "proximal region") is located between D6Mit152 and D6Mit193 and the second subregion (referred to here as the "distal region") is located distal to the D6Mit193 marker.
Fine mapping of the distal region:
The distal region spans
25 Mb and contains 277 annotated genes. To find the smallest interval associated with lesion formation in the distal region, we compared the phenotype of subcongenics 11, 12, 13, 14, and 15, which share overlapping CAST segments in the distal region. Lines 11, 14, and 15 all had significantly smaller atherosclerotic lesions compared to B6.Ldlr/ mice. The genotyping information of these three lines revealed that the resistant lines 11, 14, and 15 all had the CAST allele of the D6Mit111 marker. This analysis indicated that the region associated with smaller lesion size can be confined to the 10-Mb interval surrounding the D6Mit111 marker between markers D6Mit61 and the D6Mit198. In contrast, line 12 had the same phenotype as that of the B6.Ldlr/ mice and line 13 had an intermediate phenotype when compared to that of the B6.Ldlr/ (P = 0.037) and CON6.Ldlr/ mice (P < 0.0001). The results for lines 12 and 13 suggested that at the telomeric end of chromosome 6, outside the 10-Mb interval surrounding the D6Mit111 marker, there are at least two genes linked in repulsion with small but significant effects on lesion formation (Figure 2B).
|
From the five subcongenics used to analyze the distal region, lines 12 and 14 had recombination breakpoints within the 10-Mb fine-mapped interval. These two lines were selected for further genotyping to increase the resolution of the fine mapping. Each line was genotyped for four additional markers: D6Mit220, D6Mit301, D6Mit258, and D6Mit291. The marker pattern along with the phenotype of each strain is shown in Figure 2A. As shown in Figure 2A, the resistant line 14 has retained the CAST alleles for markers D6Mit220 and D6Mit301, indicating that the resistant gene(s) in the distal region is located proximally to the D6Mit258 marker. Consistent with this analysis is the marker pattern for the susceptible line 12. This line exhibits a B6.Ldlr/ phenotype and has B6 alleles for D6Mit220, D6Mit301, and D6Mit258, which again indicates that the protective gene(s) is located proximally to the D6Mit258 marker. In summary, these data allowed us to narrow the distal region to the 7.8-Mb interval between markers D6Mit61 and D6Mit258 for the QTL with the major effect. We designate the gene in the distal region Ath38 (Figure 2B).
Complex inheritance of the proximal region:
We next focused on the proximal region. To carry the genetic analysis of this region, we created and characterized subcongenic line 16 (Figure 1, A and B). The marker pattern (Figure 1A) shows that the CAST region retained in this line is the region surrounding marker D6Mit193 but excluding the 5LO gene. The phenotypic characterization of this line revealed that the size of aortic lesions is significantly smaller than that of B6.Ldlr/ (P < 0.0001) but larger than that of the CON6.Ldlr/ mice (line 16 average lesion size = 95,000 µm2/section ± 38,000 vs. CON6.Ldlr/ average lesion size = 57,000 µm2/section ± 39,000, P = 0.011). These data suggested that line 16 has a protective phenotype.To determine the size of the proximal region, we genotyped line 16 with four additional markers surrounding D6Mit193. The results showed that the proximal recombination breakpoint is located between D6Mit115 and D6Mit109 and the distal recombination breakpoint is between D6Mit218 and D6Mit61. Since this line had the B6 alleles of both the 5LO and the distal region, we concluded that, within the proximal region, the 12.1-Mb interval between D6Mit115 and D6Mit61 contains at least one athero-protective gene. We designate this gene Ath37 (Figure 2B).
5LO null mice develop smaller lesions during the initial stages of atherosclerosis:
As discussed above, multiple studies involving inhibitors of the 5LO pathway and disruption of leukotriene receptors have suggested that 5LO deficiency protects against atherosclerosis and that the effect of 5LO is strongest during early stages of atherosclerosis (AIELLO et al. 2002; SUBBARAO et al. 2004). To test if the effect of 5LO is strongest during the initial stages of lesion development, we examined the effect of the 5LO deficiency on atherosclerosis in a diet-induced model that results primarily from the development of fatty-streak lesions (NISHINA et al. 1993). As shown in Figure 3, 5LO/ mice exhibited considerably reduced atherosclerosis compared to C57BL/6J mice in the diet-induced system (
10-fold). These data are consistent with other studies suggesting that reduced 5LO activity has a larger effect on the development of early lesions as compared to its effect on more advanced lesions. However, it is important to note that the 5LO/ mice used here and in other studies (ZHAO et al. 2004) carry flanking genes derived from strain 129 rather than from the B6 strain. Genotyping of the 5LO/ mice used in our study revealed that the 129-derived region extends from at least markers D6Mit55 to D6Mit333 and thus overlaps with the Ath37 locus that we mapped in this study.
|
The CAST 5LO locus does not influence the development of aneurysms in the proximal aorta:
ZHAO et al. (2004) reported that 5LO deficiency decreases the frequency and severity of both abdominal and aortic medial elastic lamina destruction (aneurysm) in a hyperlipidemic background. Therefore, we asked if the 5LO CAST allele, with dramatically decreased 5LO expression as compared to the B6 allele, has a similar effect in subcongenic lines. To determine this, we divided the subcongenics into two groups on the basis of the homozygosity for the parental 5LO genotype and scored aortic arch sections for the presence or absence of aneurysms. In cases where aneurysms were present, they were scored on a scale of 06 using predetermined criteria based on the morphology of the aortic section (see MATERIALS AND METHODS and supplemental Figure 1 at http://www.genetics.org/supplemental/). The results of this analysis showed no significant differences in the frequency of aneurysms between homozygous subcongenic lines bearing the CAST 5LO allele and those containing the B6 5LO allele. In addition, among the mice having aneurysms, there were no significant differences in regard to the severity of the aneurysms in these two groups (Figure 4).
|
Although we observed that there are at least two other genes at the chromosome 6 locus that contribute to lesion development, our results are consistent with previous evidence that 5LO affects atherosclerosis (MEHRABIAN et al. 2001; DWYER et al. 2004; HELGADOTTIR et al. 2004; HUANG et al. 2004), at least in earlier stages. Recently, however, ZHAO et al. (2004) observed inconsistent effects of 5LO deficiency on the background of the Apoe null mutation in two separately maintained colonies. In this study, one colony showed a 25% decrease in lesions and the other showed no difference. These authors also failed to observe significant differences in lesion development between the 5LO/ Ldlr/ double knockout and the Ldlr/ mice (ZHAO et al. 2004). They, however, did observe an effect of 5LO deficiency on the frequency and severity of aneurysms in Apoe/ mice (ZHAO et al. 2004). In contrast, we observed a significant reduction in lesion size in 5LO null homozygous mice compared to wild-type B6 mice and no evidence for aneurysms in the subcongenic lines with CAST 5LO hypomorph allele. These differing findings may be due to differences in experimental design such as the methodology for lesion and aneurysm quantitation, the age of the animals, and/or type and length of the diet, all of which differed in some respects. One significant difference in experimental design was that ZHAO et al. (2004) assessed aneurysms in the distal aorta whereas we studied aneurysms in the proximal aorta. However, in light of the study presented here, a plausible explanation would be that there are genetic factors differing between the two studies that confound the results. In particular, it could be that the presence of 129 genomic DNA flanking the targeted allele of 5LO could influence lesion or aneurysm development. Here we provide evidence that two regions distal to 5LO contain genes that affect atherosclerosis. Genotyping of the 5LO/ mice obtained from the Jackson Laboratory and used in our study indicates that in this colony the 14-Mb region surrounding the targeted 5LO gene consists of the 129 genomic sequence. How much of the 129 genomic DNA remained in the 5LO/ mouse used by ZHAO et al. (2004) is not known. But clearly, given that multiple genes at the chromosome 6 locus affect atherosclerosis, the extent of the 129 flanking region could influence the results if strain 129 differed from strain B6 with respect to alleles of these genes. We acknowledge that in our report the evidence for the antiatherogenic effects of loss of 5LO in the 5LO null mice may be confounded by the presence of the Ath37 129 allele surrounding the targeted 5LO gene. In addition, we were unable to genetically isolate the 5LO CAST allele from the Ath37 locus to directly investigate the effect of the CAST 5LO on atherosclerosis. However, the results obtained from the 5LO null mice are consistent with other mouse (AIELLO et al. 2002; SUBBARAO et al. 2004) and human studies (DWYER et al. 2004; HELGADOTTIR et al. 2004, 2005; CIPOLLONE et al. 2005), which collectively point toward the importance of the 5LO pathway in pathogenesis of atherosclerosis. It is noteworthy that recent studies have shown that 5LO deficiency results in complex metabolic effects, including adiposity and insulin resistance (MEHRABIAN et al. 2005). These effects predict that 5LO deficiency would result in increased atherosclerosis, but inhibition of the 5LO pathway, both genetically and pharmacologically, results in reduced atherosclerosis. Combined, these results suggest that 5LO deficiency both promotes atherogenesis (through its metabolic effects) and blocks atherosclerosis (perhaps due to its local effects in the subendothelial space in arteries) with the latter being dominant, at least in the early stages of atherosclerosis.
Our studies have revealed two novel major atherosclerosis genes, neither of which significantly impact lipoprotein levels. The more proximal locus (designated Ath37) spans 12.1 Mb between markers D6Mit115 and D6Mit61. This interval contains 175 genes and includes several candidate genes. One of the candidate genes located in this interval is Adiponectin receptor 2 (Adipor2) (SHIMADA et al. 2004; KADOWAKI and YAMAUCHI 2005). The natural ligand of Adipor2 is adiponectin, which in both animal and human studies has been shown to have antiatherogenic effects (KADOWAKI and YAMAUCHI 2005). In summary, in humans, plasma adiponectin levels are inversely correlated with the marker for coronary artery disease, the circulating C-reactive protein (OUCHI et al. 2003). In mice, adenovirus-mediated overexpression of adiponectin resulted in reduced progression of atherosclerosis in Apoe/ mice (OKAMOTO et al. 2002). In addition, adiponectin stimulates endothelial cells to produce nitric oxide (CHEN et al. 2003a) and decreases lipid accumulation in human monocyte-derived macrophages by suppressing the expression of class A scavenger receptor (OUCHI et al. 2001). Since adiponectin has many antiatherogenic effects and because it is known to bind and act only through Adipor1 or Adipor2, it would be plausible to hypothesize that some of the antiatherogenic effects of adiponectin are mediated through Adipor2. CD163, the macrophage-specific scavenger receptor for the hemoglobinhaptoglobin complex, is another candidate gene located in the Ath37 locus (SCHAER 2002). A recent study by ARISTOTELI et al. (2006) showed that the plasma levels of CD163, which previously were found to be present in human atherosclerotic lesions (RATCLIFFE et al. 2001), are significant predictors of coronary artery disease in humans. Although the exact role of CD163 in the pathogenesis of atherosclerosis is not known, the ability of IL-6 to increase expression of cell-surface CD163 protein (BUECHLER et al. 2000) and to induce hemeoxygenase-1 (HO-1) mRNA expression has led to the speculation that internalization of hemoglobinhaptoglobin complex by CD163 is an initial event in production of antiinflammatory heme metabolites by HO-1 (MOESTRUP and MOLLER 2004). The third candidate gene located in the Ath37 region is A2m. A2m is known to interact with lecithin:cholesterol acyltransferase (LCAT) and enhance its clearance (KRIMBOU et al. 2001). Since LCAT plays a major role in reverse cholesterol transport and regulation of the plasma high-density lipoprotein (HDL) levels, it is plausible to hypothesize that A2m-enhanced clearance of LCAT can lead to lower plasma HDL levels and increase atherosclerosis.
The more distal locus (designated Ath38) spans 7.8 Mb between markers D6Mit61 and D6Mit258. This locus contains 92 annotated genes, including a candidate gene, Olr1. Olr1 is known to be expressed in macrophages and vascular endothelial cells and is inducible by a variety of proinflammatory cytokines (NAGASE et al. 1998; MORAWIETZ et al. 1999, 2001). Moreover, this gene has been found to be abundantly present in human (KATAOKA et al. 1999) and rabbit atherosclerotic lesions (CHEN et al. 2000). Several independent studies have also found evidence for association between OLR1 and acute myocardial infarction (MANGO et al. 2003; TATSUGUCHI et al. 2003) and coronary artery disease (CHEN et al. 2003b; OHMORI et al. 2004). Perhaps the most direct evidence suggesting that Olr1 plays a role in the pathogenesis of atherosclerosis comes from the transgenic experiments. Recently, INOUE et al. (2005) overexpressed the bovine Olr1 cDNA under endothelial-specific promoter in mice, which resulted in a 10-fold increase in the size of atheroma-like lesions in intramyocardial vessels of transgenic animals fed a high-fat diet. They, however, saw no statistical difference in lesions in the aorta of these animals, which they attribute to lack of Olr1 overexpression in the aortic endothelial cells compared to myocardial vessel endothelial cells.
In addition to Ath37 and Ath38, which have strong effects on lesion formation, we were able to find evidence for the presence of at least two other genes with smaller effects at the telomeric end of the chromosome 6. These genes, however, seem to be linked in repulsion, meaning that the CAST allele of one of these genes is athero-protective and the CAST allele of the other gene is atherogenic. There are no apparent candidate genes that we could identify in this 13.1-Mb region.
In summary, our data emphasize the complications that can arise in the genetic dissection of polygenic diseases such as atherosclerosis. Clearly, the chromosome 6 locus has a dramatic impact on atherosclerosis because it contains multiple genes contributing to the trait. The presence of closely linked genes affecting the same trait complicates not only the genetic analysis of the locus but also the interpretation of the results obtained from experiments with knockout mice.
AIELLO, R. J., P. A. BOURASSA, S. LINDSEY, W. WENG, A. FREEMAN et al., 2002 Leukotriene B4 receptor antagonism reduces monocytic foam cells in mice. Arterioscler. Thromb. Vasc. Biol. 22: 443449.
ALLAYEE, H., A. GHAZALPOUR and A. J. LUSIS, 2003 Using mice to dissect genetic factors in atherosclerosis. Arterioscler. Thromb. Vasc. Biol. 23: 15011509.
ARISTOTELI, L. P., H. J. MOLLER, B. BAILEY, S. K. MOESTRUP and L. KRITHARIDES, 2006 The monocytic lineage specific soluble CD163 is a plasma marker of coronary atherosclerosis. Atherosclerosis 184: 342347.[Medline]
BUECHLER, C., M. RITTER, E. ORSO, T. LANGMANN, J. KLUCKEN et al., 2000 Regulation of scavenger receptor CD163 expression in human monocytes and macrophages by pro- and antiinflammatory stimuli. J. Leukoc. Biol. 67: 97103.[Abstract]
CHAWLA, A., W. A. BOISVERT, C. H. LEE, B. A. LAFFITTE, Y. BARAK et al., 2001 A PPAR gamma-LXR-ABCA1 pathway in macrophages is involved in cholesterol efflux and atherogenesis. Mol. Cell 7: 161171.[CrossRef][Medline]
CHEN, H., M. MONTAGNANI, T. FUNAHASHI, I. SHIMOMURA and M. J. QUON, 2003a Adiponectin stimulates production of nitric oxide in vascular endothelial cells. J. Biol. Chem. 278: 4502145026.
CHEN, M., M. KAKUTANI, M. MINAMI, H. KATAOKA, N. KUME et al., 2000 Increased expression of lectin-like oxidized low density lipoprotein receptor-1 in initial atherosclerotic lesions of Watanabe heritable hyperlipidemic rabbits. Arterioscler. Thromb. Vasc. Biol. 20: 11071115.
CHEN, Q., S. E. REIS, C. KAMMERER, W. Y. CRAIG, S. E. LAPIERRE et al., 2003b Genetic variation in lectin-like oxidized low-density lipoprotein receptor 1 (LOX1) gene and the risk of coronary artery disease. Circulation 107: 31463151.
CHEN, Z., S. ISHIBASHI, S. PERREY, J. OSUGA, T. GOTODA et al., 2001 Troglitazone inhibits atherosclerosis in apolipoprotein E-knockout mice: pleiotropic effects on CD36 expression and HDL. Arterioscler. Thromb. Vasc. Biol. 21: 372377.
CIPOLLONE, F., A. MEZZETTI, M. L. FAZIA, C. CUCCURULLO, A. IEZZI et al., 2005 Association between 5-lipoxygenase expression and plaque instability in humans. Arterioscler. Thromb. Vasc. Biol. 25: 16651670.
DIAMENT, A. L., and C. H. WARDEN, 2004 Multiple linked mouse chromosome 7 loci influence body fat mass. Int. J. Obes. Relat. Metab. Disord. 28: 199210.[Medline]
DWYER, J. H., H. ALLAYEE, K. M. DWYER, J. FAN, H. WU et al., 2004 Arachidonate 5-lipoxygenase promoter genotype, dietary arachidonic acid, and atherosclerosis. N. Engl. J. Med. 350: 2937.
FLINT, J., W. VALDAR, S. SHIFMAN and R. MOTT, 2005 Strategies for mapping and cloning quantitative trait genes in rodents. Nat. Rev. Genet. 6: 271286.[CrossRef][Medline]
HAKONARSON, H., S. THORVALDSSON, A. HELGADOTTIR, D. GUDBJARTSSON, F. ZINK et al., 2005 Effects of a 5-lipoxygenase-activating protein inhibitor on biomarkers associated with risk of myocardial infarction: a randomized trial. JAMA 293: 22452256.
HELGADOTTIR, A., A. MANOLESCU, G. THORLEIFSSON, S. GRETARSDOTTIR, H. JONSDOTTIR et al., 2004 The gene encoding 5-lipoxygenase activating protein confers risk of myocardial infarction and stroke. Nat. Genet. 36: 233239.[CrossRef][Medline]
HELGADOTTIR, A., S. GRETARSDOTTIR, D. ST. CLAIR, A. MANOLESCU, J. CHEUNG et al., 2005 Association between the gene encoding 5-lipoxygenase-activating protein and stroke replicated in a Scottish population. Am. J. Hum. Genet. 76: 505509.[CrossRef][Medline]
HELGADOTTIR, A., A. MANOLESCU, A. HELGASON, G. THORLEIFSSON, U. THORSTEINSDOTTIR et al., 2006 A variant of the gene encoding leukotriene A4 hydrolase confers ethnicity-specific risk of myocardial infarction. Nat. Genet. 38: 6874.[Medline]
HUANG, L., A. ZHAO, F. WONG, J. M. AYALA, M. STRUTHERS et al., 2004 Leukotriene B4 strongly increases monocyte chemoattractant protein-1 in human monocytes. Arterioscler. Thromb. Vasc. Biol. 24: 17831788.
INOUE, K., Y. ARAI, H. KURIHARA, T. KITA and T. SAWAMURA, 2005 Overexpression of lectin-like oxidized low-density lipoprotein receptor-1 induces intramyocardial vasculopathy in apolipoprotein E-null mice. Circ. Res. 97: 176184.
KADOWAKI, T., and T. YAMAUCHI, 2005 Adiponectin and adiponectin receptors. Endocr. Rev. 26: 439451.
KATAOKA, H., N. KUME, S. MIYAMOTO, M. MINAMI, H. MORIWAKI et al., 1999 Expression of lectinlike oxidized low-density lipoprotein receptor-1 in human atherosclerotic lesions. Circulation 99: 31103117.
KRIMBOU, L., M. MARCIL, J. DAVIGNON and J. GENEST, JR., 2001 Interaction of lecithin:cholesterol acyltransferase (LCAT). alpha 2-macroglobulin complex with low density lipoprotein receptor-related protein (LRP). Evidence for an alpha 2-macroglobulin/LRP receptor-mediated system participating in LCAT clearance. J. Biol. Chem. 276: 3324133248.
LEGARE, M. E., and W. N. FRANKEL, 2000 Multiple seizure susceptibility genes on chromosome 7 in SWXL-4 congenic mouse strains. Genomics 70: 6265.[CrossRef][Medline]
LI, A. C., K. K. BROWN, M. J. SILVESTRE, T. M. WILLSON, W. PALINSKI et al., 2000 Peroxisome proliferator-activated receptor gamma ligands inhibit development of atherosclerosis in LDL receptor-deficient mice. J. Clin. Invest. 106: 523531.[Medline]
LIU, H., G. R. ABECASIS, S. C. HEATH, A. KNOWLES, S. DEMARS et al., 2002 Genetic variation in the 22q11 locus and susceptibility to schizophrenia. Proc. Natl. Acad. Sci. USA 99: 1685916864.
LUSIS, A. J., 2000 Atherosclerosis. Nature 407: 233241.[CrossRef][Medline]
MANGO, R., F. CLEMENTI, P. BORGIANI, G. B. FORLEO, M. FEDERICI et al., 2003 Association of single nucleotide polymorphisms in the oxidised LDL receptor 1 (OLR1) gene in patients with acute myocardial infarction. J. Med. Genet. 40(12): 933936.
MEHRABIAN, M., and H. ALLAYEE, 2003 5-lipoxygenase and atherosclerosis. Curr. Opin. Lipidol. 14: 447457.[CrossRef][Medline]
MEHRABIAN, M., J. WONG, X. WANG, Z. JIANG, W. SHI et al., 2001 Genetic locus in mice that blocks development of atherosclerosis despite extreme hyperlipidemia. Circ. Res. 89: 125130.
MEHRABIAN, M., H. ALLAYEE, J. WONG, W. SHI, X. P. WANG et al., 2002 Identification of 5-lipoxygenase as a major gene contributing to atherosclerosis susceptibility in mice. Circ. Res. 91: 120126.
MEHRABIAN, M., H. ALLAYEE, J. STOCKTON, P. Y. LUM, T. A. DRAKE et al., 2005 Integrating genotypic and expression data in a segregating mouse population to identify 5-lipoxygenase as a susceptibility gene for obesity and bone traits. Nat. Genet. 37: 1381.
MOESTRUP, S. K., and H. J. MOLLER, 2004 CD163: a regulated hemoglobin scavenger receptor with a role in the anti-inflammatory response. Ann. Med. 36: 347354.[CrossRef][Medline]
MORAWIETZ, H., U. RUECKSCHLOSS, B. NIEMANN, N. DUERRSCHMIDT, J. GALLE et al., 1999 Angiotensin II induces LOX-1, the human endothelial receptor for oxidized low-density lipoprotein. Circulation 100: 899902.
MORAWIETZ, H., N. DUERRSCHMIDT, B. NIEMANN, J. GALLE, T. SAWAMURA et al., 2001 Induction of the oxLDL receptor LOX-1 by endothelin-1 in human endothelial cells. Biochem. Biophys. Res. Commun. 284: 961965.[CrossRef][Medline]
NAGASE, M., J. ABE, K. TAKAHASHI, J. ANDO, S. HIROSE et al., 1998 Genomic organization and regulation of expression of the lectin-like oxidized low-density lipoprotein receptor (LOX-1) gene. J. Biol. Chem. 273: 3370233707.
NISHINA, P. M., S. LOWE, J. VERSTUYFT, J. K. NAGGERT, F. A. KUYPERS et al., 1993 Effects of dietary fats from animal and plant sources on diet-induced fatty streak lesions in C57BL/6J mice. J. Lipid Res. 34: 14131422.[Abstract]
OHMORI, R., Y. MOMIYAMA, M. NAGANO, H. TANIGUCHI, T. EGASHIRA et al., 2004 An oxidized low-density lipoprotein receptor gene variant is inversely associated with the severity of coronary artery disease. Clin. Cardiol. 27: 641644.[Medline]
OKAMOTO, Y., S. KIHARA, N. OUCHI, M. NISHIDA, Y. ARITA et al., 2002 Adiponectin reduces atherosclerosis in apolipoprotein E-deficient mice. Circulation 106: 27672770.
OUCHI, N., S. KIHARA, Y. ARITA, M. NISHIDA, A. MATSUYAMA et al., 2001 Adipocyte-derived plasma protein, adiponectin, suppresses lipid accumulation and class A scavenger receptor expression in human monocyte-derived macrophages. Circulation 103: 10571063.
OUCHI, N., S. KIHARA, T. FUNAHASHI, T. NAKAMURA, M. NISHIDA et al., 2003 Reciprocal association of C-reactive protein with adiponectin in blood stream and adipose tissue. Circulation 107: 671674.
PAIGEN, B., D. MITCHELL, K. REUE, A. MORROW, A. J. LUSIS et al., 1987 Ath-1, a gene determining atherosclerosis susceptibility and high density lipoprotein levels in mice. Proc. Natl. Acad. Sci. USA 84: 37633767.
PAIGEN, B., M. N. NESBITT, D. MITCHELL, D. ALBEE and R. C. LEBOEUF, 1989 Ath-2, a second gene determining atherosclerosis susceptibility and high density lipoprotein levels in mice. Genetics 122: 163168.
RATCLIFFE, N. R., S. M. KENNEDY and P. M. MORGANELLI, 2001 Immunocytochemical detection of Fcgamma receptors in human atherosclerotic lesions. Immunol. Lett. 77: 169174.[CrossRef][Medline]
ROBERTS, A., and J. S. THOMPSON, 1976 Inbred mice and their hypbrids as an animal model for atherosclerosis research. Adv. Exp. Med. Biol. 67: 313327.[Medline]
ROGNER, U. C., C. BOITARD, J. MORIN, E. MELANITOU and P. AVNER, 2001 Three loci on mouse chromosome 6 influence onset and final incidence of type I diabetes in NOD.C3H congenic strains. Genomics 74: 163171.[CrossRef][Medline]
SCHAER, D. J., 2002 The macrophage hemoglobin scavenger receptor (CD163) as a genetically determined disease modifying pathway in atherosclerosis. Atherosclerosis 163: 199201.[CrossRef][Medline]
SHI, W., M. D. BROWN, X. WANG, J. WONG, D. F. KALLMES et al., 2003 Genetic backgrounds but not sizes of atherosclerotic lesions determine medial destruction in the aortic root of apolipoprotein E-deficient mice. Arterioscler. Thromb. Vasc. Biol. 23: 19011906.
SHIMADA, K., T. MIYAZAKI and H. DAIDA, 2004 Adiponectin and atherosclerotic disease. Clin. Chim. Acta 344: 112.[CrossRef][Medline]
SPANBROEK, R., R. GRABNER, K. LOTZER, M. HILDNER, A. URBACH et al., 2003 Expanding expression of the 5-lipoxygenase pathway within the arterial wall during human atherogenesis. Proc. Natl. Acad. Sci. USA 100: 12381243.
SUBBARAO, K., V. R. JALA, S. MATHIS, J. SUTTLES, W. ZACHARIAS et al., 2004 Role of leukotriene B4 receptors in the development of atherosclerosis: potential mechanisms. Arterioscler. Thromb. Vasc. Biol. 24: 369375.
TATSUGUCHI, M., M. FURUTANI, J. HINAGATA, T. TANAKA, Y. FURUTANI et al., 2003 Oxidized LDL receptor gene (OLR1) is associated with the risk of myocardial infarction. Biochem. Biophys. Res. Commun. 303(1): 247250.[CrossRef][Medline]
WANG, X., N. ISHIMORI, R. KORSTANJE, J. ROLLINS and B. PAIGEN, 2005a Identifying novel genes for atherosclerosis through mouse-human comparative genetics. Am. J. Hum. Genet. 77: 115.[CrossRef][Medline]
WANG, X., M. RIA, P. M. KELMENSON, P. ERIKSSON, D. C. HIGGINS et al., 2005b Positional identification of TNFSF4, encoding OX40 ligand, as a gene that influences atherosclerosis susceptibility. Nat. Genet. 37: 365372.[CrossRef][Medline]
YALCIN, B., S. A. WILLIS-OWEN, J. FULLERTON, A. MEESAQ, R. M. DEACON et al., 2004 Genetic dissection of a behavioral quantitative trait locus shows that Rgs2 modulates anxiety in mice. Nat. Genet. 36: 11971202.[CrossRef][Medline]
ZHAO, L., M. P. MOOS, R. GRABNER, F. PEDRONO, J. FAN et al., 2004 The 5-lipoxygenase pathway promotes pathogenesis of hyperlipidemia-dependent aortic aneurysm. Nat. Med. 10: 966973.[CrossRef][Medline]
Communicating editor: N. A. JENKINS
This article has been cited by other articles:
![]() |
S. Chiu, K. Kim, K. A. Haus, G. M. Espinal, L. V. Millon, and C. H. Warden Identification of positional candidate genes for body weight and adiposity in subcongenic mice Physiol Genomics, September 11, 2007; 31(1): 75 - 85. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Meng, I. Vera, N. Che, X. Wang, S. S. Wang, L. Ingram-Drake, E. E. Schadt, T. A. Drake, and A. J. Lusis Identification of Abcc6 as the major causal gene for dystrophic cardiac calcification in mice through integrative genomics PNAS, March 13, 2007; 104(11): 4530 - 4535. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Data Supplement
-
All Versions of this Article:
genetics.106.057455v1
173/2/943 most recent - Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Ghazalpour, A.
- Articles by Mehrabian, M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Ghazalpour, A.
- Articles by Mehrabian, M.







