| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Genetics, Vol. 170, 779-792, June 2005, Copyright © 2005
doi:10.1534/genetics.104.035691
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


Department of Biology, Tokyo Metropolitan University, Tokyo 192-0397, Japan
* Department of Life Sciences and Zoology, University of Toronto at Scarborough, Toronto, Ontario M1C 1A4, Canada
1 Corresponding author: Department of Life Sciences, University of Toronto at Scarborough, 1265 Military Trail, Toronto, ON M1C 1A4, Canada.
E-mail: stewart{at}utsc.utoronto.ca
| ABSTRACT |
|---|
|
|
|---|
-SNAP (soluble NSF attachment protein), can bind a protein complex of SNAP receptors (the SNARE complex). The SNARE complex is a tripartite complex (SOLLNER et al. 1993b) consisting of VAMP, syntaxin, and SNAP-25. A trans-membrane SNARE complex consisting of VAMP on the vesicle and syntaxin and SNAP-25 on the target membrane is thought to form the core molecular machinery that can mediate vesicular fusion (WEBER et al. 1998; PARLATI et al. 1999). Following fusion and incorporation of the vesicle into the target membrane, all three members of the SNARE complex reside in the same membrane: this is called a cis-SNARE complex. NSF and
-SNAP can bind the cis-SNARE complex and upon ATP hydrolysis the barrel-shaped NSF hexamer rotates and imparts torsional force on the SNARE complex through
-SNAP. This force disassembles the SNARE complex, freeing the individual SNAREs for further rounds of vesicle fusion.
In addition to this canonical role for NSF, other roles have recently emerged (WHITEHEART and MATVEEVA 2004). The most widely studied new role for NSF is in trafficking of postsynaptic
-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA)-type glutamate neurotransmitter receptors (NISHIMUNE et al. 1998; SONG et al. 1998). Insertion and retrieval of neurotransmitter receptors is thought to be an important mechanism regulating synaptic strength (NISHIMUNE et al. 1998; NOEL et al. 1999) and NSF is an important molecule regulating receptor trafficking. It appears that the ATPase activity of NSF is important for regulating the disassembly of a protein complex containing a glutamate receptor subunit (GluR2) and PICK-1 (HANLEY et al. 2002). These data show that non-SNARE protein complexes can act as substrates for NSF's activity and raise the possibility that NSF interacts with non-SNARE proteins in the presynaptic nerve terminal as well.
Other recently identified molecules that interact with NSF include G-protein-coupled receptors, Lma1, GATE-16, and rab6 (XU et al. 1998; MCDONALD et al. 1999; HAN et al. 2000; CONG et al. 2001; MULLER et al. 2002). Altogether these interactions indicate that NSF likely has a large repertoire of cellular functions.
Drosophila has two NSF isoforms that share 80% amino acid identity (BOULIANNE and TRIMBLE 1995; PALLANCK et al. 1995) and they can functionally substitute for each other (GOLBY et al. 2001). NSF1 is the functionally predominant isoform in the adult central nervous system, while NSF2 is functional throughout early development in neural and nonneural tissue. Null alleles of NSF1 die as pharate adults while NSF2 null alleles die early as first instar larvae (GOLBY et al. 2001). We wished to study synaptic development and function at the accessible larval neuromuscular synapse. To circumvent the lethality associated with severe NSF2 mutants, we generated dominant-negative NSF2 constructs (NSF2E/Q; STEWART et al. 2001) that can be expressed in a tissue-specific manner, in the wild-type background. When expressed in larval neurons, this NSF2E/Q construct suppresses synaptic transmission, reduces the size of the pool of releasable synaptic vesicles, and increases synaptic fatigue (STEWART et al. 2002). Surprisingly, we also observed a dramatic overgrowth of the neuromuscular junction. This phenotype is not likely a response to impaired synaptic physiology since mutations in syntaxin or n-synaptobrevin that reduce synaptic transmission to comparable levels do not have a hypersprouting phenotype at the neuromuscular junction (NMJ) (STEWART et al. 2000). Thus, in contrast to the other SNARE mutants, it appears that the overgrowth phenotype is unique to NSF and may indicate that NSF additionally plays a developmental role at the NMJ. To further understand the overgrowth phenotype, and to identify genes that interact with NSF, we have conducted a suppressor screen to identify genes that, when overexpressed, can restore the NSF2 mutant NMJ morphology to normal.
| MATERIALS AND METHODS |
|---|
|
|
|---|
10-fold compared to enhancer promoter (EP) elements, which drive gene expression in one direction only (TOBA et al. 1999). In addition, we screened unidirectional misexpression lines carrying P{GS2}, P{GS3}, and P{GS6} vectors (T. AIGAKI, unpublished results; see http://www.comp.metro-u.ac.jp/%7Eatsugyou/gs/Methods/Vectors/GSvectors.html). Generation of dominant-negative UAS-NSF2E/Q is described in STEWART et al. (2001), and the recombinant third chromosome bearing elav3A-Gal4 and UAS-NSF2E/Q is described in STEWART et al. (2002). P{Mhc.CD8-GFP-Sh}, described in ZITO et al. (1999), carries the myosin heavy chain (MHC) promoter driving the expression of a chimeric GFP fusion protein bearing the CD8 transmembrane domain and the C-terminal of the Shaker potassium channel. This fusion protein concentrates at type I neuromuscular junction boutons, thus providing postsynaptic GFP labeling of the NMJ.
Screening for NMJ overgrowth suppressors:
We directly screened for changes in NMJ morphology using the GFP transgene as first described in PARNAS et al. (2001). A total of 510 virgin females of the stock w Mhc.CD8-GFP-Sh; elav3A-Gal4.UAS-NSF2E/Q/TM6B,Tb were mated to three to five males from viable gene search lines. Non-Tb larval offspring were selected for direct analysis of NMJ morphology. For GS lines that were known to be located on the X chromosome, the sexes were reversed and only female non-Tb larvae were examined. In total,
3000 GS lines were screened. To visualize the NMJ in the intact larvae, we immobilized the larvae by placing up to four of them in a 0.2-ml tube with 100 µl of glycerol that was heated to 60° for 10 sec in a thermocycler. The larvae were then placed onto glass slides in glycerol with a coverslip, which was used to role the larvae into a lateral orientation.
GFP signals were viewed at the neuromuscular junction within the intact larvae on a Nikon E600FN microscope using a x40 long working distance objective. Fluorescent illumination was provided by a 100-W Hg bulb and GFP filter set. A Hammamatsu ORCA ER camera was used to visualize the GFP signals, and images of NMJs from intact larvae were acquired with SimplePCI software (Compix, Mars, PA).
We routinely scored NMJs of muscles 12 and 13 since they have a reasonably unobstructed view in the intact larva and they could be easily identified by first locating the lateral end of the denticle belts and then identifying the triangle formed by muscles 12, 5, and 8. Occasionally we scored NMJs of muscles 6/7 or muscle 4, but these were usually harder to visualize in the intact animal.
Immunocytochemistry:
For tertiary screening to confirm the observations made in the intact larvae, we dissected third instar larvae in HL3 saline (STEWART et al. 1994), fixed the preparation in 4% formaldehyde for 10 min, washed the preparation in phosphate-buffered saline plus 0.1% Triton X-100 for 30 min, followed by a 1- to 2-hr incubation at room temperature, or overnight at 4°, in 1:1000 dilution of FITC-conjugated goat anti-HRP antibody (ICN Biochemicals). The preparations were washed for another 30 min and then mounted in Vectashield (Vector Labs, Burlingame, CA) for microscopic analysis. Neuromuscular junction rescue data were tabulated using Microscoft Access and analyzed using Microsoft Excel and Graphpad Prism 3.0. Images were acquired on a Zeiss LSM 510 confocal microscope with a x40 oil immersion lens by collecting z-sections at 1-µm intervals and projecting the images onto a single plane.
Identification of P{GS} insertion sites:
Standard molecular methods for inverse polymerase chain reaction (PCR) were used to identify the insertion sites of the GS elements. In brief, DNA was prepared from
30 adult flies and digested with Sau3AI or MspI (for 5' sequence of GS lines 50005999 and 70007999). The DNA fragments were then ligated overnight at 4° with T4 DNA ligase. Ligated fragments were next amplified via PCR with primer sets designed to amplify from P{GS}sequence. Detailed methods, including primer sequences, are available at http://www.comp.metro-u.ac.jp/%7Eatsugyou/gs/Methods/protocol.html.
Following amplification, the PCR products were analyzed by DNA sequencing using the following sequencing primers: 5'seq, TCGTCCGCACACAACCTTTC; 3'pseq, CTCACTCAGACTCAATACGAC. The DNA sequence data flanking the GS element insertions were compared to the Drosophila genome sequence, made publicly available by the Berkeley Drosophila Genome Project, and the GS elements were thus superimposed on the genomic map of known and predicted genes.
Quantitative RT-PCR for GS vector flanking genes:
GS lines were crossed to hs-GAL4 stock (P{GAL4-Hsp70.PB}89-2-1). The resulting third instar larvae were heat induced for 45 min at 37°, allowed to recover for 1 hr at 25°, and then homogenized in QIAGEN (Chatsworth, CA) RLT buffer using FASTPREP FP120 (BIO101) with lysing matrix D (BIO101). Lysate was eluted through a Qiashredder, and total RNA was then isolated using a QIAGEN RNeasy mini kit. Fifty micrograms of total RNA was treated with RNase free DNase I (TAKARA) to eliminate genomic DNA contamination. Two micrograms of total RNA was used as template for reverse transcription (Invitrogen SuperScript III RNase H free reverse transcriptase), and the resulting cDNA samples were then used as templates for quantitative PCR using PTC-200 cycler equipped with a Chromo4 real-time fluorescence detector (MJ Research, Watertown, MA). PCR was carried out with TAKARA SYBR Premix Ex Taq and a pair of gene-specific primers (listed below). RpL32 ribosomal protein mRNA in each sample was also quantified as an internal control using primers RP49-F2 GCTAAGCTGTCGCACAAATG) and RP49-R TGTGCACCAGGAACTTCTTG). We used the following amplification parameters: hot start 95° 1 min, then 45 cycles of (95° for 5 sec 57° for 20 sec, 72° for 15 sec). The amount of PCR product was monitored and quantitated using Opticon software (MJ Research). To compare with the endogenous level of mRNA, samples were prepared from the corresponding GS lines and subjected to quantitative PCR. Experiments were repeated four times for each genotype.
The following forward (f) and reverse (r) gene-specific primers were used: CG3793(f) GAAGGACGACTACATCGGGTACTT; CG3793(r) GCACTCGGCGAGAAATATGGTGGG; Gli(f) CGGCGAATACACGTTCAAGTAGAG; Gli(r) TGAAGTCCATCGACATCTACACGG; Snap(f) GATGGTGGTGTACCACTGATCCAA; Snap(r) GATGGTGGTGTACCACTGATCCAA; polo(f) AAGCATTACGGAGTTCGAATGCCG; polo(r) AAGAACATGGGCACCTTTGAGCCC; CG32225(f) CTGCCTCAACGTGGCACTGATTTA; and CG32225(r) CCTTGTCGCAGACATAGGACTTAC.
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
The NSF2E/Q hypersprouting phenotype is extremely penetrant, showing clear defects in every hemi-segment of the larval bodywall. The hallmarks of this mutant allele are very long nerve terminal branches, supernumerary branches, and small synaptic boutons. Thus, it is relatively easy to score rescue of this phenotype since any change toward normal is an indicator of genetic interaction. We concentrated our screen of intact NMJs on muscles 12 and 13 and used two criteria to judge rescue, reduction of nerve terminal branch length, and restoration of synaptic bouton morphology (Figure 1). For our initial screen, we categorized rescued animals into strong, moderate, and weak rescues with the strong categorization reserved for lines that produced nearly normal NMJs in several hemi-segments. The moderate and weak descriptors were used for those lines that showed some degree of rescue of either branch length or bouton number in a fewer number of hemi-segments. We scored at least three intact larvae per GS line and kept lines in which weak rescue was observed in at least two hemisegments. From the initial screen we kept
300 lines. We next rescreened these GS lines and retested the ability of the GS lines to rescue the phenotype. After the second round of scoring we kept 99 GS lines from the 3000 initially screened for further analysis.
|
|
25% of the NMJs showed some degree of rescue. The muscle 4 NMJ shows rescue in
25% of NMJs in all the segments examined. Therefore, we conservatively expect to observe rescue in
1/4 of m6/7 or m12/13 NMJs in the GS lines examined.
|
|
|
Interestingly, MAREK et al. (2000) have examined cyclic AMP response element-binding protein (CREB) (nejire) function at larval neuromuscular synapses and while they found that the presynaptic overexpression of CREB impaired neurotransmitter release, it had no effect on presynaptic morphology. Here we found that a GS line in position to overexpress CREB in the NSF2E/Q mutant background rescues the overgrowth phenotype, suggesting that this gene may have a role in presynaptic development.
Three of the 18 transcriptional regulators, buttonless, couch potato, and hoi polloi, were previously recovered in loss-of-function screens designed to uncover genes important for peripheral nervous system development (SALZBERG et al. 1997; PROKOPENKO et al. 2000). Our results indicate the potential for these genes to also be involved in motor neuron development.
One gene that we recovered, ovo, is not normally associated with neural function. ovo is normally expressed in the male and female germline cells, where it controls F-actin extension. When expressed in the eye under UAS/Gal4 control, eye bristle formation is impaired and induces ectopic extensions from the ommatadia (DELON et al. 2003), suggesting that it has a strong influence on cytoskeletal remodeling (see Cytoskeletal components and regulators below).
Currently no expression data or mutational analysis is available for skuld, His2av, CG10865, CG4119, CG6388, and CG31782 so it is difficult to determine whether the effects we see here are gain-of-function overexpression effects or the effect of misexpression.
Cytoskeletal components and regulators:
It is likely that overgrowth of the neuromuscular junction ultimately affects the underlying cytoskeleton but it was somewhat surprising to identify a large number of genes composing structural components of the cytoskeleton or enzymes with the potential to regulate cytoskeletal dynamics. The structural genes are Actin5c, moesin, fimbrin, syntrophin-like 2, Myosin binding subunit, Ptpmeg, and CG5740. Two genes that encode proteins with enzymatic activity that have the potential to regulate the cytoskeleton, RhoBTB and RhoGap18B, were also found.
Actin5C is one of two cytoplasmic actins in Drosophila and it is highly expressed in many tissues throughout development (FYRBERG et al. 1983). It has been studied extensively in many processes, including spermatogenesis and dorsal closure (KIEHART et al. 2000; NOGUCHI and MILLER 2003). In the nervous system, Act5c has been recovered in a screen for changes in bristle numberpresumably a reporter of peripheral nervous system development (NORGA et al. 2003)and its role has been studied in glial cell function (SEPP and AULD 2003).
Moesin is a member of the ezrin-radixin-moesin (ERM) family of actin-binding proteins that link actin to the plasma membrane. While a neural role for Drosophila moesin has not previously been reported, it does have a role in growth cone motility in other neural systems (PAGLINI et al. 1998) and a recent report demonstrates the role of Drosophila moesin in photoreceptor rhabdomere development (KARAGIOSIS and READY 2004).
Ubiquitin pathway components:
We additionally identified four genes involved in the ubiquitin protein degradation pathway: bendless, Bruce, thread, and Ufd1-like. The gene products of bendless, Bruce, and thread (also known as DIAP1) are thought to act as E2 or E3 ubiquitin-conjugating enzymes (MURALIDHAR and THOMAS 1993; OH et al. 1994; VERNOOY et al. 2002; WILSON et al. 2002). The Ufd1-like gene encodes a transcript that is involved in ubiquitin-dependent protein degradation (RATTI et al. 2001). Thus, the four candidates in this category would all have the potential to enhance ubiquitin-dependent protein degradation if their expression is increased.
Identification of these genes is an important finding in light of previous developmental NMJ studies, which revealed that loss-of-function mutants of highwire, whose gene product contains a RING finger domain implicated in E3 ubiquitin ligase activity, lead to NMJ overgrowth (WAN et al. 2000) that is very similar to NSF2E/Q-induced overgrowth. Furthermore, transgenic overexpression of fat facets also causes excessive NMJ overgrowth (DIANTONIO et al. 2001). faf encodes a deubiquitinating protease (HUANG et al. 1995) and is thought to protect ubiquitinated proteins from degradation.
Therefore, hiw loss of function or faf overexpression should lead to reduced ubiquitin-dependent protein degradation. Since the NSF2E/Q phenotype is rescued by expression of genes that should increase the ubiquitin degradation pathway, we infer that reduced ubiquitin pathway function may also be one of the molecular dysfunctions underlying the NSF2E/Q phenotype.
Signaling proteins:
We identified three genes involved in G-protein-receptor-coupled signaling: methuseleh (mth), Frizzled 4, and AlstR. methuseleh is a gene first identified for its effects on life span (LIN et al. 1998) and prior analysis of mth at the NMJ, using hypomorphic loss-of-function mutants, revealed no effect on the number of synaptic boutons or length of NMJ branches (SONG et al. 2002). Our results suggest that mth may have a previously undetected developmental role at the synapse.
Frizzled 4 is a Wnt receptor that is expressed in the CNS (JANSON et al. 2001) but so far there has been no genetic analysis of this receptor. However, a recent study has demonstrated the involvement of Wnt signaling at the Drosophila NMJ, showing that wingless (wg) loss of function resulted in fewer boutons while presynaptic wg overexpression produced more boutons; these effects are thought to be mediated through the Wnt receptor Frizzled 2 (PACKARD et al. 2002). While it is currently unknown if the CNS expression of fz4 is presynaptic or not, our result implies that there may be an autocrine component to Wnt signaling at the synapse, as there is during wing development (HOOPER 1994).
There is no previous neural expression or mutant data for Galpha73B, a component of a trimeric G-protein complex, and it is not presently clear how this gene aids the restoration of NSF2E/Q neuromuscular overgrowth.
Four genes with known or predicted kinase activity were also recovered: Pka-C1, grapes, Pak3, and CG6386. Prominent in this group is Pka-C1, which encodes cAMP-dependent protein kinase 1. Previous studies of rutabaga, the adenylyl cyclase that produces cAMP, and dunce, the phosphodiesterase that hydrolyzes cAMP, have shown dramatic effects on NMJ morphology and physiology (ZHONG et al. 1992). Loss of function of either rut or dnc leads to NMJ overgrowth, although the extent of that effect is not as large as is seen with the NSF2E/Q allele. Interestingly, GS9123 is inserted 252 bp upstream of the rutabaga 5'-UTR; however, the orientation of the UAS sequence appears to be in the wrong direction to drive expression of rut.
PAK3 is a member of the p21-activated kinase family that has been shown in other systems to strongly influence the cytoskeleton (EBY et al. 1998) by way of its interactions with the small GTPases Rho and cdc42 that directly regulate actin biochemistry. Thus, our finding of PAK3 also potentially fits with our observations of the cytoskeletal components described above.
Three genes with activity in the Ras signaling pathway were found: C3G, PTP-ER, and CG32560. C3G is a RAS family guanine nucleotide exchange factor (ISHIMARU et al. 1999) that activates Ras by catalyzing exchange of GDP for GTP. PTP-ER encodes a tyrosine phosphatase that dephosphorylates Drosophila MAPK (KARIM and RUBIN 1999), thereby downregulating its kinase activity. CG32560 is predicted to be a RAS GTPase activator, which would activate GTP hydrolysis and downregulate RAS signaling. Thus, the result of C3G appears to be in contradiction to the results of PTP-ER and CG32560.
The Spitz protein is the EGF receptor (EGFR) ligand that has been implicated in many developmental processes, including photoreceptor axon guidance. rolled is the Drosophila homolog of MAP kinase and a downstream target of EGFR. MAPK has recently been linked to Netrin-dependent growth cone attraction through the Netrin receptor DCC (FORCET et al. 2002).
Finally, another important signaling gene that we identified was NetrinB. This is one of two Netrin isoforms in Drosophila that are well known for their role in axon guidance, both in the periphery and in central commissural axons that cross the midline. NetrinB is a secreted molecule that can interact with two receptors: frazzled, the Drosophila DCC receptor that exerts attractive cues (KOLODZIEJ et al. 1996), and unc-5, which can mediate repulsive cues in axon guidance (KELEMAN and DICKSON 2001). Although Drosophila Netrins are widely known to be expressed in midline glial cells and in muscles, NetrinB RNA and protein are also found in a number of ventral-lateral neurons in the Drosophila embryo (HARRIS et al. 1996; MITCHELL et al. 1996). Therefore, the rescue of the NSF2E/Q overgrowth phenotype by presynaptic expression of NetrinB may reveal an autocrine component to this signaling pathway whereby Netrin is released from the growth cone or mature nerve terminal and acts upon Netrin receptors there.
Other notable GS lines recovered:
We recovered two other interesting lines that do not fit into the above classifications. First, GS3062 is positioned 0.4 kb upstream of polo, which acts as a serine/threonine kinase and hypomorphic alleles of this gene affect larval brain development through cytokinesis defects. However, this GS element is also 3.5 kb upstream of the soluble NSF attachment protein (snap) gene. The SNAP protein is the cofactor that links NSF to the SNARE complex (WEIDMAN et al. 1989; WHITEHEART et al. 1992) and to AMPA-type glutamate receptors (OSTEN et al. 1998; HANLEY et al. 2002). Therefore, while snap is a very attractive candidate, it remains to be determined whether GS3062 drives expression of polo, snap, or both (see Confirmation of screen results below).
Second, we identified GS8030 as a line with the potential to activate Rab5 expression. This gene is a member of the Rab small GTPase family, and Rab5 in particular is thought to be an important component in the endocytic pathway. Recently, Rab5 has also been shown to be critical for receptor tyrosine-kinase-induced actin remodeling in mouse fibroblasts (LANZETTI et al. 2004) and thus there is a potentially interesting link between this gene and the cytoskeleton.
Confirmation of screen results:
Since we identified a large number of genes, we sought to generate proof in principle that the GS lines regulate the genes that we identified in Table 1. To this end we used two strategies. First, from the genes listed in Table 1 we identified EP insertions from the Rorth EP collection (RORTH 1996) that regulate some of the genes that we identified in our screen. We obtained the EP lines from the Bloomington Stock Center and tested them for their ability to rescue the NSF2E/Q phenotype. Indeed, we found that each showed rescue (Figure 5). Specifically, the lines that we tested were moe[EP1652], RhoBTB[EP3099], C3G[EP1613], and nej[EP950]. Since these EP inserts were previously characterized, independently derived unidirectional elements, our finding that each of them rescues the NSF2E/Q phenotype greatly strengthens our confidence in the gene identification results shown in Table 1.
|
|
Our RT-PCR results show that GS3062 increases the expression of polo and CG32225 but not Snap (Figure 6), indicating that the ability of GS3062 to rescue the NSF2E/Q phenotype is not through Snap. To distinguish between the rescuing ability of polo and CG32225, we next tested the ability of the unidirectional line GS16634, inserted upstream of polo, to restore synaptic morphology in NSF2E/Q larvae. As shown in Figure 7, GS16634 returns NMJ morphology toward normal, confirming that polo is a gene that can rescue the NSF2E/Q phenotype. From these data we conclude that upregulation of polo by GS3062 leads to restoration of the NSF2E/Q phenotype.
|
Therefore, the above data indicate that further delineation of the genes regulated by the GS lines recovered in our screen will be straightforward and that Snap is an additional gene that can restore the NSF2E/Q phenotype.
Conclusions:
Genetic modifier screens have been successfully used to identify genes involved in specific biological processes. For many years such screens were designed as loss-of-function screens for enhancers or suppressors of a given phenotype. More recently, development of Drosophila technology that allows for systematic gain-of-function genetics, namely the EP and Gene Search collections (RORTH 1996; TOBA et al. 1999), has allowed screens to identify gain-of-function phenotypes in the wild-type background and also has allowed for modifiers of phenotypes in mutant backgrounds. This gain-of-function analysis is a useful addition to the repertoire of Drosophila genetic techniques because many genes display no loss-of-function phenotype, likely due to functional redundancy among related genes. Thus, increasing gene expression may uncover interacting genes that could not be discovered by loss-of-function analysis.
We have a high degree of confidence in the outcome of our screen. First, all 97 GS lines reported here were screened twice and 74 of the 97 GS lines were screened three times. The 74 lines each showed some degree of rescue on the third pass so we believe that all 97 represent genuine genetic interaction. Second, a number of the genes associated with the GS inserts have been isolated in other neural development screens (ABDELILAH-SEYFRIED et al. 2000; KRAUT et al. 2001; NORGA et al. 2003) and we were thus reassured by having some overlap with previous screens. For example, KRAUT et al. (2001) performed a similar screen to the one that we did, except that they screened the EP collection for effects on axon guidance and synaptogenesis in a wild-type background. They reported that, of 2293 EP lines examined, they recorded phenotypes in 114 EPs representing 76 genes. The overlapping genes found in their screen and ours include amn, Gli, LanA, and spi. Finally, we confirmed rescue of the NSF2E/Q phenotype by the GS lines with independently derived lines from the Rorth EP collection of unidirectional UAS driver lines.
While the present screen was efficient at identifying suppressors of the NSF2E/Q overgrowth phenotype, its design places some limitations, common to all gain-of-function screens, on our ability to interpret the outcome. One cautionary possibility is that the GS element causes misexpression of a gene in a tissue where it is not normally found. This is particularly relevant for predicted genes for which there is no prior expression or mutant data. In such cases, we cannot conclude that a particular gene is involved in the NSF2E/Q phenotype. However, finding a misexpression phenotype may indicate the role of a related gene; since the present study was a suppressor screen, such results may be a guide to what type of gene needs to be upregulated to rescue the NSF2E/Q phenotype. A second caution is that since some of the GS elements contain two UAS sequences oriented in opposite directions; it is not always straightforward to determine which of the nearby genes may be affected. Finally, if a GS element is inserted near the 3'-end of a gene, but in reverse orientation, there is the possibility of driving expression of an antisense transcript of the upstream gene (RORTH et al. 1998). We noted this possibility for 14 of the genes in Table 1.
The NMJ overgrowth phenotype induced by NSF2E/Q is a novel one for this molecule (STEWART et al. 2002). NSF is well known for its biochemical role in the SNARE cycle, and its role in synaptic vesicle exocytosis has been the subject of intense molecular, genetic, and physiological analysis (WHITEHEART et al. 2001), including the study of the Drosophila comatose alleles of NSF1 (KAWASAKI et al. 1998; TOLAR and PALLANCK 1998). Neural expression of UAS- NSF2E/Q induces physiological effects at the NMJ that might be predicted from the known biochemistry of the molecule, but the NMJ developmental effect was unexpected. Indeed, hypomorphic mutants of n-synaptobrevin and syntaxin that severely impair transmitter release do not lead to any morphological changes (STEWART et al. 2000), signifying that the overgrowth phenotype is unique to NSF and not likely a response to impaired synaptic physiology.
In light of the present findings that components of the cytoskeleton have the potential to reverse the NSF2E/Q phenotype, it is noteworthy that substantial proportions of NSF exist in noncytosolic intracellular compartments (MOHTASHAMI et al. 2001; PHILLIPS et al. 2001). Subcellular fractionation studies of Drosophila NSF1, for example, show that nearly as much NSF1 is found in Triton X-100 insoluble fractions as is found in the cytosolic fractions prepared from normal adult fly heads (MOHTASHAMI et al. 2001). The present findings that the NSF2E/Q phenotype is rescued by expression of cytoskeletal components, together with those of PHILLIPS et al. (2001) who found that both NSF and actin, along with many other proteins, is associated with the presynaptic particle isolated from rat synaptosomes, suggests that this noncytosolic NSF may indeed have a functional role.
It is also remarkable to note that we identified two genes whose products are secreted, amn and NetB, and another gene, fz4, that acts as a receptor for a secreted molecule. These findings may indicate that autocrine signaling is an important component of NMJ development. An interesting linkage can be made between NetB and the ubiquitin pathway genes found in this study because CAMPBELL and HOLT (2001) have shown that Netrin activity increases the amount of ubiquinated proteins in the growth cone. Since our ubiquitin results all indicate a need for increased ubiquitin pathway function to rescue NSF2E/Q, the secretion and autocrine action of NetrinB may also positively regulate the ubiquitin pathway.
Our goal here was to identify potential genetic interactions with NSF. Further studies that examine loss-of-function phenotypes, gene expression, and protein localization of the candidate genes are required to further our goal. These data represent a substantial resource that will aid our efforts to understand the role of NSF in neuromuscular junction development and point to novel functions of NSF.
| ACKNOWLEDGEMENTS |
|---|
|
|
|---|
| LITERATURE CITED |
|---|
|
|
|---|
ABDELILAH-SEYFRIED, S., Y. M. CHAN, C. ZENG, N. J. JUSTICE, S. YOUNGER-SHEPHERD et al., 2000 A gain-of-function screen for genes that affect the development of the Drosophila adult external sensory organ. Genetics 155: 733752.
BLOCK, M. R., B. S. GLICK, C. A. WILCOX, F. T. WIELAND and J. E. ROTHMAN, 1988 Purification of an N-ethylmaleimide-sensitive protein catalyzing vesicular transport. Proc. Natl. Acad. Sci. USA 85: 78527856.
BOULIANNE, G. L., and W. S. TRIMBLE, 1995 Identification of a second homolog of N-ethylmaleimide-sensitive fusion protein that is expressed in the nervous system and secretory tissues of Drosophila. Proc. Natl. Acad. Sci. USA 92: 70957099.
CAMPBELL, D. S., and C. E. HOLT, 2001 Chemotropic responses of retinal growth cones mediated by rapid local protein synthesis and degradation. Neuron 32: 10131026.[CrossRef][Medline]
CONG, M., S. J. PERRY, L. A. HU, P. I. HANSON, A. CLAING et al., 2001 Binding of the beta2 adrenergic receptor to N-ethylmaleimide-sensitive factor regulates receptor recycling. J. Biol. Chem. 276: 4514545152.
DELON, I., H. CHANUT-DELALANDE and F. PAYRE, 2003 The Ovo/Shavenbaby transcription factor specifies actin remodelling during epidermal differentiation in Drosophila. Mech. Dev. 120: 747758.[CrossRef][Medline]
DIANTONIO, A., A. P. HAGHIGHI, S. L. PORTMAN, J. D. LEE, A. M. AMARANTO et al., 2001 Ubiquitination-dependent mechanisms regulate synaptic growth and function. Nature 412: 449452.[CrossRef][Medline]
EBY, J. J., S. P. HOLLY, F. VAN DROGEN, A. V. GRISHIN, M. PETER et al., 1998 Actin cytoskeleton organization regulated by the PAK family of protein kinases. Curr. Biol. 8: 967970.[CrossRef][Medline]
FORCET, C., E. STEIN, L. PAYS, V. CORSET, F. LLAMBI et al., 2002 Netrin-1-mediated axon outgrowth requires deleted in colorectal cancer-dependent MAPK activation. Nature 417: 443447.[CrossRef][Medline]
FYRBERG, E. A., J. W. MAHAFFEY, B. J. BOND and N. DAVIDSON, 1983 Transcripts of the six Drosophila actin genes accumulate in a stage- and tissue-specific manner. Cell 33: 115123.[CrossRef][Medline]
GOLBY, J. A., L. A. TOLAR and L. PALLANCK, 2001 Partitioning of N-ethylmaleimide-sensitive fusion (NSF) protein function in Drosophila melanogaster: dNSF1 is required in the nervous system, and dNSF2 is required in mesoderm. Genetics 158: 265278.
HAN, S. Y., D. Y. PARK, S. D. PARK and S. H. HONG, 2000 Identification of Rab6 as an N-ethylmaleimide-sensitive fusion protein-binding protein. Biochem. J. 352(Pt. 1): 165173.
HANLEY, J. G., L. KHATRI, P. I. HANSON and E. B. ZIFF, 2002 NSF ATPase and alpha-/beta-SNAPs disassemble the AMPA receptor-PICK1 complex. Neuron 34: 5367.[CrossRef][Medline]
HARRIS, R., L. M. SABATELLI and M. A. SEEGER, 1996 Guidance cues at the Drosophila CNS midline: identification and characterization of two Drosophila Netrin/UNC-6 homologs. Neuron 17: 217228.[CrossRef][Medline]
HOOPER, J. E., 1994 Distinct pathways for autocrine and paracrine Wingless signalling in Drosophila embryos. Nature 372: 461464.[CrossRef][Medline]
HUANG, Y., R. T. BAKER and J. A. FISCHER-VIZE, 1995 Control of cell fate by a deubiquitinating enzyme encoded by the fat facets gene. Science 270: 18281831.
ISHIMARU, S., R. WILLIAMS, E. CLARK, H. HANAFUSA and U. GAUL, 1999 Activation of the Drosophila C3G leads to cell fate changes and overproliferation during development, mediated by the RAS-MAPK pathway and RAP1. EMBO J. 18: 145155.[CrossRef][Medline]
JANSON, K., E. D. COHEN and E. L. WILDER, 2001 Expression of DWnt6, DWnt10, and DFz4 during Drosophila development. Mech. Dev. 103: 117120.[CrossRef][Medline]
KARAGIOSIS, S. A., and D. F. READY, 2004 Moesin contributes an essential structural role in Drosophila photoreceptor morphogenesis. Development 131: 725732.
KARIM, F. D., and G. M. RUBIN, 1999 PTP-ER, a novel tyrosine phosphatase, functions downstream of Ras1 to downregulate MAP kinase during Drosophila eye development. Mol. Cell 3: 741750.[CrossRef][Medline]
KAWASAKI, F., A. M. MATTIUZ and R. W. ORDWAY, 1998 Synaptic physiology and ultrastructure in comatose mutants define an in vivo role for NSF in neurotransmitter release. J. Neurosci. 18: 1024110249.
KELEMAN, K., and B. J. DICKSON, 2001 Short- and long-range repulsion by the Drosophila Unc5 netrin receptor. Neuron 32: 605617.[CrossRef][Medline]
KIEHART, D. P., C. G. GALBRAITH, K. A. EDWARDS, W. L. RICKOLL and R. A. MONTAGUE, 2000 Multiple forces contribute to cell sheet morphogenesis for dorsal closure in Drosophila. J. Cell Biol. 149: 471490.
KOLODZIEJ, P. A., L. C. TIMPE, K. J. MITCHELL, S. R. FRIED, C. S. GOODMAN et al., 1996 frazzled encodes a Drosophila member of the DCC immunoglobulin subfamily and is required for CNS and motor axon guidance. Cell 87: 197204.[CrossRef][Medline]
KRAUT, R., K. MENON and K. ZINN, 2001 A gain-of-function screen for genes controlling motor axon guidance and synaptogenesis in Drosophila. Curr. Biol. 11: 417430.[CrossRef][Medline]
LANZETTI, L., A. PALAMIDESSI, L. ARECES, G. SCITA and P. P. DI FIORE, 2004 Rab5 is a signalling GTPase involved in actin remodelling by receptor tyrosine kinases. Nature 429: 309314.[CrossRef][Medline]
LIN, Y. J., L. SEROUDE and S. BENZER, 1998 Extended life-span and stress resistance in the Drosophila mutant methuselah. Science 282: 943946.
MAREK, K. W., R. FETTER, S. SMOLIK, C. S. GOODMAN and G. W. DAVIS, 2000 A genetic analysis of synaptic development: pre- and postsynaptic dCBP control transmitter release at the Drosophila NMJ. Neuron 25: 537547.[CrossRef][Medline]
MCDONALD, P. H., N. L. COTE, F. T. LIN, R. T. PREMONT, J. A. PITCHER et al., 1999 Identification of NSF as a beta-arrestin1-binding protein. Implications for beta2-adrenergic receptor regulation. J. Biol. Chem. 274: 1067710680.
MITCHELL, K. J., J. L. DOYLE, T. SERAFINI, T. E. KENNEDY, M. TESSIER-LAVIGNE et al., 1996 Genetic analysis of Netrin genes in Drosophila: Netrins guide CNS commissural axons and peripheral motor axons. Neuron 17: 203215.[CrossRef][Medline]
MOHTASHAMI, M., B. A. STEWART, G. L. BOULIANNE and W. S. TRIMBLE, 2001 Analysis of the mutant Drosophila N-ethylmaleimide sensitive fusion-1 protein in comatose reveals molecular correlates of the behavioural paralysis. J. Neurochem. 77: 14071417.[CrossRef][Medline]
MULLER, J. M., J. SHORTER, R. NEWMAN, K. DEINHARDT, Y. SAGIV et al., 2002 Sequential SNARE disassembly and GATE-16-GOS-28 complex assembly mediated by distinct NSF activities drives Golgi membrane fusion. J. Cell Biol. 157: 11611173.
MURALIDHAR, M. G., and J. B. THOMAS, 1993 The Drosophila bendless gene encodes a neural protein related to ubiquitin-conjugating enzymes. Neuron 11: 253266.[CrossRef][Medline]
NISHIMUNE, A., J. T. ISAAC, E. MOLNAR, J. NOEL, S. R. NASH et al., 1998 NSF binding to GluR2 regulates synaptic transmission. Neuron 21: 8797.[CrossRef][Medline]
NOEL, J., G. S. RALPH, L. PICKARD, J. WILLIAMS, E. MOLNAR et al., 1999 Surface expression of AMPA receptors in hippocampal neurons is regulated by an NSF-dependent mechanism. Neuron 23: 365376.[CrossRef][Medline]
NOGUCHI, T., and K. G. MILLER, 2003 A role for actin dynamics in individualization during spermatogenesis in Drosophila melanogaster. Development 130: 18051816.
NORGA, K. K., M. C. GURGANUS, C. L. DILDA, A. YAMAMOTO, R. F. LYMAN et al., 2003 Quantitative analysis of bristle number in Drosophila mutants identifies genes involved in neural development. Curr. Biol. 13: 13881396.[CrossRef][Medline]
OH, C. E., R. MCMAHON, S. BENZER and M. A. TANOUYE, 1994 bendless, a Drosophila gene affecting neuronal connectivity, encodes a ubiquitin-conjugating enzyme homolog. J. Neurosci. 14: 31663179.[Abstract]
OSTEN, P., S. SRIVASTAVA, G. J. INMAN, F. S. VILIM, L. KHATRI et al., 1998 The AMPA receptor GluR2 C terminus can mediate a reversible, ATP-dependent interaction with NSF and alpha- and beta-SNAPs. Neuron 21: 99110.[CrossRef][Medline]
PACKARD, M., E. S. KOO, M. GORCZYCA, J. SHARPE, S. CUMBERLEDGE et al., 2002 The Drosophila Wnt, wingless, provides an essential signal for pre- and postsynaptic differentiation. Cell 111: 319330.[CrossRef][Medline]
PAGLINI, G., P. KUNDA, S. QUIROGA, K. KOSIK and A. CACERES, 1998 Suppression of radixin and moesin alters growth cone morphology, motility, and process formation in primary cultured neurons. J. Cell Biol. 143: 443455.
PALLANCK, L., R. W. ORDWAY, M. RAMASWAMI, W. Y. CHI, K. S. KRISHNAN et al., 1995 Distinct roles for N-ethylmaleimide-sensitive fusion protein (NSF) suggested by the identification of a second Drosophila NSF homolog. J. Biol. Chem. 270: 1874218744.
PARLATI, F., T. WEBER, J. A. MCNEW, B. WESTERMANN, T. H. SOLLNER et al., 1999 Rapid and efficient fusion of phospholipid vesicles by the alpha-helical core of a SNARE complex in the absence of an N-terminal regulatory domain. Proc. Natl. Acad. Sci. USA 96: 1256512570.
PARNAS, D., A. P. HAGHIGHI, R. D. FETTER, S. W. KIM and C. S. GOODMAN, 2001 Regulation of postsynaptic structure and protein localization by the Rho-type guanine nucleotide exchange factor dPix. Neuron 32: 415424.[CrossRef][Medline]
PHILLIPS, G. R., J. K. HUANG, Y. WANG, H. TANAKA, L. SHAPIRO et al., 2001 The presynaptic particle web: ultrastructure, composition, dissolution, and reconstitution. Neuron 32: 6377.[CrossRef][Medline]
PROKOPENKO, S. N., Y. HE, Y. LU and H. J. BELLEN, 2000 Mutations affecting the development of the peripheral nervous system in Drosophila: a molecular screen for novel proteins. Genetics 156: 16911715.
RATTI, A., F. AMATI, M. BOZZALI, E. CONTI, F. SANGIUOLO et al., 2001 Cloning and molecular characterization of three ubiquitin fusion degradation 1 (Ufd1) ortholog genes from Xenopus laevis, Gallus gallus and Drosophila melanogaster. Cytogenet. Cell Genet. 92: 279282.[CrossRef][Medline]
RORTH, P., 1996 A modular misexpression screen in Drosophila detecting tissue-specific phenotypes. Proc. Natl. Acad. Sci. USA 93: 1241812422.
RORTH, P., K. SZABO, A. BAILEY, T. LAVERTY, J. REHM et al., 1998 Systematic gain-of-function genetics in Drosophila. Development 125: 10491057.[Abstract]
SALZBERG, A., S. N. PROKOPENKO, Y. HE, P. TSAI, M. PAL et al., 1997 P-element insertion alleles of essential genes on the third chromosome of Drosophila melanogaster: mutations affecting embryonic PNS development. Genetics 147: 17231741.[Abstract]
SEPP, K. J., and V. J. AULD, 2003 RhoA and Rac1 GTPases mediate the dynamic rearrangement of actin in peripheral glia. Development 130: 18251835.
SOLLNER, T., M. K. BENNETT, S. W. WHITEHEART, R. H. SCHELLER and J. E. ROTHMAN, 1993a A protein assembly-disassembly pathway in vitro that may correspond to sequential steps of synaptic vesicle docking, activation, and fusion. Cell 75: 409418.[CrossRef][Medline]
SOLLNER, T., S. W. WHITEHEART, M. BRUNNER, H. ERDJUMENT-BROMAGE, S. GEROMANOS et al., 1993b SNAP receptors implicated in vesicle targeting and fusion. Nature 362: 318324.[CrossRef][Medline]
SONG, I., S. KAMBOJ, J. XIA, H. DONG, D. LIAO et al., 1998 Interaction of the N-ethylmaleimide-sensitive factor with AMPA receptors. Neuron 21: 393400.[CrossRef][Medline]
SONG, W., R. RANJAN, K. DAWSON-SCULLY, P. BRONK, L. MARIN et al., 2002 Presynaptic regulation of neurotransmission in Drosophila by the g protein-coupled receptor methuselah. Neuron 36: 105119.[CrossRef][Medline]
STEWART, B. A., H. L. ATWOOD, J. J. RENGER, J. WANG and C. F. WU, 1994 Improved stability of Drosophila larval neuromuscular preparations in haemolymph-like physiological solutions. J. Comp. Physiol. A 175: 179191.[CrossRef][Medline]
STEWART, B. A., M. MOHTASHAMI, W. S. TRIMBLE and G. L. BOULIANNE, 2000 SNARE proteins contribute to calcium cooperativity of synaptic transmission. Proc. Natl. Acad. Sci. USA 97: 1395513960.
STEWART, B. A., M. MOHTASHAMI, L. ZHOU, W. S. TRIMBLE and G. L. BOULIANNE, 2001 SNARE-dependent signaling at the Drosophila wing margin. Dev. Biol. 234: 1323.[CrossRef][Medline]
STEWART, B. A., M. MOHTASHAMI, P. RIVLIN, D. L. DEITCHER, W. S. TRIMBLE et al., 2002 Dominant-negative NSF2 disrupts the structure and function of Drosophila neuromuscular synapses. J. Neurobiol. 51: 261271.[CrossRef][Medline]
TOBA, G., T. OHSAKO, N. MIYATA, T. OHTSUKA, K. H. SEONG et al., 1999 The gene search system: a method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster. Genetics 151: 725737.
TOLAR, L. A., and L. PALLANCK, 1998 NSF function in neurotransmitter release involves rearrangement of the SNARE complex downstream of synaptic vesicle docking. J. Neurosci. 18: 1025010256.
VERNOOY, S. Y., V. CHOW, J. SU, K. VERBRUGGHE, J. YANG et al., 2002 Drosophila Bruce can potently suppress Rpr- and Grim-dependent but not Hid-dependent cell death. Curr. Biol. 12: 11641168.[CrossRef][Medline]
WAN, H. I., A. DIANTONIO, R. D. FETTER, K. BERGSTROM, R. STRAUSS et al., 2000 Highwire regulates synaptic growth in Drosophila. Neuron 26: 313329.[CrossRef][Medline]
WEBER, T., B. V. ZEMELMAN, J. A. MCNEW, B. WESTERMANN, M. GMACHL et al., 1998 SNAREpins: minimal machinery for membrane fusion. Cell 92: 759772.[CrossRef][Medline]
WEIDMAN, P. J., P. MELANCON, M. R. BLOCK and J. E. ROTHMAN, 1989 Binding of an N-ethylmaleimide-sensitive fusion protein to Golgi membranes requires both a soluble protein(s) and an integral membrane receptor. J. Cell Biol. 108: 15891596.
WHITEHEART, S. W., and E. A. MATVEEVA, 2004 Multiple binding proteins suggest diverse functions for the N-ethylmaleimide sensitive factor. J. Struct. Biol. 146: 3243.[CrossRef][Medline]
WHITEHEART, S. W., M. BRUNNER, D. W. WILSON, M. WIEDMANN and J. E. ROTHMAN, 1992 Soluble N-ethylmaleimide-sensitive fusion attachment proteins (SNAPs) bind to a multi-SNAP receptor complex in Golgi membranes. J. Biol. Chem. 267: 1223912243.
WHITEHEART, S. W., K. ROSSNAGEL, S. A. BUHROW, M. BRUNNER, R. JAENICKE et al., 1994 N-ethylmaleimide-sensitive fusion protein: a trimeric ATPase whose hydrolysis of ATP is required for membrane fusion. J. Cell Biol. 126: 945954.