Originally published as Genetics Published Articles Ahead of Print on August 3, 2005.

Genetics, Vol. 171, 1683-1694, December 2005, Copyright © 2005
doi:10.1534/genetics.105.045534

A Genetic Screen Targeting the Tumor Necrosis Factor/Eiger Signaling Pathway: Identification of Drosophila TAB2 as a Functionally Conserved Component

Institut für Molekularbiologie, Universität Zürich, CH-8057 Zürich, Switzerland

1 Corresponding author: Institut für Molekularbiologie, Universität Zürich, Winterthurerstrasse 190, CH-8057 Zürich, Switzerland.
E-mail: basler{at}molbio.unizh.ch

Manuscript received May 11, 2005. Accepted for publication July 22, 2005.

ABSTRACT

Signaling by tumor necrosis factors (TNFs) plays a prominent role in mammalian development and disease. To fully understand this complex signaling pathway it is important to identify all regulators and transduction components. A single TNF family member, Eiger, is encoded in the Drosophila genome, offering the possibility of applying genetic approaches for pursuing this goal. Here we present a screen for the isolation of novel genes involved in the TNF/Eiger pathway. On the basis of Eiger's ability to potently activate Jun-N-terminal kinase (JNK) and trigger apoptosis, we used the Drosophila eye to establish an assay for dominant suppressors of this activity. In a large-scale screen the Drosophila homolog of TAB2/3 (dTAB2) was identified as an essential component of the Eiger-JNK pathway. Genetic epistasis and biochemical protein-protein interaction assays assign an adaptor role to dTAB2, linking dTRAF1 to the JNKKK dTAK1, demonstrating a conserved mechanism of TNF signal transduction in mammals and Drosophila. Thus, in contrast to morphogenetic processes, such as dorsal closure of the embryo, in which the JNK pathway is activated by the JNKKK Slipper, Eiger uses the dTAB2-dTAK1 module to induce JNK signaling activity.


LIGANDS of the tumor necrosis factor (TNF) family regulate fundamental processes in humans, such as apoptosis, cell survival, differentiation, proliferation, and inflammation. Deregulation of TNF signaling pathways is associated with many diseases, including autoimmune disorders and cancer. The study of TNF signaling mechanisms in mammalian systems is complicated by the existence of numerous ligands and receptors and at least three different intracellular signaling pathways (WALLACH et al. 1999; LOCKSLEY et al. 2001). Recently it became apparent that there is a single TNF ligand (Eiger) encoded in the Drosophila genome (IGAKI et al. 2002; MORENO et al. 2002; KAUPPILA et al. 2003), raising the prospect of investigating conserved principles underlying this signaling system by simple genetic means.

Like a subset of the mammalian TNF proteins, Eiger is a potent inducer of apoptosis. Unlike its mammalian counterparts, however, the apoptotic effect of Eiger does not require the activity of the caspase-8 homolog DREDD, but it completely depends on its ability to activate the Jun-N-terminal kinase (JNK) pathway and subsequent activation of the Drosophila apoptosome (DARK + DRONC) (MORENO et al. 2002). Although the JNK pathway is used multiple times in Drosophila development, Eiger is the only known extracellular protein that triggers its activation. Of particular interest is therefore the interface between the cell membrane and the core JNK cassette [consisting of the JNKK Hemipterous (Hep), the JNK Basket (Bsk), and the transcription factors Jun and Fos]. Apart from Wengen (Wgn), the presumptive TNF receptor homolog in Drosophila (KANDA et al. 2002; KAUPPILA et al. 2003), no other components have been convincingly implicated in JNK activation upstream of the candidate JNKKK dTAK1 (VIDAL et al. 2001).

Here we designed and performed a genetic screen to isolate rate-limiting components in mediating Eiger-induced apoptosis. We report the identification of >100 mutations that weaken the Eiger-JNK pathway. While some of these mutations affect already known components, such as Bsk and dTAK1, and thus validate the screen, we further show that one group of alleles inactivates a previously uncharacterized Drosophila gene, CG7417. By genetic and biochemical means we demonstrate that it functions as the TAB2/3 homolog. TAB2/3 have been demonstrated to link TNF receptor-associated factor (TRAF) proteins to TAK1 in mammalian interleukin- and TNF-signal transduction (TAKAESU et al. 2000; ISHITANI et al. 2003). We propose that the Drosophila TAB2/3 homolog provides, together with dTRAF1, an adaptor function enabling the presumptive JNKKKK Misshapen (Msn) to activate the JNKKK dTAK1, which in turn advances the Eiger signal to the JNKK Hep and its JNK substrate Bsk.


MATERIALS AND METHODS

Fly stocks:

The Bloomington Drosophila Stock Center (BDSC) provided bsk1, Df(2R)P34, and the Exelixis deficiency collection. The following reagents have been described previously: UAS-egr (MORENO et al. 2002), dTAK1 alleles and their rescuing transgene (VIDAL et al. 2001), UAS-hepCA (ADACHI-YAMADA et al. 1999), and GMR-Gal4 (HAY et al. 1994).

Stocks carrying the UAS-Drosophila homolog of TAB2/3 (dTAB2) and tubulin{alpha}1-dTAB2 transgene were obtained by standard P-element-induced transformation. The dTAB2 full-length cDNA (LD40663) was cloned into pUAST (BRAND and PERRIMON 1993) or into a vector containing the tubulin{alpha}1 promoter (BASLER and STRUHL 1994), respectively.

EMS mutagenesis:

Drosophila males carrying the GMR-Gal4 insertion were starved for 8 hr before mutagenesis. These males were then kept for 24 hr in a bottle containing a filter paper soaked with 0.4% EMS in sugar solution (1 g/100 ml). After a recovery phase of another 24 hr on normal food, the mutagenized males were mated at 25° with virgins carrying the UAS-egr transgene.

Genetic distance to GMR-Gal4 insertion:

Chromosomes carrying the GMR-Gal4 insertion and a suppressor mutation were allowed to recombine with a wild-type chromosome in females. Such virgins were crossed to UAS-egr males. The number of GMR-Gal4 progeny with a suppressed eye phenotype in relation to the number of GMR-Gal4 progeny with a small eye phenotype reflects the genetic distance between the suppressor mutation and the GMR-Gal4 insertion.

Generation and analysis of ey-flp mosaics:

For genes that did not dominantly suppress the Eiger-induced small eye phenotype, such as djun and dTRAF1, ey-flp clones were generated to obtain animals with eyes composed largely of homozygous mutant cells (NEWSOME et al. 2000). In this background the ability of Eiger to induce apoptosis was analyzed. Such analysis was uninformative, however, for the dTRAF1ex1 allele (CHA et al. 2003) as mosaic eyes exhibited a distorted pattern already in the absence of Eiger expression.

Sequencing:

Genomic DNA was amplified by PCR using evenly spaced primers in the CG7417, bsk, and dTAK1 coding regions. PCR products were analyzed by standard sequencing.

Drosophila cell culture and transfection:

Schneider (S2) cells were cultured in Schneider's Drosophila medium (Invitrogen, San Diego) supplemented with 10% fetal calf serum and 1% penicillin/streptomysin at 25°. Cells were transfected with expression vectors, using Cellfectin (Invitrogen) according to the manufacturer's protocol.

Expression vectors:

Full-length dTRAF1 and dTRAF2 coding sequences were amplified by PCR, using ESTs RE63023 and RE19938 as templates, respectively. These PCR fragments were inserted into the triple-HA-containing vector pMZ55 and subcloned into pUAST along with the 3x HA tag. The dTAK1-FLAG construct was amplified by PCR from transgenic flies harboring UAS-dTAK1 (gift from Makoto Nakamura) and inserted into pUAST. FLAG-dTAB2, HA-dTAB2-N, HA-dTAB2-C, and HA-dTAB2-{Delta}cc were amplified by PCR from a HA-dTAB2 construct and cloned into pUAST. The UAS-Wengen plasmid was a gift from E. Moreno.

Immunoprecipitation and immunoblotting:

S2 cells (0.75 x 106 cells/well) were seeded into a 12-well plate. One day after seeding cells were transfected with the indicated expression vectors. Forty-eight hours after transfection the cells were harvested and lysed in lysis buffer containing 150 mM NaCl, 50 mM Tris-HCl (pH 8.0), 1% Nonidet P-40, 0.5% deoxycholic acid, and protease inhibitors (Complete Mini; Roche, Indianapolis). Lysates were mixed either with an anti-HA antibody and 25 µl of Protein-A sepharose beads or with 25 µl of anti-FLAG agarose beads (Sigma, St. Louis) and allowed to rotate at 4° overnight. The beads were then collected and washed with the lysis buffer four times. Proteins were eluted from the beads and resolved on a 4–12% NUPAGE gel system (Invitrogen) and transferred to a nitrocellulose membrane. After blocking, the membrane was incubated with either anti-HA antibody (3F10, Roche) or anti-FLAG M2 antibody (Sigma) followed by appropriate secondary antibodies conjugated with horseradish peroxidase (HRP). Signals were detected with ECL reagents (Amersham, Arlington Heights, IL).

Double-stranded RNA production:

Double-stranded RNA (dsRNA) was prepared as described by the Dixon lab (CLEMENS et al. 2000). Briefly, using PCR products as templates, the MEGASCRIPT T7 transcription kit (Ambion, Austin, TX) was used to produce RNA according to the manufacturer's protocol. RNA products were ethanol precipitated and resuspended in DEPC-treated water. dsRNA was generated by annealing at 65° for 30 min followed by slow cooling to room temperature. The following sets of forward (FP) and reverse primers (RP) were used: Basket (FP 5' cgccgcaaaggaacttgg 3'; RP 5' tcagcatcataccacacg 3'), dTAK1 (FP 5' gatgaccaacaatcgcgg 3'; RP 5' ggcgctgagtggcctcagc 3'), msn (FP 5' atggcgcaccagcagcaacaac 3'; RP 5' ccatctccagagcggtgatgc 3'), and dTAB2 (FP 5' atggcggctacaccaccaatgc-3'; RP 5' gtcgctgctggcgctgcataatc 3').

LPS treatment:

S2 cells were treated with dsRNA (15 µg/106 cells) as indicated in Figure 5F. The cells were then split into two. One-half was left untreated and one-half was treated with lipopolysaccharide (LPS) (Sigma) at a concentration of 50 µg/ml for 10 min. The cells were then lysed in lysis buffer. The lysates were analyzed by immunoblotting to detect phosphorylated JNK (Promega, Madison, WI) and JNK (Santa Cruz Biotechnologies, Santa Cruz, CA).



View larger version (48K):
In this window
In a new window
Download PPT slide
 
FIGURE 5.—

dTAB2 is in a complex with dTRAF1/2 and dTAK1. (A) dTAB2 interacts with dTAK1. S2 cells were transfected with plasmids encoding UAS-HA-dTAB2 and UAS-dTAK1-FLAG together with ptub-GAL4. Samples that immunoprecipitated with anti-FLAG antibody were immunoblotted with anti-HA antibody and vice versa. (B) dTAB2 interacts with dTAK1 most likely through its coiled-coil domain. S2 cells were transfected with plasmids encoding UAS-dTAK1-FLAG and UAS-HA-dTAB2 or UAS-HA-dTAB2-N or UAS-HA-dTAB2-C or UAS-HA-dTAB2-{Delta}cc together with ptub-GAL4. Anti-FLAG immunoprecipitated samples were immunoblotted with anti-HA antibody or vice versa. (C) dTAB2 associates with both dTRAF1 and dTRAF2. S2 cells were transfected with plasmids encoding UAS-FLAG-dTAB2 and UAS-HA-dTRAF1 or UAS-HA-dTRAF2 together with ptub-GAL4. Samples immunoprecipitated with the anti-HA antibody were detected with anti-FLAG antibody. (D) The presumptive Eiger receptor Wengen interacts with both dTRAF1 and dTRAF2. S2 cells were transfected with plasmids encoding Wengen and UAS-HA-dTRAF1 or UAS-HA-dTRAF2 together with ptub-GAL4. Anti-HA antibody immunoprecipitated samples were immunoblotted with an anti-Wengen antibody. (E) dTAB2 links dTRAF1 and dTRAF2 to dTAK1 and forms a triple complex. S2 cells were transfected with plasmids encoding UAS-FLAG-dTAB2, UAS-dTAK1-FLAG, and UAS-HA-dTRAF1 or UAS-HA-dTRAF2 together with ptub-GAL4. Anti-HA antibody-immunoprecipitated samples were immunoblotted with anti-FLAG antibody. (C–E) Asterisks (*) indicate nonspecific bands in the HA-dTRAF2 lysates. (F) dTAB2 is also required for LPS-induced JNK activation. RNAi against dTAK1 or dTAB2 but not against GFP abolishes LPS-mediated phosphorylation of JNK in S2 cells.

 

Luciferase assay:

S2 cells (0.4 x 106 cells/well) were seeded into a 24-well plate. One day after seeding cells were transfected with an AP1-luciferase reporter plasmid along with the indicated expression vector. The total DNA concentration (1 µg) was kept constant by supplementing with empty vector. Forty-eight hours after transfection, cells were harvested, lysed in passive lysis buffer, and luciferase activity was measured using the dual luciferase assay system (Promega). The values shown reflect the relative luciferase activity: the ratio of firefly (AP1 luciferase) and tub-renilla luciferase activity of one representative experiment in which each transfection was made in duplicate.


RESULTS

A dominant modifier screen to identify new components of the Eiger-JNK pathway:

Forced expression of Eiger in the developing compound eye of Drosophila triggers massive apoptosis and results in a small eye phenotype (Figure 1, A and B; IGAKI et al. 2002; MORENO et al. 2002; KAUPPILA et al. 2003). A reduction in copy number of genes encoding core JNK pathway components partially rescues this phenotype (Figure 1C; IGAKI et al. 2002; MORENO et al. 2002). Complete elimination of bsk (encoding Drosophila JNK) or djun in mosaic animals by genetic means or suppression of Bsk activity by forced expression of the JNK-phosphatase Puckered (MARTIN-BLANCO et al. 1998) reverted the Eiger-induced small eye phenotype (data not shown and MORENO et al. 2002). Hence, all apoptosis-inducing activity of the Eiger pathway is apparently transduced by the JNK pathway (Figure 1E). Animals heterozygous for dTAK1 dominant-negative alleles (Figure 1D) or hemizygous mutant for dTAK1 (null allele, Figure 4F) also show a complete suppression of the small eye phenotype. Thus dTAK1 appears to provide the most relevant JNKKK function in the Eiger pathway, as none of the other five putative JNKKK homologs encoded in the Drosophila genome (STRONACH 2005) can substitute for dTAK1. Indeed, removing one copy of slipper, which codes for a JNKKK involved in JNK activation during the morphogenetic process of dorsal closure (STRONACH and PERRIMON 2002), does not suppress the small eye phenotype (data not shown).



View larger version (54K):
In this window
In a new window
Download PPT slide
 
FIGURE 1.—

The small eye phenotype caused by eiger (egr) overexpression in the eye provides a sensitized system to screen for new components. (A) GMR-Gal4 UAS-egr/+. Overexpression of egr in the Drosophila compound eye leads to a small eye phenotype due to massive induction of apoptosis. (B) GMR-Gal4/+ control eye. (C) GMR-Gal4 UAS-egr/bsk1. Removing a single copy of the Drosophila JNK gene bsk dominantly suppresses the small eye phenotype. (D) dTAK14/+ ; GMR-Gal4 UAS-egr/+. dTAK14 is a dominant-negative allele of dTAK1, which fully suppresses the small eye phenotype in a dominant fashion. (E) Schematic representation of the current model of Eiger signaling.

 


View larger version (72K):
In this window
In a new window
Download PPT slide
 
FIGURE 4.—

dTAB2 functions upstream of Hep and dTAK1. A–G are in GMR-Gal4 UAS-egr/+ background. (A) GMR-Gal4 UAS-egr/dTAB2G609. dTAB2 alleles dominantly suppress the small eye phenotype. (B) GMR-Gal4 UAS-egr dTAB2G609/dTAB2G71. The small eye phenotype is not completely suppressed in dTAB2 homozygous mutant flies. (C) GMR-Gal4 UAS-egr/dTAB2G609; tub-dTAB2. (D) GMR-Gal4 UAS-egr/G56; tub-dTAB2. A tub-dTAB2 rescue transgene reverts the suppression of the small eye phenotype caused by heterozygous loss of dTAB2, but not the suppression brought about by the unrelated suppressor mutation G56. (E) GMR-Gal4 UAS-egr/UAS-dTAB2. Overexpression of wild-type dTAB2 has a dominant-negative effect on Eiger signal transduction. (F) dTAK12/Y; GMR-Gal4 UAS-egr/+. A hemizygous null allele of dTAK1 completely suppresses the small eye phenotype. dTAK12 has an early stop mutation (VIDAL et al. 2001). (G) dTAK12/Y; GMR-Gal4 UAS-egr/+; P(dTAK1)/+. In contrast to dominant-negative alleles of dTAK1 (G14, 4), the suppression of the small eye phenotype brought about by a null allele of dTAK1 can be completely reverted by introducing a dTAK1 genomic rescue transgene. (H) GMR-Gal4 UAS-hepCA/+. (I) GMR-Gal4 UAS-hepCA/bskG258. (J) GMR-Gal4 UAS-hepCA/dTAB2G71. The small eye phenotype caused by overexpression of a constitutive active form of Hep is dominantly suppressed by removing one copy of bsk but not by removing one copy of dTAB2. (K) RNAi against bsk but not against msn or dTAB2 suppresses the dTAK1-FLAG-induced activation of the AP1-luc-reporter in S2 cells. (L) Overexpression of UAS-HA-dTAB2 does not activate the AP1-luc-reporter. Wild-type dTAB2 does not exert a dominant-negative effect on dTAK1-mediated activation of the JNK pathway. Numbers in parentheses indicate amounts of plasmid in micrograms.

 
The above described assay was used as a basis for a screening system to identify genes required for Eiger signaling. Adult males carrying a GMR-Gal4 transgene were mutagenized with EMS and mated to UAS-eiger females (UAS-egr; see crossing scheme in Figure 2A). The progeny was scored for suppression of the small eye phenotype. Candidate suppressors were isolated, retested, and mapped to individual chromosomes by virtue of visible markers on chromosomes 2 and 3 (Figure 2A). After screening ~55,000 animals, 117 stocks with suppressor mutations were established (Figure 2B), each categorized in one of three phenotypic classes on the basis of the extent of the rescue: "complete" (not shown), "intermediate" (Figure 2C), and "weak" (Figure 2D).



View larger version (42K):
In this window
In a new window
Download PPT slide
 
FIGURE 2.—

A dominant modifier screen to identify new components of the Eiger pathway in Drosophila. (A) Crossing scheme. Males carrying a GMR-Gal4 transgene are mutagenized with EMS and crossed to virgins carrying a UAS-egr transgene. Suppressors were rescreened, balanced, and mapped to a chromosome by virtue of visible dominant markers. The second chromosome is marked by the w+ (dark red) included in the GMR-Gal4 insertion. The w+ of the UAS-egr insertion displays an orange eye color. The third chromosome is marked by the absence of a P[y+] insertion present on the non-EMS-treated chromosome. Lethal mutations on the X chromosome escaped our detecting system. Since the X chromosome was not marked, viable mutations, which were obtained only when female suppressors were selected, could not be followed and therefore were obtained only rarely. (B) Numbers of animals that were screened and rescreened and stocks that were established, with the number of alleles identified for positive controls. C–I are in a GMR-Gal4 UAS-egr/+ background. (C) GMR-Gal4 UAS-egr/G56. An example of a suppressor belonging to the "intermediate" class is shown. (D) GMR-Gal4 UAS-egr/G87. An example of a suppressor belonging to the "weak" class is shown. (E) GMR-Gal4 UAS-egr/bskG258. G258, one of the new bsk alleles identified in the screen, dominantly suppresses the small eye phenotype. (F) dTAK1G14/+; GMR-Gal4 UAS-egr/+. G14, the dTAK1 allele identified in the screen, dominantly suppresses the small eye phenotype. (G) dTAK1G14/+; GMR-Gal4 UAS-egr; P(dTAK1)/+. (H) dTAK14/+; GMR-Gal4 UAS-egr/+; P(dTAK1)/+. (I) GMR-Gal4 UAS-egr/G56; P(dTAK1)/+. A dTAK1 genomic rescue transgene partially reverts the suppression of the small eye phenotype caused by heterozygous loss of dTAK1G14 or dTAK14 but not the suppression caused by the unrelated suppressor mutation G56. The suppression of the small eye phenotype is not completely reverted by the dTAK1 rescue construct due to the dominant-negative nature of the dTAK1G14 and dTAK14 alleles. Both carry amino acid substitutions in the kinase domain of dTAK1 (VIDAL et al. 2001), which leads to dominant-negative proteins. (J) Molecular lesions found in the 10 novel bsk mutants.

 

Validation of the screen:

In our screen, the genome of GMR-Gal4 animals was exposed to the EMS mutagen. Since Gal4 activity is vital for the small eye phenotype, we expected some of the suppressors to harbor mutations in the Gal4 driver transgene. Twenty-one such events were indeed identified on the basis of the following criteria: (i) lack of recombination separating the suppressor mutation and the GMR-Gal4 transgene insertion and (ii) suppression of unrelated Gal4-dependent overexpression phenotypes, such as the UAS-Inr-driven big eye phenotype (BROGIOLO et al. 2001). Most members of this class show a full reversion of the Eiger-induced small eye phenotype and thus accounted for the vast majority of the complete suppressors.

As described above, JNK activity is critical for the transduction of the Eiger signal. One prediction for our screen would therefore be that it leads to the isolation of new basket (bsk) alleles (Figure 2E). All suppressor mutations that mapped to the second chromosome were subjected to a complementation analysis with a previously described allele of bsk (RIESGO-ESCOVAR et al. 1996; SLUSS et al. 1996). Ten mutations failed to complement bsk1 and subsequent sequence analysis revealed that all of them carry molecular lesions in the bsk coding region (Figure 2J, Table 1).


View this table:
In this window
In a new window

 
TABLE 1

Molecular lesions identified in basket (bsk)

 
Only one mutation (G14) mapped to the X chromosome (Figure 2F). This mutation is homozygous viable and completely suppresses the Eiger-induced small eye phenotype when hemizygous (not shown). Since this behavior reflects exactly that of known dTAK1 alleles (Figure 4F), we expected, and also found, a mutation in the dTAK1 coding region of G14. To confirm that the detected mutation (Thr221 -> Iso) is indeed responsible for the observed suppression of Eiger signaling, rescue experiments with a genomic dTAK1 transgene were performed (VIDAL et al. 2001). G14 animals carrying the dTAK1 rescue construct displayed a reduced suppression of the small eye phenotype (Figure 2G). The known dTAK1 allele dTAK14 shows the same behavior (Figure 2H, compare with Figure 1D). The presumed dominant-negative nature of these two dTAK1 alleles (4 and G14) may explain why the eye phenotype is not completely reverted to "small." Indeed, the suppression activity of a presumed null allele of dTAK1 is fully inhibited by the dTAK1 transgene rescue construct (Figure 4G), while an unrelated suppressor mutation (G56) from our screen showed the same extent of suppression irrespective of the presence or absence of the dTAK1 rescue construct (Figure 2I, compare with Figure 2C).

Mapping and molecular cloning of a novel Eiger suppressor:

Complementation analysis revealed that, with the exception of our bsk alleles and one thus far uncharacterized complementation group, most of the mutations isolated in our screen are homozygous viable like mutations in the dTAK1 or eiger (egr) genes (VIDAL et al. 2001; IGAKI et al. 2002). To group our second chromosomal suppressors by other means, we mapped them by recombination analysis relative to the GMR-Gal4 insertion (see MATERIALS AND METHODS). In parallel, we screened a large collection of deficiencies for dominant suppressors of the Eiger-induced small eye phenotype. These deficiencies are molecularly mapped and uncover ~56% of the Drosophila genome (PARKS et al. 2004). Interestingly, one group of our EMS-induced mutations mapped to the same chromosomal region as deficiency Df(2R)Exel6069, which behaved as a suppressor of Eiger signaling (Figure 3B). Df(2R)Exel6069 uncovers only 20 genes at cytological position 56B5–56C11. By using overlapping deficiencies and sequence analysis (Figure 3A), we identified in 39 suppressors molecular lesions in gene CG7417 (Figure 3C, Table 2). We interpreted these results as an indication that CG7417 may encode a component critically required for Eiger signaling.



View larger version (19K):
In this window
In a new window
Download PPT slide
 
FIGURE 3.—

Identification of dTAB2 (CG7417). (A) The two overlapping deficiencies Df(2R)Exel6069 and Df(2R)P34 narrow down the region of interest to 11 genes. The distal breakpoint of Df(2R)P34 was placed between CG11906 and ribbon on the basis of the fact that Df(2R)P34 and ribbon fail to complement each other (BRADLEY and ANDREW 2001). The CG7417 coding region has a mutation in 39 of the established suppressor stocks. (B) GMR-Gal4 UAS-egr/Df(2R)Exel6069. Df(2R)Exel6069 dominantly suppresses the small eye phenotype whereas Df(2R)P34 does not. (C) Domain architecture and mutations identified in the dTAB2 protein. Red, Gln -> Stop. Blue, Arg -> Stop. Green, Trp -> Stop. Gold, deletions. Black, splice sites mutated. Gray, amino acid substitutions.

 

View this table:
In this window
In a new window

 
TABLE 2

Molecular lesions identified in dTAB2 (CG7417)

 

CG7417 encodes the Drosophila homolog of TAB2:

The full open reading frame (represented by cDNA LD40663) of CG7417 encoded an uncharacterized protein of 831 amino acids with a CUE, a coiled-coil, and a zinc-finger domain (Figure 3C). These domains are found together only in human TAB2 and TAB3 and in homologs of these proteins in other organisms. Human TAB2 and TAB3 are almost identical and were identified as binding partners of TAK1 (TAKAESU et al. 2000; ISHITANI et al. 2003; CHEUNG et al. 2004; JIN et al. 2004). On the basis of the conserved domain architecture we propose CG7417 as the Drosophila homolog of TAB2 and TAB3 and hereafter refer to CG7417 as dTAB2.

Each of the 39 dTAB2 alleles displays a similar degree of suppression of the Eiger-induced small eye phenotype (Figure 4A). Removing both copies of dTAB2 does not fully revert the small eye phenotype to wild type (Figure 4B), indicating that even in complete absence of dTAB2 a slight activation of the pathway can occur (see DISCUSSION). To verify that the suppression activity of our alleles is indeed caused by the mutations detected in the dTAB2 coding region, rescue experiments with a tubulin{alpha}1 promoter-driven dTAB2 transgene were carried out. The predicted suppression caused by heterozygosity for dTAB2 could be overcome by expression of a tubulin{alpha}1-dTAB2 transgene (Figure 4C). Importantly, the tubulin{alpha}1-dTAB2 construct had no effect on the suppression of the Eiger eye phenotype brought about by an unrelated suppressor mutation (G56, Figure 4D).

dTAB2 functions upstream of Hep and dTAK1:

Expression of a constitutively active form of Hep (hepCA) (ADACHI-YAMADA et al. 1999) causes a reduction in eye size (Figure 4H). This effect is mediated by JNK activation as it is completely inhibited by coexpression of Puc (not shown). The HepCA small eye phenotype is suppressed by reducing bsk activity (Figure 4I), but not by reducing dTAB2 activity (Figure 4J), indicating that Bsk and dTAB2 act downstream and upstream of Hep, respectively. The HepCA phenotype is not suppressed in males hemizygous for dTAK1, placing dTAK1, like dTAB2, upstream of Hep (not shown). To address where dTAB2 and dTAK1 act relative to each other, epistasis experiments were performed in S2 cells, using a JNK luciferase reporter system in combination with RNAi. Expression of dTAK1 strongly activated a JNK luciferase reporter. Reporter activity was reduced by RNAi against bsk (Figure 4K) or djun (not shown), but not by RNAi against msn or dTAB2 (Figure 4K), although RNAi against msn and dTAB2 strongly reduces their protein levels (data not shown). These experiments place Msn and dTAB2 upstream of dTAK1.

dTAB2 links dTRAF1 to dTAK1:

In contrast to HepCA and dTak1, overexpression of dTAB2—either in S2 cells (Figure 4L) or in vivo (not shown)—does not activate the JNK pathway, indicating that dTAB2 does not function as a direct activator of dTAK1 but possibly provides an adaptor function. Consistent with this notion, we find that overexpression of dTAB2 exerts a dominant-negative effect on Eiger signal transduction, as it suppresses the Eiger-induced small eye phenotype (Figure 4E).

To explore the molecular nature of such an adaptor function we carried out protein-protein interaction assays with candidate partners of dTAB2. We first found that N-terminally HA-tagged dTAB2 can immunoprecipitate C-terminally FLAG-tagged dTAK1 from Drosophila S2 cell lysates, and vice versa (Figure 5A). The N-terminal half of dTAB2 (aa 1–450), which includes the CUE domain, did not bind to dTAK1, but the C-terminal half (aa 451–831), which includes coiled-coil and Zn-finger domains, was sufficient to interact with dTAK1 (Figure 5B). Removal of amino acids 451–749 severely impaired its interaction with dTAK1 (Figure 5B). This indicates that dTAB2, like TAB2/3 in mammalian systems, interacts with dTAK1 most likely through its coiled-coil domain.

On the basis of the proximal placement of dTAB2 in the Eiger pathway (see above), we also analyzed its interaction with the Drosophila homologs of the TRAF proteins. FLAG-dTAB2 was coexpressed either with an HA-dTRAF1 or with HA-dTRAF2 in S2 cells and was immunoprecipitated with an anti-HA antibody. Western blot analysis of the immune complexes with an anti-FLAG antibody revealed that dTRAF1 (the homolog of hTRAF2) and dTRAF2 (the homolog of hTRAF6) precipitated dTAB2 (Figure 5C). The weaker binding of dTAB2 to dTRAF1 compared to dTRAF2 might be explained by the lack of a RING-finger domain in dTRAF1. The interaction of TAB2/3 with TRAF2/6 in mammals is dependent in part on ubiquitination, which is mediated by the ring-finger domain (TAKAESU et al. 2000; ISHITANI et al. 2003; KANAYAMA et al. 2004). The intact ZnF domain of TAB2/3 is required for binding to polyubiquitin chains (KANAYAMA et al. 2004).

We also tested the binding of the presumptive Eiger receptor Wengen for its interaction with Drosophila TRAF proteins. Wengen was expressed with either HA-dTRAF1 or HA-dTRAF2 in S2 cells. The dTRAFs were precipitated with anti-HA and the precipitates were analyzed with an anti-Wengen antibody (Figure 5D). In agreement with the result of KAUPPILA et al. (2003) we found that Wengen can interact with dTRAF2. In addition, we find that Wengen also interacts with dTRAF1 (Figure 5D).

Next, we asked whether dTRAF1 interacts with dTAK1 directly or via dTAB2. S2 cells were cotransfected with dTAK1-FLAG and either HA-dTRAF1 or HA-dTRAF2. We could detect a very weak binding of both TRAFs with dTAK1, perhaps mediated by endogenous dTAB2. Upon coexpression of dTAB2, significantly increased amount of dTAK1 was precipitated (Figure 5E). This result suggests that dTAB2 can act as an adaptor molecule to link dTRAFs to dTAK1.

dTAB2 mediates JNK activation also upon LPS stimulation:

LPS-induced JNK phosphorylation reflects JNK activation during an innate immune response (SLUSS et al. 1996; BOUTROS et al. 2002). Treatment of S2 cells with LPS indeed dramatically increases JNK phosphorylation (Figure 4F). RNAi targeting dTAK1 or dTAB2 (Figure 4F), but not eiger, wengen, or msn (not shown), prevents this increase in JNK phosphorylation. From this we conclude that dTAB2 mediates dTAK1 activation not only in the Eiger pathway but also in response to other stimuli. Furthermore these results suggest that dTAB2, like dTAK1 (VIDAL et al. 2001), may also play an important role in innate immunity.


DISCUSSION
Here we describe an effective genetic modifier screen for the identification of components of the primordial TNF-JNK-pathway in Drosophila. The isolation of mutations in bsk and dTAK1 validated the specificity of the screen. In addition, the identification of dTAB2 alleles demonstrates that this screening system will also lead to the discovery of other novel components, which so far have escaped detection by genetic means. Together with the low redundancy of its genome, our findings indicate that Drosophila serves as a suitable system to genetically dissect the TNF pathway. Identification of new evolutionarily conserved components of the TNF pathway may shed light on as-yet unknown aspects of this signaling system that plays numerous roles in human disease.

The screen:

The high number of alleles identified for bsk and dTAB2 suggests that we have reached saturation for dosage-sensitive components, at least for the second and third chromosome. The allele frequencies for the loci analyzed differ considerably. The fact that we found only a single dTAK1 allele can be explained by the genetic setup, in which only a small fraction of mutagenized X chromosomes are recovered (see Figure 2A legend). While the allele frequencies for the bsk and Gal4 genes are roughly proportional to the size of their coding regions (bsk, 1 kb—10 alleles; Gal4, 2.6 kb—21 alleles), we isolated a surprisingly high number of dTAB2 alleles (the dTAB2 coding region is ~2.5 kb, with 39 molecularly confirmed alleles). This high number of dTAB2 alleles is particularly surprising when the low degree of sequence conservation is taken into consideration. Only short domains with sequence similarities to its mammalian homologs can be identified (Figure 3C: CUE, coiled coil, and ZnF), consistent with a role as an adaptor protein. The most effective way to abolish the function of an adaptor is to disconnect the two protein interaction domains, which genetically is best achieved by the introduction of a stop codon between these domains. EMS induces primarily G/C -> A/T mutations (ASHBURNER 1989). Codons of only three amino acids can be mutated to stops by this means: Gln (CAA, CAG), Trp (TGG), and Arg (only CGA). For Arg five other codons exist for which this is not the case, while all Gln and Trp codons can serve as substrates for EMS-induced nonsense mutations. Thus the frequency by which EMS causes premature chain terminations in a gene is largely a function of the Gln and Trp content of its product. It is interesting to note, therefore, that dTAB2 has a Gln content that exceeds the mean Gln frequency of the Drosophila proteome by more than a factor of 2.5 (13.7% vs. 5.1%). Indeed, molecular analysis of our dTAB2 alleles revealed that 24 of the 39 alleles are nonsense mutations of Gln codons (Figure 3C, red alleles).

The pathway:

A central issue concerning the TNF/JNK pathway relates to the question of how TAK1 is activated (SHIBUYA et al. 1996; KISHIMOTO et al. 2000; SAKURAI et al. 2000). On the basis of previous studies and our genetic and biochemical analysis we propose a model for the Eiger pathway, in which dTAB2 and dTRAF1 function as adaptors between the JNKKKK Msn and the JNKKK dTAK1 and in this way may mediate activation of dTAK1 by Msn and the subsequent transduction of the signal via Hep and Bsk (Figure 6). The outline of the pathway is based on the following arguments:
  1. Genetic studies have demonstrated the involvement of Msn and dTAK1 in Eiger signaling (IGAKI et al. 2002; MORENO et al. 2002).
  2. We identified dTAB2 as an additional component of the Eiger pathway (this article).
  3. Epistasis experiments in S2 cells and in vivo place Msn and dTAB2 upstream of dTAK1 and Hep (Figure 4, H–K).
  4. LIU et al. (1999) have shown that Msn interacts with dTRAF1.
  5. dTAB2 also binds to dTRAF1 (Figure 5C). Although we failed to detect biochemical evidence for a triple complex Msn-dTRAF1-dTAB2 (data not shown), points 4 and 5 suggest that dTRAF1 may act as an adaptor to link Msn and dTAB2. It is possible that such a complex forms only transiently and is thus difficult to detect biochemically.
  6. A triple complex consisting of dTRAF1-dTAB2-dTAK1 can form (Figure 5D), in which dTAB2 functions as a link between dTRAF1 and dTAK1. While each of the above arguments may also be compatible with other models, they collectively support a scenario (Figure 6) in which dTAB2 facilitates the phosphorylation of dTAK1 by Msn. The dominant-negative effect observed by expression of wild-type dTAB2 is an indication that dTAB2 protein levels are critical for proper complex formation (Figure 4E). Our observation that the Eiger-induced small eye phenotype is not entirely suppressed in animals homozygous mutant for dTAB2 suggests that even in the absence of dTAB2 Msn is able to activate dTAK1, although only inefficiently. In the wild-type situation, dTAB2 may function as an adaptor that stabilizes such a signaling complex for efficient transduction of the Eiger signal.



View larger version (14K):
In this window
In a new window
Download PPT slide
 
FIGURE 6.—

Proposed model for Eiger signaling in Drosophila. Following the binding of Eiger to Wengen a signaling complex consisting of Msn-dTRAF1-dTAB2-dTAK1 is stabilized, which allows the phosphorylation and activation of dTAK1 by Msn. Subsequently dTAK1 activates the core JNKK-JNK module, consisting of the Drosophila homologs Hep and Bsk.

 
Even though dTRAF1 exhibited a weaker interaction than dTRAF2 toward dTAB2 and Wengen, we suggest that dTRAF1 rather than dTRAF2 functions as a component of this signaling complex on the basis of the following arguments: (1) Only dTRAF1 but not dTRAF2 binds to Msn (LIU et al. 1999); (2) loss-of-function and protein-interaction studies place dTRAF1 in the JNK pathway and dTRAF2 in the NF-{kappa}B pathway (LIU et al. 1999; SHEN et al. 2001; CHA et al. 2003); and (3) males hemizygous mutant for dTRAF2 do not suppress the Eiger-induced small eye phenotype (not shown; dTRAF1 alleles are homozygous lethal and could not be properly analyzed—see MATERIALS AND METHODS).

In mammalian systems it is not understood how TAK1 is activated. TAB1 is an activator of TAK1, but the mechanism by which it activates TAK1 and the possible involvement of upstream kinases are not known (SHIBUYA et al. 1996; SAKURAI et al. 2000). In Drosophila no functional TAB1 homolog has been identified so far. On the basis of our genetic epistasis data, its interaction with dTRAF1, and its homology to MAP4Ks, we propose that Msn functions as an upstream kinase of dTAK1. In mammals NIK and germinal center kinases are structural homologs of Msn. NIK has been demonstrated to act downstream of TAK1 (NINOMIYA-TSUJI et al. 1999) in NF-{kappa}B activation. Several germinal center kinases have been involved in TRAF-mediated activation of JNK (YUASA et al. 1998; FU et al. 1999; SHI et al. 1999; SHI and KEHRL 2003). It will be interesting to determine whether one of them plays a role in TNF-induced activation of TAK1. The mapping of other suppressor mutations and the characterization of their corresponding gene products may unravel important aspects of this evolutionarily ancient signaling pathway that has been employed for prominent roles in mammalian development and homeostasis.


ACKNOWLEDGEMENTS
We thank E. Moreno and C. von Mering for valuable advice; T. Adachi-Yamada, D. Egli, B. Lemaitre, M. Nakamura, and Exelixis for fly stocks; P. Bregy and D. Dosch for technical help; and P. Gallant, G. Hausmann, and H. Stocker for comments on the manuscript. This work was supported by the Swiss National Science Foundation and the Kanton of Zürich.


LITERATURE CITED

ADACHI-YAMADA, T., K. FUJIMURA-KAMADA, Y. NISHIDA and K. MATSUMOTO, 1999 Distortion of proximodistal information causes JNK-dependent apoptosis in Drosophila wing. Nature 400: 166–169.[CrossRef][Medline]

ASHBURNER, M., 1989 Drosophila. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

BASLER, K., and G. STRUHL, 1994 Compartment boundaries and the control of Drosophila limb pattern by hedgehog protein. Nature 368: 208–214.[CrossRef][Medline]

BOUTROS, M., H. AGAISSE and N. PERRIMON, 2002 Sequential activation of signaling pathways during innate immune responses in Drosophila. Dev. Cell 3: 711–722.[CrossRef][Medline]

BRADLEY, P. L., and D. J. ANDREW, 2001 ribbon encodes a novel BTB/POZ protein required for directed cell migration in Drosophila melanogaster. Development 128: 3001–3015.[Abstract/Free Full Text]

BRAND, A. H., and N. PERRIMON, 1993 Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118: 401–415.[Abstract]

BROGIOLO, W., H. STOCKER, T. IKEYA, F. RINTELEN, R. FERNANDEZ et al., 2001 An evolutionarily conserved function of the Drosophila insulin receptor and insulin-like peptides in growth control. Curr. Biol. 11: 213–221.[CrossRef][Medline]

CHA, G. H., K. S. CHO, J. H. LEE, M. KIM, E. KIM et al., 2003 Discrete functions of TRAF1 and TRAF2 in Drosophila melanogaster mediated by c-Jun N-terminal kinase and NF-kappaB-dependent signaling pathways. Mol. Cell. Biol. 23: 7982–7991.[Abstract/Free Full Text]

CHEUNG, P. C., A. R. NEBREDA and P. COHEN, 2004 TAB3, a new binding partner of the protein kinase TAK1. Biochem. J. 378: 27–34.[CrossRef][Medline]

CLEMENS, J. C., C. A. WORBY, N. SIMONSON-LEFF, M. MUDA, T. MAEHAMA et al., 2000 Use of double-stranded RNA interference in Drosophila cell lines to dissect signal transduction pathways. Proc. Natl. Acad. Sci. USA 97: 6499–6503.[Abstract/Free Full Text]

FU, C. A., M. SHEN, B. C. HUANG, J. LASAGA, D. G. PAYAN et al., 1999 TNIK, a novel member of the germinal center kinase family that activates the c-Jun N-terminal kinase pathway and regulates the cytoskeleton. J. Biol. Chem. 274: 30729–30737.[Abstract/Free Full Text]

HAY, B. A., T. WOLFF and G. M. RUBIN, 1994 Expression of baculovirus P35 prevents cell death in Drosophila. Development 120: 2121–2129.[Abstract]

IGAKI, T., H. KANDA, Y. YAMAMOTO-GOTO, H. KANUKA, E. KURANAGA et al., 2002 Eiger, a TNF superfamily ligand that triggers the Drosophila JNK pathway. EMBO J. 21: 3009–3018.[CrossRef][Medline]

ISHITANI, T., G. TAKAESU, J. NINOMIYA-TSUJI, H. SHIBUYA, R. B. GAYNOR et al., 2003 Role of the TAB2-related protein TAB3 in IL-1 and TNF signaling. EMBO J. 22: 6277–6288.[CrossRef][Medline]

JIN, G., A. KLIKA, M. CALLAHAN, B. FAGA, J. DANZIG et al., 2004 Identification of a human NF-kappaB-activating protein, TAB3. Proc. Natl. Acad. Sci. USA 101: 2028–2033.[Abstract/Free Full Text]

KANAYAMA, A., R. B. SETH, L. SUN, C. K. EA, M. HONG et al., 2004 TAB2 and TAB3 activate the NF-kappaB pathway through binding to polyubiquitin chains. Mol. Cell 15: 535–548.[CrossRef][Medline]

KANDA, H., T. IGAKI, H. KANUKA, T. YAGI and M. MIURA, 2002 Wengen, a member of the Drosophila tumor necrosis factor receptor superfamily, is required for Eiger signaling. J. Biol. Chem. 277: 28372–28375.[Abstract/Free Full Text]

KAUPPILA, S., W. S. MAATY, P. CHEN, R. S. TOMAR, M. T. EBY et al., 2003 Eiger and its receptor, Wengen, comprise a TNF-like system in Drosophila. Oncogene 22: 4860–4867.[CrossRef][Medline]

KISHIMOTO, K., K. MATSUMOTO and J. NINOMIYA-TSUJI, 2000 TAK1 mitogen-activated protein kinase kinase kinase is activated by autophosphorylation within its activation loop. J. Biol. Chem. 275: 7359–7364.[Abstract/Free Full Text]

LIU, H., Y. C. SU, E. BECKER, J. TREISMAN and E. Y. SKOLNIK, 1999 A Drosophila TNF-receptor-associated factor (TRAF) binds the ste20 kinase Misshapen and activates Jun kinase. Curr. Biol. 9: 101–104.[CrossRef][Medline]

LOCKSLEY, R. M., N. KILLEEN and M. J. LENARDO, 2001 The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell 104: 487–501.[CrossRef][Medline]

MARTIN-BLANCO, E., A. GAMPEL, J. RING, K. VIRDEE, N. KIROV et al., 1998 puckered encodes a phosphatase that mediates a feedback loop regulating JNK activity during dorsal closure in Drosophila. Genes Dev. 12: 557–570.[Abstract/Free Full Text]

MORENO, E., M. YAN and K. BASLER, 2002 Evolution of TNF signaling mechanisms: JNK-dependent apoptosis triggered by Eiger, the Drosophila homolog of the TNF superfamily. Curr. Biol. 12: 1263–1268.[CrossRef][Medline]

NEWSOME, T. P., B. ASLING and B. J. DICKSON, 2000 Analysis of Drosophila photoreceptor axon guidance in eye-specific mosaics. Development 127: 851–860.[Abstract]

NINOMIYA-TSUJI, J., K. KISHIMOTO, A. HIYAMA, J. INOUE, Z. CAO et al., 1999 The kinase TAK1 can activate the NIK-I kappaB as well as the MAP kinase cascade in the IL-1 signalling pathway. Nature 398: 252–256.[CrossRef][Medline]

PARKS, A. L., K. R. COOK, M. BELVIN, N. A. DOMPE, R. FAWCETT et al., 2004 Systematic generation of high-resolution deletion coverage of the Drosophila melanogaster genome. Nat. Genet. 36: 288–292.[CrossRef][Medline]

RIESGO-ESCOVAR, J. R., M. JENNI, A. FRITZ and E. HAFEN, 1996 The Drosophila Jun-N-terminal kinase is required for cell morphogenesis but not for DJun-dependent cell fate specification in the eye. Genes Dev. 10: 2759–2768.[Abstract/Free Full Text]

SAKURAI, H., H. MIYOSHI, J. MIZUKAMI and T. SUGITA, 2000 Phosphorylation-dependent activation of TAK1 mitogen-activated protein kinase kinase kinase by TAB1. FEBS Lett. 474: 141–145.[CrossRef][Medline]

SHEN, B., H. LIU, E. Y. SKOLNIK and J. L. MANLEY, 2001 Physical and functional interactions between Drosophila TRAF2 and Pelle kinase contribute to Dorsal activation. Proc. Natl. Acad. Sci. USA 98: 8596–8601.[Abstract/Free Full Text]

SHI, C. S., and J. H. KEHRL, 2003 Tumor necrosis factor (TNF)-induced germinal center kinase-related (GCKR) and stress-activated protein kinase (SAPK) activation depends upon the E2/E3 complex Ubc13-Uev1A/TNF receptor-associated factor 2 (TRAF2). J. Biol. Chem. 278: 15429–15434.[Abstract/Free Full Text]

SHI, C. S., A. LEONARDI, J. KYRIAKIS, U. SIEBENLIST and J. H. KEHRL, 1999 TNF-mediated activation of the stress-activated protein kinase pathway: TNF receptor-associated factor 2 recruits and activates germinal center kinase related. J. Immunol. 163: 3279–3285.[Abstract/Free Full Text]

SHIBUYA, H., K. YAMAGUCHI, K. SHIRAKABE, A. TONEGAWA, Y. GOTOH et al., 1996 TAB1: an activator of the TAK1 MAPKKK in TGF-beta signal transduction. Science 272: 1179–1182.[Abstract]

SLUSS, H. K., Z. HAN, T. BARRETT, R. J. DAVIS and Y. T. IP, 1996 A JNK signal transduction pathway that mediates morphogenesis and an immune response in Drosophila. Genes Dev. 10: 2745–2758.[Abstract/Free Full Text]

STRONACH, B., 2005 Dissecting JNK signaling, one KKKinase at a time. Dev. Dyn. 232: 575–584.[CrossRef][Medline]

STRONACH, B., and N. PERRIMON, 2002 Activation of the JNK pathway during dorsal closure in Drosophila requires the mixed lineage kinase, slipper. Genes Dev. 16: 377–387.[Abstract/Free Full Text]

TAKAESU, G., S. KISHIDA, A. HIYAMA, K. YAMAGUCHI, H. SHIBUYA et al., 2000 TAB2, a novel adaptor protein, mediates activation of TAK1 MAPKKK by linking TAK1 to TRAF6 in the IL-1 signal transduction pathway. Mol. Cell 5: 649–658.[CrossRef][Medline]

VIDAL, S., R. S. KHUSH, F. LEULIER, P. TZOU, M. NAKAMURA et al., 2001 Mutations in the Drosophila dTAK1 gene reveal a conserved function for MAPKKKs in the control of rel/NF-kappaB-dependent innate immune responses. Genes Dev. 15: 1900–1912.[Abstract/Free Full Text]

WALLACH, D., E. E. VARFOLOMEEV, N. L. MALININ, Y. V. GOLTSEV, A. V. KOVALENKO et al., 1999 Tumor necrosis factor receptor and Fas signaling mechanisms. Annu. Rev. Immunol. 17: 331–367.[CrossRef][Medline]

YUASA, T., S. OHNO, J. H. KEHRL and J. M. KYRIAKIS, 1998 Tumor necrosis factor signaling to stress-activated protein kinase (SAPK)/Jun NH2-terminal kinase (JNK) and p38. Germinal center kinase couples TRAF2 to mitogen-activated protein kinase/ERK kinase kinase 1 and SAPK while receptor interacting protein associates with a mitogen-activated protein kinase kinase kinase upstream of MKK6 and p38. J. Biol. Chem. 273: 22681–22692.[Abstract/Free Full Text]

Communicating editor: K. G. GOLIC




This article has been cited by other articles:


Home page
J. Immunol.Home page
G. W. Glenney and G. D. Wiens
Early Diversification of the TNF Superfamily in Teleosts: Genomic Characterization and Expression Analysis
J. Immunol., June 15, 2007; 178(12): 7955 - 7973.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
S. Polaski, L. Whitney, B. W. Barker, and B. Stronach
Genetic Analysis of Slipper/Mixed Lineage Kinase Reveals Requirements in Multiple Jun-N-Terminal Kinase-Dependent Morphogenetic Events During Drosophila Development
Genetics, October 1, 2006; 174(2): 719 - 733.
[Abstract] [Full Text] [PDF]