Mutations in the human Tsc1 and Tsc2 genes predispose to tuberous sclerosis complex (TSC), a disorder characterized by the wide spread of benign tumors. Tsc1 and Tsc2 proteins form a complex and serve as a GTPase-activating protein (GAP) for Rheb, a GTPase regulating a downstream kinase, mTOR. The genome of Schizosaccharomyces pombe contains tsc1⁺ and tsc2⁺, homologs of human Tsc1 and Tsc2, respectively. In this study we analyzed the gene expression profile on a genomewide scale and found that deletion of either tsc1⁺ or tsc2⁺ affects gene induction upon nitrogen starvation. Three hours after nitrogen depletion genes encoding permeases and genes required for meiosis are less induced. Under the same condition, retrotransposons, G1-cyclin (pas1⁺), and inv1⁺ are more induced. We also demonstrate that a mutation (cpp1-1) in a gene encoding a ß-subunit of a farnesyltransferase can suppress most of the phenotypes associated with deletion of tsc1⁺ or tsc2⁺. When a mutant of rhb1⁺ (homolog of human Rheb), which bypasses the requirement of protein farnesylation, was expressed, the cpp1-1 mutation could no longer suppress, indicating that deficient farnesylation of Rhb1 contributes to the suppression. On the basis of these results, we discuss TSC pathology and possible improvement in chemotherapy for TSC.

---

TUBEROUS sclerosis complex (TSC) is an autosomal dominant disorder characterized by the wide spread of benign tumors called hamartomas in different organs including the brain, eyes, heart, kidney, skin, and lungs (KWIATKOWSKI and SHORT 1994; GOMEZ 1995). Seizures and learning and behavioral problems, which are likely due to development of tumors in the brain, are also common in patients with TSC (KWIATKOWSKI and SHORT 1994; GOMEZ et al. 1999). Two human genes, TSC1 and TSC2, are responsible for TSC (EUROPEAN CHROMOSOME 16 TUBEROUS SCLEROSIS CONSORTIUM 1993; VAN SLEGTENHORST et al. 1997), each of which encodes hamartin and tuberin, respectively. Inactivation of TSC1 and TSC2 causes phenotypes similar each other, suggesting that they might affect the same pathway. TSC1 and TSC2 form a heterodimer and the TSC1–TSC2 interaction appears to be important for the stability of the two proteins (LI et al. 2004b). Therefore, TSC1 and TSC2 are generally considered as a complex (TSC1/2) with a single biological function, and understanding functions of the TSC1/2 complex is clinically important.

Genetic studies in mammalian systems (CARBONARA et al. 1994; GREEN et al. 1994a,b; HENSKE et al. 1996; KWIATKOWSKI et al. 2002) and Drosophila (ITO and RUBIN 1999) have shown that TSC1/2 functions to inhibit cell growth as well as cellular proliferation (HENGSTSCHLAGER et al. 2001). Appearance of giant cells within hamartomas from TSC patients and the gigas phenotype in the fly mutant highlight the capability of TSC1/2 in controlling cell size (ITO and RUBIN 1999). Studies have shown that TSC1/2 controls cell growth/proliferation by regulating the activity of a small GTPase, RHEB (ZHANG et al. 2003). When the environment surrounding the cell is not favorable for growth/proliferation, TSC1 and TSC2, which have a GTPase-activating protein (GAP) domain in their C-terminal region, convert RHEB into an inactive form. A kinase, mTOR is a target of RHEB and promotes protein synthesis when stimulated by RHEB GTPase (MANNING and CANTLEY 2003; LI et al. 2004a,b; PAN et al. 2004; LONG et al. 2005). It is postulated that formation of hamartomas in TSC is a result of abnormal regulation of RHEB GTPase. A loss of TSC1/2 would allow constitutive activation of the GTPase as well as its target, mTOR.

Homologs of the mTOR kinase and RHEB can be found in lower eukaryotes. The genome of Schizosaccharomyces pombe contains two genes homologous to mTOR (tor1⁺ and tor2⁺) and a gene homologous to RHEB, rhb1⁺ (MACH et al. 2000). It also contains genes tsc1⁺ and tsc2⁺, each of which corresponds to mammalian TSC1 and TSC2, respectively (MATSUMOTO et al. 2002). Although the genome of Saccharomyces cerevisiae also encodes proteins homologous to mTOR (CAFFERKEY et al. 1994) and RHEB GTPase (URANO et al. 2000), it does not contain any obvious homologs to TSC1/2, suggesting that RHEB GTPase may be regulated by another mechanism.

In our previous study we showed that fission yeast strains lacking either tsc1⁺ or tsc2⁺ are viable in rich media, but exhibit several defects. First, deletion strains for tsc1⁺ (tsc1) and tsc2⁺ (tsc2) are defective in uptake of nutrients such as amino acids and adenine. Consistent with this defect, an amino acid permease, which is normally positioned on the plasma membrane, aggregates in the cytoplasm or is confined in vacuole-like structures in tsc1 and tsc2. Second, tsc1 and tsc2 are unable to induce the sxa2⁺ gene, which is usually expressed upon stimulation by a mating-type pheromone, P factor, in starved h^– cells (IMAI and YAMAMOTO 1994). On the basis of these phenotypes, we postulate that tsc1⁺ and tsc2⁺ are required for sensing/responding to starvation. We speculate that S. pombe Tsc1/2 regulates Tor1/2 via Rhb1 and plays a role in sensing/responding to starvation. In this study we continued to take advantage of this simple and tractable system and attempted to dissect genetic pathways to interact with Tsc1/2. Through a genetic screen of extragenic suppressors of tsc2, we identified a gene, cpp1⁺, encoding a subunit of the enzyme required for protein farnesylation.

Yeast strains, media, and transformation:

The S. pombe strains used in this study are listed in Table 1. The yeast cells were grown in YEA and EMM with appropriate nutrient supplements as described previously (MORENO et al. 1991). All yeast transformations were carried out by lithium acetate methods (OKAZAKI et al. 1990; GIETZ et al. 1992).

View this table: In this window In a new window   TABLE 1 Strains used in this study

 

Screen for an extragenic suppressor of tsc2:

The reversion rate of the AE512 strain used for the screening was 1.25 x 10^–6. The spontaneous revertants were grown at 26° for 4 days on EMM medium with leucine at 40 µg/ml. Sixty-five revertants obtained through the primary screen were tested for their temperature sensitivity in the secondary screen. The revertants were replicated on two YEA plates and incubated at 26° (for 3 days) or 36° (for 2 days), respectively. Among the revertants isolated through the primary screen, 11 strains exhibited a temperature sensitivity for growth at 36°. Finally, the 11 revertants were further tested for their ability to induce fnx1⁺ and mei2⁺ upon nitrogen starvation by Northern analysis. Two revertants satisfied the final criterion and were further examined genetically.

Cloning of cpp1⁺:

The cpp1-1 mutant (YKK25) was transformed with an S. pombe genomic library containing partially digested Sau3AI DNA fragment constructed in a multicopy plasmid, pAL-KS (TANAKA et al. 2000). Plasmids were recovered from Ts⁺ Leu⁺ transformants and their nucleotide sequences were determined. BLAST search was performed for the obtained sequences, and the region covered by the inserted genomic sequence was determined.

Plasmid construction:

Plasmid pREP41-cpp1 was constructed as follows. The cpp1⁺ gene was amplified by PCR using the forward primer F-cpp1 [5'-CCCCCCGTCGAC(SalI)GATGGATGAATTATCAGAAAC-3'] and the reverse primer R-cpp1 [5'-CCCCCCGGATCC(BamHI)TTAGAATTTTGATGATTCTTG-3']. The resulting fragment was digested with BamHI and SalI and then cloned into pREP41 (MAUNDRELL 1993). Plasmids pREP41-rhb1 and pREP81-rhb1 were constructed as follows. The rhb1⁺ gene was amplified by PCR using the forward primer F-rhb1 [5'- CCCCCCGTCGAC(SalI)CATGGCTCCTATTAAATCTC -3'] and the reverse primer R-rhb1 [5'-CCCCCCGGATCC(BamHI)TTAGGCGATAACACAACCCTTTCC-3']. The resulting fragment was digested with BamHI and SalI and then cloned into pREP41 and pREP81, respectively. pREP41-rhb1^CVIL was constructed similarly with the exception of the primer used for PCR that was the reverse primer R-rhb1^CVIL [5'-CCCCCCGGATCC(BamHI)TTACAAGATAACACAACCC-3'].

Generation of anti-Rhb1 antibody:

A His-tagged protein of Rhb1 produced in Escherichia coli was used to raise polyclonal antibodies. His-Rhb1 was obtained as follows: A 558-bp DNA fragment carrying the entire rhb1 coding region was amplified by PCR with two oligonucleotides, 5'-GGGGGGATCC(BamHI) GCTCCTATTAAATCTCGTAGAATTG-3' and 5' - CCCCGTCGAC(SalI)TTAGGCGATAACACAACCCTTTCC-3'. The amplified DNA was digested with BamHI and SalI and then inserted into the same sites of the His-tag expression vector pET-30-a to make pET(rhb1). The pET(rhb1) was transformed into E. coli Tuner. The fusion protein was purified from the MagneHis Protein Purification System (Promega, Madison, WI) and used to immunize rabbits.

Nucleotide sequence analysis of the cpp1-1 mutant allele:

The entire cpp1 ORF was amplified by PCR using genomic DNA prepared from tsc2 cpp1-1 cells (YKK25) as a template and then cloned into pREP41. The nucleotide sequences of three clones derived from each independent PCR amplification were determined entirely. Comparison of the nucleotide sequences of cpp1-1 with cpp1⁺ revealed a single-nucleotide change, from G to A, which resulted in the replacement of glycine 254 with asparatate.

Western blotting:

Total cell lysates were prepared as follows: Cells were lysed with glass beads in lysis buffer [150 mM NaCl and 10 mM Tris–HCl (pH 7.0)] containing 0.5% Triton X-100 and 0.5% deoxycholate. The following protease inhibitors were added to the cell extracts: 0.4 mM phenylmethylsulfonyl fluoride and 1x protease inhibitor cocktail (Nacalai Tesque). Equal amounts of total proteins were then loaded onto a 15% polyacrylamide gel and transferred to nitrocellulose membranes. Antibodies used were anti-Rhb1 and monoclonal TAT-1 for S. pombe tubulin (gift from K. Gull, University of Manchester, United Kingdom).

Northern blotting:

Total RNAs were prepared from S. pombe culture as described (JENSEN et al. 1983) and fractionated on a 0.8% gel containing 3.7% formaldehyde gel as previously reported (THOMAS et al. 1980). Probes for fnx1⁺, mei2⁺, and inv1⁺ were PCR amplified from a S. pombe genomic DNA library and labeled with [-³²P]dCTP using standard methods.

Spot test:

Cells were cultured in liquid YES or EMM medium at a concentration of 1 x 10⁷ cells/ml and each culture was diluted 10, 100, and 1000-fold. Five microliters of each suspension were spotted on appropriate media.

Subcellular fractionation:

Spheroplasts were prepared as follows. A total of 10¹⁰ cells were incubated at 37° for 1 hr in spheroplasts buffer [50 mM citrate–phosphate (pH 5.6) and 1.2 M sorbitol] containing 5 mg/ml lysing enzyme (Sigma, St. Louis). Spheroplasts were resuspended in a lysis buffer [20 mM Hepes-potassium hydroxide (pH 7.5), 20 mM potassium acetate, and 0.1 M sorbitol] containing 0.4 mM phenylmethylsulfonyl fluoride and 1x protease inhibitor cocktail (Nacalai Tesque) and downed 20 times with a glass tissue homogenizer. The crude lysate was centrifuged at 300 x g to remove unlysed spheroplasts. The 300 x g supernatant was centrifuged at 100,000 x g for 1 hr to separate pellet (P100) and supernatant (S100) fractions.

Microarray analysis:

Details of DNA-microarray construction, RNA isolation from fission yeast cells, sample labeling, microarray hybridization, and data processing will be described elsewhere (Y. CHICASHIGE and Y. HIRAOKA, unpublished data). Cells of tsc1 and tsc2 mutants were grown under the reference condition (YES liquid medium) to early-log phase and divided into two parts, one shifted to the experimental condition (3-hr incubation in EMM depleted of nitrogen sources), referred to as mutant/experimental (Mex), and the remainder kept under the reference condition for 3 hr (mutant/reference, Mrf). Poly(A)⁺ RNA was extracted from Mex cells and cDNA probes were prepared, labeled with Cy5, and hybridized to a fission yeast cDNA microarray covering >4900 genes together with Cy3-labeled cDNA probes prepared from Mrf cells. To exclude false positives generated by the experimental condition, we performed the same analysis with a wild-type strain, designating the samples as wild type/experimental (Wex) and wild type/reference (Wrf). After measurement of fluorescent intensity for Cy5 and Cy3, the measured fluorescent intensity, I, was corrected as follows to give a corrected intensity, C,

where M and s are an average and a standard deviation of I of negative control spots for each wave length, respectively. When I = M + 2s, that is, C = 2s, it was set to be a detection limit. When C for either Cy3 or Cy5 or both was >2s, the values were considered to be effective data. Expression ratio r' of each effective detection spot obtained thus was scaled as follows: r' = r – m, r = log₂R, R = (C_cy5/C_cy3), and m is an average of r of all effective detection spots.

We identified transcripts that were not induced in each of the two mutants, tsc1 and tsc2, with the following criteria: r' of the wild-type strain was >2 whereas that of each mutant was <2. Transcripts that were more induced in each of the two mutants were identified with the following criteria: r' of the mutant strain was >2 whereas that of the wild-type strain was <2. The original data of microarray experiments have been submitted to Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/index.cgi) and are accessible with accession no. GSE4449.

Gene expression in tsc1 and tsc2:

We previously showed that the sxa2⁺ gene is not induced in tsc1 (MATSUMOTO et al. 2002). Another study (VAN SLEGTENHORST et al. 2004) also indicated that expression of a number of genes in exponentially growing tsc1 and tsc2 cells is abnormal. Having shown that S. pombe Tsc1/2 is required for sensing/responding to starvation, we thought that analysis of gene induction/repression upon starvation might provide more insightful information. It was previously demonstrated that expression of fnx1⁺ is induced upon nitrogen starvation (DIMITROV and SAZER 1998). As shown in Figure 1, Northern blot analysis indicated that the level of the induction of fnx1⁺ was indeed much lower in tsc1 and tsc2. To obtain genomewide information, we analyzed the expression profile of tsc1 and tsc2 by DNA microarrays. RNAs were prepared from tsc1 and tsc2 cells grown in nitrogen-rich YE medium as well as the cells grown for 3 hr in EMM medium lacking nitrogen. These RNAs were labeled with Cy3 or Cy5 and used as probes for hybridization to DNA microarrays. For the control experiment, we also prepared RNAs from the wild-type strain and used them as probes. Our quantitative analysis indicated that 131 genes are induced upon nitrogen depletion in the wild-type strain, of which 31 genes are not induced in tsc1 and tsc2 (Table 2). We also found that 32 genes are induced in tsc1 and tsc2, but not in the wild-type strain (Table 3). By performing Northern blots, we confirmed some of the results obtained by the DNA microarray analysis. As shown in Figure 1, mei2⁺, which was normally induced upon nitrogen starvation, was not induced in tsc1 and tsc2. Furthermore, inv1⁺, which was not expressed at a detectable level in the wild-type strain, was induced in tsc1 and tsc2 cells.

View larger version (97K): In this window In a new window Download PPT slide   FIGURE 1.— Gene expression upon nitrogen starvation. Wild-type cells (SP6), tsc1 cells (AE413), tsc2 cells (AE512), and tsc2 cpp1-1 cells (YKK25) transformed with pAL-KS vector were precultured overnight in EMM plus N and then transferred to EMM minus N. Total RNAs were analyzed by Northern blot hybridization with fnx1+ (A), mei2+ (B), and inv1+ (C) as probes.

 

View this table: In this window In a new window   TABLE 2 Genes not induced in tsc1 and tsc2

 

View this table: In this window In a new window   TABLE 3 Genes induced more in tsc1 and tsc2 3 hr after nitrogen starvation

 

Screen for an extragenic suppressor of tsc2:

To dissect a genetic pathway involving tsc1⁺/2⁺, we attempted to isolate extragenic suppressors of tsc2. Assuming that Tsc2 serves as a GAP for Rhb1 GTPase and negatively regulates the Rhb1 function, we were particularly interested in a mechanism to positively regulate the GTPase. If Rhb1 is constitutively active in the tsc2 cells, a loss of function of a gene encoding a positive regulator for Rhb1 would suppress the phenotypes caused by tsc2.

As we previously showed (MATSUMOTO et al. 2002), tsc2 leu1-32 strains are defective in uptake of amino acids and cannot grow on EMM containing leucine at 40 µg/ml. In the primary screen for the extragenic suppressors of tsc2, we isolated spontaneous revertants, which could grow at 26° on the EMM with leucine at 40 µg/ml. Sixty-five revertants obtained through the primary screen were tested for their temperature sensitivity at 36° in the secondary screen. Because rhb1⁺ is an essential gene for growth (MACH et al. 2000), we postulated that if a revertant carried a mutation on a positive regulator for Rhb1, it might be lethal under a more severe condition. Among the 65 revertants isolated through the primary screen, 11 strains exhibited a temperature sensitivity for growth at 36°. Finally, the revertants, which appeared to be temperature sensitive in the secondary screen, were further tested for their ability to induce fnx1⁺ and mei2⁺ upon nitrogen starvation. Two revertants satisfied the final criterion and were further examined genetically.

Gene cloning of extragenic suppressor:

Genetic analysis indicated that the two revertants carried a single mutation at the same locus responsible for the suppression of tsc2. Furthermore, the suppression activity was found to link to the temperature sensitivity. We attempted to clone the corresponding gene by complementation of the temperature sensitivity and identified six genes. Integration mapping and sequence analysis of the genome of the suppressors indicated that cpp1⁺ is the gene responsible for the suppression. cpp1⁺ encodes a ß-subunit of a farnesyltransferase (FTase), which farnesylates proteins. The two suppressors of tsc2 carry a mutation at the identical amino acid position Glycine-254 (Figure 2B). We refer to this allele as cpp1-1 hereafter. Genes encoding the ß-subunit of FTase have been identified from yeast to humans. According to a study of the human FTase (PARK et al. 1997), the mutation site of cpp1-1 corresponds to the catalytic center that traps the zinc ion.

View larger version (39K): In this window In a new window Download PPT slide   FIGURE 2.— cpp1-1 is an extragenic suppressor of tsc2. (A) Genetic interaction among cpp1-1, tsc1, and tsc2. Each strain was spotted on the indicated media and grown for 2 days (YEA, 36°) or 3 days (other conditions). (B) Comparison of the amino acid sequences of Cpp1 and other members of ß-subunit of FTases. The cpp1-1 mutant allele carries a single-nucleotide change (from G to A) that results in the replacement of Gly-254 with Asp. Identical amino acids among four species are shown in white against black and the amino acids conserved among three species are shaded. Sp, Schizosaccharomyces pombe; Sc, Saccharomyces cerevisiae; Hs, Homo sapiens; Dm, Drosophila melanogaster. (C) The multicopy suppressors of tsc2 cpp1-1 cells. tsc2 cpp1-1 cells carrying each of the five multicopy suppressors were grown in liquid EMM (1 x 107 cells/ml) and spotted on EMM or EMM with canavanine (60 µg/ml). They were incubated for 2 days (EMM, 36°) or 3 days (EMM or EMM containing canavanine, 26°).

 
The other five genes appeared to be a multicopy suppressor of cpp1-1. Overexpression of the cwp1⁺ (ARELLANO et al. 1998) gene encoding an -subunit of the FTase suppressed the temperature sensitivity of cpp1-1 comparatively to that by cpp1⁺. The remaining four genes, SPBC36.06c encoding a farnesyl pyrophosphate synthetase, zfs1⁺ (KANOH et al. 1995), ykt6⁺ (MCNEW et al. 1997), and ste11⁺ (SUGIMOTO et al. 1991), suppressed the temperature sensitivity of cpp1-1 to a lesser extent (Figure 2C and Table 4).

View this table: In this window In a new window   TABLE 4 Multicopy suppressors of tsc2 cpp1-1 cells

 

Genetic interaction of cpp1-1:

The cpp1-1 allele was originally isolated through a screen for an extragenic suppressor of tsc2. The two phenotypes associated with tsc2 (i.e., defects in uptake of leucine and gene induction upon nitrogen starvation) were suppressed by this allele. First, fnx1⁺ and mei2⁺ could be induced upon nitrogen starvation in tsc2 cpp1-1 (Figure 1). Second, tsc2 cpp1-1 double mutants could grow on the EMM containing leucine at 40 µg/ml (Figure 2A). Interestingly, the cpp1-1 mutation could not suppress the abnormal induction of inv1⁺ (Figure 1).

Owing to the defect in uptake, tsc2 cells are resistant to canavanine, a toxic analog of arginine (Figure 2A). The cpp1-1 mutation abolished the resistance to canavanine in the background of tsc2 (Figure 2A). When the cpp1⁺ gene was introduced into a tsc2 cpp1-1 strain, the strain became resistant to canavanine (Figure 2C). Introduction of each of the five multicopy suppressors into a tsc2 cpp1-1 strain also conferred a resistance to canavanine (Figure 2C).

As it has been postulated that Tsc1 and Tsc2 function together in the same pathway, we were tempted to test if cpp1-1 could also suppress tsc1. We found that tsc1 cpp1-1 double mutants could grow on the EMM containing leucine at 40 µg/ml (Figure 2A), indicating that cpp1-1 can suppress the defect in uptake of tsc1.

The Cpp1-dependent FTase likely farnesylates a number of proteins (SEBTI 2005). Although suppression of tsc2 by cpp1-1 suggested that a failure in farnesylation of a protein contributed to the suppression, it was not clear which protein was involved in this process. A likely protein was Rhb1 GTPase, which is believed to be a target of Tsc1/2. Its amino acid sequence ends with the consensus sequence of the FTase substrates, Cys–Val–Ile–Ala (STRICKLAND et al. 1998). The previous study (STRICKLAND et al. 1998) showed that the requirement of the Cpp1-dependent FTase could be bypassed by alteration of the amino acid sequence of the C terminus to Cys–Val–Ile–Leu, which is recognized by geranylgeranyl transferase, another enzyme to isoprenylate proteins. It was shown previously that proteins, which are normally farnesylated, can remain functional if modified by a geranylgeranyl group (YANG et al. 2001). We expressed a mutant of Rhb1-CVIL in a tsc2 cpp1-1 double mutant, which was sensitive to canavanine, and found that expression of Rhb1-CVIL could confer a resistance to canavanine (Figure 3). The result would suggest that Rhb1 is, at least in part, a protein involved in the suppression of tsc2 by cpp1-1. Expression of the mutant Rhb1 did not rescue the temperature sensitivity of the tsc2 cpp1-1 double mutant, indicating that a failure in farnesylation of another protein caused the temperature sensitivity.

View larger version (33K): In this window In a new window Download PPT slide   FIGURE 3.— Expression of SpRheb (rhb1CVIL). tsc2 cpp1-1 cells were transformed with vector, plasmids expressing rhb1+ wild type, rhb1CVIL mutant, or cpp1+ wild type. Transformants were suspended in liquid EMM at a concentration of 1 x 107 cells/ml and 5 µl of the suspension was spotted on solid EMM or solid EMM containing canavanine (60 µg/ml). They were incubated for 2 days (EMM, 36°) or 3 days (EMM or EMM containing canavanine, 26°).

 

Rhb1 in the cpp1-1 mutant:

Having demonstrated that Rhb1 was involved in the suppression of tsc2, we were prompted to investigate Rhb1 protein biochemically. An antibody to Rhb1 was raised in rabbit and we tested its specificity. As shown in Figure 4, a band corresponding to a 20.5-kDa protein on SDS–PAGE was recognized by the antibody. Because the intensity of this band increased upon overexpression of Rhb1 (Figure 4A), we concluded that the 20.5-kDa protein was Rhb1. To further examine the specificity of the antibody, the antibody was first incubated with an excess amount of recombinant Rhb1 proteins immobilized on beads and the unbound fraction was used for Western blot. The incubation with the Rhb1 beads clearly abolished the 20.5-kDa band, whereas after incubation with beads alone, the antibody could still recognize the 20.5-kDa band (Figure 4B). These results indicated that the antibody specifically recognized the Rhb1 protein in fission yeast cell extracts.

View larger version (32K): In this window In a new window Download PPT slide   FIGURE 4.— Antibody to Rhb1. (A) Wild-type cells (SP6) carrying pREP81-rhb1 were grown to midlog phase in EMM containing thiamine (50 µg/ml) and then transferred to thiamine-free EMM for 17 hr at 30°. Protein extracts were subjected to immunoblot analysis with antibody to Rhb1 as well as with anti--tubulin antibody (TAT-1) as a loading control. (B) The antibody was first incubated with an excess amount of recombinant Rhb1 proteins immobilized on beads and the unbound fraction was used for Western blot (lane 1). The antibody was incubated with beads alone and the unbound fraction was used for Western blot (lane 2).

 
It was likely that the cpp1-1 mutation causes a defect in the FTase activity and that Rhb1 in the cpp1-1 background may not be properly modified by a farnesyl group. To test this, we prepared cell extracts from the cpp1-1 mutant and examined the mobility of Rhb1 on SDS–PAGE. It was shown previously that Rhb1 GTPase in fission yeast (YANG et al. 2000) migrates faster on SDS–PAGE if properly modified. As shown in Figure 5A, Rhb1 was detected as a doublet in cell extracts prepared from the cpp1-1 mutant grown at 26°. Six hours after the shift to the restrictive temperature of 36°, the faster-migrating form of Rhb1 decreased. In cell extracts prepared from the wild-type strain, only the faster-migrating form was detected. These results indicated that the cpp1-1 mutant was indeed defective in protein farnesylation and that the Rhb1 protein was not modified by a farnesyl group.

View larger version (52K): In this window In a new window Download PPT slide   FIGURE 5.— Modification of Rhb1 in cpp1-1. (A) Wild-type cells (SP740) and cpp1-1 cells (YKK55) were grown to midlog phase in YEL medium at 26° and then shifted to 36°. Cell extracts were analyzed with SDS–PAGE and immunoblotted with the anti-Rhb1 and with TAT-1 antibody. (B) Subcellular fractionation of Rhb1. Wild-type cells (SP6) and tsc2 cpp1-1 cells (YKK25) were grown at 36° for 6 hr. Cells were converted to spheroplasts, homogenized, and subjected to differential centrifugation to fractionate into P100 (membrane fraction) and S100 (supernatant). Each fraction was resolved by SDS–PAGE and subjected to immunoblot analysis using either the anti-Rhb1 or the anti-Spo14 antibody, respectively.

 
Farnesylation of the C termini of GTPases is thought to be important for membrane association (CASEY et al. 1989). We fractionated cell extracts into a membrane fraction and a cytosolic fraction, and examined which fraction contained Rhb1 GTPase. Spo14, a membrane-bound protein (NAKAMURA-KUBO et al. 2003), was used as a probe for the membrane fraction. While a majority of Rhb1 was found in the cytosolic fraction, a small amount of Rhb1 was found in the membrane fraction prepared from the wild-type strain. On the other hand, Rhb1 was not detectable in the membrane fraction prepared from the cpp1-1 mutant grown at 36° for 6 hr (Figure 5B). These results suggested that only a fraction of Rhb1 is farnesylated and thereby functional in the cpp1-1 mutant even at the permissive temperature, 26°. We speculate that although the majority of Rhb1 would be a GTP-bound form in tsc2 cells, a failure in farnesylation results in a partial loss of the Rhb1 function, which contributes to the suppression of tsc2.

In this study we first analyzed the gene expression profile in tsc1 and tsc2. Second, we demonstrated that a mutation in a gene encoding the ß-subunit of FTase can suppress most of the phenotypes associated with a loss of function of Tsc1/Tsc2.

Expression profile of tsc1 and tsc2:

The expression profiles of the tsc1 and tsc2 strains examined by the microarrays were very similar each other. We did not find any genes abnormally induced in either one of the two strains. The two genes, tsc1⁺ and tsc2⁺, thereby function together in the same pathway to regulate gene expression upon nitrogen starvation. The genes that cannot be induced in tsc1 and tsc2 are broadly classified in the following groups: genes required for meiosis, genes encoding permeases/transporter for nutrients, and genes encoding enzymes for biosynthesis. The defect in induction of these genes accounts well for the phenotypes of tsc1 and tsc2 (i.e., inefficient meiosis and low uptake).

We also found that 32 genes were induced at higher levels in tsc1 and tsc2 3 hr after nitrogen starvation. It should be noted that some of these genes may possibly be induced in the wild-type strains at earlier time points and already repressed 3 hr after nitrogen starvation. If their induction is delayed in tsc1 and tsc2 and reaches a peak later, the induction level in tsc1 and tsc2 may be higher than that in the wild-type strain 3 hr after nitrogen starvation. It is, therefore, necessary to examine the induction level of each gene in more detail to identify a gene, which is induced specifically in tsc1 and tsc2. Among the 32 genes that are induced >3 hr after nitrogen starvation in tsc1 and tsc2, we examined inv1⁺ in detail and demonstrated that it is induced poorly up to 6 hr after nitrogen starvation in the wild-type strain. inv1⁺ is thereby induced specifically in tsc1 and tsc2. It is normally derepressed upon glucose starvation in fission yeast (TANAKA et al. 1998). At present, it is not clear why inv1⁺ is induced in tsc1 and tsc2 even in the presence of glucose. A factor required for repression of inv1⁺ may not be expressed in tsc1 and tsc2 when nitrogen is depleted.

Activation of Rhb1 by FTase:

Our genetic study demonstrated that a mutation (cpp1-1) in the ß-subunit of FTase can suppress a loss of function of Tsc1/Tsc2. When a mutant of Rhb1 that bypasses the requirement of farnesylation was expressed, the cpp1-1 mutation no longer suppressed tsc1 and tsc2. The result indicated that a failure in farnesylation of Rhb1 contributes to the suppression. Only a small fraction of Rhb1 GTPase was found as a modified form in the cpp1-1 mutant. It has been generally accepted that protein farnesylation at the C terminus of GTPases facilitates membrane association. Consistent with this notion, while a portion of Rhb1 in the wild-type strain was found in the P100 membrane fraction, no Rhb1, in the cpp1-1 mutant, was found in this fraction. We speculate that activation of Rhb1 requires both GTP binding and farnesylation. The suppression of tsc1 and tsc2 by cpp1-1 is a result of a decrease in the level of active Rhb1.

Role of the Tsc1/2 complex:

Considering that the known biochemical function of the Tsc1/2 complex has so far been to serve as a GAP for the Rhb1 GTPase, it is likely that the defect in gene induction in tsc1 and tsc2 is due to constitutive activation of Rhb1. An active form of Rhb1, in turn, would continuously repress the gene induction even when nitrogen is removed. Supporting this notion, expression of a hyperactive mutant of Rhb1 (URANO et al. 2005) resulted in a failure in induction of mei2⁺ and fnx1⁺ (K. FUKUDA and T. MATSUMOTO, unpublished results). It has also been reported that the two genes, mei2⁺ and fnx1⁺, are induced upon repression of a hypomorphic allele of rhb1⁺ in the presence of nitrogen, demonstrating that expression of these genes is solely regulated by Rhb1 (MACH et al. 2000). In budding yeast, a number of studies demonstrated that Tor, a downstream target of Rhb1, is involved in transcriptional regulation (BECK and HALL 1999; DUVEL et al. 2003; ROHDE and CARDENAS 2003). We speculate that fission yeast Tor1 and Tor2 as targets of Rhb1 play a role in a signal cascade to regulate transcription/translation in response to the availability of nutrients. In this cascade the Tsc1/2 complex regulates Tor1/2 via Rhb1 GTPase.

While the cpp1-1 mutant clearly restored the ability of tsc2 to induce mei2⁺ and fnx1⁺ upon nitrogen starvation, it failed to repress abnormal induction of inv1⁺ in tsc1 and tsc2. Assuming that the cpp1-1 mutation can suppress defects in Rhb1-dependent events, it is possible that the abnormal induction of inv1⁺ in tsc1 and tsc2 may not be a result of constitutive activation of Rhb1. In addition to GAP for Rhb1 GTPase, the Tsc1/2 complex may play another role.

TSC pathology and treatment:

TSC is a disorder characterized by the wide spread of benign tumors, called hamartomas. The tumor cells exhibit abnormalities in cell size, number, morphology, and location, thereby implying a role of the Tsc1/2 complex in regulating cell growth, proliferation, differentiation, and migration (YEUNG 2003). Because the Tsc1/2 complex regulates protein synthesis via Rheb and mTOR (MANNING and CANTLEY 2003; LI et al. 2004a,b; PAN et al. 2004), it is currently considered that formation of hamartomas is due to deregulation of protein synthesis.

Our analysis of the expression profile revealed that the tsc1 and tsc2 strains exhibit an abnormality in induction of a number of genes upon nitrogen starvation. They cannot efficiently induce genes required for meiosis, a process of differentiation in fission yeast. We also found that in the tsc1 and tsc2 strains 3 hr after nitrogen starvation, retrotransposons (LTR Tf2) and a G1 cyclin (pas1⁺) are expressed at a level higher than that in the wild-type strain. It has been previously reported that pas1⁺ is expressed at a higher level in exponentially growing tsc1 and tsc2 strains as well (VAN SLEGTENHORST et al. 2005). Although the consequence of abnormal induction of these genes remains to be examined, deregulation of these genes could result in alteration of the genome structure as well as a program of cell proliferation. Expression analysis of the hamartoma cells may allow identification of genes whose abnormal expression accounts for the complex pathology of TSC.

As Rapamycin targets mTOR, it is a good candidate for an anti-TSC drug. On the other hand, it also has immunosuppressive effects (ABRAHAM and WIEDERRECHT 1996), suggesting that it is not an ideal drug for a long term-administration. Our model study in fission yeast demonstrated that a defect in FTase well suppresses the phenotypes associated with deletion of tsc1/2⁺. We thereby postulate that an inhibitor of FTase (FTI) should be considered as an anti-TSC drug as well. A combination of Rapamycin and FTI may enhance the specificity of the chemotherapy for TSC. FTIs were originally proposed as anticancer agents because Ras-oncoproteins must be farnesylated for its transforming activity. A number of compounds, some of which competitively inhibit FTase with their structure mimicking the C-terminal C-A-A-X motif of the GTPase, have been developed and tested clinically (OMER and KOHL 1997; GRAAF et al. 2004).

The authors are grateful to C. Shimoda and T. Nakamura (Osaka City University, Japan) for providing the antibody to Spo14 and to K. Gull (University of Manchester, United Kingdom) for providing the anti--tubulin antibody, TAT-1. The S. pombe genomic library was supplied by National BioResource Project (http://www.nbrp.jp/). This work was supported by the U.S. Army Medical Research and Material Command "Tuberous Sclerosis Complex Research Program" (to T.M.) and the Japan Science and Technology Agency (to Y.H.).

ABRAHAM, R. T., and G. J. WIEDERRECHT, 1996 Immunopharmacology of rapamycin. Annu. Rev. Immunol. 14: 483–510.[CrossRef][Medline]

ARELLANO, M., P. M. COLL, W. YANG, A. DURAN, F. TAMANOI et al., 1998 Characterization of the geranylgeranyl transferase type I from Schizosaccharomyces pombe. Mol. Microbiol. 29: 1357–1367.[CrossRef][Medline]

BECK, T., and M. N. HALL, 1999 The TOR signalling pathway controls nuclear localization of nutrient-regulated transcription factors. Nature 402: 689–692.[CrossRef][Medline]

CAFFERKEY, R., M. M. MCLAUGHLIN, P. R. YOUNG, R. K. JOHNSON and G. P. LIVI, 1994 Yeast TOR (DRR) proteins: amino-acid sequence alignment and identification of structural motifs. Gene 141: 133–136.[CrossRef][Medline]

CARBONARA, C., L. LONGA, E. GROSSO, C. BORRONE, M. G. GARRE et al., 1994 9q34 loss of heterozygosity in a tuberous sclerosis astrocytoma suggests a growth suppressor-like activity also for the TSC1 gene. Hum. Mol. Genet. 3: 1829–1832.[Abstract/Free Full Text]

CASEY, P. J., P. A. SOLSKI, C. J. DER and J. E. BUSS, 1989 p21ras is modified by a farnesyl isoprenoid. Proc. Natl. Acad. Sci. USA 86: 8323–8327.[Abstract/Free Full Text]

DIMITROV, K., and S. SAZER, 1998 The role of fnx1, a fission yeast multidrug resistance protein, in the transition of cells to a quiescent G0 state. Mol. Cell. Biol. 18: 5239–5246.[Abstract/Free Full Text]

DUVEL, K., A. SANTHANAM, S. GARRETT, L. SCHNEPER and J. R. BROACH, 2003 Multiple roles of Tap42 in mediating rapamycin-induced transcriptional changes in yeast. Mol. Cell 11: 1467–1478.[CrossRef][Medline]

EUROPEAN CHROMOSOME 16 TUBEROUS SCLEROSIS CONSORTIUM, 1993 Identification and characterization of the tuberous sclerosis gene on chromosome 16. Cell 75: 1305–1315.[Medline]

GIETZ, D., A. ST. JEAN, R. A. WOODS and R. H. SCHIESTL, 1992 Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Res. 20: 1425.[Free Full Text]

GOMEZ, M. R., 1995 History of the tuberous sclerosis complex. Brain Dev. 17(Suppl.): 55–57.

GOMEZ, M. R., J. R. SAMPSON and V. H. WHITTEMORE, 1999 Tuberous Sclerosis Complex, Ed. 3. Oxford University Press, London.

GRAAF, M. R., D. J. RICHEL, C. J. VAN NOORDEN and H. J. GUCHELAAR, 2004 Effects of statins and farnesyltransferase inhibitors on the development and progression of cancer. Cancer Treat. Rev. 30: 609–641.[CrossRef][Medline]

GREEN, A. J., P. H. JOHNSON and J. R. YATES, 1994a The tuberous sclerosis gene on chromosome 9q34 acts as a growth suppressor. Hum. Mol. Genet. 3: 1833–1834.[Abstract/Free Full Text]

GREEN, A. J., M. SMITH and J. R. YATES, 1994b Loss of heterozygosity on chromosome 16p13.3 in hamartomas from tuberous sclerosis patients. Nat. Genet. 6: 193–196.[CrossRef][Medline]

HENGSTSCHLAGER, M., D. M. RODMAN, A. MILOLOZA, E. HENGSTSCHLAGER-OTTNAD, M. ROSNER et al., 2001 Tuberous sclerosis gene products in proliferation control. Mutat. Res. 488: 233–239.[CrossRef][Medline]

HENSKE, E. P., B. W. SCHEITHAUER, M. P. SHORT, R. WOLLMANN, J. NAHMIAS et al., 1996 Allelic loss is frequent in tuberous sclerosis kidney lesions but rare in brain lesions. Am. J. Hum. Genet. 59: 400–406.[Medline]

IMAI, Y., and M. YAMAMOTO, 1994 The fission yeast mating pheromone P-factor: its molecular structure, gene structure, and ability to induce gene expression and G1 arrest in the mating partner. Genes Dev. 8: 328–338.[Abstract/Free Full Text]

ITO, N., and G. M. RUBIN, 1999 gigas, a Drosophila homolog of tuberous sclerosis gene product-2, regulates the cell cycle. Cell 96: 529–539.[CrossRef][Medline]

JENSEN, R., G. F. SPRAGUE, JR. and I. HERSKOWITZ, 1983 Regulation of yeast mating-type interconversion: feedback control of HO gene expression by the mating-type locus. Proc. Natl. Acad. Sci. USA 80: 3035–3039.[Abstract/Free Full Text]

KANOH, J., A. SUGIMOTO and M. YAMAMOTO, 1995 Schizosaccharomyces pombe zfs1⁺ encoding a zinc-finger protein functions in the mating pheromone recognition pathway. Mol. Biol. Cell 6: 1185–1195.[Abstract]

KWIATKOWSKI, D. J., and M. P. SHORT, 1994 Tuberous sclerosis. Arch. Dermatol. 130: 348–354.[Abstract]

KWIATKOWSKI, D. J., H. ZHANG, J. L. BANDURA, K. M. HEIBERGER, M. GLOGAUER et al., 2002 A mouse model of TSC1 reveals sex-dependent lethality from liver hemangiomas, and up-regulation of p70S6 kinase activity in Tsc1 null cells. Hum. Mol. Genet. 11: 525–534.[Abstract/Free Full Text]

LI, Y., K. INOKI and K. L. GUAN, 2004a Biochemical and functional characterizations of small GTPase Rheb and TSC2 GAP activity. Mol. Cell. Biol. 24: 7965–7975.[Abstract/Free Full Text]

LI, Y., M. N. CORRADETTI, K. INOKI and K. L. GUAN, 2004b TSC2: filling the GAP in the mTOR signaling pathway. Trends Biochem. Sci. 29: 32–38.[CrossRef][Medline]

LONG, X., Y. LIN, S. ORTIZ-VEGA, K. YONEZAWA and J. AVRUCH, 2005 Rheb binds and regulates the mTOR kinase. Curr. Biol. 15: 702–713.[CrossRef][Medline]

MACH, K. E., K. A. FURGE and C. F. ALBRIGHT, 2000 Loss of Rhb1, a Rheb-related GTPase in fission yeast, causes growth arrest with a terminal phenotype similar to that caused by nitrogen starvation. Genetics 155: 611–622.[Abstract/Free Full Text]

MANNING, B. D., and L. C. CANTLEY, 2003 Rheb fills a GAP between TSC and TOR. Trends Biochem. Sci. 28: 573–576.[CrossRef][Medline]

MATSUMOTO, S., A. BANDYOPADHYAY, D. J. KWIATKOWSKI, U. MAITRA and T. MATSUMOTO, 2002 Role of the Tsc1–Tsc2 complex in signaling and transport across the cell membrane in the fission yeast Schizosaccharomyces pombe. Genetics 161: 1053–1063.[Abstract/Free Full Text]

MAUNDRELL, K., 1993 Thiamine-repressible expression vectors pREP and pRIP for fission yeast. Gene 123: 127–130.[CrossRef][Medline]

MCNEW, J. A., M. SOGAARD, N. M. LAMPEN, S. MACHIDA, R. R. YE et al., 1997 Ykt6p, a prenylated SNARE essential for endoplasmic reticulum-Golgi transport. J. Biol. Chem. 272: 17776–17783.[Abstract/Free Full Text]

MORENO, S., A. KLAR and P. NURSE, 1991 Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194: 795–823.[Medline]

NAKAMURA-KUBO, M., T. NAKAMURA, A. HIRATA and C. SHIMODA, 2003 The fission yeast spo14⁺ gene encoding a functional homologue of budding yeast Sec12 is required for the development of forespore membranes. Mol. Biol. Cell 14: 1109–1124.[Abstract/Free Full Text]

OKAZAKI, K., N. OKAZAKI, K. KUME, S. JINNO, K. TANAKA et al., 1990 High-frequency transformation method and library transducing vectors for cloning mammalian cDNAs by trans-complementation of Schizosaccharomyces pombe. Nucleic Acids Res. 18: 6485–6489.[Abstract/Free Full Text]

OMER, C. A., and N. E. KOHL, 1997 CA1A2X-competitive inhibitors of farnesyltransferase as anti-cancer agents. Trends Pharmacol. Sci. 18: 437–444.[Medline]

PAN, D., J. DONG, Y. ZHANG and X. GAO, 2004 Tuberous sclerosis complex: from Drosophila to human disease. Trends Cell Biol. 14: 78–85.[CrossRef][Medline]

PARK, H. W., S. R. BODULURI, J. F. MOOMAW, P. J. CASEY and L. S. BEESE, 1997 Crystal structure of protein farnesyltransferase at 2.25 angstrom resolution. Science 275: 1800–1804.[Abstract/Free Full Text]

ROHDE, J. R., and M. E. CARDENAS, 2003 The tor pathway regulates gene expression by linking nutrient sensing to histone acetylation. Mol. Cell. Biol. 23: 629–635.[Abstract/Free Full Text]

SEBTI, S. M., 2005 Protein farnesylation: implications for normal physiology, malignant transformation, and cancer therapy. Cancer Cell 7: 297–300.[CrossRef][Medline]

STRICKLAND, C. L., W. T. WINDSOR, R. SYTO, L. WANG, R. BOND et al., 1998 Crystal structure of farnesyl protein transferase complexed with a CaaX peptide and farnesyl diphosphate analogue. Biochemistry 37: 16601–16611.[CrossRef][Medline]

SUGIMOTO, A., Y. IINO, T. MAEDA, Y. WATANABE and M. YAMAMOTO, 1991 Schizosaccharomyces pombe ste11⁺ encodes a transcription factor with an HMG motif that is a critical regulator of sexual development. Genes Dev. 5: 1990–1999.[Abstract/Free Full Text]

TANAKA, N., N. OHUCHI, Y. MUKAI, Y. OSAKA, Y. OHTANI et al., 1998 Isolation and characterization of an invertase and its repressor genes from Schizosaccharomyces pombe. Biochem. Biophys. Res. Commun. 245: 246–253.[CrossRef][Medline]

TANAKA, K., T. YONEKAWA, Y. KAWASAKI, M. KAI, K. FURUYA et al., 2000 Fission yeast Eso1p is required for establishing sister chromatid cohesion during S phase. Mol. Cell. Biol. 20: 3459–3469.[Abstract/Free Full Text]

THOMAS, P. A., K. S. BHAT and K. M. KOTIAN, 1980 Antibacterial properties of dilute formocresol and eugenol and propylene glycol. Oral Surg. Oral Med. Oral Pathol. 49: 166–170.[Medline]

URANO, J., A. P. TABANCAY, W. YANG and F. TAMANOI, 2000 The Saccharomyces cerevisiae Rheb G-protein is involved in regulating canavanine resistance and arginine uptake. J. Biol. Chem. 275: 11198–11206.[Abstract/Free Full Text]

URANO, J., M. J. COMISO, L. GUO, P. J. ASPURIA, R. DENISKIN et al., 2005 Identification of novel single amino acid changes that result in hyperactivation of the unique GTPase, Rheb, in fission yeast. Mol. Microbiol. 58: 1074–1086.[CrossRef][Medline]

VAN SLEGTENHORST, M., R. DE HOOGT, C. HERMANS, M. NELLIST, B. JANSSEN et al., 1997 Identification of the tuberous sclerosis gene TSC1 on chromosome 9q34. Science 277: 805–808.[Abstract/Free Full Text]

VAN SLEGTENHORST, M., E. CARR, R. STOYANOVA, W. D. KRUGER and E. P. HENSKE, 2004 tsc1⁺ and tsc2⁺ regulate arginine uptake and metabolism in Schizosaccharomyces pombe. J. Biol. Chem. 279: 12706–12713.[Abstract/Free Full Text]

VAN SLEGTENHORST, M., A. MUSTAFA and E. P. HENSKE, 2005 Pas1, a G1 cyclin, regulates amino acid uptake and rescues a delay in G1 arrest in Tsc1 and Tsc2 mutants in Schizosaccharomyces pombe. Hum. Mol. Genet. 14: 2851–2858.[Abstract/Free Full Text]

YANG, W., J. URANO and F. TAMANOI, 2000 Protein farnesylation is critical for maintaining normal cell morphology and canavanine resistance in Schizosaccharomyces pombe. J. Biol. Chem. 275: 429–438.[Abstract/Free Full Text]

YANG, W., A. P. TABANCAY, JR., J. URANO and F. TAMANOI, 2001 Failure to farnesylate Rheb protein contributes to the enrichment of G0/G1 phase cells in the Schizosaccharomyces pombe farnesyltransferase mutant. Mol. Microbiol. 41: 1339–1347.[CrossRef][Medline]

YEUNG, R. S., 2003 Multiple roles of the tuberous sclerosis complex genes. Genes Chromosomes Cancer 38: 368–375.[Medline]

ZHANG, Y., X. GAO, L. J. SAUCEDO, B. RU, B. A. EDGAR et al., 2003 Rheb is a direct target of the tuberous sclerosis tumour suppressor proteins. Nat. Cell Biol. 5: 578–581.[CrossRef][Medline]

Communicating editor: P. RUSSELL

This article has been cited by other articles:

				Y. Ye, M. Fujii, A. Hirata, M. Kawamukai, C. Shimoda, and T. Nakamura Geranylgeranyl Diphosphate Synthase in Fission Yeast Is a Heteromer of Farnesyl Diphosphate Synthase (FPS), Fps1, and an FPS-like Protein, Spo9, Essential for Sporulation Mol. Biol. Cell, September 1, 2007; 18(9): 3568 - 3581. [Abstract] [Full Text] [PDF]

				T. Matsuo, Y. Otsubo, J. Urano, F. Tamanoi, and M. Yamamoto Loss of the TOR Kinase Tor2 Mimics Nitrogen Starvation and Activates the Sexual Development Pathway in Fission Yeast Mol. Cell. Biol., April 15, 2007; 27(8): 3154 - 3164. [Abstract] [Full Text] [PDF]

				R. Weisman, I. Roitburg, M. Schonbrun, R. Harari, and M. Kupiec Opposite Effects of Tor1 and Tor2 on Nitrogen Starvation Responses in Fission Yeast Genetics, March 1, 2007; 175(3): 1153 - 1162. [Abstract] [Full Text] [PDF]

				J. Urano, T. Sato, T. Matsuo, Y. Otsubo, M. Yamamoto, and F. Tamanoi Point mutations in TOR confer Rheb-independent growth in fission yeast and nutrient-independent mammalian TOR signaling in mammalian cells PNAS, February 27, 2007; 104(9): 3514 - 3519. [Abstract] [Full Text] [PDF]

				B. Alvarez and S. Moreno Fission yeast Tor2 promotes cell growth and represses cell differentiation J. Cell Sci., November 1, 2006; 119(21): 4475 - 4485. [Abstract] [Full Text] [PDF]

International Access Link

Online ISS 1091-6490
Copyright 2008 by the Genetics Society of America
phone: 412-268-1812   fax: 412-268-1813   email: genetics-gsa{at}andrew.cmu.edu