| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Genetics, Vol. 169, 563-574, February 2005, Copyright © 2005
doi:10.1534/genetics.104.035204
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Molecular Biology and Genetics, Cornell University, Ithaca, New York 14853-2703
1 Corresponding author: Department of Molecular Biology and Genetics, Cornell University, 459 Biotechnology Bldg., Ithaca, NY 14853-2703.
E-mail: eea3{at}cornell.edu
| ABSTRACT |
|---|
|
|
|---|
MMR proteins are highly conserved and their biochemical activities have been well characterized. In E. coli, DNA mismatches and insertion-deletion loops generated during DNA replication are recognized by MutS. MutS binding to mismatched DNA results in the recruitment of MutL followed by activation of the MutH endonuclease. This leads to nicking of the newly synthesized, unmethylated, DNA strand. These interactions promote unwinding by UvrD helicase of the newly replicated strand toward the mismatch, which is followed by excision of the mismatch site by single-strand exonucleases. Resynthesis of the gapped DNA results in repair of the mismatch using the parental strand as a template (MODRICH and LAHUE 1996; SCHOFIELD and HSIEH 2003).
Eukaryotes contain six MutS homologs (Msh 16 proteins) and four MutL homologs (Mlh13 proteins, Pms1p). These proteins are present as Msh and Mlh heterodimers in vivo. Msh2p-Msh6p recognizes base-base mismatches and single-nucleotide insertion-deletions, while Msh2p-Msh3p displays specificity for insertion-deletion loops up to 12 nucleotides in length (reviewed in KOLODNER and MARSISCHKY 1999). The Mlh1p-Pms1p complex acts as the major Mlh heterodimer in MMR and is thought to coordinate Msh-DNA binding with downstream repair factors. Recent studies have suggested that such factors include Exo1, a 5'-3' exonuclease that has been implicated in excision steps, the clamp loader RFC, and the processivity clamp PCNA (SCHOFIELD and HSIEH 2003; DZANTIEV et al. 2004).
In addition to its role in postreplicative MMR, Msh2p-Msh3p is involved in facilitating single-strand annealing (SSA) events when a double-strand break (DSB) occurs in a region flanked by direct repeats (SUGAWARA et al. 1997). SSA is a major repair pathway in many organisms, including mammals, and appears to be the predominant pathway for the repair of breaks occurring between repeated DNA sequences (LIANG et al. 1998). In SSA, a DSB is processed by a 5'-3' exonuclease activity to expose complementary sequences. Annealing of the sequences results in an intermediate that contains 3' single-strand tails that must be removed before DNA resynthesis and ligation steps can occur (Figure 1A). Msh2p-Msh3p plays an important role in this process when the complementary regions are <1 kb in length (SUGAWARA et al. 1997) and when the nonhomologous tails are >30 nucleotides in length (PâQUES and HABER 1997). On the basis of these findings, Msh2p-Msh3p has been hypothesized to act during SSA by stabilizing the annealed region and/or by recruiting the Rad1p-Rad10p endonuclease to the homology-nonhomology junction (SUGAWARA et al. 1997). Consistent with these activities, in vitro experiments have shown that Rad1p-Rad10p cleaves DNA substrates containing 3' single-stranded tails (SUNG et al. 1993; TOMKINSON et al. 1993; BARDWELL et al. 1994), and physical interactions between Msh2p-Msh3p and Rad1p-Rad10p have been observed (BERTRAND et al. 1998). No other components of the nucleotide excision repair or MMR pathways are required in this process (SUGAWARA et al. 1997).
|
Recently, sgs1 null mutants of S. cerevisiae were shown in mitotic gene conversion and SSA assays to be defective in suppressing homeologous recombination (MYUNG et al. 2001; SPELL and JINKS-ROBERTSON 2004; SUGAWARA et al. 2004). Sgs1p, a homolog of the E. coli RecQ protein, is a 3'-5' helicase that can unwind duplex and partially duplex DNA. In vitro studies have shown that Sgs1p can also extend DNA pairing and disrupt joint molecules formed by aberrant recombination (HARMON and KOWALCZYKOWSKI 1998). sgs1 mutants display genomic instability phenotypes including increased sister chromatid exchange, chromosome nondisjunction, hyper-recombination, and defects in DNA replication (reviewed in COBB et al. 2002; HICKSON 2003). An attractive model to explain the role of Sgs1p in preventing homeologous recombination is that it is recruited by Msh proteins to unwind heteroduplex DNA containing mismatches. This would allow the unwound DNA to participate in another homology search (SUGAWARA et al. 2004). Consistent with this model is the finding that a human homolog of Sgs1p, BLM, interacts with human Msh6p (PEDRAZZI et al. 2003).
We conducted genetic and physical analyses of MSH2, MSH6, and SGS1 alleles with the goal of understanding how these factors participate in preventing homeologous recombination. Specific mutations known to disrupt biochemical activities of Msh2p, Msh6p, and Sgs1p (mismatch binding, ATP binding, and helicase) were constructed and strains bearing these mutations were examined in a recently developed SSA assay involving homeologous repeat sequences. This assay is of special interest because, of the factors known to be important in preventing homeologous recombination, only the Msh and Sgs1 proteins appear to play critical roles. Our results support the idea that the Msh proteins interact with Sgs1p to unwind DNA recombination intermediates containing mismatches. Importantly, we found that msh2 and msh6 mutants defective in MMR were also defective in heteroduplex rejection. We also identified an msh2 mutant defective in nonhomologous tail removal but functional in MMR and heteroduplex rejection. These studies suggest that the mode of DNA binding during MMR and homeologous rejection in this assay is likely to be distinct from that required for nonhomologous tail removal. It also indicates that subsets of the MMR proteins act to maintain genome stability by collaborating with factors belonging to different DNA repair pathways.
| MATERIALS AND METHODS |
|---|
|
|
|---|
3 thr4 leu2 trp1 THR4-ura3-A(205bp)-HOcs-URA3-A ade3::GAL10-HO::NAT] and EAY1143 [mat::leu2::hisG hmr
3 thr4 leu2 trp1 THR4-ura3-F(205bp)-HOcs-URA3-A ade3::GAL10-HO::NAT] were the parental strains tested in the SSA assay. Both strains contain two 205-bp repeats of URA3 sequence separated by 2.6 kb of DNA containing pUC9 DNA, the HO recognition sequence, and
DNA (described in SUGAWARA et al. 2004). These strains contain the GAL10-HO construct integrated into the ADE3 locus. EAY1141 is designated as "A-A" because it contains identical repeats of the URA3 repeat sequence. EAY1143 is designated as "F-A" because one of the URA3 repeat sequences contains seven single-site mutations. Mutant derivatives of the EAY1141 (A-A) and EAY1143 (F-A) parental strains were constructed by single-step gene replacement using the lithium acetate method (GEITZ and SCHIESTL 1991). Single-step integration vectors for MSH2 (MSH2-HA4::LEU2, AatII, PvuII digestion of pEAI118), MSH6 (MSH6::KANMX, KpnI, BstEII digestion of pEAI186), SGS1 (SGS1::KANMX, XhoI, BamHI digestion of pEAI195), and mutant derivatives were constructed such that the indicated selectable markers were inserted downstream of the open reading frame but within homologous sequence, allowing for targeted gene replacement. The insertion of the selectable marker downstream of the open reading did not disrupt wild-type gene function. Derivatives of EAY1141 include EAY1400 (msh2
::TRP1), EAY1309 (msh2-K564E-HA4::LEU2), EAY1377 (msh2
1-HA4::LEU2), EAY1225 (msh2-S656P-HA4::LEU2), EAY1314 (msh2-R730W-HA4::LEU2), EAY1387 (msh6
::KANMX), EAY1350 (msh6-F337A::KANMX), EAY1347 (msh6-G987D::KANMX), EAY1392 (sgs1
::KANMX), EAY1381 (sgs1-hd::KANMX), EAY1343 (sgs1
N644::KANMX), and EAY1333 (sgs1
C795::KANMX). Derivatives of EAY1143 include EAY1401 (msh2
::TRP1), EAY1227 (msh2-K564E-HA4::LEU2), EAY1260 (msh2
1-HA4::LEU2), EAY1267 (msh2-S656P-HA4::LEU2), EAY1265 (msh2-R730W-HA4::LEU2), EAY1388 (msh6
::KANMX), EAY1352 (msh6-F337A::KANMX), EAY1297 (msh6-G987D::KANMX), EAY1354 (sgs1
::KANMX), EAY1326 (sgs1-hd::KANMX), EAY1345 (sgs1
N644::KANMX), and EAY1336 (sgs1
C795::KANMX).
SSA time courses:
Stationary phase cultures of the above strains were diluted into YP (ROSE et al. 1990) medium supplemented with lactate (2% w/v final concentration) and grown until midlog phase (12 x 107 cells/ml). The cultures were then induced with galactose (2% w/v final concentration; US Biological) and 45-ml samples were collected at various time points. Thirty minutes after induction, HO expression was suppressed by the addition of glucose (2% w/v final concentration). After centrifugation, each sample was washed with 1 ml ddH2O, resuspended in 0.4 ml DNA extraction buffer (2% SDS, 100 mM Tris-HCl, pH 8.0, 50 mM EDTA, pH 8.0), and then added to tubes containing 0.4 ml glass beads (425600 µm; Sigma, St. Louis) and 0.4 ml phenol:chloroform (1:1). Samples were vortexed for 5 min at 4°, followed by phenol:chloroform extraction. DNA was precipitated by adding 30 µl 3 M Na acetate (pH 5.2) and 600 µl isopropanol and washed with 1 ml 75% ethanol. Samples were RNase treated in 0.4 ml of RNase buffer [10 mM Tris, pH 8.0, 1 mM EDTA, pH 8.0, 25 µg/ml RNase (Sigma)] for 1 hr at 37°, followed by phenol:chloroform extraction and DNA precipitation as described above. DNA was resusupended in 50 µl TE.
Southern blot analysis:
DNA samples from the above time courses were digested with BglII (New England Biolabs, Beverly, MA) and run on 1% agarose gels with 1x TAE buffer. Southern blot transfer and hybridizations were performed essentially as described by the manufacturer (Amersham, Arlington Heights, IL) and SUGAWARA et al. (2004). Blots were visualized using the Phosphor Imaging system and quantified using the Imagequant program (Molecular Dynamics, Sunnyvale, CA). The probe used to visualize SSA products was an 880-bp HindIII-BamHI fragment downstream of URA3 obtained by digesting plasmid pNSU151 with EcoRI (SUGAWARA et al. 2004). The loading control probe consisted of a 600-bp PCR-generated RAD10 fragment amplified using primers TP30 (5' GGTCACAGCAAGATTTTCATC) and AO641 (5' TAAGGGCTGCATTCTCCTAGAG). Probes were synthesized using an NEBlot kit with 32P-dCTP as directed by the manufacturer (New England Biolabs), and were purified using Bio-Spin P30 columns as suggested by the manufacturer (Bio-Rad, Richmond, CA). To measure product formation, the intensity of the product band 5 hr after HO induction was divided by the intensity of the 0-hr uncut band. Both the 5-hr and the 0-hr bands were normalized to the RAD10 loading control band. For each strain, average product formation and standard deviation were calculated from three to six independent experiments.
Cell viability analysis:
Cell survival during SSA with both homologous and homeologous recombination was determined as described previously (SUGAWARA et al. 2004). Briefly, cells were pregrown in YP-lactate medium (2% w/v final concentration) to midlog phase and plated on YP plates containing either glucose (2% w/v final concentration) or galactose (2% w/v final concentration). The efficiency of SSA was measured by determining the number of cells growing on the galactose plates compared to those on the glucose plates. Cell viability data were determined by calculating the average and standard deviation of three to seven independent experiments for each strain.
Determination of mutation rates:
The rate per generation of forward mutation to canavanine resistance was calculated from the median mutation frequency using the method of LEA and COULSON (1949). The forward mutation rate to canavanine resistance (REENAN and KOLODNER 1992) was measured in EAY745 (MATa, HMRa,
hml::ADE1,
ho, ade1-100, leu2-3, 112, lys5, trp1::hisG, ura3-52, ade3::GAL-HO, MSH2-HA4::LEU2) and msh2
(EAY969), msh3
(EAY854), msh6
(EAY855), and msh2
1 (EAY1398) mutant derivatives. The mutation rate and 95% confidence interval were determined from 19 independent measurements for each strain.
Western blot analysis:
Cell lysates derived from midlog cultures of EAY1143 (MSH2), EAY1257 (MSH2-HA4::LEU2), and EAY1378 (msh2
1-HA4::LEU2) were separated on 8% SDS-PAGE gels and transferred to nitrocellulose membrane (Bio-Rad) using a semidry electrophoretic transfer system (Bio-Rad). Western blot analysis was carried out with primary antibody specific to HA (12CA5, Roche, Indianapolis) and secondary anti-mouse IgG antibody at 1:2000 and 1:5000 dilutions, respectively. The loading control was detected using primary antibody to glucose 6-phosphate dehydrogenase (Sigma) and secondary anti-rabbit IgG antibody at 1:20,000 and 1:10,000 dilutions, respectively. Detection was carried out using ECLPlus (Amersham) according to the manufacturer's instructions.
| RESULTS |
|---|
|
|
|---|
|
|
|
|
strain (1.3 and 1.4). The msh6-F337A mutation conferred a defect in heteroduplex rejection that resembled the msh6
mutation (A-A/F-A ratios of 1.4 for product and 1.4 for cell viability), suggesting a direct correlation between mismatch recognition by Msh2p-Msh6p and heteroduplex rejection. The finding that the msh2-K564E strain displayed a somewhat less severe defect than the msh6 strains suggests that the residual msh2p-Msh6p binding activity observed in this mutant (KIJAS et al. 2003) may be sufficient to promote a low level of heteroduplex rejection.
An msh2 DNA binding domain I deletion mutant that is functional in MMR and heteroduplex rejection, but defective in nonhomologous tail removal:
We used the Taq MutS crystal structure as a guide to make deletions of DNA binding domains I (amino acids 2133, designated as msh2
1) and IV (amino acids 497606, designated as msh2
4) in Msh2p (OBMOLOVA et al. 2000). We were interested in testing the domain I deletion in Msh2p because this domain makes very few contacts with the DNA mismatch substrate within the corresponding subunit in the MutS crystal structure (OBMOLOVA et al. 2000). As described above, the DNA binding domain IV of MSH2 contains the K564 residue that was shown to be important for mismatch recognition (KIJAS et al. 2003). The msh2
4 mutation conferred null-like phenotypes in MMR and nonhomologous tail removal assays (data not shown). Surprisingly, a complete deletion of DNA binding domain I (amino acids 2133) conferred only a weak defect in MMR as measured in the canavanine resistance assay (Figure 3A). This assay measures the forward mutation rate in the CAN1 gene and was shown previously to be specific to DNA lesions recognized by Msh2p-Msh6p (MARSISCHKY et al. 1996).
|
1p was expressed at wild-type levels (Figure 3B). However, the msh2
1 mutation conferred a severe defect in nonhomologous tail removal in the Southern blot assay (Figure 3C; Table 1). Cell viability analysis indicated that cell survival in the A-A strain background was nearly as low in the msh2
1 strain (0.11 ± 0.05) as in the msh2
strain (0.04 ± 0.01). Consistent with a somewhat functional Msh2p-Msh6p complex, the A-A/F-A product formation and cell viability ratios for the msh2
1 strain (2.9 and 2.8) were similar to those seen in wild type (3.5 and 3.4), indicating that heteroduplex rejection was still functional (Table 1; Figure 3C). These data suggest that domain I in Msh2p plays an important functional role in nonhomologous tail removal when acting within the Msh2p-Msh3p complex. It is important to note that the strong defect in nonhomologous tail removal in msh2
1 strains made it difficult to accurately assess heteroduplex rejection (Table 1). The fact that msh2
1 strains displayed A-A/F-A ratios similar to those of wild type in both assays and the mutant strain appeared functional for Msh2p-Msh6p-mediated MMR supports our conclusion. However, it will be important to test the effect of the msh2
1 mutation in other homeologous recombination assays that do not involve nonhomologous tail removal (e.g., NICHOLSON et al. 2000).
ATP binding and hydrolysis by the MutS homologs is required for rejection:
Genetic and biochemical studies have shown that the ATP binding domain in each subunit of Msh2p-Msh6p is required for MMR (STUDAMIRE et al. 1998; OBMOLOVA et al. 2000; JUNOP et al. 2001). Analysis of the Msh2p-Msh6p complex has led to a model where the two Msh subunits hydrolyze ATP sequentially, with the Msh6p ATPase activity acting as a mismatch sensor (IACCARINO et al. 1998; STUDAMIRE et al. 1998; KIJAS et al. 2003). The role of ATP binding and hydrolysis in the rejection of homeologous recombination was tested by studying the effects of both Msh2p and Msh6p ATPase mutants in the SSA assay. The msh6-G987D mutation contains a substitution at the Walker A motif in Msh6p that is predicted to disrupt ATP binding. Previous work indicated that this mutant is capable of recognizing and binding mismatches, but is unable to signal mismatch recognition to activate downstream repair factors (STUDAMIRE et al. 1998; KIJAS et al. 2003). The equivalent mutation in Msh2p (msh2-G693D) could not be studied in this assay because it causes a complete defect in nonhomologous tail removal (STUDAMIRE et al. 1999). However, two msh2 separation-of-function mutations, msh2-R730W and msh2-S656P, were isolated that are functional in nonhomologous tail removal yet defective in ATP binding and/or hydrolysis (STUDAMIRE et al. 1998; KIJAS et al. 2003).
The msh2-R730Wp-Msh6p complex is functional for ATP-dependent recruitment of Mlh1p-Pms1p but is hypothesized to be defective in a late step in MMR, perhaps in the recycling of MMR components or the recruitment of downstream factors (KIJAS et al. 2003). While this complex appears proficient in ATP binding and Mlh1p-Pms1p recruitment, it displays a significant defect in ATP hydrolysis (KIJAS et al. 2003). The msh2-R730W mutation maps to a region on the Taq MutS crystal structure near residues thought to be important for
-phosphate binding of the ATP molecule in the adjacent subunit (KIJAS et al. 2003). The msh2-S656P mutation maps to a region on the Taq MutS crystal structure that is
7 Å from the bound ATP and could affect the structure of the ATP binding pocket (KIJAS et al. 2003). Biochemical studies showed that msh2p-Msh6p complexes containing the msh2-S656P mutation display defects in both ATP binding and hydrolysis and in interacting with Mlh1p-Pms1p on a DNA mismatch substrate (KIJAS et al. 2003). It is important to note that all of the ATP binding mutant Msh2p-Msh6p complexes display similar mismatch binding activities in the absence of ATP in gel shift assays (KIJAS et al. 2003).
As shown in Figure 4 and Table 1, the msh6-G987D, msh2-R730W, and msh2-S656P mutations all caused severe defects in heteroduplex rejection as seen in both Southern blot analysis (A-A/F-A ratios of 1.21.3) and cell viability (A-A/F-A ratios of 1.01.7) assays. The defect in homeologous rejection conferred by the msh2-R730W mutation was similar to that reported previously using a plasmid-based GAL10-HO induction system (SUGAWARA et al. 2004). Product formation and cell viability were unaffected by the msh6-G987D and msh2-R730W mutations in the A-A assay but were reduced in the msh2-S656P mutant, indicating that nonhomologous tail removal was somewhat compromised in the msh2-S656P mutant, but not in the other two ATPase mutants (Figure 4; Table 1). It is important to note that while ATP binding by Msh2p-Msh6p is required for the formation of a complex containing a DNA mismatch substrate, Msh2p-Msh6p, and Mlh1p-Pms1p in MMR, the Mlh homologs were shown to have little to no effect on rejection in the SSA pathway (SUGAWARA et al. 2004). The finding that ATP binding and hydrolysis are required for heteroduplex rejection independent of a requirement for the MutL homologs suggests that the role of ATP binding and hydrolysis during the rejection of homeologous recombination is not likely to involve the formation of a ternary complex with Mlh1p-Pms1p. This indicates that the requirement for ATP binding and hydrolysis by the Msh proteins in heteroduplex rejection is likely to be distinct from that observed during MMR. One possible explanation of the results is that mismatch binding by Msh2p-Msh6p is not sufficient for rejection and that conformational changes induced by ATP binding and/or interactions with downstream factors are likely to be required for heteroduplex rejection.
The helicase domain of Sgs1 is required for rejection of homeologous recombination:
The 1447-amino-acid Sgs1p is a 3'-5' helicase that contains an acidic amino-terminal region and a conserved helicase motif (MULLEN et al. 2000). Because SUGAWARA et al. (2004) hypothesized that homeologous rejection occurs by an unwinding mechanism, we investigated the effect of sgs1 helicase mutations on heteroduplex rejection. The sgs1-hd allele contains a lysine-to-alanine substitution at position 706 that affects the ATP binding domain and disrupts Sgs1p helicase activity (LU et al. 1996). Previous studies have indicated that sgs1
C795, an allele that contains a deletion of the C-terminal 795 amino acids, including the entire helicase domain, confers a phenotype that is less severe than that of the helicase point mutant in a subset of assays including MMS sensitivity, hyperrecombination, and growth in the presence of the top1 mutation (MULLEN et al. 2000). On the basis of this and other work, MULLEN et al. (2000) proposed that the amino-terminal region of Sgs1p contains a functional domain that is somehow inhibited by the sgs1-hd point mutation. We also tested the sgs1
N644 mutation, an allele that contains a deletion of the first 644 amino acids of Sgs1p but retains the helicase domain (MULLEN et al. 2000). The sgs1
N644 mutation conferred a more severe phenotype than the sgs1-hd mutation did in a subset of the assays listed above. As shown in Figure 5 and Table 1, all three alleles conferred a heteroduplex rejection phenotype that was indistinguishable from the sgs1
mutation. It is important to note that cell survival appeared to be higher in the A-A assay in the sgs1 strains (0.791.0) compared to wild type (0.61; Table 1). One way to explain this difference is that the hyperrecombination phenotype observed in sgs1 strains is able to overcome a block to recombination that is observed during SSA.
| DISCUSSION |
|---|
|
|
|---|
1, msh2-K564E, and msh2-R730W) strengthens the idea that the pathways are distinct.
|
Mutations that disrupted mismatch binding in both MSH2 (msh2-K564E) and MSH6 (msh6-F337A) conferred defects in homeologous rejection, with the msh6-F337A mutation conferring a more severe defect that was indistinguishable from the msh6
mutation. The different phenotypes seen for the msh2-K564E and msh6-F337A mutants appear specific to antirecombination; previous genetic studies showed that the msh2-K564E and msh6-F337A mutants are similarly defective in MMR (STUDAMIRE et al. 1999). One explanation for the different phenotypes in the two assays is that there may be a different kinetic requirement for the Msh proteins during DNA replication, where MMR is thought to be coordinated with fork movement, and heteroduplex rejection, which occurs within the context of a relatively slow DNA repair event (see Figure 1). Thus the residual DNA binding activity observed for the msh2-K564Ep-Msh6p complex may be sufficient to reject homeologous recombination at some level (KIJAS et al. 2003; SCHOFIELD and HSIEH 2003).
In contrast to the subunit A domain I (msh6-F337A) and subunit B domain IV (msh2-K564E) DNA binding mutants, a complete deletion of DNA binding domain I of subunit B (msh2
1) caused only a weak defect in Msh2p-Msh6p-specific MMR. A deletion of domain I is likely to enlarge the channel that is present in the MutS crystal structure (LAMERS et al. 2000; OBMOLOVA et al. 2000; Figure 3A). At present, it is not clear whether this channel plays any role in MMR or in the formation of the Msh diffusible clamp that is hypothesized to form in the presence of ATP (GRADIA et al. 1999; JUNOP et al. 2003). The Taq and E. coli MutS crystal structures indicated that the phenylalanine residue at position 39 and 36 of subunit A, respectively, intercalate with the mismatch, making direct contact with DNA (LAMERS et al. 2000; OBMOLOVA et al. 2000). Analogous substitutions in Msh2p-Msh6p showed that the msh6-F337A caused a dramatic defect in MMR while the msh2-Y42A mutation appeared silent (BOWERS et al. 1999; DUFNER et al. 2000). These results are consistent with the Taq and E. coli MutS crystal structure diagrams indicating that domain I of subunit B (the "Msh2p" subunit) does not make direct contact with the DNA (LAMERS et al. 2000; OBMOLOVA et al. 2000). An amino acid alignment analysis indicates that a lysine residue in Msh3p (amino acid 187) is located where a phenylalanine is present in Msh6p and in E. coli and Taq MutS. Together, these observations provide additional evidence that Msh2p-Msh3p and Msh2p-Msh6p bind DNA lesions in distinct ways. Further support for this idea was obtained in a dinucleotide repeat instability assay (HENDERSON and PETES 1992), where we found that the msh2
1 mutant displayed a DNA slippage phenotype similar to the msh3
mutant (E. ALANI and T. GOLDFARB, unpublished observations). A systematic investigation of the effect of the msh2
1 mutation, alone and in combination with other MMR mutations, on the repair of loop mismatches varying in size from 1 to 20 nucleotides will be important in determining whether the defect in nonhomologous tail removal observed in msh2
1 strains extends to other Msh2p-Msh3p-dependent repair processes (HENDERSON and PETES 1992; SIA et al. 1997).
We investigated the effects of ATP binding mutations in the Msh2p and Msh6p subunits (msh2-S656P and msh6-G987D, respectively) on heteroduplex rejection. These experiments were performed to test whether mismatch binding alone by Msh2p-Msh6p was sufficient to elicit rejection. If this were the case, mutant Msh complexes defective in ATP binding/hydrolysis but proficient in mismatch binding would be functional in preventing homeologous recombination. Mutations predicted to disrupt ATP binding/hydrolysis in both subunits were tested because studies indicated that the two subunits of the heterodimer bind and hydrolyze ATP with different affinities and at different rates (IACCARINO et al. 1998; STUDAMIRE et al. 1998; BJORNSON et al. 2000; ANTONY and HINGORANI 2003; KIJAS et al. 2003). As shown in Figure 4, the msh6-G987D allele conferred a defect in heteroduplex rejection that was similar to the msh6
mutation. Although msh2-S656P strains displayed a defect in nonhomologous tail removal, a comparison of product formation in the A-A and F-A assays clearly showed that this mutation conferred defects in heteroduplex rejection. Finally, the msh2-R730W strain showed a defect in homeologous rejection that was observed previously (SUGAWARA et al. 2004). These data indicate that mismatch binding alone is not sufficient for rejection of homeologous recombination and that the conformational changes in the Msh proteins induced by ATP binding and hydrolysis (e.g., KIJAS et al. 2003) are likely to be important during heteroduplex rejection processes to recruit downstream factors, such as the Sgs1 helicase protein (Figure 6).
Recent genetic and physical studies have implicated the Sgs1p helicase in rejecting homeologous recombination (MYUNG et al. 2001; SPELL and JINKS-ROBERTSON 2004; SUGAWARA et al. 2004). Null mutations in SGS1 display a variety of phenotypes including MMS sensitivity, synthetic lethality with SLX1-4, hyperrecombination, suppression of the top3 slow growth phenotype, and slow growth in the presence of the top1
mutation (GANGLOFF et al. 1994; MULLEN et al. 2000, 2001). Physical interactions in mammalian cell lines between hMSH6 and BLM suggest that these proteins could work in the same pathway (PEDRAZZI et al. 2003). We analyzed previously characterized alleles in Sgs1p (MULLEN et al. 2000) to determine the activities required for heteroduplex rejection in the SSA assay. Previous work with these alleles indicated that Sgs1p contains a bipartite structure consisting of a helicase domain and an amino-terminal region. It was proposed that this amino-terminal region could contain an activity, such as a nuclease function like that found in WRN, or could be required for interactions with other proteins (MULLEN et al. 2000). Previous work demonstrated that protein levels from these alleles are as high as or higher than those observed for the wild-type protein, indicating that loss-of-function is not a result of unstable protein (MULLEN et al. 2000).
We found that that a helicase point mutant (sgs1-hd), an N-terminal truncation (sgs1
N644), and a C-terminal truncation (sgs1
C795) all showed defects in rejecting homeologous recombination (Figure 5). The null phenotype observed for sgs1-hd in our assay supports a model in which the helicase activity of Sgs1p is required to unwind intermediates formed during heteroduplex rejection. This is in agreement with previous data suggesting that heteroduplex rejection occurs by an unwinding mechanism (SUGAWARA et al. 2004; Figure 6). We were somewhat surprised that sgs1
C795 and sgs1-hd strains displayed indistinguishable defects in heteroduplex rejection because a previous analysis showed that the sgs1
C795 mutation conferred a less severe phenotype than sgs1-hd did in MMS sensitivity assays, hyperrecombination, and sgs1 top1 complementation assays (MULLEN et al. 2000). One way to explain this difference is that the sgs1
C795 mutation disrupts interactions between Sgs1p and Msh6p or other factors involved in the rejection of homeologous recombination. Alternatively, the limited range of the heteroduplex rejection assay may prevent the detection of subtle differences in Sgs1p function. Experiments to test these ideas are planned.
| ACKNOWLEDGEMENTS |
|---|
|
|
|---|
| LITERATURE CITED |
|---|
|
|
|---|
ANTONY, E., and M. M. HINGORANI, 2003 Mismatch recognition-coupled stabilization of Msh2-Msh6 in an ATP-bound state at the initiation of DNA repair. Biochemistry 42: 76827693.[CrossRef][Medline]
BARDWELL, A. J., L. BARDWELL, A. E. TOMKINSON and E. C. FRIEDBERG, 1994 Specific cleavage of model recombination and repair intermediates by the yeast Rad1-Rad10 DNA endonuclease. Science 265: 20822085.
BERTRAND, P., D. X. TISHKOFF, N. FILOSI, R. DASGUPTA and R. D. KOLODNER, 1998 Physical interaction between components of DNA mismatch repair and nucleotide excision repair. Proc. Natl. Acad. Sci. USA 95: 1427814283.
BJORNSON, K. P., D. J. ALLEN and P. MODRICH, 2000 Modulation of MutS ATP hydrolysis by DNA cofactors. Biochemistry 39: 31763183.[CrossRef][Medline]
BOWERS, J., T. SOKOLSKY, T. QUACH and E. ALANI, 1999 A mutation in the MSH6 subunit of the Saccharomyces cerevisiae MSH2MSH6 complex disrupts mismatch recognition. J. Biol. Chem. 274: 1611516125.
CHEN, W., and S. JINKS-ROBERTSON, 1999 The role of the mismatch repair machinery in regulating mitotic and meiotic recombination between diverged sequences in yeast. Genetics 151: 12991313.
COBB, J. A., L. BJERGBAEK and S. M. GASSER, 2002 RecQ helicases: at the heart of genetic stability. FEBS Lett. 529: 4348.[CrossRef][Medline]
DATTA, A., A. ADJIRI, L. NEW, G. F. CROUSE and S. JINKS-ROBERTSON, 1996 Mitotic crossovers between diverged sequences are regulated by mismatch repair proteins in Saccharomyces cerevisiae. Mol. Cell. Biol. 16: 10851093.[Abstract]
DUFNER, P., G. MARRA, M. RASCHLE and J. JIRICNY, 2000 Mismatch recognition and DNA-dependent stimulation of the ATPase activity of hMutS
is abolished by a single mutation in the hMSH6 subunit. J. Biol. Chem. 275: 3655036555.
DZANTIEV, L., N. CONSTANTIN, J. GENSCHEL, R. R. IYER, P. M. BURGERS et al., 2004 A defined human system that supports bidirectional mismatch-provoked excision. Mol. Cell 15: 3141.[CrossRef][Medline]
EVANS, E., and E. ALANI, 2000 Roles for mismatch repair factors in regulating genetic recombination. Mol. Cell. Biol. 20: 78397844.
FABISIEWICZ, A., and L. WORTH, JR., 2001 Escherichia coli MutS,L modulate RuvAB-dependent branch migration between diverged DNA. J. Biol. Chem. 276: 94139420.
GANGLOFF, S., J. P. MCDONALD, C. BENDIXEN, L. ARTHUR and R. ROTHSTEIN, 1994 The yeast type I topoisomerase Top3 interacts with Sgs1, a DNA helicase homolog: a potential eukaryotic reverse gyrase. Mol. Cell. Biol. 14: 83918398.
GEITZ, R. D., and R. H. SCHIESTL, 1991 Applications of high efficiency lithium acetate transformation of intact yeast cells using single-stranded nucleic acids as carrier. Yeast 7: 253263.[CrossRef][Medline]
GRADIA, S., D. SUBRAMANIAN, T. WILSON, S. ACHARYA, A. MAKHOV et al., 1999 hMSH2-hMSH6 forms a hydrolysis-independent sliding clamp on mismatched DNA. Mol. Cell 3: 255261.[CrossRef][Medline]
HARMON, F. G., and S. C. KOWALCZYKOWSKI, 1998 RecQ helicase, in concert with RecA and SSB proteins, initiates and disrupts DNA recombination. Genes Dev. 12: 11341144.
HENDERSON, S. T., and T. D. PETES, 1992 Instability of simple sequence DNA in Saccharomyces cerevisiae. Mol. Cell. Biol. 12: 27492757.
HICKSON, I. D., 2003 RecQ helicases: caretakers of the genome. Nat. Rev. 3: 169178.
IACCARINO, I., G. MARRA, F. PALOMBO and J. JIRICNY, 1998 hMSH2 and hMSH6 play distinct roles in mismatch binding and contribute differently to the ATPase activity of hMutSa. EMBO J. 17: 26772686.[CrossRef][Medline]
IVANOV, E. L., N. SUGAWARA, J. FISHMAN-LOBELL and J. E. HABER, 1996 Genetic requirements for the single-strand annealing pathway of double-strand break repair in Saccharomyces cerevisiae. Genetics 142: 693704.[Abstract]
JUNOP, M. S., G. OBMOLOVA, K. RAUSCH, P. HSIEH and W. YANG, 2001 Composite active site of an ABC ATPase: MutS uses ATP to verify mismatch recognition and authorize DNA repair. Mol. Cell 7: 112.[CrossRef][Medline]
JUNOP, M. S., W. YANG, P. FUNCHAIN, W. CLENDENIN and J. H. MILLER, 2003 In vitro and in vivo studies of MutS, MutL and MutH mutants: correlation of mismatch repair and DNA recombination. DNA Repair 2: 387405.[CrossRef][Medline]
KIJAS, A. W., B. STUDAMIRE and E. ALANI, 2003 msh2 separation of function mutations confer defects in the initiation steps of mismatch repair. J. Mol. Biol. 331: 123138.[CrossRef][Medline]
KOLODNER, R. D., and G. T. MARSISCHKY, 1999 Eukaryotic DNA mismatch repair. Curr. Opin. Genet. Dev. 9: 8996.[CrossRef][Medline]
LAMERS, M. H., A. PERRAKIS, J. H. ENZLIN, H. H. K. WINTERWERP, N. DEWIND et al., 2000 The crystal structure of DNA mismatch repair protein MutS binding to a G-T mismatch. Nature 407: 711717.[CrossRef][Medline]
LEA, D. E., and C. A. COULSON, 1949 The distribution of the numbers of mutants in bacterial populations. J. Genet. 49: 264285.
LIANG, F., M. HAN, P. J. ROMANIENKI and M. JASIN, 1998 Homology-directed repair is a major double-strand break repair pathway in mammalian cells. Proc. Natl. Acad. Sci. USA 95: 51725177.
LU, J., J. R. MULLEN, S. J. BRILL, S. KLEFF and A. ROMEO, 1996 Human homologs of yeast DNA helicase. Nature 383: 678679.[CrossRef][Medline]
MARSISCHKY, G. T., N. FILOSI, M. F. KANE and R. KOLODNER, 1996 Redundancy of Saccharomyces cerevisiae MSH3 and MSH6 in MSH2-dependent mismatch repair. Genes Dev. 10: 407420.
MODRICH, P., and R. LAHUE, 1996 Mismatch repair in replication fidelity, genetic recombination, and cancer biology. Annu. Rev. Biochem. 65: 101133.[CrossRef][Medline]
MULLEN, J. R., V. KALIRAMAN and S. J. BRILL, 2000 Bipartite structure of the SGS1 DNA helicase in Saccharomyces cerevisiae. Genetics 154: 11011114.
MULLEN, J. R., V. KALIRAMAN, S. S. IBRAHIM and S. J. BRILL, 2001 Requirement for three novel protein complexes in the absence of the Sgs1 DNA helicase in Saccharomyces cerevisiae. Genetics 157: 103118.
MYUNG, K., A. DATTA, C. CHEN and R. D. KOLODNER, 2001 SGS1, the Saccharomyces cerevisiae homologue of BLM and WRN, suppresses genome instability and homeologous recombination. Nat. Genet. 27: 113116.[CrossRef][Medline]
NICHOLSON, A., M. HENDRIX, S. JINKS-ROBERTSON and G. F. CROUSE, 2000 Regulation of mitotic homeologous recombination in yeast: functions of mismatch repair and nucleotide excision repair genes. Genetics 154: 133146.
OBMOLOVA, G., C. BAN, P. HSIEH and W. YANG, 2000 Crystal structure of mismatch repair protein MutS and its complex with a substrate DNA. Nature 407: 703710.[CrossRef][Medline]
PâQUES, F., and J. E. HABER, 1997 Two pathways for removal of non-homologous DNA ends during double-strand break repair in Saccharomyces cerevisiae. Mol. Cell. Biol. 17: 67656771.[Abstract]
PâQUES, F., and J. E. HABER, 1999 Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 63: 349404.
PEDRAZZI, G., C. Z. BACHRATI, N. SELAK, I. STUDER, M. PETKOVIC et al., 2003 The Bloom's syndrome helicase interacts directly with the human DNA mismatch repair protein hMSH6. Biol. Chem. 384: 11551164.[CrossRef][Medline]
RAYSSIGUIER, C., D. S. THALER and M. RADMAN, 1989 The barrier to recombination between Escherichia coli and Salmonella typhimurium is disrupted in mismatch-repair mutants. Nature 342: 396401.[CrossRef][Medline]
REENAN, R. A., and R. D. KOLODNER, 1992 Characterization of insertion mutations in the Saccharomyces cerevisiae MSH1 and MSH2 genes: evidence for separate mitochondrial and nuclear functions. Genetics 132: 975985.[Abstract]
ROSE, M. D., F. WINSTON and P. HIETER, 1990 Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SCHMID, C. W., 1996 Alu: structure, origin, evolution, significance and function of one- tenth of human DNA. Prog. Nucleic Acid Res. Mol. Biol. 53: 283319.[Medline]
SCHOFIELD, M. J., and P. HSIEH, 2003 DNA mismatch repair: molecular mechanisms and biological function. Annu. Rev. Microbiol. 57: 579608.[CrossRef][Medline]
SHEN, P., and H. HUANG, 1989 Effect of base pair mismatches on recombination via the RecBCD pathway. Mol. Gen. Genet. 18: 358360.
SIA, E. A., R. J. KOKOSKA, M. DOMINSKA, P. GREENWELL and T. D. PETES, 1997 Microsatellite instability in yeast: dependence on repeat unit size and DNA mismatch repair genes. Mol. Cell. Biol. 17: 28512858.[Abstract]
SPELL, R. M., and S. JINKS-ROBERTSON, 2004 Examination of the roles of Sgs1 and Srs2 helicases in the enforcement of recombination fidelity in Saccharomyces cerevisiae. Genetics 168: 18551865.
STAMBUK, S., and M. RADMAN, 1998 Mechanism and control of interspecies recombination in Escherichia coli. I. Mismatch repair, methylation, recombination and replication functions. Genetics 150: 533542.
STUDAMIRE, B., T. QUACH and E. ALANI, 1998 Saccharomyces cerevisiae Msh2p and Msh6p ATPase activities are both required during mismatch recognition. Mol. Cell. Biol. 18: 75907601.
STUDAMIRE, B., G. PRICE, N. SUGAWARA, J. E. HABER and E. ALANI, 1999 Separation of function mutations in Saccharomyces cerevisiae MSH2 that confer mismatch repair defects but do not affect non-homologous-tail removal during recombination. Mol. Cell. Biol. 19: 75587567.
SUGAWARA, N., F. PâQUES, M. COLAIACOVO and J. E. HABER, 1997 Role of Saccharomyces cerevisiae Msh2 and Msh3 repair proteins in double-strand break-induced recombination. Proc. Natl. Acad. Sci. USA 94: 92149219.
SUGAWARA, N., T. GOLDFARB, B. STUDAMIRE, E. ALANI and J. E. HABER, 2004 Heteroduplex rejection during single-strand annealing requires Sgs1 helicase and mismatch repair proteins Msh2 and Msh6 but not Pms1. Proc. Natl. Acad. Sci. USA 1010: 93159320.
SUNG, P., P. REYNOLDS, L. PRAKASH and S. PRAKASH, 1993 Purification and characterization of the Saccharomyces cerevisiae Rad1/Rad10 endonuclease. J. Biol. Chem. 268: 2639126399.
SURTEES, J. A., J. L. ARGUESO and E. ALANI, 2004 Mismatch repair proteins: key regulators of genetic recombination. Cytogenet. Genome Res. 107: 146159.[CrossRef][Medline]
TOMKINSON, A. E., A. J. BARDWELL, L. BARDWELL, N. J. TAPPE and E. C. FRIEDBERG, 1993 Yeast DNA repair and recombination proteins Rad1 and Rad10 constitute a single-stranded-DNA endonuclease. Nature 362: 860862.[CrossRef][Medline]
WORTH, L., JR., S. CLARK, M. RADMAN and P. MODRICH, 1994 Mismatch repair proteins MutS and MutL inhibit RecA-catalyzed strand transfer between diverged DNAs. Proc. Natl. Acad. Sci. USA 91: 32383241.
WORTH, L., JR., T. BADER, J. YANG and S. CLARK, 1998 Role of MutS ATPase activity in MutS,L-dependent block of in vitro strand transfer. J. Biol. Chem. 273: 2317623182.
ZAHRT, T. C., and S. MALOY, 1997 Barriers to recombination between closely related bacteria: MutS and RecBCD inhibit recombination between Salmonella typhimurium and Salmonella typhi. Proc. Natl. Acad. Sci. USA 94: 97869791.
This article has been cited by other articles:
![]() |
J. A. Smith, L. A. Bannister, V. Bhattacharjee, Y. Wang, B. C. Waldman, and A. S. Waldman Accurate Homologous Recombination Is a Prominent Double-Strand Break Repair Pathway in Mammalian Chromosomes and Is Modulated by Mismatch Repair Protein Msh2 Mol. Cell. Biol., November 15, 2007; 27(22): 7816 - 7827. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Saydam, R. Kanagaraj, T. Dietschy, P. L. Garcia, J. Pena-Diaz, I. Shevelev, I. Stagljar, and P. Janscak Physical and functional interactions between Werner syndrome helicase and mismatch-repair initiation factors Nucleic Acids Res., September 27, 2007; 35(17): 5706 - 5716. [Abstract] [Full Text] |