| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Genetics, Vol. 173, 25-34, May 2006, Copyright © 2006
doi:10.1534/genetics.105.054700
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,1
* Programa Doctorado de Genética Molecular y Microbiología, Pontificia Universidad Católica de Chile and Departamento de Ciencias Biológicas, Universidad Andrés Bello, Santiago, Chile
1 Corresponding author: Laboratorio de Microbiología, Departamento de Ciencias Biológicas, Universidad Andrés Bello, República 217, Santiago, Chile.
E-mail: gmora{at}unab.cl
 |
ABSTRACT |
|---|
 TOP ABSTRACT MATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
-helices. Fusions of the lacZ gene to both tsx and impX reveal that the transcription of both genes is induced in the presence of adenosine. A null mutation in the S. Typhi impX gene suppresses the induced auxotrophy for adenosine or thymidine resulting from a tsx mutation and confers sensitivity to high concentrations of adenosine or thymidine. The ImpX protein, when tagged with a 3xFLAG epitope, is functional and associates with the inner membrane; impX mutants are defective in the export of 3H-radiolabeled thymidine. Taken together, these and other results suggest that the S. Typhi Tsx porin and ImpX inner membrane protein facilitate competing mechanisms of thymidine influx and efflux, respectively, to maintain the steady-state levels of internal nucleoside pools.
Both eukaryotes and prokaryotes salvage nucleosides for acting as precursors for nucleic acid synthesis and, in several cases, to serve as carbon and nitrogen sources (HANTKE 1976; MCKEOWN et al. 1976; ACIMOVIC and COE 2002). In gram-negative enteric bacteria, the first step in this salvage process is the transport of nucleosides across the outer membrane into the periplasm, mediated by the Tsx family of porins. After traversing the periplasmic space, nucleosides are transported across the inner membrane into the cytoplasm by the transporters NupC and NupG (WESTH HANSEN et al. 1987; MUNCH-PETERSEN and JENSEN 1990; CRAIG et al. 1994; NORHOLM and DANDANELL 2001).
In previous studies of the Salmonella enterica sv. Typhi (S. Typhi) Tsx porin, we found that Tsx is among the proteins in outer membrane preparations whose expression increases dramatically in response to anaerobiosis, a condition that favors the virulence of this pathogen. Surprisingly, we found that Tsx is essential for the prototrophic growth of S. Typhi in the absence of nucleosides. On the basis of these and other results, we have proposed that the Tsx porin plays a critical role in the assembly and integrity of the S. Typhi membrane, and thus in the virulence of S. Typhi (BUCAREY et al. 2005). In this article, we show that a short open reading frame (ORF) adjacent to the S. Typhi tsx gene, impX (STY0450), encodes an additional product that mediates nucleoside transport across the S. Typhi membrane.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
(endA1 hsdR17 [r-m+] supE44 thi-1 recA1 gyrA [NalR] relA1 
[lacZYA-argF]U169 deoR [
80{lacZ}M15]) was used as the host for the selection and preparation of plasmids.
|
The 3' 20 bases of each primer (underlined) were annealed to the 5'- or 3'-ends of Cam or KanR cassettes flanked by FRT sites in template plasmids pKD3 and pKD4, respectively (DATSENKO and WANNER 2000). PCR reactions using Taq DNA polymerase were made according to the manufacturer's instructions (Life Technologies). STH2370 carrying plasmid pKD46 (encoding the 
-Red recombinase functions) was grown at 30° in LB medium with Amp and 1 mM arabinose, made electrocompetent, and electroporated with 
500 ng of each PCR product. Electroporated cells were plated on LB medium with Cam or Kan at 37°. Substitution mutations in recombinant strains resulting from this procedure were moved into a clean wild-type background by electroporation with linear chromosomal DNA as described by TORO et al. (1998). The presence of each substitution mutation was confirmed by PCR amplification, using primers complementary to the S. Typhi genome flanking the sites of substitution. After backcrosses, resistance determinants were eliminated to avoid polar effects using plasmid pCP20, an AmpR plasmid that is temperature sensitive for replication and the production of FLP recombinase (DATSENKO and WANNER 2000). S. Typhi CamR or KanR mutants were transformed with pCP20, AmpR recombinants were selected at 30°, and isolated colonies were purified at 37° before testing for loss of antibiotic resistance. After the elimination of resistance cassettes, we obtained nonpolar mutations, as described previously by DATSENKO and WANNER (2000).
Cloning and complementation of the S. Typhi tsx-impX operon:
To clone the tsx-impX operon, we amplified a 1.9-kb fragment of S. Typhi STH2370 DNA, including the tsx and impX coding sequences and their upstream promoter with primers TAGAATTCTACGGGCAAATTCAGGGCACTA and TTGAATGTTAGGTTACGCTTC. The PCR fragment was purified and ligated to AmpR plasmid vector pGEM-T (Promega, Madison, WI). The ligation mix was electroporated into E. coli host strain DH5, and recombinants that form white colonies on LB Amp plates with 0.5 mM IPTG and 40 µg/ml X-gal at 37° were screened. Plasmid DNA purified from one clone yielded an insert of the predicted size after digestion with EcoRI. This plasmid, pGEM::tsx-impX, was electroporated into S. Typhi tsx impX; AmpR recombinants were found to have a wild-type phenotype (our unpublished results).
Phenotypic analysis of S. Typhi mutants:
A modification of the disk diffusion assay (BAUER et al. 1966) was used to determine the auxotrophic requirements of mutant strains, as well as their sensitivities to nucleosides. Assays to measure the efficiencies of plating of wild-type and mutant strains in the presence of nucleosides were performed as described previously (BUCAREY et al. 2005) and in the text. Efficiencies of plating are expressed as the titers of colony-forming units on media with or without nucleosides, divided by the titer of the wild-type strain on media without nucleosides.
Subcellular fractionation of inner and outer membrane proteins:
Membrane fractions were prepared as described by LOBOS and MORA (1991) on the basis of the modification of the method of SCHNAITMAN (1971). Bacteria were grown to midexponential phase, chilled on ice, pelleted by centrifugation at 3000 x g for 15 min at 4°, resuspended in lysis buffer (Tris–HCl 10 mM pH 8, 10 mM MgCl2), sonicated, and then supplemented to 2 mM phenylmethylsulfonyl fluoride. Whole cells and debris were removed by low-speed centrifugation (3000 x g, 10 min), and total membrane fractions were obtained after 45 min of centrifugation at 13,000 x g at 4°. Inner membrane fractions were solubilized with 2% Triton X-100, and the outer membrane fraction was pelleted by centrifugation at 13,000 x g and solubilized in 50 µl of Tris–HCl 100 mM, pH 8 buffer, 1% SDS. Supernatants containing proteins associated with the inner membrane were precipitated by the addition of trichloroacetic acid to 10%, washed twice with acetone, dried, and resuspended in 50 µl of Tris–HCl 100 mM, pH 8 buffer, 1% SDS. Proteins were separated in 12% SDS–polyacrylamide gels.
Epitope tagging:
A fusion of the sequence encoding the 3xFLAG epitope with the impX gene was constructed using the method of DATSENKO and WANNER (2000) as modified by UZZAU et al. (2001). Primers were designed with 36- to 40-base 5' extensions corresponding to the 3'-end of the impX coding sequence and to the region immediately downstream of impX to amplify plasmid pSUB11. The sequences of the primers used are: FLAG-impX1 CGCAACATTGCGCCTCACCGGGTTGCCCCGGCTTACCGCGACTACAAAGACCATGACGG and FLAG-impX2 CTGACATTTTTTCAGCCCCGGAGTTTGTCGCCAGCCCCAACATATGAATATCCT CCTTAG.
The PCR product was used to transform strain STH2370 carrying plasmid pKD46. The presence of the genetic fusion was confirmed by PCR amplification, using primers complementary to the S. Typhi genome flanking the fusion.
Immunoblot analysis:
The 3xFLAG fusion protein was detected in immunoblots by the use of anti-FLAG M2 monoclonal antibody from Sigma. Strains carrying the epitope-tagged gene were grown in cultures (2 ml) to stationary phase and centrifuged. Bacterial pellets were resuspended in 50 µl of 100 mM Tris–HCl (pH 8), mixed with 50 µl of Laemmli lysis buffer, and incubated at 100° for 10 min. The resulting lysates were centrifuged to remove cell debris and resolved by SDS–PAGE. Total bacterial lysates and inner and outer membrane fractions were resolved by SDS–PAGE, transferred to polyvinylidenedifluoride (PDVF) membranes, and probed with mouse antiflag Ab M2 (1:10,000) and then with alkaline phosphatase-conjugated goat anti-mouse IgG [1:5000 (Sigma)]. Alkaline phosphatase activity was revealed by using the nitroblue tetrazolium–5-bromo-4-chloro-3-indolylphosphate dye system.
Assays for ß-galactosidase activity:
S. Typhi mutant strains with lacZY fusions were grown to an OD600nm of 0.2 and then chilled to 4°. ß-Galactosidase activities were assayed as described and are expressed in Miller units, 103 x ((OD420nm – 1.75 x OD550nm) x OD600nm–1) ml–1 min–1 (MILLER 1972).
RNA isolation and reverse transcriptase–PCR:
To isolate RNA, cells were grown overnight in LB medium at 37°. Total RNA was extracted and purified using TRIzol and treated with RNase-free DNase I (amplification grade; GIBCO-BRL, Gaithersburg, MD). Reverse transcription (RT)–PCR was performed on 200 ng of DNase-treated RNA using Superscript II RT (Invitrogen, San Diego). Amplification was for 30 cycles (94° for 30 sec, 55° for 30 sec, and 72° for 2 min, followed by a 7-min extension at 72°). Primers jajI TAGAATTCTACGGGCAAATTCAGGGCACTA, impX CCGGATCCGGAAAGAGAAAACCCCCGCACA, tsx2 CCGGATCCAATCCAATCGCCGTCGCCCCAGTTCAG, and tsx1 CCGGTACCCAAAGCCAGCCGCCAGAGCACA, corresponding to internal regions of the S. Typhi jajI, impX, and tsx genes, were designed on the basis of the S. Typhi strain CT18 genome sequence (PARKHILL et al. 2001). Genomic DNA served as a positive control, and DNase-treated RNA that had not been reverse transcribed was used as a negative control. Twenty-microliter aliquots removed after 30 cycles of amplification were resolved in 1% agarose gels with ethidium bromide, and gels were analyzed using a Digital Science 120 system (Kodak).
Uptake and efflux assays:
For the measurements of [3H]thymidine (85 Ci/mmol, Perkin-Elmer, Norwalk, CT) uptake and efflux, bacterial cultures of strain S. Typhi STH2370 and its mutant derivatives were grown in LB medium to an OD600nm of 0.2 or to overnight density, and cells were harvested by centrifugation and washed twice with M9 glycerol medium or 20 mM HEPES buffer (pH 7), respectively. To measure uptake, a mix of 1 µCi 3H-radiolabeled thymidine (0.01 nmol) and cold thymidine (0.415 nmol) was added to a 0.5-ml cell suspension to yield a final concentration of 0.85 µM. Samples (100 µl) were removed at various time intervals, filtered through membrane filters (ME 25, 0.45 pm; Schleicher & Schuell, Keene, NH), prewashed with M9 medium, and washed twice with 1 ml M9 medium. The radioactivity retained on the membrane filters was determined by scintillation counting. To measure efflux, cells were resuspended in 0.5 ml of 20 mM HEPES buffer (pH 7) and a mix of 1 µCi 3H-radiolabeled thymidine (0.01 nmol) and cold thymidine (0.415 nmol) was added to a final concentration of 0.85 µM. Carbonylcyanide-m-chlorophenylhydrazone (CCCP) was added to a final concentration of 20 µM to dissipate the membrane potential, and cells were incubated for 15 min at 37° and aerated by shaking. Cells were then washed twice and resuspended in a 900-µl buffer at 4°. Efflux was initiated by the addition of sodium succinate to 0.1 M. Samples (100 µl) were removed at various time intervals and filtered. Radioactivity present in the supernatants was determined by scintillation counting. Efflux was expressed as the counts per minute released to the supernatant, divided by the counts per minute retained on the membrane filters.
|
RESULTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
tsx nonpolar mutation confers an auxotrophic requirement for the nucleosides adenosine or thymidine (BUCAREY et al. 2005).
The auxotrophy resulting from the tsx mutation is unusual. Unlike mutations affecting the essential purine and pyrimidine biosynthetic pathways of Salmonella enterica, the tsx mutation causes an auxotrophy that can be masked by the addition of nucleosides, but not their nucleotide counterparts, and that can be masked by the addition of either purine or pyrimidine nucleosides (adenosine or thymidine) and only by these specific nucleosides. To understand this unusual phenotype, we have taken a genetic approach, and have attempted to isolate second-site suppressors of a tsx mutation that restore prototrophic growth.
During this search, we noted a small ORF (STY0450) immediately downstream and adjacent to the S. Typhi tsx gene (STY0451). The gene corresponding to ORF STY0450, hereafter referred to as impX, is predicted to encode a protein product 108 amino acids in length with a molecular mass of 12 kDa. This gene is unique to serovars of S. enterica. To determine the function of the S. Typhi impX gene, we constructed a mutant derivative of S. Typhi strain STH2370 with a impX mutation, using the method of DATSENKO and WANNER (2000), and determined its phenotype. As shown in Table 2, the impX mutant is a prototroph; however, the deletion of the S. Typhi impX gene also results in an inability to grow in the presence of higher concentrations of adenosine (or inosine) and thymidine. For comparison, a deletion of the gene upstream of tsx (jajI) confers a wild-type phenotype (our unpublished results).
|
tsx mutant, which is an auxotroph that requires either adenosine or thymidine for growth in minimal medium, a impX tsx double mutant is a prototroph whose growth is sensitive to adenosine or thymidine. Clearly, the tsx mutation does not have a polar effect on the expression of the impX gene, because the phenotype of the double mutants is different from that of the tsx single mutant. Rather, the impX mutation is epistatic to the tsx mutation and suppresses the auxotrophy caused by the tsx mutation (Figure 1). Formally, these genetic results suggest that the products of the impX and tsx genes participate in the same pathway in which the activity of ImpX precedes that of Tsx; however, we show below that this is not the case.
|
tsx mutant with a derivative of the moderate-copy-number plasmid pSU19 carrying the cloned tsx gene yields a strain that is prototrophic, yet cannot grow in the presence of high concentrations of adenoside or thymidine, suggesting that overproduction of the Tsx porin results in an imbalance of membrane proteins that renders S. Typhi sensitive to adenosine or thymidine (BUCAREY et al. 2005). This is the same phenotype exhibited by the S. Typhi impX mutant. In addition, expression of impX from a high-copy-number plasmid complements the adenosine or thymidine sensitivity of a impX mutant only partially. In contrast, we find that the high-copy-number plasmid vector pGEM-T carrying an insert of the entire tsx impX operon with its promoter complements a tsx impX double mutant completely and restores both prototrophy and the ability to grow in the presence of high concentrations of adenosine or thymidine (our unpublished results). Taken together, these results suggest that the balance of Tsx and ImpX products is implicated in both the prototrophic growth of S. Typhi in the absence of adenosine or thymidine and the growth of S. Typhi in the presence of high concentrations of adenosine or thymidine.
The S. Typhi tsx and impX genes are cotranscribed:
As illustrated in Figure 2, the tsx and impX genes are transcribed in the same direction and are separated by 53 bp of noncoding sequence. These genes lie 299 bp downstream of an open reading frame designated jajI (STY0452), which is also transcribed in the same direction and is separated by 252 bp from the potential ORF STY0449, which is divergently transcribed.
|
|
tsx and impX strains of S. Typhi to generate these fusions (ELLERMEIER et al. 2002). As shown in Figure 3, the ß-galactosidase activity produced by the recombinant S. Typhi impX::lacZY strain in presence of 2 mM adenosine is about twofold higher than that in the absence of adenosine. The ß-galactosidase activity produced by a recombinant S. Typhi tsx::lacZY strain also increases by a similar amount in response to adenosine induction.
Second, we constructed a mutant derivative of S. Typhi carrying a fusion of the coding sequence for a threefold repeated FLAG epitope to the 3'-end of the impX coding sequence (UZZAU et al. 2001). This insertion mutant has a wild-type phenotype (our unpublished results), showing that the C terminus of the ImpX protein is not essential for function. To confirm the result that the expression of the impX gene is induced by the presence of adenosine, we grew the impX::3xFLAG mutant in the presence of various concentrations of adenosine, resuspended pelleted cells in sample buffer with SDS, and resolved the proteins in cells by SDS–PAGE. Proteins in gels were transferred to PDVF membranes, and the presence of the fusion protein was detected by Western blot analysis, as described in MATERIALS AND METHODS. Immunoblot analysis shows that this mutant produces a protein with an apparent molecular mass of 14 kDa that binds anti-FLAG monoclonal antibody. This analysis also shows that the steady-state level of the ImpX–3xFLAG protein increases in response to increasing concentrations of adenosine (Figure 4).
|
tsx mutation, we encountered a second-site revertant with an insertion of the mini-Tn10 transposon derivative, T-POP (RAPPLEYE and ROTH 1997), upstream of the S. Typhi pyrD gene. The pyrD gene encodes a dehydrogenase, the only membrane-associated protein required for de novo nucleoside biosynthesis (HANSEN et al. 2004). This T-POP insertion suppresses the auxotrophy caused by a tsx mutation presumably by lowering the amount of PyrD protein product relative to that of Tsx (BUCAREY et al. 2005).
PyrD is an unusual membrane protein, because, like ImpX, it is predicted to have only two transmembrane -helices (HANSEN et al. 2004). Because our genetic evidence suggests that, like PyrD, ImpX may interact with Tsx, we determined the subcellular localization of the ImpX protein. As shown in Figure 5, when proteins made by the impX::3xFLAG mutant are fractionated, ImpX–3xFLAG protein is found associated with the inner membrane fraction.
|
impX mutation suppresses the defect in nucleoside uptake caused by a tsx mutation and is defective in nucleoside export:tsx mutation (Figure 2). In E. coli, a null mutation in the tsx gene results in a complete defect in the uptake of both adenosine and thymidine when these nucleosides are present at low (micromolars to millimolars) extracellular concentrations (FSIHI et al. 1993). To determine the effects of the tsx and impX mutations on nucleoside uptake, we measured the initial rates of [3H]thymidine uptake by wild-type and mutant strains of S. Typhi. As shown in Figure 6, unlike the case of E. coli in which a tsx mutation results in a complete defect in thymidine uptake under similar conditions, an S. Typhi tsx mutation results in only a partial defect in the initial rate of thymidine uptake; mutant cells uptake thymidine at a rate approximately half that of the wild type. From this result, we can conclude that S. Typhi has other outer membrane proteins in addition to the Tsx porin that facilitates the import of thymidine across the outer membrane. Thus, unlike the case for E. coli, thymidine uptake in S. Typhi is mediated by multiple porins. Surprisingly, the impX mutant uptakes thymidine at a greater initial rate than the wild type, as does the impX tsx double mutant. Again, we find that the impX mutation is epistatic to the tsx mutation with respect to thymidine uptake, reinforcing the idea that the Tsx channel is not the only mechanism by which thymidine can enter S. Typhi and arguing that ImpX either inhibits the uptake of thymidine or facilitates the competing export of thymidine.
|
tsx mutant shows a somewhat higher rate of thymidine efflux than the wild type. This result is consistent with the idea that Tsx facilitates the directional transport of extracellular thymidine across the outer membrane and into the periplasm. In contrast, the impX single mutant shows a lower rate of efflux than does the wild type, implicating the product of the impX gene directly in thymidine efflux. The impX tsx double mutant resembles the wild-type strain in its initial rate of thymidine efflux. |
DISCUSSION |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
Previously, we found that a deletion of the S. Typhi tsx gene confers an auxotrophic requirement for adenosine or thymidine. Prototrophy can be restored by the complementation of a tsx mutant with an intermediate-copy-number plasmid carrying the tsx gene, but the complemented strain acquires sensitivity to these nucleosides, presumably as a consequence of the overexpression of tsx. To understand these unusual phenotypes, we have isolated revertants of an S. Typhi tsx mutant that can grow in minimal medium. One of these revertants carries an insertion that places the pyrD gene under the control of the tetracycline-inducible tetA promoter from transposon T-POP. This revertant grows in minimal medium only in the presence of intermediate concentrations of tetracycline, suggesting that the balance of products of the tsx and pyrD genes, an outer membrane porin and an inner-membrane-associated dehydrogenase, is essential for the growth of S. Typhi (BUCAREY et al. 2005). In this article, we have extended our search for suppressors of the induced auxotrophy resulting from a tsx nonpolar mutation and have found that mutations in the cotranscribed and coregulated gene, immediately downstream of tsx, impX, can suppress this auxotrophy.
The impX gene, like pyrD, is predicted to encode an inner membrane protein with only two transmembrane -helices, similar in size to that of the small multidrug resistance (SMR) proteins. This smallest family of membrane proteins has members that range in size from 100 to 120 aminoacyl residues and participate in the efflux of a wide variety of antibiotics (GRINIUS et al. 1992; GRINIUS and GOLDBERG 1994). These proteins function as homo- or hetero-oligomers, but unlike ImpX, have four transmembrane -helices. Indeed, ImpX shares no sequence similarity with proteins of the SMR family, nor with larger multidrug resistance proteins or other membrane transporters, and represents the first member of a new class of inner membrane exporters.
Our genetic evidence argues strongly that the Tsx outer membrane protein and ImpX inner membrane protein act in opposition to maintain a balance of nucleoside transport. Not only does an impX mutation suppress a tsx mutation, but also it confers the same phenotype, sensitivity to a specific subset of nucleosides (the preferred substrates of Tsx), which results from the overexpression of the tsx gene. These results argue that the balance of products of the tsx and impX genes is critical for nucleoside transport in S. Typhi.
However, nucleoside import and export in S. Typhi must involve both outer and inner membrane protein in addition to Tsx and ImpX, respectively. The findings that the tsx mutant is only partially defective in thymidine import reveals that S. Typhi has another porin involved in nucleoside import. Similarly, the impX mutant is only partially defective in thymidine export. Because the inner membrane is impermeable to thymidine, this result reveals that there is another, impX-independent, energy-dependent thymidine efflux system. The simplest model to explain our result is that the Tsx channel and other porins facilitate the import of nucleosides to the periplasm, and additional inner membrane transporters, including those encoded by the nupC, nupG, and potentially other S. Typhi genes, complete the import process. In addition, there is a competing export pathway that involves the principal ImpX and another inner membrane transporter and potentially as-yet-unknown outer membrane proteins. Thus, both impX and impX tsx mutants show a higher rate of nucleoside import, because the major route of competing nucleoside export is blocked by the impX mutation. The tsx mutant likely has a higher rate of nucleoside efflux, because Tsx-mediated nucleoside import in this mutant cannot counter the effects of ImpX-mediated export. Both the impX mutant and mutants that overproduce Tsx are sensitive to high concentrations of nucleosides, presumably because they accumulate levels of these metabolites sufficient to inhibit cell growth. The tsx mutant is an auxotroph, presumably because the combination of the alternative uptake system and a functional ImpX-dependent efflux system in the absence of Tsx does not permit the accumulation of intracellular levels of nucleosides sufficient for growth.
Our results are of particular importance to our understanding of epistatic interactions. Normally, the result that one loss-of-function mutation (for example, impX) is epistatic to another loss-of-function mutation (for example, tsx) is taken as a strong indication that the product of the first gene acts before that of the second gene in the same pathway. In the case of the impX and tsx genes, it is clear that their products act in opposing pathways involving redundant functions to maintain a balance of the concentrations of their substrates. It is likely that other examples of this type of epistasis will be encountered upon the genetic analysis of other transport mechanisms, as well as of competing pathways involving multiple, redundant functions in general.
|
ACKNOWLEDGEMENTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
|
LITERATURE CITED |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSLITERATURE CITED |
|---|
ACIMOVIC, Y., and I. R. COE, 2002 Molecular evolution of the equilibrative nucleoside transporter family: identification of novel family members in prokaryotes and eukaryotes. Mol. Biol. Evol. 19: 2199–2210.
BAUER, A. W., W. M. M. KIRBY, J. C. SHERRIS and M. TURCK, 1966 Antibiotic susceptibility testing by a standardized single disk method. Am. J. Clin. Pathol. 45: 493–496.[Medline]
BENSON, S. A., and A. DECLOUX, 1985 Isolation and characterization of outer membrane permeability mutants in Escherichia coli K-12. J. Bacteriol. 161: 361–367.
BENZ, R., A. SCHMID, C. MAIER and E. BREMER, 1988 Characterization of the nucleoside-binding site inside the Tsx channel of Escherichia coli outer membrane. Reconstitution experiments with lipid bilayer membranes. Eur. J. Biochem. 176: 699–705.[Medline]
BIRCH, R. G., and S. S. PATIL, 1985 Preliminary characterization of an antibiotic produced by Xanthomonas albilineans which inhibits DNA synthesis in Escherichia coli. J. Gen. Microbiol. 131(Pt. 5): 1069–1075.[Medline]
BIRCH, R. G., J. M. PEMBERTON and W. V. BASNAYAKE, 1990 Stable albicidin resistance in Escherichia coli involves an altered outer-membrane nucleoside uptake system. J. Gen. Microbiol. 136(Pt. 1): 51–58.[Medline]
BREMER, E., P. GERLACH and A. MIDDENDORF, 1988 Double negative and positive control of tsx expression in Escherichia coli. J. Bacteriol. 170: 108–116.
BUCAREY, S. A., N. A. VILLAGRA, M. P. MARTINIC, A. N. TROMBERT, C. A. SANTIVIAGO et al., 2005 The Salmonella enterica serovar Typhi tsx gene, encoding a nucleoside-specific porin, is essential for prototrophic growth in the absence of nucleosides. Infect. Immun. 73(10): 6210–6219.
CRAIG, J. E., Y. ZHANG and M. P. GALLAGHER, 1994 Cloning of the nupC gene of Escherichia coli encoding a nucleoside transport system, and identification of an adjacent insertion element, IS 186. Mol. Microbiol. 11: 1159–1168.[Medline]
DATSENKO, K. A., and B. L. WANNER, 2000 One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97: 6640–6645.
ELLERMEIER, C. D., A. JANAKIRAMAN and J. M. SLAUCH, 2002 Construction of targeted single copy lac fusions using lambda red and FLP-mediated site-specific recombination in bacteria. Gene 290: 153–161.[CrossRef][Medline]
FSIHI, H., B. KOTTWITZ and E. BREMER, 1993 Single amino acid substitutions affecting the substrate specificity of the Escherichia coli K-12 nucleoside-specific Tsx channel. J. Biol. Chem. 268: 17495–17503.
GERLACH, P., P. VALENTIN-HANSEN and E. BREMER, 1990 Transcriptional regulation of the cytR repressor gene of Escherichia coli: autoregulation and positive control by the cAMP/CAP complex. Mol. Microbiol. 4: 479–488.[CrossRef][Medline]
GRINIUS, L. L, and E. B. GOLDBERG, 1994 Bacterial multidrug resistance is due to a single membrane protein which functions as a drug pump. J. Biol. Chem. 269(47): 29998–30004.
GRINIUS, L., G. DREGUNIENE, E. B. GOLDBERG, C. H. LIAO and S. J. PROJAN, 1992 A staphylococcal multidrug resistance gene product is a member of a new protein family. Plasmid 27(2): 119–129.[CrossRef][Medline]
HANSEN, M., J. LE NOURS, E. JOHANSSON, T. ANTAL, A. ULLRICH et al., 2004 Inhibitor binding in a class 2 dihydroorotate dehydrogenase causes variations in the membrane-associated N-terminal domain. Protein Sci. 13(4): 1031–1042.
HANTKE, K., 1976 Phage T6-colicin K receptor and nucleoside transport in Escherichia coli. FEBS Lett. 70: 109–112.[CrossRef][Medline]
HARDESTY, C., C. FERRAN and J. M. DIRIENZO, 1991 Plasmid-mediated sucrose metabolism in Escherichia coli: characterization of scrY, the structural gene for a phosphoenolpyruvate-dependent sucrose phosphotransferase system outer membrane porin. J. Bacteriol. 173: 449–456.
LOBOS, S. R., and G. C. MORA, 1991 Alteration in the electrophoretic mobility of OmpC due to variations in the ammonium persulfate concentration in sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Electrophoresis 12: 448–450.[CrossRef][Medline]
LUCKEY, M., and H. NIKAIDO, 1980 Specificity of diffusion channels produced by lambda phage receptor protein of Escherichia coli. Proc. Natl. Acad. Sci. USA 77: 167–171.
MAIER, C., E. BREMER, A. SCHMID and R. BENZ, 1988 Pore-forming activity of the Tsx protein from the outer membrane of Escherichia coli. Demonstration of a nucleoside-specific binding site. J. Biol. Chem. 263: 2493–2499.
MCKEOWN, M., M. KAHN and P. HANAWALT, 1976 Thymidine uptake and utilization in Escherichia coli: a new gene controlling nucleoside transport. J. Bacteriol. 126: 814–822.
MILLER, J. H., 1972 Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
MUNCH-PETERSEN, A., and N. JENSEN, 1990 Analysis of the regulatory region of the Escherichia coli nupG gene, encoding a nucleoside-transport protein. Eur. J. Biochem. 190: 547–551.[Medline]
MUNCH-PETERSEN, A., B. MYGIND, A. NICOLAISEN and N. J. PIHL, 1979 Nucleoside transport in cells and membrane vesicles from Escherichia coli K12. J. Biol. Chem. 254: 3730–3737.
NIEWEG, A., and E. BREMER, 1997 The nucleoside-specific Tsx channel from the outer membrane of Salmonella typhimurium, Klebsiella pneumoniae and Enterobacter aerogenes: functional characterization and DNA sequence analysis of the tsx genes. Microbiology 143: 603–615.[Abstract]
NIKAIDO, H., 1994 Porins and specific diffusion channels in bacterial outer membranes. J. Biol. Chem. 269: 3905–3908.
NIKAIDO, H., 2003 Molecular basis of bacterial outer membrane permeability revisited. Microbiol. Mol. Biol. 67: 593–656.
NORHOLM, M. H., and G. DANDANELL, 2001 Specificity and topology of the Escherichia coli xanthosine permease, a representative of the NHS subfamily of the major facilitator superfamily. J. Bacteriol. 183: 4900–4904.
PARKHILL, J., G. DOUGAN, K. D. JAMES, N. R. THOMSON, D. PICKARD et al., 2001 Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18. Nature 413: 848–852.[CrossRef][Medline]
RAPPLEYE, C. A., and J. R. ROTH, 1997 A Tn10 derivative (T-POP) for isolation of insertions with conditional (tetracycline-dependent) phenotypes. J. Bacteriol. 179: 5827–5834.
SCHNAITMAN, C. A, 1971 Solubilization of the cytoplasmic membrane of Escherichia coli by Triton X-100. J. Bacteriol. 108: 545–552.
TORO, C. S., G. C. MORA and N. FIGUEROA-BOSSI, 1998 Gene transfer between related bacteria by electrotransformation: mapping Salmonella typhi genes in Salmonella typhimurium. J. Bacteriol. 180: 4750–4752.
TRIAS, J., and H. NIKAIDO, 1990 Protein D2 channel of the Pseudomonas aeruginosa outer membrane has a binding site for basic amino acids and peptides. J. Biol. Chem. 265: 15680–15684.
TRIAS, J., E. Y. ROSENBERG and H. NIKAIDO, 1988 Specificity of the glucose channel formed by protein D1 of Pseudomonas aeruginosa. Biochim. Biophys. Acta 938: 493–496.[Medline]
UZZAU, S., N. FIGUEROA-BOSSI, S. RUBINO and L. BOSSI, 2001 Epitope tagging of chromosomal genes in Salmonella. Proc. Natl. Acad. Sci. USA 98: 15264–15269.
VALENTIN-HANSEN, P., B. A. SVENNINGSEN, A. MUNCH-PETERSEN and K. HAMMER-JESPERSEN, 1978 Regulation of the deo operon in Escherichia coli: the double negative control of the deo operon by the cytR and deoR repressors in a DNA directed in vitro system. Mol. Gen. Genet. 159(2): 191–202.[CrossRef][Medline]
VAN ALPHEN, W., N. VAN SEIM and B. LUGTENBERG, 1978 Pores in the outer membrane of Escherichia coli K12: involvement of proteins b and e in the functioning of pores for nucleotides. Mol. Gen. Genet. 159: 75–83.[CrossRef][Medline]
WESTH HANSEN, S. E., N. JENSEN and A. MUNCH-PETERSEN, 1987 Studies on the sequence and structure of the Escherichia coli K-12 nupG gene, encoding a nucleoside-transport system. Eur. J. Biochem. 168: 385–391.[Medline]
YE, J., and B. VAN DEN BERG, 2004 Crystal structure of the bacterial nucleoside transporter Tsx. EMBO J. 23(16): 3187–3195.[CrossRef][Medline]
Communicating editor: A. L. SONENSHEINThis article has been cited by other articles:
 |
|
 |
|
  R. S. Laishram and J. Gowrishankar Environmental regulation operating at the promoter clearance step of bacterial transcription Genes & Dev., May 15, 2007; 21(10): 1258 - 1272. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
