Originally published as Genetics Published Articles Ahead of Print on September 2, 2005.

Genetics, Vol. 171, 1999-2012, December 2005, Copyright © 2005
doi:10.1534/genetics.105.046623

Ac-Immobilized, a Stable Source of Activator Transposase That Mediates Sporophytic and Gametophytic Excision of Dissociation Elements in Maize

* Department of Plant Breeding and Genetics, Cornell University, Ithaca, New York 14853 and {dagger} Boyce Thompson Institute, Cornell University, Ithaca, New York 14853

1 Corresponding author: Boyce Thompson Institute, Cornell University, 1 Tower Rd., Ithaca, NY 14853. 
E-mail: tpb8{at}cornell.edu

Manuscript received June 8, 2005. Accepted for publication August 21, 2005.

ABSTRACT

We have identified and characterized a novel Activator (Ac) element that is incapable of excision yet contributes to the canonical negative dosage effect of Ac. Cloning and sequence analysis of this immobilized Ac (Ac-im) revealed that it is identical to Ac with the exception of a 10-bp deletion of sequences at the left end of the element. In screens of ~6800 seeds, no germinal transpositions of Ac-im were detected. Importantly, Ac-im catalyzes germinal excisions of a Ds element resident at the r1 locus resulting in the recovery of independent transposed Ds insertions in ~4.5% of progeny kernels. Many of these transposition events occur during gametophytic development. Furthermore, we demonstrate that Ac-im transactivates multiple Ds insertions in somatic tissues including those in reporter alleles at bronze1, anthocyaninless1, and anthocyaninless2. We propose a model for the generation of Ac-im as an aberrant transposition event that failed to generate an 8-bp target site duplication and resulted in the deletion of Ac end sequences. We also discuss the utility of Ac-im in two-component Ac/Ds gene-tagging programs in maize.


IN the absence of efficient gene replacement technologies, plant geneticists have relied heavily on insertional mutagenesis to elucidate gene function. In maize, several groups have worked to distribute the maize transposable element Activator (Ac) throughout the genome for use in forward genetic screens (DELLAPORTA and MORENO 1994; DOONER et al. 1994; AUGER and SHERIDAN 1999; KOLKMAN et al. 2005). As Ac tends to transpose to closely linked sites, elements inserted near a gene of interest can be used as donors in regional mutagenesis programs (DELLAPORTA et al. 1988; DELONG et al. 1993; SHEN et al. 2000; SINGH et al. 2003). The propensity for short-range transposition (GREENBLATT 1984; DOONER and BELACHEW 1989) makes it likely that multiple insertion alleles will be recovered (SINGH et al. 2003) and a high frequency of germinal reversion associated with Ac-induced alleles can be exploited to generate stable excision alleles (MA and DOONER 2004). Importantly, many Ac elements have been distributed in a uniform genetic inbred, greatly facilitating the analysis of recovered mutants by permitting near-isogenic comparisons of mutant and wild-type individuals (COWPERTHWAITE et al. 2002; KOLKMAN et al. 2005).

Despite these many attractive features of Ac, there are several practical limitations of Ac for large-scale tagging programs. For one, relatively few mapped Ac elements are positioned in reporter genes (DELLAPORTA and MORENO 1994; AUGER and SHERIDAN 1999). Instead, most have been placed relative to a translocation breakpoint (DOONER et al. 1994) or relative to molecular markers on recombinant inbred populations (KOLKMAN et al. 2005). As a result, the integrity of these lines can be confirmed only through time-consuming mapping experiments or by a molecular assay. In addition, propagating lines containing active Ac insertions over several generations is likely to lead to an increased mutational load due to transposition of the autonomous Ac element or nonautonomous Ds insertions present in the genome. The frequency of germinal Ac transposition events is also relatively low, averaging from 2 to 4% of kernel progeny (DOONER and BELACHEW 1989; BRUTNELL and DELLAPORTA 1994). Thus, given the low number of precisely positioned Ac insertions available, a large number of crosses must be performed to ensure a high probability that an insertion will be recovered in a gene of interest (BRUTNELL and CONRAD 2003).

A two-component Ac/Ds system in maize would circumvent many of these limitations. If Ds insertion lines lacking active Ac elements are crossed by an Ac transposase source that is incapable of excision, Ds transpositions could be generated and the resulting Ds insertion alleles maintained as either unstable (+ Ac) or stable (– Ac) alleles. A primary limitation to date has been the lack of a genetically well-characterized source of immobilized Ac transposase that is capable of mediating a high frequency of Ds excision in maize. Although a number of Ac derivatives in maize have been identified, all are capable of autonomous transposition (CHOMET 1988; DEMPSEY 1993; BRUTNELL et al. 1997; XIAO and PETERSON 2002). Furthermore, the frequency of Ds excision mediated by these elements is very low (DEMPSEY 1993; BRUTNELL et al. 1997) or has not been determined (CHOMET 1988; XIAO and PETERSON 2002).

Here we identify and characterize a naturally occurring deletion derivative of Ac that was generated in a uniform W22 inbred. This immobilized Ac (Ac-im) is incapable of autonomous transposition yet transactivates Ds elements at a time and frequency that is similar to autonomous Ac elements (MCCLINTOCK 1951; BRINK and NILAN 1952). The Ac-im element was likely generated during an aberrant transposition event associated with a large rearrangement at the target locus. We identified independent and heritable Ds insertions in 4.5% of testcross progeny in lines that carried Ac-im and the r1-sc:m3 reporter allele, representing a minimal Ds transposition frequency. We also demonstrate that Ac-im catalyzes the somatic excision of Ds elements resident at bronze1(bz1), anthocyaninless1(a1), and anthocyaninless2(a2), suggesting that Ac-im will provide a useful source of stable transposase to mobilize any Ds element in the maize genome. Finally, we discuss genetic strategies for exploiting Ac-im in a large-scale two-component gene-tagging platform for maize.


MATERIALS AND METHODS

Description of maize stocks:

All alleles and experiments described were performed in a common genetic background of the inbred W22. A brief description of each allele used in this study is given below:
P1-vv::Ac: an unstable Ac insertion at the p1 locus required for the accumulation of a red phlobaphene-like pigment (STYLES and CESKA 1977) resulting in variegated pericarp and cob tissues (LECHELT et al. 1989).
p1-wr: a complex p1 allele resulting in colorless pericarp and red cob tissues (CHOPRA et al. 1998).
r1-sc:m3: a Ds6-like insertion in the r1 locus that controls anthocyanin accumulation in aleurone and scutellar tissues (ALLEMAN and KERMICLE 1993).
r1-g: a deletion allele of the r1 locus conditioning a colorless aleurone and green anthers (STADLER 1946).
bz1-m2::Ds (DII): a 3.9-kb Ds insertion in the second exon of the Bz-McC allele (MCCLINTOCK 1962; DOONER 1986). The Bz1 gene encodes a UDP-glucose:flavonoid 3-O-glucosyl-transferase required for anthocyanin accumulation in several tissues (DOONER and NELSON 1977; LARSON and COE 1977).
a1-m3::Ds: a Ds insertion allele in the A1 gene (J. KERMICLE, personal communication). A1 encodes a dihydroquercetin reductase (DFR) required for anthocyanin production (O'REILLY et al. 1985; REDDY et al. 1987).
a2-m4::Ds: a Ds insertion allele in the A2 gene (J. KERMICLE, personal communication). A2 encodes a leucoanthocyanidin dioxygenase and is required for anthocyanin accumulation in seed and plant tissues (MENSSEN et al. 1990).

Genetic characterization of Ac-im:

The Ac-im allele was identified using a genetic scheme to detect Ac transposition events as previously described (KOLKMAN et al. 2005). In brief, lines homozygous for P1-vv::Ac were testcrossed to the r1-sc:m3 tester line. Ac-mediated excision of the Ds from the r1-sc:m3 allele results in purple sectors in the aleurone. The size and frequency of these sectors are inversely proportional to the copy number of Ac in the genome (MCCLINTOCK 1951). Hence, one copy of Ac results in a coarsely spotted aleurone, whereas four or more copies of Ac in the triploid endosperm result in a nearly colorless aleurone. This "negative dosage effect" of Ac was utilized to select near colorless kernels that were hemizygous for both the P1-vv::Ac insertion and a transposed Ac (tr-Ac). The progeny plants grown from nearly colorless kernels were then testcrossed by pollen from a stock homozygous for the r1-sc:m3 Ds tester to test for linkage of the tr-Ac relative to P1-vv::Ac (KOLKMAN et al. 2005). Ten coarsely spotted kernels that carried either P1-vv::Ac or Ac-im were selected and self-pollinated to generate ears that segregated one or the other Ac alleles. Ears that inherited P1-vv::Ac conditioned a variegated pericarp and were discarded and a single ear with colorless pericarp and variegated aleurone was selected. Finely spotted kernels were planted from this ear and self-pollinated to generate a line homozygous for Ac-im.

DNA blot analysis:

DNA extraction was performed on 1 g of leaf tissue as described by CHEN and DELLAPORTA (1994). Restriction digests and DNA blot analysis were performed as previously described (BRUTNELL and CONRAD 2003). All DNA probes were synthesized using the DIG Synthesis Kit following the manufacturer's protocol (Roche Applied Science, Indianapolis) unless otherwise noted. Blots were visualized using the Kodak Image Station 440 CR chemiluminescence detection system (Eastman Kodak, Rochester, NY).

To characterize the Ac-im insertion, DNA blot analysis was performed on Ac-im, P1-vv::Ac, and r1-sc:m3 DNA using PstI, PvuII, and EcoRI (Figure 2A). Filters were hybridized to the 700-bp EcoRI-HindIII fragment of Ac that was synthesized with Ac primers TBp38 (AAGCTTCATTTGTCAATAATCATG) and TBp39 (CATCTAGTTGAGACATCATATGAG) (Figure 2C) and the 5'-flanking probe designed to the sequence 1002–728 bp upstream of the Ac-im that was synthesized using primers LC12 (AGGATCTGATGAGGACTCGAATTA) and LC13 (CTGAAACACTTAACGGAGAGAGGATT) (Figure 2C). These and all LC primers detailed below were designed using the Primer3 program (available at http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi/).



View larger version (67K):
In this window
In a new window
Download PPT slide
 
FIGURE 2.—

Molecular characterization of the Ac-im element. (A) DNA blot hybridized with internal 700-bp HindIII-EcoRI fragment of Ac (Ac 700 probe). (B) The same DNA blot in A, stripped and reprobed with Ac-im flanking sequences (5'-flanking probe). Probes are depicted in C. DNA was digested with EcoRI, lanes 1–4; PstI, lanes 6–9; or PvuII, lanes 11–14. Two individuals homozygous for the Ac-im allele (lanes 1, 6, and 11 and 2, 7, and 12, respectively) and parental lines P1-vv::Ac (lanes 3, 8, and 13) and r1-sc:m3 (lanes 4, 9, and 14) were analyzed. Lanes 5, 10, and 15 contain Roche Ladder VII-Dig-labeled. (C) Schematic of Ac-im (4.55 kb) and flanking DNA (1.1 kb 5' and 0.14 kb 3') (not drawn to scale). Primers utilized for the verification PCR assay in part D are depicted as arrows. Ac-im sequence is represented as a box and internal lines denote exons. (D) PCR verification of Ac-im. An ethidium bromide-stained gel showing DNA amplified with 3'-flanking (JGp3) and Ac right-end (LC28) primers (lanes 1–4) and 5'-flanking (TBp34) and Ac left-end (LC30) primers (lanes 5–8). Predicted product sizes of 235 and 382, representing Ac-im junction fragments at the right and left ends, respectively, of the element are shown. PCR reactions were performed on DNA from two individuals carrying Ac-im (lanes 1–2 and 5–6) and the progenitor lines (lanes 3–4 and 7–8). Lane 9 is a positive PCR control and lanes 10 and 11 are negative controls using primers JGp3 and LC28 and LC30 and TBp34, respectively. Promega 1-kb DNA ladder is shown in lane 12.

 
To identify new Ds insertions, DNA blot analysis was performed using the restriction enzymes PvuII, PstI, BamHI, SacI, and BglII according to the manufacturer's recomendations (Promega, Madison, WI). tr-Ds insertions were detected using an {alpha}-32P-radiolabeled DNA fragment derived from internal Ds6-like sequences from the element inserted in the r1-sc:m3 allele (GenBank accession no. DQ068389). The 328-bp Ds6-like fragment was amplified from DNA homozygous for the r1-sc:m3 allele using the verification PCR protocol described below and primers LC3 (ATAGCCGATGCACGAAGTAAAT) and LC11 (CACTTAGCAGTACAGCACGTCAG).

To monitor r1 alleles, DNA blots containing DNA digested with PvuII were hybridized to an {alpha}-32P-radiolabeled 288-bp R1 gene fragment. This DNA fragment flanks the Ds insertion site at the r1 locus and was amplified with primers LC9 (TGAACAAGATACGTACCATCGACT) and LC10 (GACGAGTTTCATGGCTTGGAC) (R1 gene sequence kindly provided by Mary Alleman, Duquesne University).

Radiolabeled Ds6-like and R1 gene probes were generated and purified as described (SHEEHAN et al. 2004). Hybridizations were performed as described (CHURCH and GILBERT 1984) at 65° in a bottle incubator (Thermo Hybaid, Needham Heights, MA). Filters were exposed overnight to PhosphorImage screens (Amersham Biosciences, Sunnyvale, CA) and scanned at 50 µm resolution using the Storm 840 scanner (Molecular Dynamics, Sunnyvale, CA).

Cloning and sequence analysis:

To amplify DNA flanking the left end (nearest the internal BamHI site of Ac) of Ac-im, a PstI restriction digest was performed using 15 µg of genomic DNA from a homozygous Ac-im line as previously described (KOLKMAN et al. 2005). The digest was fractionated overnight on 0.8% low EEO agarose gel (Fisher Scientific, Fair Lawn, NJ) containing ethidium bromide in Tris-acetate EDTA (TAE) buffer with Promega 1-kb DNA ladder. DNA running at ~5.6 kb was excised from the gel and purified using the GeneCleanIII Kit (Qbiogene, Vista, CA). An intramolecular ligation was performed using T4 DNA ligase with 20 ng of purified product in a 50-µl reaction (Promega). The inverse PCR-1 (iPCR-1) protocol was performed with primers JGp2, JGp3, TBp34, and TBp35 as previously described (KOLKMAN et al. 2005) to amplify ~1.1 kb of sequence flanking the Ac-im left end and 11 bp flanking the right end of Ac-im.

Additional sequences flanking the right end of Ac-im were recovered following PCR amplification of DNA digested with restriction enzyme XhoI that cuts once within the Ac-im element. Approximately 12.5 µg of genomic DNA from a line homozygous for Ac-im was digested with XhoI in a total reaction volume of 100 µl according to the manufacturer's recommendation (Promega). The restriction enzyme digest was purified using the GeneCleanIII Kit (Qbiogene) following the protocol provided by the manufacturer. Approximately 3 µg of total restricted DNA was self-ligated using T4 DNA ligase (Promega) in a 50-µl reaction overnight at 12°. The reaction was heat killed at 70° for 10 min and purified using the QIAGEN nucleotide removal kit following the manufacturer's protocol (QIAGEN, Valencia, CA). PCR amplifications were performed using inverse PCR-3 (iPCR-3) protocol (KOLKMAN et al. 2005) with 150 ng of DNA. Primers were designed to internal Ac sequence: LC14 (GGCATGCAGTGAGATCAAAAATC) and to the right end of Ac that included 4 bp of DNA flanking Ac-im, LC25 (ACCGACCGTTTTCATCCCTAGACG).

PCR products were separated on a 0.8% agarose gel as described above and purified using the QIAquick Gel Extraction Kit (QIAGEN). DNA was cloned into either pGEM-T Easy (Promega) or TOPO TA cloning kit for sequencing (Invitrogen, Carlsbad, CA) and sequenced as described by SINGH et al. (2003). The left- and right-end sequences flanking the Ac-im insertion have been submitted to GenBank under accession nos. DQ068387 and DQ068388, respectively. The entire Ac-im sequence has been submitted to GenBank under accession no. DQ168849.

Cloning of the Ac-im element was confirmed using a verification PCR assay that selectively amplified the left and right junctions of Ac-im. Primers LC30 (CCTCTCCGTTAAGTGTTTCAGG) and TBp34 were used to amplify a junction fragment of 382 bp at the left end of Ac-im and primers LC28 (GGCAAGAAGCTTTGCTCAGA) and JGp3 were used to amplify a 235-bp fragment at the right end of Ac-im. PCR amplifications were performed using 6 ng of total genomic DNA in a 50-µl reaction mix containing 2 µl DMSO (Fisher Scientific, Pittsburgh), 2.5 units Taq (Promega), 0.2 mM dNTP's (Promega), 0.5 µM primers, and 1X Promega buffer with MgCl2. The DNA was denatured at 94° for 2 min, followed by 30 cycles of 94° for 30 sec, 57° for 30 sec, and 72° for 1 min, and one cycle of 72° for 10 min.

Recombinant inbred mapping:

DNA sequences flanking the Ac-im insertion were mapped using the IBM94 recombinant inbred population (LEE et al. 2002) as described by KOLKMAN et al. (2005). The DNA sequence 1002–728 bp upstream of the Ac-im insertion was mapped with an RFLP probe (Figure 2C, 5'-probe) generated with primers LC12 and LC13. Flanking DNA directly adjacent downstream of the Ac-im was mapped with an RFLP probe (Figure 2C, 3'-probe) produced using primers LC26 (ATTGTGGCAGAACTGAACAATCC) and LC27 (TCCTCAATCTTCCTCTAATCCCCTA).



View larger version (16K):
In this window
In a new window
Download PPT slide
 
FIGURE 5.—

Genetic scheme to identify premeiotic excisions of Ds. Lines hemizygous for Ac-im were crossed by the r1-sc:m3 Ds tester line. Kernels displaying a fully colored aleurone were selected. These kernels were sown and plants were testcrossed to the Ds reporter line. If Ds excisions occurred exclusively in the gametophyte, all progeny plants that inherit an R1-sc allele would also inherit Ac-im. The expected and observed frequencies of progeny genotypes are shown, assuming independent assortment of Ac-im and R1-sc.

 


View larger version (74K):
In this window
In a new window
Download PPT slide
 
FIGURE 3.—

Ac-im catalyzes Ds transposition from the r1 locus. Genomic DNA was isolated from seedling tissue and digested with PvuII prior to DNA blot analysis using (A) an r1-specific probe and (B) a Ds6-specific probe. DNA was isolated from putative revertant alleles (lanes 1–12), from a homozygous Ac-im individual (lane 13), a homozygous r1-sc:m3 individual (lane 14), or from an individual homozygous for the r1-g allele (lane 15). Roche Ladder VII-Dig labeled was run in lane 16. Newly tr-Ds elements are identified by an asterisk.

 


RESULTS

Identification of Ac-im:

The Ac-im allele was initially selected as a finely spotted kernel carrying a transposed Ac (tr-Ac) and the donor P1-vv::Ac allele (see MATERIALS AND METHODS). To map the tr-Ac relative to P1-vv::Ac, the doubly hemizygous plant (P1-vv::Ac/+, Ac-im/+) was testcrossed by pollen carrying the Ds reporter r1-sc:m3. Approximately 50% of testcross seed was coarsely spotted, indicating that P1-vv::Ac and Ac-im are genetically unlinked (see MATERIALS AND METHODS).

In an attempt to generate transpositions from Ac-im, ears homozygous for Ac-im were crossed by pollen carrying the Ds reporter, r1-sc:m3. Although we typically detect Ac transpositions at a frequency of 2–4% as finely spotted or near colorless kernels (KOLKMAN et al. 2005), no transposition events were detected in screens of ~6800 progeny kernels. This finding suggested that Ac-im was either greatly impaired in or incapable of autonomous transposition or did not contribute to the canonical "negative dosage effect" of Ac (MCCLINTOCK 1948; BRINK and NILAN 1952).

To examine the effects of Ac-im copy number on Ds excision patterns, crosses were performed with lines homozygous for the Ac-im and the Ds tester line r1-sc:m3. As shown in Figure 1A, a single copy of Ac inherited through the male gametophyte results in a very coarsely spotted aleurone, suggesting that Ds excisions from r1 occur often and early in endosperm development. Transmission of Ac-im through the female gametophyte yields two copies of Ac-im in the triploid endosperm and conditions less frequent excisions of Ds (Figure 1B). The frequency of Ds excisions decreases further in lines homozygous for Ac-im (Figure 1C) where kernels often contain a single, large, colored sector and many very fine spots or a few very fine spots, patterns typical of lines homozygous for an Ac insertion in the W22 inbred (KOLKMAN et al. 2005). This change in aleurone variegation in response to Ac copy number is consistent with the notion that Ac-im contributes to the negative dosage effect of Ac. The relative uniformity of the spotting patterns also suggests that Ac-im is not undergoing cycles of inactivation and reactivation known as "changes in phase" (MCCLINTOCK 1964). Thus, Ac-im appears to encode a transposase that is capable of mediating Ds excisions at a time and frequency that is similar to active Ac elements.



View larger version (114K):
In this window
In a new window
Download PPT slide
 
FIGURE 1.—

Ac-im contributes to negative dosage. Aleurone variegation patterns of ears carrying (A) one, (B) two, or (C) three copies of Ac-im in the triploid endosperm. Kernels with fully colored aleurone (clearly visible in B and C) carry revertant R1-sc alleles resulting from excisions of the Ds at r1.

 

Molecular characterization of Ac-im:

DNA blot analysis was performed to examine the structure and methylation status of Ac-im. Methylation of the internal PvuII sites of Ac is diagnostic of inactive or cycling Ac elements and hypomethylation at these sites is correlated with activity (SCHWARTZ and DENNIS 1986; CHEN et al. 1987; CHOMET et al. 1987). As shown in Figure 2, a 7.4-kb EcoRI fragment (Figure 2A, lanes 1 and 2) and a 5.6-kb PstI fragment (Figure 2A, lanes 6 and 7) were detected with an Ac-specific fragment in lines carrying Ac-im but not from the near-isogenic progenitor lines (Figure 2A, lanes 3–4 and 8–9). Our ability to detect Ac-im with the methylation-sensitive enzyme PstI suggests that it lies in a hypomethylated region of the genome. To survey the methylation status of the element itself, DNA was digested with the methylation-sensitive restriction enzyme PvuII. As shown in Figure 2A, the predicted 2.6-kb internal fragment of Ac was detected in lines carrying Ac-im (lanes 11 and 12) and the progenitor P1-vv::Ac line (lane 13) but not in the Ds reporter line lacking Ac activity (lane 14). Together, these findings suggest that Ac-im is present in a hypomethylated region of the maize genome and is itself hypomethylated.

To examine the fine structure of Ac-im, Ac-im and ~1.1 kb of DNA flanking the element were cloned using inverse PCR (IPCR) (see MATERIALS AND METHODS). Sequence analysis revealed a deletion of 10 bp at the terminal left end of the element (we define the left end of Ac as the end closest to the internal BamHI site of Ac) and no 8-bp duplication of flanking sequences, typical of most Ac and Ds insertion sites (FEDOROFF et al. 1983). Otherwise, the element was identical to previously published Ac sequence (GenBank accession no. X05424). As a PstI site was located 11 bp from the right end of Ac, additional sequences were cloned following IPCR amplification of total genomic DNA digested with XhoI (see MATERIALS AND METHODS). A schematic of the Ac-im element and flanking sequences is shown in Figure 2C.

The 10-bp deletion of Ac end sequences and absence of an 8-bp duplication of flanking sequence indicated that the insertion of Ac-im was likely the result of an aberrant transposition event. Sequence ~300 bp immediately flanking the left end of Ac-im showed homology to a Prem-1 retroelement (GenBank accession no. U03680.1). However, sequences flanking the right end of Ac-im show homology to an unannotated maize clone (GenBank accession no. MAGI 75050) and not to the retroelement insertion, suggesting that the integration event was complex.

To further characterize the Ac-im insertion site, we attempted to recover the insertion site from the progenitor lines by PCR amplification. As shown in Figure 2D, PCR amplification products of the predicted size were obtained when using Ac end primers and both left-end (LC30) and right-end (LC28) flanking primers from DNA isolated from individuals carrying Ac:im (Figure 2B, lanes 1, 2, 5, and 6) but not from DNA isolated from progenitor lines (Figure 2B, lanes 3–4 and 7–8). This finding is consistent with the results of DNA blot analysis indicating that Ac-im represents a novel insertion and not the reactivation of a cryptic Ac allele. We further reasoned that if the integration of Ac-im was associated with a relatively small rearrangement of flanking sequences, it should be possible to amplify a fragment of ~382 bp from the progenitor lines using primers LC28 and LC30 located 81 and 301 bp from the left and right ends of the Ac-im element, respectively (see Figure 2C). However, despite many attempts, we were unable to amplify any products of the predicted size from the progenitor lines, indicating that the rearrangement included at least one of the flanking primer sequences (data not shown). When primers LC28 and LC30 were used with DNA isolated from lines homozygous for Ac-im, a 4.9-kb band containing Ac-im was amplified but we failed to amplify products of ~382 bp, indicating an absence of somatic excisions events. The 4.9-kb product was subcloned and sequenced to verify the junction of the insertion plus 382 bp of flanking DNA (data not shown). Together, these findings indicate that Ac-im is a novel Ac insertion incapable of somatic excision that is associated with a rearrangement at the site of integration.

Although sequences immediately flanking the left end of Ac-im were repetitive, a single-copy probe was generated ~700 bp from the left end of the element (5'-probe; Figure 2C). Interestingly, this fragment detected two EcoRI fragments in lines carrying Ac-im (Figure 2B, lanes 1 and 2), but a single fragment in the progenitor lines (Figure 2B, lanes 3 and 4). The 7.4-kb band is identical in size to the fragment detected with the internal Ac probe, indicating that this fragment contains ~2.5 kb of internal Ac sequence and 4.9 kb of DNA flanking the Ac-im insertion. This probe also detected the 5.6-kb PstI fragment identified with the Ac-specific DNA probe in Ac-im individuals (Figure 2B, lanes 6 and 7), but did not hybridize to any bands in the progenitor DNA digested with PstI (Figure 2B, lanes 8 and 9) or PvuII (Figure 2B, lanes 13 and 14). Taken together, these results suggest that the transposition event that generated Ac-im resulted in a duplication of a single-copy region from the P1-vv::Ac progenitor line that now flanks the left end of Ac-im. This sequence is likely hypermethylated in the progenitor genomes and thus not detected in DNA blot analysis with the methylation-sensitive restriction enzymes PstI or PvuII.

Both the 5'-probe described above and a 3'-probe designed to sequences immediately flanking the right end of the Ac-im (see Figure 2C) were positioned on the short arm of chromosome 7 (7.02) using the intermated B73 x Mo17 recombinant inbred population (LEE et al. 2002). Interestingly, although both fragments localized to the same bin, the map scores were not identical. The 5'-probe mapped between markers mon03068 and bnlg1808, ~5.6 coordinates from mon03068 on the IBM94 framework map. However, the 3'-probe was placed 4.4 coordinates from mon03068 (M. POLACCO, personal communication). This differential placement corresponded to recombination events that occurred between the 5'- and 3'-probe sequences in three lines of the IBM94 population. These findings with the results of DNA blot anlaysis suggest that the transposition of Ac-im from the p1 locus was associated with the duplication of sequences linked to the site of Ac-im insertion.

To further investigate the mechanism of Ac-im formation, kernels were selected from the original mapping ear that contained approximately equal numbers of spotted and colorless kernels (see MATERIALS AND METHODS). DNA blot analysis confirmed that both P1-vv::Ac and Ac-im were segregating on this testcross ear and were represented at equal frequencies in the coarsely spotted kernel class (data not shown). These findings indicate that deletion of Ac end sequences from the left end of Ac-im was likely generated during or soon after transposition of the Ac from the p1 locus to an unlinked site in the maize genome where it contributed to Ac dosage. Our genetic selection for transposition events as single, finely spotted, or near colorless kernels favors the recovery of tr-Acs that are inherited with the Ac (P1-vv::Ac) on the sister chromatid of the donor and biases against the recovery of the excision chromosome (see KOLKMAN et al. 2005). Thus, it is not possible to examine the molecular footprint of the empty donor site at the P1-vv::Ac locus. Nevertheless, the results of DNA blot analysis and segregation analysis of F2 progeny are consistent with a scenario in which a deletion of Ac-im end sequences and the resulting insertion site rearrangement occurred as a single aberrant excision and integration event. An important consequence of this event is the creation of a novel endogenous Ac transposase source that is capable of transactivating Ds, but is itself incapable of autonomous excision.

Frequency of Ds transposition catalyzed by Ac-im:

To explore the potential of Ac-im in the development of a two-component Ac/Ds gene-tagging system in maize, the frequency of Ac-im-mediated germinal Ds excision events was examined when Ac-im was transmitted through either the male or female gametophyte. Lines homozygous for Ac-im and r1-sc:m3 were crossed by pollen homozygous for a deletion allele of the r1 locus (Ac-im/Ac-im, r1-sc:m3/r1-sc:m3 x +/+, r1-g/r1-g). The majority of F1 testcross progeny, hemizygous for Ac-im and r1-sc:m3, displayed a coarse spotted aleurone typical of kernels that inherit a single copy of Ac through the female gametophyte. However, a small percentage of the progeny kernels displayed a fully colored aleurone, indicative of Ds excision from the r1 locus prior to the division of the triploid primary endosperm nucleus.

Of the 438 progeny kernels examined, 53 (12%) had a fully colored aleurone layer, indicating an excision of the Ds from the r1-sc:m3 prior to the division of the triploid primary endosperm nucleus. To molecularly characterize these events, the solid purple kernels were planted in the greenhouse and DNA was extracted from 35 recovered seedlings. DNA blot analysis was then performed using five different restriction enzymes to detect the maximum number of Ds transpositions that were inherited in these F1 progeny using R1- and Ds6-specific probes (see MATERIALS AND METHODS). A representative DNA blot of PvuII-digested DNA from 12 individuals is shown in Figure 3. The R1 probe detects the R1-sc excision allele (5.6 kb) and the r1-sc:m3 allele (3.5 kb), but not the r1-g deletion allele (lane 15). The band corresponding to the r1-sc:m3 allele is smaller due to the presence of a single PvuII site within the Ds element. The Ds6-like probe detected the Ds6-like element at R1 (3.5 kb) or at new insertions elsewhere in the genome ( Figure 3B, asterisk).

Surprisingly, the r1-sc:m3 allele was detected in 15 of the 35 individuals examined, despite selections for kernels with fully colored aleurone (e.g., Figure 3, A and B, lanes 3, 4, 11, 13, and 14). This finding indicates that many Ds excisions occurred during the mitotic divisions of the female gametophyte. As shown in Figure 4, the triploid endosperm nucleus is derived from the fusion of two polar nuclei from the female parent and one sperm nucleus from the male. The embryo is derived from the fusion of a separate sperm cell nucleus with the egg cell. Ds excisions that occur at multiple mitotic cell divisions of megagametogenesis may result in nonconcordance between endosperm and embryo genotypes (asterisk in Figure 4A). The high frequency of nonconcordant embryo and endosperm genotypes (43%) suggests that many if not all Ds excisions from r1-sc:m3 occur during the gametophytic phase of development (i.e., after the functional megaspore begins to divide).



View larger version (13K):
In this window
In a new window
Download PPT slide
 
FIGURE 4.—

Mitotic divisions of gametophyte development. (A) In megagametogenesis, a single meiotic product forms the megaspore and the remaining three cells disintegrate. Following three rounds of mitotic divisions, eight nuclei are generated, including three antipodals, two polar nuclei, one egg nucleus, and two synergids. (B) In microsporogenesis, all four meiotic products develop into pollen grains. Each haploid cell undergoes a mitotic division to produce the generative and vegetative nuclei. The generative nucleus undergoes a second mitotic division to generate two sperm nuclei. Ds excisions that occur at cell divisions marked with an asterisk will result in nonconcordant embryo and endosperm phenotypes. A was adapted from DOONER and BELACHEW (1989).

 
Transposed Ds (tr-Ds) elements were not detected in 7 individuals on DNA blot analysis using five different restriction enzymes despite the absence of the Ds reporter from R1 (e.g., Figure 3, lanes 5, 6, and 8). This finding may reflect the poor representation of restriction enzymes sites flanking these Ds insertions or, more likely, the independent assortment of the tr-Ds inserted at a site unlinked to the revertant R1 allele following a transposition event that occurred premeiotically, or the loss of the Ds element following excision. Of the remaining 13 individuals, novel Ds6-containing fragments were detected with at least one of the five restriction enzymes used and the seedlings did not carry the parental r1-sc:m3 Ds allele (e.g., Figure 3, lanes 1, 2, 7, 9, 10, and 12). In all instances, the band sizes were clearly discernible as distinct bands of a unique size (Figure 3, asterisk). In summary, 13 independent tr-Ds insertions were detected among 35 individuals screened by DNA blot analysis. In total, 53 fully colored kernels from a population of 438 kernels were identified. Thus, Ac-im mobilizes Ds at the r1-sc:m3 locus resulting in the recovery of germinal Ds insertions in 4.5% (13/35 x 53/438) of progeny seed when transmitted through the female gametophyte. This frequency represents a minimal transposition frequency as the number of tr-Ds insertions was determined by DNA blot analysis and not all tr-Ds elements will be detected using this methodology.

The frequency of Ds excision from the r1 locus was also examined when Ac-im was transmitted through the male gametophyte. Plants homozygous for r1-sc:m3 were pollinated by individuals homozygous for Ac-im. One hundred twenty-eight solid purple revertant kernels were selected from a total of 808 kernels (16%). The 128 purple kernels were planted and 54 testcross ears that were pollinated by the r1-sc:m3 tester were recovered. Thirty-two of 54 plants (59%) inherited a Ds excision allele (R1-sc) as evidenced by >50% fully colored kernels on testcross ears. We expected >50% of the kernels to be fully colored as additional Ds excision alleles would be generated on testcross ears. Interestingly, this 41% nonconcordance is essentially the same frequency that was determined when Ac-im was transmitted through the female gametophyte (43%) and suggests that the majority of Ds excisions mediated by Ac-im occur during mega- and microgametophytic development. As shown in Figure 4B, only Ds excisions that occur during the S-phase preceding the mitotic division of the generative cell nucleus will result in nonconcordant endosperm and embryo genotypes. Thus, Ac-im mediates Ds excision from r1-sc:m3 at the S-phase preceding the second mitotic division of the male gametophyte in nearly half of all pollen grains that carry the Ac-im allele.

In summary, the frequencies of fully colored (12% vs. 16%) and nonconcordant (43% vs. 41%) kernel tissues are similar when Ac-im is transmitted through the female or male gametophyte, respectively. The high rate of nonconcordance observed when Ac-im is transmitted through either the male or female gametophytes indicates that Ds excisions from r1-sc:m3 frequently occur soon after meiosis. Thus, the majority of kernels that inherit a tr-Ds transactivated by Ac-im should carry novel insertions and not a common insertion generated through clonal propagation of lineage carrying a tr-Ds insertion that occurred early in sporophytic development.

Ac-im mediates sporophytic and gametophytic Ds excisions:

As described above, and previously shown (DOONER and BELACHEW 1989), nonconcordance of endosperm and embryo genotypes is frequently observed as a result of Ac-mediated excision events occurring during gametophytic development. We therefore designed an experiment to test if all Ac-im-mediated transposition occurs during gametophytic development (Figure 5). Lines hemizygous for Ac-im were testcrossed by pollen from the r1-sc:m3 Ds tester and fully colored F1 kernels were selected. These fully colored kernels were sown and resulting plants were testcrossed by pollen from the r1-sc:m3 tester. If Ds excisions occur only during gametophytic development then all fully colored kernels would be expected to carry Ac-im and segregate spotted kernels. However, if Ac-im mediated exclusively premeiotic excisions of Ds that are inherited through the megaspore mother cell lineage, independent assortment of the revertant R1-sc (chromosome 10) and Ac-im (chromosome 7) alleles would produce ears that, in 50% of cases, carry R1-sc alleles but not Ac-im.

Sixty-two fully colored F1 kernels were selected from 4 testcross ears and progeny plants were backcrossed by the Ds tester. DNA blot analysis revealed that 8 of the 62 progeny plants carried only the r1-sc:m3 allele as a result of nonconcordance in selected kernels. Thus, 49 individuals carried Ac-im and 13 did not (Table 1). A chi-square goodness of fit test indicated a deviation from 1:1 segregation of ears carrying Ac-im and those lacking Ac-im (P = 4.83 x 10–6). Thus, when a fully colored kernel is selected, Ac-im more often cosegregates with the Ds excision allele than would be expected by chance, demonstrating that many excisions occur during gametophytic development as discussed above. Nevertheless, Ac-im is capable of mediating premeiotic excisions of Ds in lineages that ultimately form the megaspore mother cell as evidenced by the recovery of 13 testcross ears that did not carry Ac-im. If we assume that the frequency of premeiotic Ds excision is the same in lines that inherit Ac-im and those that do not, then we can approximate the frequency of premeiotic excision as (13 + 13)/54 = 48%. Thus, approximately equal frequencies of premeiotic and gametophytic Ds excision events from r1-sc:m3 are mediated by Ac-im. However, differences in the rates of nonconcordance between lines hemizygous (8/62) and homozygous (15/35) for Ac-im suggest that premeiotic Ds excision events occur more frequently when a single copy of Ac-im is maintained in the genome.


View this table:
In this window
In a new window

 
TABLE 1

Segregation of Ac-im and newly tr-Ds elements

 

Ac-im mediates somatic excision from multiple Ds elements throughout the genome:

To examine the utility of Ac-im in developing large-scale two-component tagging programs in maize, lines that carried both Ac-im and Ds insertions at multiple loci throughout the genome were generated. Lines homozygous for both Ac-im and the Ds reporters bz1-m2::Ds, a2-m4::Ds, and a1-m3::Ds were grown and plants were examined for the presence of somatic excision events. As shown in Figure 6, all three lines displayed revertant somatic sectors on anther and stem tissues, indicating that Ac-im catalyzes the transposition of all three of these Ds reporters in somatic tissue. Fully colored kernels were also recovered on testcross progeny recovered from all three tester lines, indicative of germinal excision events. Ds insertions in bz1 and a2 are in exon sequences; thus, few excisions events are expected to restore gene function (DOONER et al. 1985; E. VOLLBRECHT, personal communication). Consequently, revertant sectors are infrequent and small. Figure 6B shows an exceptional single anther sector (arrow) among otherwise finely spotted anthers on a plant carrying the a2-m4::Ds allele. In summary, Ac-im is capable of catalyzing the excision of multiple Ds elements throughout the maize genome and in several plant tissues.



View larger version (138K):
In this window
In a new window
Download PPT slide
 
FIGURE 6.—

Ac-im catalyzes somatic excision from multiple Ds insertions. Lines homozygous for the Ac-im and a Ds insertion allele, (A) bz1-m2::Ds(DII), (B) a2-m4::Ds, and (C) a1-m3::Ds, were grown to maturity and photographed at flowering. Revertant sectors can be seen as colored sectors in anther (A and B) and sheath (C) tissue. Full anther sector is indicated by arrow in B.

 
As detailed in Table 2, we have assembled a collection of Ds insertion alleles obtained through the Maize Genetics Cooperative Stock Center or generously provided to us by members of the community. Alleles that have been maintained in the W22 inbred have been backcrossed to Ac-im and self-pollinated, creating populations that are segregating Ac-im and the Ds reporter. Alleles that have not been maintained in W22 are currently being backcrossed to the W22 inbred (Table 2). After five generations of backcrossing, plants will be crossed to Ac-im (BC6) and self-pollinated. The goal is to develop multiple Ds tester lines in a common genetic background for use with the Ac-im transposase source. These genetic materials will greatly facilitate phenotypic characterizations of any mutants recovered and aid in the establishment of a comprehensive two-component Ac/Ds gene-tagging program for maize.


View this table:
In this window
In a new window

 
TABLE 2

Ds insertion alleles

 


DISCUSSION
A novel immobilized Ac element, Ac-im, which is incapable of autonomous transposition, but transactivates Ds insertions throughout the genome, has been characterized. Sequence analysis revealed that Ac-im contains a 10-bp deletion at its left end (nearest the BamHI site within Ac) and is not flanked by an 8-bp duplication of target sequences typical of Ac and Ds insertions (MULLER-NEUMANN et al. 1984; POHLMAN et al. 1984). Ac-im is nearly identical to Ac and encodes a functional transposase that contributes to the canonical negative dosage effect of Ac (MCCLINTOCK 1951; BRINK and NILAN 1952).

Several studies have indicated that the terminal left- and right-end sequences of Ac are essential for transposition in transgenic systems (KUNZE 1996). However, only one Ac derivative has been characterized in maize that displays an altered transposition pattern due to a mutation in the terminal inverted repeat of the element. The P1-vv5145 allele lacks the terminal adenosine residue at the right end of Ac and displays a greatly reduced rate of somatic excision (XIAO and PETERSON 2002). The most notable difference between Ac-im and P1-vv5145 is that somatic excisions, although rare, do occur in lines carrying P1-vv5145. In screens of 6800 testcross progeny, and in PCR assays performed on leaf tissue, we were unable to detect any germinal or somatic excision events from lines carrying Ac-im. Interestingly, a similar Ac derivative termed Ac3 was recovered as a stable Ac source from transgenic tomato plants carrying an active maize Ac transposon (HEALY et al. 1993). The Ac3 derivative appears to have been generated following transposition of an active Ac from its donor T-DNA locus to an unlinked site in the genome that resulted in the deletion of the terminal five nucleotides at the left end of Ac (CAGGG). In DNA blot analysis, no somatic or germinal transposition events could be detected from lines that carried Ac3, suggesting that the terminal 5 bp at the left end of Ac are essential for transposition (HEALY et al. 1993). Thus, our data with previous characterizations of Ac derivatives indicate that Ac-im is incapable of somatic or germinal excision due to the deletion of 10 bp at the terminal left end of the element.

Generation of the Ac-im allele:

A possible mechanism for the formation of the Ac-im element is presented in Figure 7. This model expands on the one proposed for the creation of the P1-vv5145 allele in which Ac excision proceeds in a two-step process following replication through the p1 locus (XIAO and PETERSON 2002). Both P1-vv5145 and Ac-im were derived from the same donor Ac insertion at the p locus (P1-vv::Ac; EMERSON 1914). In the model of XIAO and PETERSON (2002), exonucleolytic degradation at the right end of Ac, immediately after double-strand-break formation, results in an abortive transposition event and the deletion of 1 bp of Ac and 1 bp of flanking DNA sequence to create the P1-vv5145 allele (see XIAO and PETERSON 2002, Figure 6). In the formation of Ac-im, we envision a similar two-step transposition process (Figure 7A) initiated by a staggered 1-bp double-strand break that occurs at the right end of the element (COEN et al. 1989; WEIL and KUNZE 2000). However, an aberrant excision event at the left end of the element is associated with an exonucleolytic attack that results in a deletion of 10 bp from this end of the element, eliminating the left-end terminal inverted repeat (TIR) and most likely flanking DNA at the p1 locus. Numerous studies have demonstrated that the TIRs are involved in transposase binding and are essential for normal integration of Ac (reviewed in KUNZE 1996; BECKER and KUNZE 1997). The loss of these left-end tranposase-binding sites precludes normal integration of Ac-im into the target site.



View larger version (12K):
In this window
In a new window
Download PPT slide
 
FIGURE 7.—

Model of Ac-im formation. (A) As the replication fork proceeds through the p1 locus from right to left, transposase molecules (circles) bind to the terminal inverted repeat (triangle) and subterminal repeats at the right end of the Ac element in the P1-vv::Ac allele and generate a double-strand break (arrows). After the left end nearest BamHI site (BamHI site marked as B) is replicated, a double-strand break is generated followed by exonucleolytic attack (crescents) that removes 10 bp at the left end of the Ac and possibly flanking DNA at the p1 locus. (B) The right end of Ac-im integrates into the target site. (C) A synthesis-dependent SDSA copies nonallelic flanking sequences (dashed line) adjacent to the left end of Ac-im. (D) NHEJ ligates newly synthesized "filler DNA" to the target site.

 
Ac-im was selected as an unlinked transposition from p1 and molecularly mapped to chromosome 7. Integration at the target site may have initially proceeded through the generation of an 8-bp staggered double-strand break and participation of both ends of the Ac-im element (KUNZE and WEIL 2002). Alternatively, the intact right end may have acted exclusively to create a double-strand break in a process similar to Ac/Ds excision (KUNZE and WEIL 2002). The intact right-end integration event likely proceeded through a nonhomologous end-joining (NHEJ) process (RINEHART et al. 1997; PUCHTA 2005), whereas left-end integration was interrupted due to the deletion of the terminal 10 bp (Figure 7B).

We propose that the left-end integration is resolved through a synthesis-dependent strand-annealing (SDSA) mechanism of DNA repair (Figure 7C; GORBUNOVA and LEVY 1999). Frequently, SDSA is initiated by a 3'-strand invasion event (SALOMON and PUCHTA 1998) with as little as 1–6 bp of homology (RUBIN and LEVY 1997). The weak association between the template and newly synthesized DNA can also lead to template switching (GORBUNOVA and LEVY 1999). One consequence of SDSA is the creation of "filler DNA," from single or multiple sites in the genome, at the site of Ac or Ds insertion, which has little or no homology to sequences at the target sites of the progenitor lines (RUBIN and LEVY 1997; SALOMON and PUCHTA 1998; GORBUNOVA and LEVY 1999).

In the case of Ac-im, the 294 bp of sequence immediately upstream of the element shares homology to Prem1-like retroelements while sequences farther upstream (e.g., 5'-probe sequences) are single copy in the progenitor lines, but duplicated in lines carrying Ac-im (Figure 2B). To account for this duplication of sequence, we hypothesize that a 3' invasion of sequence with homology to a Prem1-like element initiated the SDSA process. Either DNA synthesis continued using the original template strand or template switching occurred in which the newly synthesized DNA was released and a secondary strand invasion occurred at a new site elsewhere in the genome. Map data suggest that the template for "filler DNA" is closely linked to Ac-im as both right- and left-end flanking sequences are located on chromosome 7.02. The process continued until the "filler DNA" was ligated through NHEJ to the insertion site (Figure 7D).

An important consequence of Ac-im insertion was that a single-copy region of the W22 genome was duplicated. Recent studies have revealed widespread violation of genetic colinearity throughout the maize genome (FU and DOONER 2002; BRUNNER et al. 2005) and have identified transposable helitrons as likely mediators of many gene duplication events that generate this intraspecific variation (LAI et al. 2005; MORGANTE et al. 2005). Here we have proposed another mechanism to account for a duplication of single-copy sequence mediated by the transposable element Ac.

Utility of Ac-im in two-component Ac/Ds gene tagging:

As demonstrated for a number of transgenic systems, a two-component Ac/Ds platform affords several advantages for mutagenesis. Ac/Ds tagging systems have been utilized to isolate a number of genes (BANCROFT et al. 1993; JONES et al. 1994; JAMES et al. 1995; BHATT et al. 1996; MEISSNER et al. 1999), to define promoter and enhancer elements (SUNDARESAN et al. 1995; CHIN et al. 1999; GRECO et al. 2003; WU et al. 2003; JIN et al. 2004), and to create genetic mosaics for clonal analysis (PENG and HARBERD 1997; JENIK and IRISH 2001). The tendency of Ds to transpose to linked sites has also been exploited to disrupt genes present in tandem arrays (TAKKEN et al. 1999; TANTIKANJANA et al. 2004) and to perform localized saturation mutagenesis (NISHAL et al. 2005). Ac/Ds mutagenesis platforms in Arabidopsis (SUNDARESAN et al. 1995; ITO et al. 1999; MUSKETT et al. 2003; KUROMORI et al. 2004), tomato (HEALY et al. 1993; KNAPP et al. 1994; MEISSNER et al. 2000), tobacco (SCOFIELD et al. 1992), rice (CHIN et al. 1999; ZHENG-GE et al. 2003; KIM et al. 2004; KOLESNIK et al. 2004), and barley (KOPREK et al. 2000; COOPER et al. 2004) have been developed. Yet, despite the demonstrated utility of Ds in gene tagging in maize (HAKE et al. 1989; COLASANTI et al. 1998), a two-component Ac/Ds gene-tagging program for this important crop plant has not yet been developed.

One limitation to the development of an Ac/Ds program has been the lack of a genetically well-characterized source of stable transposase. Although several Ac derivatives in maize have been identified (CHOMET 1988; DEMPSEY 1993; BRUTNELL et al. 1997; XIAO and PETERSON 2002), the frequency of Ds excision mediated by these elements is very low (DEMPSEY 1993; BRUTNELL et al. 1997) or has not been determined (CHOMET 1988; XIAO and PETERSON 2002). Here we have shown that Ac-im is capable of catalyzing germinal Ds transpositions from the r1 locus, resulting in the recovery of independent Ds insertions in ~4.5% of progeny kernels. Furthermore, no somatic excisions or germinal transpositions of Ac-im were detected in our PCR and genetic screens.

There are several potential genetic schemes for exploiting Ac-im in two-component gene-tagging programs. As shown in Table 2, many Ds insertions have been characterized throughout the maize genome and each of these elements has the potential to serve as a donor locus in regional mutagenesis experiments. To mobilize these Ds insertions, plants homozygous for Ac-im and the Ds reporter are first self-pollinated to bulk seed stocks. Revertant kernels are then selected on testcross ears generated in directed or nondirected tagging schemes (see BRUTNELL and CONRAD 2003). Studies in maize have shown that the majority of Ac transposition events are to linked sites in the genome (VAN SCHAIK and BRINK 1959; GREENBLATT 1984; DOONER and BELACHEW 1989). As Ds transposition is mediated through the activity of the Ac transposase, it is likely that the distribution of Ds transposition will display a similar profile (KERMICLE et al. 1989; WEIL et al. 1992). In a directed tagging program, plants carrying a mutation in the gene of interest (reference allele) are crossed to lines that carry the Ac-im allele and a Ds insertion that is closely linked to the gene of interest. As Ac-im mediates a high frequency of gametophytic excision through the male and female lineages, the direction of the cross can be determined by whichever genotypes are limiting. Revertant kernels would be selected and F1 progeny screened for mutant phenotypes. In a nondirected tagging program, revertant kernels would be selected from testcross progeny and plants self-pollinated to create segregating families. On the basis of the findings presented here, ~37% (13/35) of revertant kernel selections could be expected to carry unique tr-Ds insertions. However, it should be noted that Ds transposition frequencies can vary dramatically between reporter alleles (EISSES et al. 1997). A comprehensive study now underway in our laboratory will examine the frequencies of Ac-im-mediated Ds transposition frequencies from each of the Ds insertions listed in Table 2.

In most cases, independent assortment of the Ac-im (located on chromosome 7) and the gene of interest will result in the recovery of both stable and unstable alleles. The recovery of genetically stable alleles will greatly facilitate reverse-genetic screens, where somatic excision events can be eliminated by segregrating the Ac-im allele away through a second generation of testcrossing to the Ds reporter allele. Somatically unstable alleles will also be advantageous for creating an allelic series at the site of Ds insertion. Germinal Ds excision events can occur precisely to restore gene function and generate revertant alleles or imprecisely to create an allelic series (WESSLER et al. 1986; GIROUX et al. 1996; SCHULTES et al. 1996). The high frequency of gametophytic Ds excision mediated by Ac-im with its stability in the genome makes this novel derivative a valuable allele for two-component forward and reverse genetic programs in maize.


ACKNOWLEDGEMENTS
We thank Erik Vollbrecht and Judy Kolkman for critical reading of the manuscript and Lauren Putnam, Kelly Dusinberre, Marika Olson, Mellisa Kerrick, and Tracy Blasioli for field assistance. We also thank Phyllis Farmer for providing the map data, Mary Alleman for providing unpublished R1 gene sequence, and Jerry Kermicle for the gift of the a1-m3::Ds and a2-m4::Ds alleles. This work was supported by a grant from the National Science Foundation to T.P.B. (DBI-0076892).


FOOTNOTES
Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under accession nos. DQ068387DQ068389 and DQ168849.


LITERATURE CITED

ALLEMAN, M., and J. L. KERMICLE, 1993 Somatic variegation and germinal mutability reflect the position of transposable element Dissociation within the maize R gene. Genetics 135: 189–203.[Abstract]

AUGER, D. L., and W. SHERIDAN, 1999 Maize stocks modified to enhance the recovery of Ac-induced mutations. J. Hered. 90: 453–458.[Abstract/Free Full Text]

BANCROFT, I., J. D. JONES and C. DEAN, 1993 Heterologous transposon tagging of the DRL1 locus in Arabidopsis. Plant Cell 5: 631–638.[Abstract/Free Full Text]

BECKER, H. A., and R. KUNZE, 1997 Maize Activator transposase has a bipartite DNA binding domain that recognizes subterminal sequences and the terminal inverted repeats. Mol. Gen. Genet. 254: 219–230.[CrossRef][Medline]

BHATT, A. M., T. PAGE, E. J. LAWSON, C. LISTER and C. DEAN, 1996 Use of Ac as an insertional mutagen in Arabidopsis. Plant J. 9: 935–945.[CrossRef][Medline]

BRINK, R. A., and R. A. NILAN, 1952 The relation between light variegated and medium variegated pericarp in maize. Genetics 37: 519–544.[Free Full Text]

BRUNNER, S., K. FENGLER, M. MORGANTE, S. TINGEY and A. RAFALSKI, 2005 Evolution of DNA equence nonhomologies among maize inbreds. Plant Cell 17: 343–360.[Abstract/Free Full Text]

BRUTNELL, T. P., and L. J. CONRAD, 2003 Transposon tagging using Activator (Ac) in maize. Methods Mol. Biol. 236: 157–176.[Medline]

BRUTNELL, T. P., and S. L. DELLAPORTA, 1994 Somatic inactivation and reactivation of Ac associated with changes in cytosine methylation and transposase expression. Genetics 138: 213–225.[Abstract]

BRUTNELL, T. P., B. P. MAY and S. L. DELLAPORTA, 1997 The Ac-st2 element of maize exhibits a positive dosage effect and epigenetic regulation. Genetics 147: 823–834.[Abstract]

CHANDLEE, J., 1990 The utility of transposable elements as tools for the isolation of plant genes. Phyiol. Plant 79: 105–115.[CrossRef]

CHEN, J., and S. L. DELLAPORTA, 1994 Urea-based plant DNA miniprep, pp. 526–527 in The Maize Handbook, edited by M. FREELING and V. WALBOT. Springer-Verlag, New York.

CHEN, J., I. M. GREENBLATT and S. L. DELLAPORTA, 1987 Transposition of Ac from the P locus of maize into unreplicated chromosomal sites. Genetics 117: 109–116.[Abstract/Free Full Text]

CHIN, H. G., M. S. CHOE, S. H. LEE, S. H. PARK, J. C. KOO et al., 1999 Molecular analysis of rice plants harboring an Ac/Ds transposable element-mediated gene trapping system. Plant J. 19: 615–623.[CrossRef][Medline]

CHOMET, P., 1988 Characterization of stable and metastable changes of the maize transposable element, Activator. Ph.D. Thesis, State University of New York, Stony Brook, NY.

CHOMET, P. S., S. WESSLER and S. L. DELLAPORTA, 1987 Inactivation of the maize transposable element Activator (Ac) is associated with its DNA modification. EMBO J. 6: 295–302.[Medline]

CHOPRA, S., P. ATHMA, X. G. LI and T. PETERSON, 1998 A maize Myb homolog is encoded by a multicopy gene complex. Mol. Gen. Genet. 260: 372–380.[CrossRef][Medline]

CHURCH, G. M., and W. GILBERT, 1984 Genomic sequencing. Proc. Natl. Acad. Sci. USA 81: 1991–1995.[Abstract/Free Full Text]

COEN, E. S., T. P. ROBBINS, J. ALMEIDA, A. HUDSON and R. CARPENTER, 1989 Consequences and mechanism of transposition in Antirrhinum majus, pp. 413–436 in Mobile DNA, edited by D. E. BERG and M. M. HOWE. American Society for Microbiology, Washington, DC.

COLASANTI, J., Z. YUAN and V. SUNDARESAN, 1998 The Indeterminate gene encodes a zinc finger protein and regulates a leaf-generated signal required for the transition to flowering in maize. Cell 93: 593–603.[CrossRef][Medline]

COOPER, L. D., L. MARQUEZ-CEDILLO, J. SINGH, A. K. STURBAUM, S. ZHANG et al., 2004 Mapping Ds insertions in barley using a sequence-based approach. Mol. Genet. Genomics 272: 181–193.[Medline]

COURAGE-TEBBE, U., H. P. DORING, N. FEDOROFF and P. STARLINGER, 1983 The controlling element Ds at the Shrunken locus in Zea mays: structure of the unstable sh-m5933 allele and several revertants. Cell 34: 383–393.[CrossRef][Medline]

COWPERTHWAITE, M., W. PARK, Z. XU, X. YAN, S. C. MAURAIS et al., 2002 Use of the transposon Ac as a gene-searching engine in the maize genome. Plant Cell 14: 713–726.[Abstract/Free Full Text]

DELLAPORTA, S. L., and M. A. MORENO, 1994 Gene tagging with Ac/Ds elements in maize, pp. 219–233 in The Maize Handbook, edited by M. FREELING and V. WALBOT. Springer-Verlag, New York.

DELLAPORTA, S. L., I. M. GREENBLATT, J. L. KERMICLE, J. B. HICKS and S. R. WESSLER, 1988 Molecular cloning of the maize R-nj allele by transposon tagging with Ac, pp. 263–282 in Chromosome Structure and Function: Impact of New Concepts, edited by J. P. GUSTAFSON and R. APPELS. Plenum Press, New York.

DELONG, A., A. CALDERON-URREA and S. L. DELLAPORTA, 1993 Sex determination gene TASSELSEED2 of maize encodes a short-chain alcohol dehydrogenase required for stage-specific floral organ abortion. Cell 74: 757–768.[CrossRef][Medline]

DEMPSEY, E., 1993 The Ac2-bz2m mutable system of maize. Maydica 38: 151–161.

DOONER, H. K., 1986 Genetic fine structure of the bronze locus in maize. Genetics 113: 1021–1036.[Abstract/Free Full Text]

DOONER, H. K., and A. BELACHEW, 1989 Transposition pattern of the maize element Ac from the Bz-m2(Ac) Allele. Genetics 122: 447–457.[Abstract/Free Full Text]

DOONER, H. K., and O. E. NELSON, 1977 Controlling element-induced alterations in UDPglucose: Flavonid glucosyltransferase, the enzyme specified by the bronze locus in maize. Proc. Natl. Acad. Sci. USA 74: 5623–5627.[Abstract/Free Full Text]

DOONER, H. K., E. WECK, S. ADAMS, E. RALSTON, M. FAVREAU et al., 1985 A molecular genetic analysis of insertions in the bronze locus in maize. Mol. Gen. Genet. 200: 240–246.[CrossRef]

DOONER, H. K., A. BELACHEW, D. BURGESS, S. HARDING, M. RALSTON et al., 1994 Distribution of unlinked receptor sites for transposed Ac elements from the bz-m2(Ac) allele in maize. Genetics 136: 261–279.[Abstract]

EISSES, J. F., D. LAFOE, L. A. SCOTT and C. F. WEIL, 1997 Novel, developmentally specific control of Ds transposition in maize. Mol. Gen. Genet. 256: 158–168.[CrossRef][Medline]

EMERSON, R., 1914 The inheritance of a recurring somatic variation in variegated ears of maize. Am. Nat. 48: 87–115.[CrossRef]

FEDOROFF, N., S. WESSLER and M. SHURE, 1983 Isolation of the transposable maize controlling elements Ac and Ds. Cell 35: 235–242.[CrossRef][Medline]

FU, H., and H. K. DOONER, 2002 Intraspecific violation of genetic colinearity and its implications in maize. Proc. Natl. Acad. Sci. USA 99: 9573–9578.[Abstract/Free Full Text]

GIROUX, M. J., J. SHAW, G. BARRY, B. G. COBB, T. GREENE et al., 1996 A single mutation that increases maize seed weight. Proc. Natl. Acad. Sci. USA 93: 5824–5829.[Abstract/Free Full Text]

GORBUNOVA, V. V., and A. A. LEVY, 1999 How plants make ends meet: DNA double-strand-break repair. Trends Plant Sci. 4: 263–269.[CrossRef][Medline]

GRECO, R., P. B. OUWERKERK, R. J. DE KAM, C. SALLAUD, C. FAVALLI et al., 2003 Transpositional behaviour of an Ac/Ds system for reverse genetics in rice. Theor. Appl. Genet. 108: 10–24.[CrossRef][Medline]

GREENBLATT, I. M., 1984 A chromosome replication pattern deduced from pericarp phenotypes resulting from movements of the transposable element Modulator, in maize. Genetics 108: 471–485.[Abstract/Free Full Text]

HAKE, S., E. VOLLBRECHT and M. FREELING, 1989 Cloning Knotted, the dominant morphological mutant in maize using Ds2 as a transposon tag. EMBO J. 8: 15–22.[Medline]

HEALY, J., C. CORR, J. DEYOUNG and B. BAKER, 1993 Linked and unlinked transposition of a genetically marked Dissociation element in transgenic tomato. Genetics 134: 571–584.[Abstract]

ITO, T., M. SEKI, N. HAYASHIDA, D. SHIBATA and K. SHINOZAKI, 1999 Regional insertional mutagenesis of genes on Arabidopsis thaliana chromosome V using the Ac/Ds transposon in combination with a cDNA scanning method. Plant J. 17: 433–444.[CrossRef][Medline]

JAMES, JR., D. W., E. LIM, J. KELLER, I. PLOOY, E. RALSTON et al., 1995 Directed tagging of the Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene with the maize transposon Activator. Plant Cell 7: 309–319.[Abstract]

JENIK, P. D., and V. F. IRISH, 2001 The Arabidopsis floral homeotic gene APETALA3 differentially regulates intercellular signaling required for petal and stamen development. Development 128: 13–23.[Abstract]

JIN, W. Z., S. M. WANG, M. XU, R. J. DUAN and P. WU, 2004 Characterization of enhancer trap and gene trap harboring Ac/Ds transposon in transgenic rice. J. Zhejiang Univ. Sci. 5: 390–399.[CrossRef][Medline]

JONES, D. A., C. M. THOMAS, K. E. HAMMOND-KOSACK, P. J. BALINT-KURTI and J. D. JONES, 1994 Isolation of the tomato Cf-9 gene for resistance to Cladosporium fulvum by transposon tagging. Science 266: 789–793.[Abstract/Free Full Text]

KERMICLE, J., M. ALLEMAN and S. L. DELLAPORTA, 1989 Sequential mutagenesis of a maize gene, using the transposable element Dissociation. Genome 31: 712–716.

KIM, C. M., H. L. PIAO, S. J. PARK, N. S. CHON, B. I. JE et al., 2004 Rapid, large-scale generation of Ds transposant lines and analysis of the Ds insertion sites in rice. Plant J. 39: 252–263.[CrossRef][Medline]

KNAPP, S., Y. LARONDELLE, M. ROSSBERG, D. FURTEK and K. THERES, 1994 Transgenic tomato lines containing Ds elements at defined genomic positions as tools for targeted transposon tagging. Mol. Gen. Genet. 243: 666–673.[Medline]

KOLESNIK, T., I. SZEVERENYI, D. BACHMANN, C. S. KUMAR, S. JIANG et al., 2004 Establishing an efficient Ac/Ds tagging system in rice: large-scale analysis of Ds flanking sequences. Plant J 37: 301–314.[Medline]

KOLKMAN, J., L. J. CONRAD, P. R. FARMER, K. HARDEMAN, K. R. AHERN et al., 2005 Distribution of Activator (Ac) throughout the maize genome for use in regional mutagenesis. Genetics 169: 981–995.[Abstract/Free Full Text]

KOPREK, T., D. MCELROY, J. LOUWERSE, R. WILLIAMS-CARRIER and P. G. LEMAUX, 2000 An efficient method for dispersing Ds elements in the barley genome as a tool for determining gene function. Plant J 24: 253–263.[CrossRef][Medline]

KUNZE, R., 1996 The maize transposable element Activator (Ac). Curr. Top. Microbiol. Immunol. 204: 161–194.[Medline]

KUNZE, R., and C. F. WEIL, 2002 The hAT and CACTA superfamily of plant transposons, pp. 565–610 in Mobile DNA, edited by N. L. CRAIG. ASM Press, Washington, D.C.

KUROMORI, T., T. HIRAYAMA, Y. KIYOSUE, H. TAKABE, S. MIZUKADO et al., 2004 A collection of 11 800 single-copy Ds transposon insertion lines in Arabidopsis. Plant J. 37: 897–905.[CrossRef][Medline]

LAI, J., Y. LI, J. MESSING and H. K. DOONER, 2005 Gene movement by Helitron transposons contributes to the haplotype variability of maize. Proc. Natl. Acad. Sci. USA 102: 9068–9073.[Abstract/Free Full Text]

LARSON, R., and E. H. COE, 1977 Gene-dependent flavonoid glucosyltransferase in maize. Biochem. Genet. 15: 153–156.[CrossRef][Medline]

LECHELT, C., T. PETERSON, A. LAIRD, J. CHEN, S. L. DELLAPORTA et al., 1989 Isolation and molecular analysis of the maize P locus. Mol. Gen. Genet. 219: 225–234.[CrossRef][Medline]

LEE, M., N. SHAROPOVA, W. D. BEAVIS, D. GRANT, M. KATT et al., 2002 Expanding the genetic map of maize with the intermated B73 x Mo17 (IBM) population. Plant Mol. Biol. 48: 453–461.[CrossRef][Medline]

MA, Z., and H. K. DOONER, 2004 A mutation in the nuclear-encoded plastid ribosomal protein S9 leads to early embryo lethality in maize. Plant J. 37: 92–103.[CrossRef][Medline]

MCCLINTOCK, B., 1948 Mutable loci in maize. Carnegie Instit. Wash. Year Book 47: 155–169.

MCCLINTOCK, B., 1951 Chromosome organization and gene expression. Cold Spring Harbor Symp. Quant. Biol. 16: 13–47.[Medline]

MCCLINTOCK, B., 1962 Topographical relations between elements of control systems in maize. Carnegie Instit. Wash. Year Book 61: 448–461.

MCCLINTOCK, B., 1964 Aspects of gene regulation in maize. Carnegie Instit. Wash. Year Book 63: 592–602.

MEISSNER, R. C., H. JIN, E. COMINELLI, M. DENEKAMP, A. FUERTES et al., 1999 Function search in a large transcription factor gene family in Arabidopsis: assessing the potential of reverse genetics to identify insertional mutations in R2R3 MYB genes. Plant Cell 11: 1827–1840.[Abstract/Free Full Text]

MEISSNER, R., V. CHAGUE, Q. ZHU, E. EMMANUEL, Y. ELKIND et al., 2000 Technical advance: a high throughput system for transposon tagging and promoter trapping in tomato. Plant J. 22: 265–274.[CrossRef][Medline]

MENSSEN, A., S. HOHMANN, W. MARTIN, P. S. SCHNABLE, P. A. PETERSON et al., 1990 The En/Spm transposable element of Zea mays contains splice sites at the termini generating a novel intron from a dSpm element in the A2 gene. EMBO J. 9: 3051–3057.[Medline]

MORGANTE, M., S. BRUNNER, G. PEA, K. FENGLER, A. ZUCCOLO et al., 2005 Gene duplication and exon shuffling by helitron-like transposons generate intraspecies diversity in maize. Nat. Genet. 37: 997–1002.[CrossRef][Medline]

MOTTO, M., R. MAROTTA, N. DI FONZO and F. SALAMINI, 1986 Ds-induced alleles at Opaque-2 locus of maize. Genetics 112: 121–133.[Abstract/Free Full Text]

MULLER-NEUMANN, M., J. I. YODER and P. STARLINGER, 1984 The DNA sequence of the transposable element Ac of Zea mays L. Mol. Gen. Genet. 198: 9–24.

MUSKETT, P. R., L. CLISSOLD, A. MAROCCO, P. S. SPRINGER, R. MARTIENSSEN et al., 2003 A resource of mapped dissociation launch pads for targeted insertional mutagenesis in the Arabidopsis genome. Plant Physiol. 132: 506–516.[Abstract/Free Full Text]

NISHAL, B., T. TANTIKANJANA and V. SUNDARESAN, 2005 An inducible targeted tagging system for localized saturation mutagenesis in Arabidopsis. Plant Physiol. 137: 3–12.[Abstract/Free Full Text]

O'REILLY, C., N. SHEPHERD, A. PEREIRA, Z. SCHWARTZ-SOMMER, I. BERTRAM et al., 1985 Molecular cloning of the a1 locus of Zea mays using the transposable elements En and Mu1. EMBO J. 4: 877–882.[Medline]

PENG, J. R., and N. P. HARBERD, 1997 Transposon-associated somatic gai-loss sectors in Arabidopsis. Plant Science 130: 181–188.

POHLMAN, R. F., N. V. FEDOROFF and J. MESSING, 1984 The nucleotide sequence of the maize controlling element Activator. Cell 37: 635–643.[CrossRef][Medline]

PUCHTA, H., 2005 The repair of double-strand breaks in plants: mechanisms and consequences for genome evolution. J. Exp. Bot. 56: 1–14.[Abstract/Free Full Text]

REDDY, A. R., L. BRITSCH, F. SALAMINI, H. SAEDLER and W. ROHDE, 1987 The A1 (anthocyanin-1) locus in Zea mays encodes dihydroquercetin reductase. Plant Sci. 52: 7–14.

RINEHART, T. A., C. DEAN and C. F. WEIL, 1997 Comparative analysis of non-random DNA repair following Ac transposon excision in maize and Arabidopsis. Plant J. 12: 1419–1427.[CrossRef][Medline]

RUBIN, E., and A. A. LEVY, 1997 Abortive gap repair: underlying mechanism for Ds element formation. Mol. Cell. Biol. 17: 6294–6302.[Abstract/Free Full Text]

SALOMON, S., and H. PUCHTA, 1998 Capture of genomic and T-DNA sequences during double-strand-break repair in somatic plant cells. EMBO J. 17: 6086–6095.[CrossRef][Medline]

SCHEFFLER, B., P. FRANKEN, E. SCHUTT, A. SCHRELL, H. SAEDLER et al., 1994 Molecular analysis of C1 alleles in Zea mays defines regions involved in the expression of this regulatory gene. Mol. Gen. Genet. 242: 40–48.[Medline]

SCHULTES, N. P., T. P. BRUTNELL, A. ALLEN, S. L. DELLAPORTA, T. NELSON et al., 1996 Leaf permease1 gene of maize is required for chloroplast development. Plant Cell 8: 463–475.[Abstract]

SCHWARTZ, D., and E. DENNIS, 1986 Transposase activity of the Ac controlling element in maize is regulated by its degree of methylation. Mol. Gen. Genet. 205: 476–482.[CrossRef]

SCOFIELD, S. R., K. HARRISON, S. J. NURRISH and J. D. JONES, 1992 Promoter fusions to the Activator transposase gene cause distinct patterns of Dissociation excision in tobacco cotyledons. Plant Cell 4: 573–582.[Abstract/Free Full Text]

SHEEHAN, M. J., P. R. FARMER and T. P. BRUTNELL, 2004 Structure and expression of maize phytochrome family homeologs. Genetics 167: 1395–1405.[Abstract/Free Full Text]

SHEN, B., Z. ZHENG and H. K. DOONER, 2000 A maize sesquiterpene cyclase gene induced by insect herbivory and volicitin: characterization of wild-type and mutant alleles. Proc. Natl. Acad. Sci. USA 97: 14807–14812.[Abstract/Free Full Text]

SINGH, M., P. E. LEWIS, K. HARDEMAN, L. BAI, J. K. ROSE et al., 2003 Activator mutagenesis of the pink scutellum1/viviparous7 locus of maize. Plant Cell 15: 874–884.[Abstract/Free Full Text]

STADLER, L. J., 1946 Spontaneous mutation at the R locus in maize. I. The aleurone-color and plant-color effects. Genetics 31: 377–394.[Free Full Text]

STYLES, E. D., and O. CESKA, 1977 The genetic control of flavonoid synthesis in maize. Can. J. Genet. Cyt. 19: 289–302.

SUNDARESAN, V., P. SPRINGER, T. VOLPE, S. HAWARD, J. D. JONES et al., 1995 Patterns of gene action in plant development revealed by enhancer trap and gene trap transposable elements. Genes Dev. 9: 1797–1810.[Abstract/Free Full Text]

TAKKEN, F. L., C. M. THOMAS, M. H. JOOSTEN, C. GOLSTEIN, N. WESTERINK et al., 1999 A second gene at the tomato Cf-4 locus confers resistance to Cladosporium fulvum through recognition of a novel avirulence determinant. Plant J. 20: 279–288.[Medline]

TANTIKANJANA, T., M. D. MIKKELSEN, M. HUSSAIN, B. A. HALKIER and V. SUNDARESAN, 2004 Functional analysis of the tandem-duplicated P450 genes SPS/BUS/CYP79F1 and CYP79F2 in glucosinolate biosynthesis and plant development by Ds transposition-generated double mutants. Plant Physiol. 135: 840–848.[Abstract/Free Full Text]

VAN SCHAIK, N. W., and R. A. BRINK, 1959 Transposition of Modulator, a component of the variegated pericarp allele in maize. Genetics 44: 725–738.[Free Full Text]

WEIL, C. F., and R. KUNZE, 2000 Transposition of maize Ac/Ds transposable elements in the yeast Saccharomyces cerevisiae. Nat. Genet. 26: 187–190.[CrossRef][Medline]

WEIL, C. F., S. MARILLONNET, B. BURR and S. R. WESSLER, 1992 Changes in state of the Wx-M5 allele of maize are due to intragenic transposition of Ds. Genetics 130: 175–185.[Abstract]

WESSLER, S. R., G. BARAN, M. VARAGONA and S. L. DELLAPORTA, 1986 Excision of Ds produces waxy proteins with a range of enzymatic activities. EMBO J. 5: 2427–2432.[Medline]

WU, C., X. LI, W. YUAN, G. CHEN, A. KILIAN et al., 2003 Development of enhancer trap lines for functional analysis of the rice genome. Plant J. 35: 418–427.[CrossRef][Medline]

XIAO, Y. L., and T. PETERSON, 2002 Ac transposition is impaired by a small terminal deletion. Mol. Genet. Genomics 266: 720–731.[CrossRef][Medline]

YAN, X., I. M. MARTINEZ-FEREZ, S. KAVCHOK and H. K. DOONER, 1999 Origination of Ds elements from Ac elements in maize: evidence for rare repair synthesis at the site of Ac excision. Genetics 152: 1733–1740.[Abstract/Free Full Text]

ZHENG-GE, Z., F. YA-PING, X. HAN, H. GUO-CHENG, S. HUA-MIN et al., 2003 Ac/Ds transposition activity in transgenic rice population and DNA flanking sequences of Ds insertion site. Acta Bot. Sin. 45: 102–107.

Communicating editor: J. A. BIRCHLER




This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
J. Duvick, A. Fu, U. Muppirala, M. Sabharwal, M. D. Wilkerson, C. J. Lawrence, C. Lushbough, and V. Brendel
PlantGDB: a resource for comparative plant genomics
Nucleic Acids Res., January 11, 2008; 36(suppl_1): D959 - D965.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. J. Conrad, L. Bai, K. Ahern, K. Dusinberre, D. P. Kane, and T. P. Brutnell
State II Dissociation Element Formation Following Activator Excision in Maize
Genetics, October 1, 2007; 177(2): 737 - 747.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. Bai, M. Singh, L. Pitt, M. Sweeney, and T. P. Brutnell
Generating Novel Allelic Variation Through Activator Insertional Mutagenesis in Maize
Genetics, March 1, 2007; 175(3): 981 - 992.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
W. Yu, J. C. Lamb, F. Han, and J. A. Birchler
Cytological Visualization of DNA Transposons and Their Transposition Pattern in Somatic Cells of Maize
Genetics, January 1, 2007; 175(1): 31 - 39.
[Abstract] [Full Text] [PDF]