Originally published as Genetics Published Articles Ahead of Print on March 31, 2005.

Genetics, Vol. 170, 569-580, June 2005, Copyright © 2005
doi:10.1534/genetics.104.040295

Sensitivity to Phosphonoacetic Acid

A New Phenotype to Probe DNA Polymerase {delta} in Saccharomyces cerevisiae

Department of Biological Sciences, University of Alberta, Edmonton, Alberta T6G 2E9, Canada

2 Corresponding author: Department of Biological Sciences, CW405 BioSciences Bldg., University of Alberta, Edmonton, AB T6G 2E9, Canada.
E-mail: linda.reha-krantz{at}ualberta.ca

Manuscript received December 22, 2004. Accepted for publication February 23, 2005.

ABSTRACT

A mutant allele (pol3-L612M) of the DNA polymerase {delta} gene in Saccharomyces cerevisiae that confers sensitivity to the antiviral drug phosphonoacetic acid (PAA) was constructed. We report that PAA-sensitivity tagging DNA polymerases is a useful method for selectively and reversibly inhibiting one type of DNA polymerase. Our initial studies reveal that replication by the L612M-DNA pol {delta} requires Rad27 flap endonuclease activity since the pol3-L612M strain is not viable in the absence of RAD27 function. The L612M-DNA pol {delta} also strongly depends on mismatch repair (MMR). Reduced viability is observed in the absence of any of the core MMR proteins—Msh2, Mlh1, or Pms1—and severe sensitivity to PAA is observed in the absence of the core proteins Msh6 or Exo1, but not Msh3. We propose that pol3-L612M cells need the Rad27 flap endonuclease and MMR complexes composed of Msh2/Msh6, Mlh1/Pms1, and Exo1 for correct processing of Okazaki fragments.


EUKARYOTIC DNA polymerase {delta} (DNA pol {delta}) is required for chromosome replication, recombination, and repair, but there are several other DNA polymerases in the cell, which makes it difficult to study DNA pol {delta} specifically. DNA polymerase inhibitors have the potential to be useful, but the currently available inhibitors are not specific. Aphidicolin, for example, inhibits all three replicative DNA polymerases, DNA pols {alpha}, {delta}, and {epsilon} (BURGERS and BAUER 1988). Mutations that confer temperature sensitivity (ts) provide a way to block replication by a selected DNA polymerase, but ts DNA pol {delta} mutants lose viability rapidly after exposure to the restrictive temperature (WEINERT and HARTWELL 1993), which prevents studies of recovery mechanisms. We report a new method for inhibiting DNA pol {delta} selectively: we constructed a mutant DNA pol {delta} in Saccaromyces cerevisiae that is inhibited by the antiviral drug phosphonoacetic acid (PAA).

PAA was chosen as a new DNA pol {delta} inhibitor primarily for two reasons. First, PAA does not need to be processed by cellular enzymes to convert it to an active form. Thus, if yeast cells can take up PAA, the drug is expected to inhibit PAA-sensitive enzymes. Second, PAA preferentially inhibits viral but not essential eukaryotic DNA polymerases, which is the basis for the therapeutic use of this drug. PAA and its conjoiner phosphonoformic acid (foscarnet) are effective antiviral drugs that inhibit replication by herpes and vaccinia DNA polymerases (MAO et al. 1975; ÖBERG 1989; TADDIE and TRAKTMAN 1991) and the HIV reverse transcriptase (LARDER et al. 1987). PAA appears to act as a pyrophosphate analog in the polymerase active center of sensitive DNA polymerases to severely reduce the polymerization reaction (LEINBACH et al. 1976). Thus, since yeast like other eukaryotes is relatively resistant to PAA, PAA sensitivity is expected to increase substantially if the wild-type DNA pol {delta} is converted to a PAA-sensitive mutant.

To construct a yeast DNA pol {delta} mutant with PAA sensitivity, we used mutational studies of the bacteriophage T4 DNA polymerase as a guide (REHA-KRANTZ 1995). The bacteriophage T4 DNA polymerase, like eukaryotic DNA pols {alpha}, {delta}, and {epsilon}, is relatively resistant to PAA; however, several mutant T4 DNA polymerases were identified with markedly increased sensitivity (REHA-KRANTZ et al. 1993; REHA-KRANTZ and NONAY 1994). T4 DNA polymerase and eukaryotic DNA pol {delta} are members of a large protein-sequence-related family of DNA polymerases called {alpha}-like or family B DNA polymerases (WANG et al. 1989; BRAITHWAITE and ITO 1993). Thus, an amino acid substitution in the T4 DNA polymerase that confers PAA sensitivity may be expected to confer drug sensitivity in other {alpha}-like/family B DNA polymerases, particularly if the amino acid resides in one of the conserved protein sequence motifs that define this group of DNA polymerases. The L412M substitution (leucine to methionine at amino acid 412) in the T4 DNA polymerase fulfills these requirements. The T4 L412M-DNA polymerase is sensitive to PAA (REHA-KRANTZ et al. 1993; REHA-KRANTZ and NONAY 1994) and L412 is located in the highly conserved motif A protein sequence in the polymerase active center (DELARUE et al. 1990; Figure 1A).



View larger version (66K):
In this window
In a new window
Download PPT slide
 
FIGURE 1.—

The pol3-L612M strain is PAA sensitive. (A) The motif A sequence in the polymerase active center of the bacteriophage T4 DNA polymerase is compared to motif A sequences of DNA pol {delta}s from S. cerevisiae (Sc), human (Hu), and mouse (M). The L412M substitution in the T4 DNA polymerase and the L612M substitution in the yeast DNA pol {delta} confer sensitivity to the antiviral drug PAA. (B) PAA sensitivity of pol3-L612M cells. About 100 cells were spotted in six positions across a PAA gradient plate from 0 to 2 mg/ml PAA. The plates were incubated for 3 days at 30°. (C) POL3 cells are sensitive to PAA only at high concentrations. POL3 and pol3-L612M cells were spread on plates containing 0, 2, 4, or 6 mg/ml PAA; the plates were incubated at 30° for 6 days. (D) pol3-L612M cells form dumbbells in the presence of 0.5 mg/ml PAA. View (x200 magnification) of cells from an asynchronous pol3-L612M culture after 4 hr exposure to 0.5 mg/ml PAA and a close-up (x1000 magnification) of DAPI-stained dumbbell cells that show a mother cell and attached daughter of similar size with a single nucleus located at the bud neck.

 
We report the construction and initial characterization of the mutant yeast strain, pol3-L612M, which carries the yeast DNA pol {delta} counterpart of the T4 L412M-DNA polymerase. The mutant yeast DNA pol {delta} has the L612M substitution in the conserved motif A sequence (Figure 1A). As predicted, pol3-L612M cells are sensitive to PAA. Important interactions between L612M-DNA pol {delta} and Rad27, the yeast flap endonuclease, and between L612M-DNA pol {delta} and mismatch repair (MMR) were revealed.


MATERIALS AND METHODS

Media and culture conditions:

Standard yeast media have been described (BURKE et al. 2000). PAA (Sigma, St. Louis) was added to synthetic complete medium at the desired concentration and the pH was adjusted to 4.5 with 10 N NaOH. Solid PAA medium was made in the same way as liquid medium except that Noble agar (Difco) was added to give a final concentration of 2%. PAA gradient plates were formed by first pouring 30 ml of an agar solution containing PAA into a 100 x 100-mm square petri plate with one edge elevated by resting on a pencil. After the agar hardened, the plate was placed flat on the bench and 30 ml of drug-free agar was added. The plates were used the next day.

Yeast strains:

All strains are listed in Table 1. The pol3-L612M strain was constructed by site-directed mutagenesis of the cloned POL3 gene using the PCR method of CORMACK (1996). The two forward primers were TCAATATTGACGGCCGATTAC, complementary to nucleotides 1361–1381, and TTCAATTCTATGTATCCAAGTATTATGATGG, complementary to nucleotides 1825–1855, except for the underlined nucleotides. The two reverse primers were ACTTGGATACATAGAATTGAAATCCAAAGTTG, complementary to 1845–1814, except for the underlined nucleotides, and TCTTTTGAATGGATCCTTCTC, complementary to nucleotides 2070–2050. A restriction fragment containing the engineered nucleotide changes was inserted into the 3'-terminal half of the POL3 gene, which was placed in a yeast integrating plasmid. The plasmid was linearized at the unique HpaI site and used to transform MS71 cells. The pol3-L612M allele was integrated into the chromosomal POL3 gene by targeted integration (ROTHSTEIN 1983). Southern blotting and PCR were used to confirm integration of the plasmid in the transformant and restoration of a single gene copy after selection for plasmid DNA pop-out on 5-FOA. Sequencing was done to verify the nucleotide changes.


View this table:
In this window
In a new window

 
TABLE 1

S. cerevisiae strains used in this study

 
Gene inactivations were done by replacement of the endogenous wild-type allele with one of the kanMX cassettes (WACH et al. 1994; LONGTINE et al. 1998). PCR products were made with the following primer pairs. The ORF-specific sequences are shown in uppercase: EXO1F, AATAAAAGGAGCTCGAAAAAACTGAAAGGCGTAGAAAGGAcggatccccgggttaattaa and EXO1R, TTTTCATTTGAAAAATATACCTCCGATATGAAACGTGCAGgaattcgagctcgtttaaac; MSH3F, TGCGATCACGTGAATTTTCAATGAATAAATAAGCTGGAACAcggatccccgggttaattaa and MSH3R, ATGATAGTAATTTCGCGAGTTTATCCGTTGCTGTTATATTgaattcgagctcgtttaaac; MLH1F, ATGTCTCTCAGAATAAAAGCACTTGATGCATCAGTGGTTAcggatccccgggttaattaa and MLH1R, TTAACACCTCTCAAAAACTTTGGTATAGATCTGGAAGGTTGgaattcgagctcgtttaaac; PMS1F, AGAAAAGACGCGTCTCTCTTAATAATCATTATGCGATAAAcggatccccgggttaattaa and PMS1R, GTATTTGTTAATTATATAATGAATGAATATCAAAGCTAGAgaattcgagctcgtttaaac; RAD27F, CATTGGAAAGAAATAGGAAACGGACACCGGAAGAAAAAATcagctgaagcttcgtacgc and RAD27R, TTTAGTTGCTGAAGCCATATAATTGTCTATTTGGAATAGGgcataggccactagtggatc; RAD51F, GTAGTTATTTGTTAAAGGCCTACTAATTTGTTATCGTCATcggatccccgggttaattaa and RAD51R, GTAAACCTGTGTAAATAAATAGAGACAAGAGACCAAATACgaattcgagctcgtttaaac; RAD52F, GAAAAATATAGCGGCGGGCGGGTTACGCGACCGGTATCGAcagctgaagcttcgtacgc and RAD52R, AATGATGCAAATTTTTTATTTGTTTCGGCCAGGAAGCGTTgcataggccactagtggatc.

PCR products were transformed into diploid yeast heterozygous for the pol3-L612M allele by the method of GIETZ and WOODS (2002). Haploid strains used for this study were isolated by tetrad dissection. All of the gene replacements were verified by PCR. Multiply mutant strains were constructed by standard mating procedures (BURKE et al. 2000). For some strains the kanMX marker was first switched to natMX (GOLDSTEIN and MCCUSKER 1999).

The inviability of the rad27::kanMX pol3-L612M haploid was demonstrated by tetrad analysis of spores from a diploid heterozygous for the rad27::kanMX and pol3-L612M mutations. No viable rad27::kanMX pol3-L612M segregants were recovered from the dissection of 68 tetrads.

Mutation rates:

Mutation rates were determined by fluctuation analyses of 12 or more cultures by the method of the median (LEA and COULSON 1949). Confidence intervals were determined by the bootstrapping method of EFRON and TIBSHIRANI (1993), which provides a method for analyzing relatively small sample sizes even if the mutation rates for individual cultures are not distributed symmetrically about the median. The confidence levels reported are based on 1000 bootstrapped replicas.

Microscopy:

Samples (~107 cells) were fixed in 70% ethanol (WILLIAMSON et al. 1983), resuspended in 0.1 M potassium phosphate buffer, pH 7, and stained with 2.5 µg/ml 4,6'-diamidino-2-phenylindole (DAPI) for 15 min. Images were taken with a Zeiss Axioskop-2 microscope equipped with a SPOT-2 digital camera. Differential interference contrast (DIC) and fluorescent DAPI images were taken.


RESULTS

pol3-L612M cells are sensitive to PAA:

DNA sequence changes that encode the leucine-to-methionine substitution at codon 612 in the yeast POL3 (DNA pol {delta}) gene were constructed by standard site-directed mutagenesis procedures as described in MATERIALS AND METHODS. pol3-L612M cells were more sensitive to PAA than POL3 cells were (Figure 1B). PAA slowed growth of pol3-L612M cells, but even at 2 mg/ml PAA, a concentration that severely impaired growth, there was no loss of viability (Figure 1C). PAA at 4 mg/ml, however, killed pol3-L612M cells (Figure 1C). In contrast, POL3 cells retained good viability up to 6 mg/ml PAA, but cell proliferation was slowed at higher PAA concentrations (Figure 1C). Thus, at PAA concentrations ≤2 mg/ml, PAA targets primarily the L612M-DNA pol {delta}.

pol3-L612M cells exposed to PAA at 0.5 mg/ml accumulated as large-budded cells with the mother and daughter sharing an undivided nucleus (Figure 1D). This "dumbbell" phenotype is also seen in cdc2-1 cells at the nonpermissive temperature where DNA replication by the mutant DNA pol {delta} is blocked (HARTWELL et al. 1973). In the case of cdc2-1, the dumbbell morphology is diagnostic of cell cycle arrest in late S or G2. Unlike cdc2-1 cells, the pol3-L612M dumbbell cells are not irreversibly arrested at PAA concentrations ≤2 mg/ml, but are only delayed in S-phase.

The pol3-L612M strain has a mutator phenotype:

Since the phage T4 L412M-DNA polymerase confers a mutator phenotype because of reduced proofreading activity (REHA-KRANTZ and NONAY 1994; STOCKI et al. 1995), a mutator phenotype was expected for the yeast pol3-L612M strain. Note that the reduced proofreading activity observed for the phage T4 L412M-DNA polymerase is not caused by loss of exonuclease activity, but is due to the reduced ability of the mutant DNA polymerase to initiate the proofreading pathway (REHA-KRANTZ and NONAY 1994; BEECHEM et al. 1998; FIDALGO DA SILVA et al. 2002). Mutation rates were measured at the following sites: trp1-289, which reverts by base substitution mutations at an amber codon (CALDERON et al. 1984); his7-2, which reverts by a +1 frameshift in a sequence of seven A's (HADJIMARCOU et al. 2001); and the CAN1 gene, which detects forward mutations that arise primarily by base substitution and frameshift mechanisms, although insertions, deletions, and complex mutations are also observed (MARSISCHKY et al. 1996).

Spontaneous mutation rates were elevated 1.6- to 5.7-fold by the L612M-DNA pol {delta} (Table 2). The weak mutator phenotype detected for the pol3-L612M strain, however, underestimates the true replication error rate since MMR corrects many of the mistakes made by DNA polymerases.


View this table:
In this window
In a new window

 
TABLE 2

Spontaneous mutation rates for pol3-L612M strains

 

A strong mutator phenotype was detected for the L612M-DNA pol {delta} in the absence of MMR:

L612M-DNA pol {delta} replication fidelity was determined in the absence of individual MMR proteins by constructing a series of isogenic strains that carried the pol3-L612M allele plus an insertion/deletion mutation in one or more of the genes that encode proteins that function in MMR (Table 1). Mutation rates for the doubly mutant msh2-, mlhl-, and pms1 pol3-L612M strains increased from 17- to >30-fold compared to the mutation rates for the singly mutant MMR-deficient strains (Table 2). Specifically, the Trp+ reversion rate increased 26- to 33-fold, the His+ reversion rate increased 24- to 36-fold, and the CanR mutation rate increased 17- to 26-fold (Table 2). Since the confidence intervals for the MMR-deficient pol3-L612M strains overlap, differences observed for Msh2, Mlh1, or Pms1 deficiencies are not significant, as is expected since all three proteins are required for MMR activity.

Msh6 was as important as the Msh2, Mlh1, and Pms1 proteins for correction of base substitution errors made by the L612M-DNA pol {delta} at the trp1-289 locus (Table 2). In contrast, the His+ +1 frameshift mutation rate was only moderately elevated (~11-fold) in the absence of Msh6. Msh3 function, on the other hand, appeared dispensable for repair of base substitutions at the trp1-289 locus, as observed previously (MARSISCHKY et al. 1996), and MSH3 deficiency only slightly increased mutation rates at the his7-2 and CAN1 loci (Table 2). These results are consistent with previous reports that the Msh2/Msh6 and Msh2/Msh3 complexes have overlapping functions in the repair of frameshift premutations (MARSISCHKY et al. 1996; KOLODNER and MARSISCHKY 1999). When the MSH6 and MSH3 genes were both inactivated, mutation rates for the msh6 msh3 pol3-L612M strain were en par with the msh2 pol3-L612M strain (Table 2).

Mismatch repair also requires exonuclease activity (reviewed by MODRICH and LAHUE 1996; KOLODNER and MARSISCHKY 1999). Exo1 appears to be involved in an excision step in mismatch repair in yeast and human cells (TRAN et al. 1999; GENSCHEL et al. 2002; DZANTIEV et al. 2004), but Exo1 deficiency increases mutation rates only slightly (TISHKOFF et al. 1997) as confirmed here by the two- to threefold increases in mutation rates for Trp+, His+, and CanR for exo1 cells compared to wild-type cells (Table 2). The weak mutator phenotype for exo1 cells is interpreted to indicate that Exo1 is redundant with other nucleases that can also function in MMR.

Exo1 redundancy was also evident in the repair of premutations made by the L612M-DNA pol {delta} at the trp1-289 and CAN1 loci since only 4- and 7-fold increases in Trp+ revertants and CanR mutants, respectively, were observed in the absence of Exo1 (Table 2, numbers in brackets for the exo1 pol3-L612M strain), which are substantially lower than the mutation rates observed in the absence of the Msh2, Mlh1, or Pms1 proteins. However, the His+ mutation rate increased 69-fold in exo1 pol3-L612M cells, which indicates an Exo1-dependent mutator (edm) phenotype for +1 frameshift mutations (Table 2). Although the His+ mutation rate for the exo1 pol3-L612M strain at 167 in 108 cells is 7-fold lower than the rate observed for the completely MMR-deficient msh2 pol3-L612M strain (1204 in 108 cells), the larger 69-fold increase in +1 frameshift mutations at the his7-2 locus, compared to the smaller 4- to 7-fold increases in Trp+ and CanR mutants, suggests that Exo1 has a role in frameshift mutagenesis.

Mutations conferring the edm phenotype were identified previously as alleles of several genes (MSH2, MLH1, PMS1, MSH3, POL30, POL32, and RNR1) that as single mutations cause only a weak mutator phenotype for production of +1 or –1 frameshift mutations in repeat sequences, but a strong mutator phenotype when combined with deletion of the EXO1 gene (AMIN et al. 2001). Exo1 appears to have a similar relationship with the L612M-DNA pol {delta}. An edm phenotype for frameshift mutations has also been observed for the pol2-4 strain, which has a proofreading-defective DNA pol {epsilon} (TRAN et al. 1999).

MMR deficiency increased PAA sensitivity synergistically and reduced the viability of pol3-L612M strains:

The PAA sensitivity of the pol3-L612M strain was markedly enhanced in the absence of any of the proteins known to function in MMR except for Msh3 (Figure 2). The increase in PAA sensitivity was synergistic, as the singly mutant MMR-deficient strains were not inhibited by PAA (Figure 2, A and B). The most extreme PAA sensitivity was observed for pol3-L612M strains lacking any of the core MMR proteins Msh2, Mlh1, or Pms1; data for the msh2 pol3-L612M strain are shown in Figure 2A. Note that because of the strong mutator phenotype of the msh2 pol3-L612M strain, a few PAA-resistant colonies were observed in which the pol3-L612M allele had reverted or a second-site suppressor mutation was acquired. Even in the absence of PAA, msh2 pol3-L612M cells were only ~50% viable (Figure 2C). The addition of 0.5 mg/ml PAA further reduced viability of msh2 pol3-L612M cells (Figure 2C).



View larger version (31K):
In this window
In a new window
Download PPT slide
 
FIGURE 2.—

MMR deficiency reduces viability and increases the PAA sensitivity of pol3-L612M cells. (A) About 100 viable cells from the indicated strains were spotted at six positions across a PAA gradient plate that ranged from 0 to 1 mg/ml PAA. The plates were incubated for 3 days at 30°. (B) PAA sensitivity was also determined for exo1 pol3-L612M strains as described in A. To determine if EXO1 is epistatic to MSH2, growth of msh2 pol3-L612M and exo1 msh2 pol3-L612M cells was compared on a PAA gradient plate from 0 to 0.2 mg/ml. (C) Cell viability in the absence or presence of 0.5 mg/ml PAA. msh2 pol3-L612M cultures were inoculated at 1 x 106 cells/ml and cultured for 24 hr. At the indicated times, samples were withdrawn to determine total cell count and viability. The percentage of viability is the number of viable cells, determined by colony formation, divided by the number of cells counted with a hemocytometer. msh2 pol3-L612M cells were not exposed (•) or exposed ({circ}) to 0.5 mg/ml PAA. Only ~50–60% of msh2 pol3-L612M cells were viable in the absence of PAA (•) and PAA reduced viability to 10% after 24 hr exposure ({circ}).

 
Cells with aberrant cellular morphologies were observed in cultures of msh2 pol3-L612M cells (Figure 3A). Some of the cells had an atypical appearance with one or more elongated buds, which could indicate a failure of the bud to shift from apical to isotropic growth. When unusual msh2 pol3-L612M cells were selected by using a micromanipulator and allowed to grow, most were unable to form colonies, which indicates that the aberrant cell morphologies are diagnostic of a terminal phenotype. PAA increased the number of aberrant msh2 pol3-L612M cells (Figure 3B). Many cells were multinucleated and multibudded (Figure 3B); however, digestion of the cell wall with zymolyase separated many of the attached cells. Together, these observations suggest defects in cell cycle progression for msh2 pol3-L612M cells with or without PAA.



View larger version (73K):
In this window
In a new window
Download PPT slide
 
FIGURE 3.—

MMR-deficient pol3-L612M cells exhibit aberrant cell morphologies. (A) In the absence of PAA, many aberrant cells (arrows) are detected in cultures of msh2 pol3-L612M cells. (Left)A DIC image at x200 magnification of a field of cells. (Right) DIC images of aberrant cells at x1000 magnification and fluorescent images of the same cells stained with DAPI. (B) msh2 pol3-L612M cells exposed to 0.5 mg/ml PAA for 8 hr have increased numbers of aberrant cells. (Left) A DIC image at x200 magnification of a typical field of msh2 pol3-L612M cells exposed to PAA. (Right) DIC images of aberrant cells at x1000 and fluorescent images of the same cells stained with DAPI.

 
msh6 pol3-L612M (Figure 2A) and exo1 pol3-L612M cells (Figure 2B) were also very sensitive to PAA, but not as sensitive as msh2 pol3-L612M cells (Figure 4, A and B). On agar plates with 0.25 mg/ml PAA, pol3-L612M colonies were clearly visible after 3 days incubation, but msh6 pol3-L612M and exo1 pol3-L612M colonies were barely visible and no colonies were detected for the msh2 pol3-L612M strain except for the background of PAA-resistant colonies (Figure 4A). After 6 days growth, small colonies with ragged edges were visible for the msh6 pol3-L612M and exo1 pol3-L612M strains (Figure 4B), which indicates that Msh6- or Exo1-deficient pol3-L612M cells could just survive exposure to PAA at 0.25 mg/ml. PAA at 0.5 mg/ml, however, killed msh6 pol3-L612M (Figure 4C) and exo1 pol3-L612M cells (Figure 4D).



View larger version (60K):
In this window
In a new window
Download PPT slide
 
FIGURE 4.—

Sensitivity of msh6 pol3-L612M and exo1 pol3-L612M cells to PAA. (A–B) About 200 cells from each strain were spread in separate quadrants of a plate with 0.25 mg/ml PAA. The plates were examined after 3 days (A) and 6 days incubation at 30° (B). (C) msh6 pol3-L612M and (D) exo1 pol3-L612M cells were killed from exposure to PAA at 0.5 mg/ml. Viability was determined as described for Figure 2C.

 
Cultures of msh6 pol3-L612M and exo1 pol3-L612M cells had higher viability (80–100%) than those of msh2 pol3-L612M cells and fewer aberrant cells (data not shown). The less severe viability and PAA sensitivity phenotypes of msh6 pol3-L612M and exo1 pol3-L612M cells may be due to redundancy of MMR proteins. For example, higher viability and reduced PAA sensitivity for msh6 pol3-L612M cells compared to msh2 pol3-L612M cells could indicate the ability of the Msh2/Msh3 complex to partially substitute for Msh2/Msh6. The msh6 msh3 pol3-L612M triple-mutant strain was constructed to test this proposal. While Msh3 deficiency did not increase the PAA sensitivity of pol3-L612M cells (Figure 2A), inactivation of Msh3 increased PAA sensitivity and reduced viability of msh6 pol3-L612M cells to the levels detected for the msh2 pol3-L612M strain (Figure 2A). Redundant nucleases may also explain why exo1 pol3-L612M cells are not as sensitive to PAA as completely MMR-defective strains. Since Exo1 deficiency did not increase the PAA sensitivity of the msh2 pol3-L612M strain, EXO1 is epistatic to MSH2 (Figure 2B).

Double-strand breaks in pol3-L612M cells:

One potential consequence of PAA inhibition of replication by the L612M-DNA pol {delta} is an increase in single-strand DNA and, thus, potential sites for double-strand breaks (DSBs). If DSBs form during replication, recombinational repair will be needed. Inactivation of the RAD51 or RAD52 genes had no detectable effect on PAA sensitivity in POL3 cells (data not shown), but Rad51 deficiency slightly increased the PAA sensitivity of the pol3-L612M strain and greater sensitivity was observed in the absence of Rad52 (Figure 5).



View larger version (41K):
In this window
In a new window
Download PPT slide
 
FIGURE 5.—

PAA sensitivity of pol3-L612M strains deficient in RAD51 or RAD52. About 100 cells from cultures of the indicated strains were spotted in six positions across a PAA gradient plate from 0 to 1 mg/ml PAA. The plates were incubated for 3 days at 30°. Not shown: rad52 and rad51 singly mutant cells are not PAA sensitive.

 

Comparisons of pol3-L612M and pol3-01 strains—pol3-L612M is synthetically lethal with rad27:

The pol3-01 strain, which has an exonuclease-deficient DNA pol {delta} (MORRISON et al. 1993), also shows dependence on MMR for viability as observed for the pol3-L612M strain, but the dependence is stronger. Haploid inviability is observed for the pol3-01 strain with inactivation of any component of MMR except for Msh3 (Table 3), while only reduced viability was detected for the pol3-L612M strains (e.g., 50% viability for the msh2 pol3-L612M strain and 80–100% viability for msh6 pol3-L612M and exo1 pol3-L612M strains (Table 3). pol3-01 is also synthetically lethal with mutant alleles of several DNA replication genes, including rad27, rfc1, pol30-52, and pol2-4 (KOKOSKA et al. 1998; XIE et al. 1999; TRAN et al. 1999).


View this table:
In this window
In a new window

 
TABLE 3

Genetic interactions between DNA pol {delta} mutants and mutations affecting MMR or DNA replication

 
To determine if viability of the pol3-L612M strain is also dependent on other DNA replication proteins, we attempted to isolate the rad27 pol3-L612M haploid from the heterozygous diploid, but no viable double mutants were recovered. The synthetic lethality of rad27 pol3-01 is attributed to strand displacement synthesis at Okazaki fragment junctions by the proofreading-deficient DNA pol {delta} and the need for the Rad27 flap endonuclease to repair these flaps (JIN et al. 2003; GARG et al. 2004). The synthetic lethality of the rad27 pol3-L612M strain indicates that the L612M-DNA pol {delta} also catalyzes strand displacement synthesis, which is consistent with the reduced proofreading activity observed for the phage T4 L412M-DNA polymerase (REHA-KRANTZ and NONAY 1994; BEECHEM et al. 1998; FIDALGO DA SILVA et al. 2002). The inviability of the rad27 pol3-L612M double mutant, however, was suppressed by a second mutation in the POL3 gene that encodes the V758M substitution (Table 3), which suggests that the V758M substitution corrects the strand displacement activity conferred by the L612M substitution. This proposal is supported by the observation that the V758M substitution reduced the mutator phenotype of msh2 pol3-L612M cells (Table 3). The V758M substitution also reduced PAA sensitivity and increased the viability of msh2 pol3-L612M cells (Table 3). Second-site suppressor mutations of the PAA sensitivity of the phage T4 L412M DNA polymerase also correct defects in proofreading (REHA-KRANTZ and NONAY 1994; REHA-KRANTZ and WONG 1996).

Interactions between the L612M-DNA pol {delta} and DNA pol {epsilon} mutants were studied in preliminary experiments. In contrast to pol3-01, which is synthetically lethal with the proofreading-deficient pol {epsilon}, the pol3-L612M pol2-4 strain is viable (data not shown). The L612M-DNA pol {delta}, however, requires DNA pol {epsilon} polymerase activity as the pol2-16 allele, which retains only the C-terminal regulatory regulatory region of DNA pol {epsilon} (KESTI et al. 1999), is synthetically lethal with pol3-L612M.


DISCUSSION
Mutations were introduced into the POL3 gene in S. cerevisiae to encode the PAA-sensitive L612M-DNA pol {delta} (Figure 1A). The mutant yeast DNA pol {delta} was engineered on the basis of studies of the PAA-sensitive bacteriophage T4 L412M-DNA polymerase (REHA-KRANTZ et al. 1993; REHA-KRANTZ and NONAY 1994). Both DNA polymerases have a L -> M substitution for the conserved leucine residue in the motif A sequence (Figure 1A). The L612M substitution in the yeast DNA pol {delta} allows selective and reversible (up to 2 mg/ml PAA) inhibition of DNA pol {delta} activity (Figure 2C), which makes PAA sensitivity an important new tool for DNA polymerase studies in vivo. In addition to PAA sensitivity, a mutator phenotype was predicted for the yeast L612M-DNA pol {delta} since the phage T4 L412M-DNA polymerase replicates DNA with reduced fidelity (REHA-KRANTZ and NONAY 1994). A mutator phenotype was observed for pol3-L612M cells, but detection required inactivation of MMR (Table 2), which indicates that MMR efficiently repairs replication errors made by the L612M-DNA pol {delta}. In the absence of any of the core MMR proteins—Msh2, Mlh1 or Pms1—base substitution and frameshift mutation rates were elevated 17- to 36-fold in pol3-L612M cells compared to singly mutant MMR-deficient strains (Table 2). Thus, there is functional correspondence between the conserved leucine residues in the motif A sequences in the phage T4 and yeast DNA polymerases.

PAA sensitivity is also detected for the L868M-DNA pol {alpha}, which has the analogous L -> M substitution in the motif A sequence (L. REHA-KRANTZ, recent observations). Since a strong mutator phenotype is detected for the pol1-L868M strain in the absence of MMR (NIIMI et al. 2004), as observed for the pol3-L612M strain, functional similarities in motif A can also be extended to DNA pol {alpha}. Thus, PAA-sensitivity tagging appears to be a general method for selectively inhibiting one type of DNA polymerase.

Although we have just started to characterize the pol3-L612M strain in the absence and presence of PAA, new information about the dependence of DNA pol {delta} replication on Rad27 and MMR has been revealed. It is not surprising that Rad27 and MMR are required to keep DNA pol {delta} replication on track since these proteins are known to be involved in lagging-strand replication. The Rad27 flap endonuclease assists maturation of Okazaki fragments by removing 5' flaps produced by strand displacement synthesis (JIN et al. 2003; GARG et al. 2004) and MMR appears to be more active on the lagging strand (PAVLOV et al. 2003). We propose that MMR complexes formed with Msh6 and Exo1 may have an additional role in processing the ends of Okazaki fragments. MMR is also needed for pol3-L612M cells to survive exposure to low concentrations of PAA.

The exonuclease-deficient DNA pol {delta} in the pol3-01 strain is also dependent on Rad27 and MMR as demonstrated by synthetic lethality with deficiencies in Rad27, Exo1, or any component of MMR except for Msh3 or with alleles of several DNA replication proteins (MORRISON et al. 1993; KOKOSKA et al. 1998; TRAN et al. 1999; XIE et al. 1999). Although synthetic lethal interactions indicate functional relationships among the gene products tested, additional information can be learned if the double mutants retain partial viability or if lethality is conditional, as is observed for the pol3-L612M strain. While pol3-L612M cells were not viable in the absence of Rad27, MMR-deficient pol3-L612M strains were partially to fully viable: 50–60% for msh2 pol3-L612M, 80–90% for msh6 pol3-L612M, and 100% for exo1 pol3-L612M (Table 3). Thus, the L612M-DNA pol {delta} shows greater dependence on the Rad27 flap endonuclease than on MMR. The reduced dependence of the L612M-DNA pol {delta} on Msh6 and Exo1 for viability, compared to the core MMR proteins, is likely due to the ability of alternative MMR proteins to partially compensate. In the presence of PAA, however, pol3-L612M cells were strongly dependent on Msh6 and Exo1, as msh6 pol3-L612M and exo1 pol3-L612M cells were almost as sensitive to PAA as the MMR-defective msh2 pol3-L612M strain (Figures 2 and 4). Interestingly, the lack of strong dependence on Msh3 by both the L612M-DNA pol {delta} and the exonuclease-deficient DNA pol {delta} indicates that the Msh2/Msh3 complex plays only a minor role in modulating replication by the mutant DNA polymerases.

How does a MMR complex containing the Msh2, Msh6, Mlh1, Pms1, and Exo1 proteins protect pol3-L612M cells from replication problems created by the L612M-DNA pol {delta}? Error catastrophe is proposed to explain the haploid inviability of MMR-deficient pol3-01 cells, which replicate DNA with a proofreading-defective DNA pol {delta} (MORRISON et al. 1993). This hypothesis is supported by the observation that MMR-deficient pol3-01 diploids are viable. Diploids are expected to be more tolerant of gene-inactivating mutations because there are two copies of each gene. The L612M-DNA pol {delta} is also error prone (Table 2), but less so than the pol3-01 strain. For pol3-L612M cells in the absence of Msh2, Mlh1, or Pms1 function, the CanR mutation rate is ~9000 x 10–8 and the his7-2 reversion rate is ~1000 x 10–8 (Table 2); the doubly mutant cells are ~50–60% viable (Figure 2C; Table 3). For msh6 pol3-L612M cells, the CanR mutation rate is ~4000 x 10–8 and the his7-2 reversion rate is ~34 x 10–8 (Table 2); viability is ~80–90% (Table 3). Thus, if error catastrophe is the cause of reduced viability for MMR-deficient pol3-L612M cells, then the mutation rates observed for the msh2 pol3-L612M strain are at the cutoff between life and death.

The Exo1-dependent mutator (edm) phenotype for frameshift mutations detected for pol3-L612M cells (Table 2) indicates another role for MMR in preventing or repairing frameshift premutations. Because of speculations that the exonuclease activity of DNA pol {delta} may function in MMR, we considered the possibility that the reduced proofreading activity of L612M-DNA pol {delta} combined with loss of Exo1 nuclease activity could be responsible for the edm phenotype. However, action of DNA pol {delta} in series with Exo1 as part of MMR would produce a multiplicative increase in mutation rate, which is just a 12.5-fold increase (5.7 x 2.2), but this increase is much less than the 152-fold increase observed for the exo1 pol3-L612M strain (Table 2). Also, a combination of reduced proofreading and reduced MMR is expected to increase all types of DNA polymerase replication errors, not just frameshift mutations. We propose instead that Exo1 has a role along with the Rad27 flap endonuclease in processing junctions between Okazaki fragments and this processing is required to prevent frameshift mutations.

Although the requirement for Rad27 in pol3-L612M cells indicates the major importance of this nuclease for correct processing of Okazaki fragments, there is also a role for Exo1. Exo1 can partially compensate for Rad27 deficiency as demonstrated by the inviability of the exo1 rad27 strain and the ability of Exo1, when overexpressed, to partially suppress the mutator phenotype of rad27 cells (TISHKOFF et al. 1997). Exo1, like Rad27, has flap endonuclease activity (TRAN et al. 2002) as well as 5'–3' exonuclease activity. In the context of MMR, human Exo1 is required for 5' mismatch repair in reactions that require Msh2/Msh6 and for 3' mismatch repair in reactions that require Msh2/Msh6 and Mlh1/Pms2 (GENSCHEL et al. 2002; DZANTIEV et al. 2004); thus, Exo1 likely functions most efficiently as part of MMR complexes. While Rad27 flap endonuclease provides the bulk of flap repair activity, some aberrant DNA structures at junctions between Okazaki fragments may not be good substrates for Rad27. The preferred substrate for Rad27 endonuclease is a double flap structure containing a 3' one-nucleotide flap (KAO et al. 2002). Flap structures may also contain strand misalignments that are stabilized by repeat sequences. There may also be small gaps that prevent ligation of Okazaki fragments. Since MMR degradation begins at a nick (GENSCHEL et al. 2002; DZANTIEV et al. 2004), persistent nonligatable strand discontinuities could be repaired in the process of mismatch correction. Replication by both L612M-DNA pol {delta} and exonuclease-deficient DNA pol {delta} depends on MMR complexes containing Msh6, but not Msh3 (Table 3). Thus, frameshift mutations detected in the absence of Msh6 may be associated with aberrant repair of discontinuities at junctions between Okazaki fragments.

Another role for MMR is in protecting pol3-L612M cells from PAA (Figures 24, Table 3). While the viability of various MMR-deficient pol3-L612M strains correlates with spontaneous mutation rates—the strains with the highest mutation rates have the lowest viability (Table 3)—PAA sensitivity does not parallel mutation rates since the exo1 pol3-L612M strain, which has the lowest CanR mutation rate, is as PAA sensitive as the msh6 pol3-L612M strain (Table 3). The ability of the V758M substitution to partially suppress the severe PAA sensitivity of msh2 pol3-L612M cells as well as to rescue the inviability of rad27 pol3-L612M cells indicates that defects in Okazaki fragment processing may contribute to PAA sensitivity. PAA is predicted to reduce the ability of the L612M-DNA pol {delta} to fully replicate Okazaki fragments, which may produce persistent small gaps that cannot be effectively repaired by replicative DNA polymerases (REHA-KRANTZ et al. 1996). Expansion of the gap by MMR activity may allow for more efficient gap repair.

The phage T4 L412M DNA polymerase has proven to be useful for structure-function studies of the T4 DNA polymerase, and this prompted us to engineer the yeast L612M-DNA pol {delta} so that PAA sensitivity could be used as a genetic tool for probing DNA replication in a eukaryotic model organism. Our initial studies of the genetic interactions between DNA pol {delta} and Rad27 and between DNA pol {delta} and MMR demonstrate the utility of the PAA-sensitive replication system that we have developed to further dissect functional interactions during DNA replication in vivo.


ACKNOWLEDGEMENTS
We gratefully acknowledge Peter L. Hurd for introducing us to the bootstrap method for determining confidence intervals and for assisting with the determinations. We thank M. Suzuki for providing the pol1-L868M strain and Y. Pavlov for helpful discussions. Research was supported by the Canadian Institutes of Health Sciences (grant 14300 to L.R-K.). L.R-K. is a Scientist of the Alberta Heritage Foundation for Medical Research.


FOOTNOTES
1 These authors contributed equally to this work. Back


LITERATURE CITED

AMIN, N. S., M-N. NGUYEN, S. OH and R. D. KOLODNER, 2001 exo1-dependent mutator mutations: model system for studying functional interactions in mismatch repair. Mol. Cell. Biol. 21: 5142–5155.[Abstract/Free Full Text]

ARGUESO, J. L., D. SMITH, J. YI, M. WAASE, S. SARIN et al., 2002 Analysis of conditional mutations in Saccharomyces cerevisiae MLH1 gene in mismatch repair and in meiotic crossing over. Genetics 160: 909–921.[Abstract/Free Full Text]

BEECHEM, J. M., M. R. OTTO, L. B. BLOOM, R. E. ERITJA, L. J. REHA-KRANTZ et al., 1998 Exonuclease-polymerase active site partitioning of primer-template DNA strands and equilibrium Mg2+ binding properties of bacteriophage T4 DNA polymerase. Biochemistry 37: 10144–10155.[CrossRef][Medline]

BRAITHWAITE, D. K., and J. ITO, 1993 Compilation, alignment, and phylogenetic relationships of DNA polymerases. Nucleic Acids Res. 21: 787–802.[Free Full Text]

BURGERS, P. M. J., and G. A. BAUER, 1988 DNA polymerase III from Saccharomyces cerevisiae. II. Inhibitor studies and comparison with DNA polymerase I and II. J. Biol. Chem. 263: 925–930.[Abstract/Free Full Text]

BURKE, D., D. DAWSON and T. STEARNS, 2000 Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

CALDERON, I. L., C. R. CONTOPOULOU and R. K. MORTIMER, 1984 Isolation of a DNA fragment that is expressed as an amber suppressor when present in high copy number in yeast. Gene 29: 69–76.[CrossRef][Medline]

CORMACK, B., 1996 Mutagenesis by polymerase chain reaction, pp. 8.5.1–8.5.9 in Current Protocols in Molecular Biology, edited by F. M. AUSUBEL, R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN et al. John Wiley and Sons, New York.

DELARUE, M., O. POCH, D. MORUS and P. ARGOS, 1990 An attempt to unify the structure of polymerases. Protein Eng. 3: 461–467.[Abstract/Free Full Text]

DZANTIEV, L., N. CONSTANTIN, J. GENSCHEL, R. R. IYER, P. M. BURGERS et al., 2004 A defined human system that supports bi-directional mismatch-provoked excision. Mol. Cell 15: 31–41.[CrossRef][Medline]

EFRON, B., and R. J. TIBSHIRANI, 1993 An Introduction to the Bootstrap. Chapman & Hall/ International Thomson Publishing, London/New York.

FIDALGO DA SILVA, E., S. SUBHRANGSU and L. J. REHA-KRANTZ, 2002 Using 2-aminopurine fluorescence to measure incorporation of incorrect nucleotides by wild type and mutant bacteriophage T4 DNA polymerases. J. Biol. Chem. 277: 40640–40649.[Abstract/Free Full Text]

GARG, P., C. M. STITH, S. NASIM, E. JOHANSSON and P. M. BURGERS, 2004 Idling by DNA polymerase {delta} maintains a ligatable nick during lagging-strand DNA replication. Gene Dev. 18: 2764–2773.[Abstract/Free Full Text]

GENSCHEL, J., L. R. BAZEMORE and P. MODRICH, 2002 Human exonuclease 1 is required for 5' and 3' mismatch repair. J. Biol. Chem. 277: 13302–13311.[Abstract/Free Full Text]

GIETZ, R. D., and R. A. WOODS, 2002 Transformation of yeast by the LiAc/ss carrier DNA/PEG method. Methods Enzymol. 350: 87–96.[CrossRef][Medline]

GOLDSTEIN, A. L., and J. H. MCCUSKER, 1999 Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast 15: 1541–1553.[CrossRef][Medline]

HADJIMARCOU, M.I., R. J. KOKOSKA, T. D. PETES and L. J. REHA-KRANTZ, 2001 Identification of a mutant DNA polymerase in Saccharomyces cerevisiae with an antimutator phenotype for frameshift mutations. Genetics 158: 177–186.[Abstract/Free Full Text]

HARTWELL, L.H., R. K. MORTIMER, J. CULOTTI and M. CULOTTI, 1973 Genetic control of the cell division cycle in yeast. V. Genetic analysis of cdc mutants. Genetics 74: 267–286.[Abstract/Free Full Text]

JIN, Y. H., R. OBERT, P. M. J. BURGERS, T. A. KUNKEL, M. A. RESNICK et al., 2001 The 3'->5' exonuclease of DNA polymerase {delta} can substitute for the 5' flap endonuclease Rad27/Fen1 in processing Okazaki fragments and preventing genome instability. Proc. Natl. Acad. Sci. USA 98: 5122–5127.[Abstract/Free Full Text]

JIN, Y. H., R. AYYAGARI, M. A. RESNICK, D. A. GORDENIN and P. M. J. BURGERS, 2003 Okazaki fragment maturation in yeast. II. Cooperation between the polymerase and 3'->5' exonuclease activities of pol {delta} in the creation of a ligatable nick. J. Biol. Chem. 278: 1626–1633.[Abstract/Free Full Text]

KAO, H., L. A. HENRICKSEN, Y. LIU and R. A. BAMBARA, 2002 Cleavage specificity of Saccharomyces cerevisiae flap endonuclease I suggests a double-flap structure as the cellular substrate. J. Biol. Chem. 277: 14379–14389.[Abstract/Free Full Text]

KESTI, T., K. FLICK, S. KERäNEN, J. E. SYVäOJA and C. WITTENBERG, 1999 DNA polymerase {epsilon} catalytic domains are dispensible for DNA replication, DNA repair, and cell viability. Mol. Cell 3: 679–685.[CrossRef][Medline]

KOKOSKA, R. J., L. STEFANOVIC, H. T. TRAN, M. A. RESNICK, D. A. GORDENIN et al., 1998 Destabilization of yeast micro- and minisatellite DNA sequences by mutations affecting a nuclease involved in Okazaki fragment processing (rad27) and DNA polymerase delta (pol3-t). Mol. Cell. Biol. 18: 2779–2788.[Abstract/Free Full Text]

KOLODNER, R. D., and G. T. MARSISCHKY, 1999 Eukaryotic DNA mismatch repair. Curr. Opin. Genet. Dev. 9: 89–96.[CrossRef][Medline]

LARDER, B. A., S. D. KAMP and B. DARBY, 1987 Related functional domains in virus DNA polymerase. EMBO J. 61: 169–175.

LEA, D. E., and C. A. COULSON, 1949 The distribution of the number of mutants in bacterial populations. J. Genet. 49: 264–285.

LEINBACH, S. S., J. M. RENO, L. F. LEE, A. F. ISBELL and J. A. BOEZI, 1976 Mechanisms of phosphonoacetate inhibition of herpes virus-induced DNA polymerase. Biochemistry 15: 426–430.[CrossRef][Medline]

LONGTINE, M. S., A. MCKENZIE, D. J. DEMARINI, N. G. SHAH, A. WACH et al., 1998 Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14: 953–961.[CrossRef][Medline]

MAO, J. C.-H., E. E. ROBISHAW and L. R. OVERBY, 1975 Inhibition of DNA polymerase from herpes simplex virus-infected Wi-38 cells by phosphonoacetic acid. J. Virol. 15: 1281–1283.[Abstract/Free Full Text]

MARSISCHKY, G. T., N. FILOSI, M. F. KANE and R. KOLODNER, 1996 Redundancy of Saccharomyces cerevisiae MSH3 and MSH6 in MSH2-dependent mismatch repair. Genes Dev. 9: 1728–1739.

MODRICH, P., and R. LAHUE, 1996 Mismatch repair in replication fidelity, genetic recombination, and cancer biology. Annu. Rev. Biochem. 65: 101–133.[CrossRef][Medline]

MORRISON, A., and A. SUGINO, 1994 The 3'->5' exonucleases of both DNA polymerases delta and epsilon participate in correcting errors of DNA replication in Saccharomyces cerevisiae. Mol. Gen. Genet. 242: 289–296.[CrossRef][Medline]

MORRISON, A., A. L. JOHNSON, L. J. JOHNSTON and A. SUGINO, 1993 Pathway correcting DNA replication errors in Saccharomyces cerevisiae. EMBO J. 12: 1467–1473.[Medline]

NIIMI, A., S. LIMSIRICHAIKUL, S. YOSHIDA, S. IWAI, C. MASUTANI et al., 2004 Palm mutants in DNA polymerases {alpha} and {eta} alter DNA replication fidelity and translesion activity. Mol. Cell. Biol. 24: 2734–2746.[Abstract/Free Full Text]

ÖBERG, B., 1989 Antiviral effects of phosphonoformate (PFA, Foscarnet sodium). Pharmacol. Ther. 40: 213–285.[CrossRef][Medline]

PAVLOV, Y. I., I. M. MIAN and T. A. KUNKEL, 2003 Evidence for preferential mismatch repair of lagging strand replication errors in yeast. Curr. Biol. 13: 744–748.[CrossRef][Medline]

REHA-KRANTZ, L. J., 1995 Use of genetic analyses to probe structure, function, and dynamics of bacteriophage T4 DNA polymerase. Methods Enzymol. 262: 323–331.[Medline]

REHA-KRANTZ, L. J., and R. L. NONAY, 1994 Motif A of bacteriophage T4 DNA polymerase: role in primer extension and DNA replication fidelity. J. Biol. Chem. 269: 5635–5643.[Abstract/Free Full Text]

REHA-KRANTZ, L. J., and C. WONG, 1996 Selection of bacteriophage T4 antimutator DNA polymerases: a link between proofreading and sensitivity to phopshonoacetic acid. Mutat. Res. 350: 9–16.[Medline]

REHA-KRANTZ, L. J., R. L. NONAY and S. STOCKI, 1993 Bacteriophage T4 DNA polymerase mutations that confer sensitivity to the PPi analog phosphonoacetic acid. J. Virol. 67: 60–66.[Abstract/Free Full Text]

REHA-KRANTZ, L. J., R. L. NONAY, R. S. DAY and S. H. WILSON, 1996 Replication of O6- methylguanine-containing DNA by repair of replicative DNA polymerases. J. Biol. Chem. 271: 20088–20095.[Abstract/Free Full Text]

ROTHSTEIN, R., 1983 One-step gene disruption in yeast. Methods Enzymol. 101: 202–211.[Medline]

SIA, E. A., R. J. KOKOSKA, M. DOMINSKA, P. GREENWELL and T. D. PETES, 1997 Microsatellite instability in yeast: dependence on repeat unit size and DNA mismatch repair genes. Mol. Cell. Biol. 17: 2851–2858.[Abstract]

SOKOLSKY, T., and E. ALANI, 2000 EXO1 and MSH6 are high-copy suppressors of conditional mutations in the MSH2 mismatch repair gene of Saccharomyces cerevisiae. Genetics 155: 589–599.[Abstract/Free Full Text]

STOCKI, S. A., R. L. NONAY and L. J. REHA-KRANTZ, 1995 Dynamics of bacteriophage T4 DNA polymerase function: identification of amino acid residues which affect switching between polymerase and 3'->5' exonuclease activities. J. Mol. Biol. 254: 15–28.[CrossRef][Medline]

STRAND, M., T. A. PROLLA, R. M. LISKAY and T. D. PETES, 1993 Destabilization of tracts of simple repetitive DNA in yeast by mutations affecting DNA mismatch repair. Nature 365: 274–276.[CrossRef][Medline]

TADDIE, J. A., and P. TRAKTMAN, 1991 Genetic characterization of the vaccinia virus DNA polymerase: identification of point mutations conferring altered drug sensitivities and reduced fidelity. J. Virol. 65: 869–879.[Abstract/Free Full Text]

TISHKOFF, D. K., A. L. BOERGER, P. BERTRAND, N. FILOSI, G. M. GAIDA et al., 1997 Identification and characterization of Saccharomyces cerevisiae EXO1, a gene encoding an exonuclease that interacts with MSH2. Proc. Natl. Acad. Sci. USA 94: 7487–7492.[Abstract/Free Full Text]

TRAN, H. T., D. A. GORDENIN and M. A. RESNICK, 1999 The 3'->5' exonucleases of DNA polymerases delta and epsilon and the 5'->3' exonuclease Exo1 have major roles in postreplication mutation avoidance in Saccharomyces cerevisiae. Mol. Cell. Biol. 19: 2000–2007.[Abstract/Free Full Text]

TRAN, P. T., N. ERDENIZ, S. DUDLEY and R. M. LISKAY, 2002 Characterization of nuclease- dependent functions of Exo1p in Saccharomyces cerevisiae. DNA Rep. 1: 895–912.

WACH, A., A. BRACHAT, R. POHLMANN and P. PHILIPPSEN, 1994 New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10: 1793–1808.[CrossRef][Medline]

WANG, T. S-F., S. W. WONG and D. KORN, 1989 Human DNA polymerase {alpha}: predicted functional domains and relationships with viral DNA polymerases. FASEB J. 3: 14–21.[Abstract]

WEINERT, T. A., and L. J. HARTWELL, 1993 Cell cycle arrest of cdc mutants and specificity of the RAD9 checkpoint. Genetics 134: 63–80.[Abstract]

WILLIAMSON, D. H., L. H. JOHNSTON, D. J. FENNELL and G. SIMCHEN, 1983 The timing of the S phase and other nuclear events in yeast meiosis. Exp. Cell Res. 145: 209–217.[CrossRef][Medline]

XIE, Y., C. COUNTER and E. ALANI, 1999 Characterization of the repeat-tract instability and mutator phenotypes conferred by a Tn3 insertion in RFC1, the large subunit of the yeast clamp loader. Genetics 151: 499–509.[Abstract/Free Full Text]

Communicating editor: S. SANDMEYER




This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
J. E. Stone, G. E. Kissling, S. A. Lujan, I. B. Rogozin, C. M. Stith, P. M. J. Burgers, and T. A. Kunkel
Low-fidelity DNA synthesis by the L979F mutator derivative of Saccharomyces cerevisiae DNA polymerase {zeta}
Nucleic Acids Res., June 1, 2009; 37(11): 3774 - 3787.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
X. Zhong, L. C. Pedersen, and T. A. Kunkel
Characterization of a replicative DNA polymerase mutant with reduced fidelity and increased translesion synthesis capacity
Nucleic Acids Res., July 1, 2008; 36(12): 3892 - 3904.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
R. N. Venkatesan, P. M. Treuting, E. D. Fuller, R. E. Goldsby, T. H. Norwood, T. A. Gooley, W. C. Ladiges, B. D. Preston, and L. A. Loeb
Mutation at the Polymerase Active Site of Mouse DNA Polymerase {delta} Increases Genomic Instability and Accelerates Tumorigenesis
Mol. Cell. Biol., November 1, 2007; 27(21): 7669 - 7682.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
Z. F. Pursell, I. Isoz, E.-B. Lundstrom, E. Johansson, and T. A. Kunkel
Regulation of B family DNA polymerase fidelity by a conserved active site residue: characterization of M644W, M644L and M644F mutants of yeast DNA polymerase {varepsilon}
Nucleic Acids Res., May 14, 2007; 35(9): 3076 - 3086.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. A. N. McElhinny, C. M. Stith, P. M. J. Burgers, and T. A. Kunkel
Inefficient Proofreading and Biased Error Rates during Inaccurate DNA Synthesis by a Mutant Derivative of Saccharomyces cerevisiae DNA Polymerase {delta}
J. Biol. Chem., January 26, 2007; 282(4): 2324 - 2332.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. N. Venkatesan, J. J. Hsu, N. A. Lawrence, B. D. Preston, and L. A. Loeb
Mutator Phenotypes Caused by Substitution at a Conserved Motif A Residue in Eukaryotic DNA Polymerase {delta}
J. Biol. Chem., February 17, 2006; 281(7): 4486 - 4494.
[Abstract] [Full Text] [PDF]