- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Chen, C. Z.
- Articles by Collins, R. N.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Chen, C. Z.
- Articles by Collins, R. N.
Genetics, Vol. 168, 1827-1841, December 2004, Copyright © 2004
doi:10.1534/genetics.104.032888
Genetic Analysis of Yeast Yip1p Function Reveals a Requirement for Golgi-Localized Rab Proteins and Rab-Guanine Nucleotide Dissociation Inhibitor
Catherine Z. Chen*,
Monica Calero*,
Carol J. DeRegis*,
Matthew Heidtman
,
Charles Barlowe
and
Ruth N. Collins*,1
* Department of Molecular Medicine, Cornell University, Ithaca, New York 14853-6401
Department of Biochemistry, Dartmouth Medical School, Hanover, New Hampshire 03755
1 Corresponding author: Department of Molecular Medicine, Cornell University, Ithaca, NY 14853-6401.
E-mail: rnc8{at}cornell.edu
Yip1p is the first identified Rab-interacting membrane protein and the founder member of the YIP1 family, with both orthologs and paralogs found in all eukaryotic genomes. The exact role of Yip1p is unclear; YIP1 is an essential gene and defective alleles severely disrupt membrane transport and inhibit ER vesicle budding. Yip1p has the ability to physically interact with Rab proteins and the nature of this interaction has led to suggestions that Yip1p may function in the process by which Rab proteins translocate between cytosol and membranes. In this study we have investigated the physiological requirements for Yip1p action. Yip1p function requires Rab-GDI and Rab proteins, and several mutations that abrogate Yip1p function lack Rab-interacting capability. We have previously shown that Yip1p in detergent extracts has the capability to physically interact with Rab proteins in a promiscuous manner; however, a genetic analysis that covers every yeast Rab reveals that the Rab requirement in vivo is exclusively confined to a subset of Rab proteins that are localized to the Golgi apparatus.
RAS superfamily members have proven to be critical players in a variety of fundamental cellular processes, which they influence by modulation of their GTP binding and hydrolysis cycle. These small GTPases are commonly found to cycle between a cytosolic pool and a membrane-associated pool where the activated GTPases recruit their downstream effectors. The highly hydrophobic geranylgeranyl groups of Rho and Rab GTPases render them energetically unfavorable to partition into the cytosol as individual monomers. Cytosolic Rho and Rab proteins exist in a high-affinity dimeric complex with guanine nucleotide dissociation inhibitor (GDI) proteins (OLOFSSON 1999; ALORY and BALCH 2001). These GDI.GTPase complexes represent an inactive cytosolic reservoir of the GTPase and GDI must be induced to release its GTPase at a membrane site to enable cells to draw upon this reservoir. Mechanisms that promote GDI displacement and help recruit GTPases onto membranes are of great importance because such mechanisms will determine where and when the GTPases are activated. Possible candidates for a role in Rab protein membrane recruitment include the Rab-interacting YIP1 family of membrane proteins. Certainly the YIP1 family possess features that suggest a capability for participation in Rab membrane recruitment; they are capable of biochemical interaction with a variety of Rab proteins in a manner dependent on COOH-terminal prenylation (CALERO et al. 2002) and so might compete with Rab-GDI for Rab protein interactions in vivo.
YIP1 is an essential gene in Saccharomyces cerevsiae and extremely well conserved in evolution; the human ortholog can fully replace loss of the yeast gene (CALERO et al. 2003). In cellular lysates, Yip1p is capable of promiscuous interaction with Rab proteins, with a specific requirement for the double prenylation motif contained at the COOH termini that is one of the defining features of the Rab protein family. Recent studies combining in vitro reconstitution and cell biological and genetic analyses have demonstrated that Yip1p functions at an early stage in ER vesicle budding (BARROWMAN et al. 2003; HEIDTMAN et al. 2003). This function of Yip1p is difficult to reconcile with its connection to Rab proteins. Although Rab proteins are required for vesicle budding and cargo selection in several systems, it is possible to form fusion-competent transport vesicles from the ER in the absence of Ypt1p function, the Rab protein thought to regulate this particular transport step in vivo (CAO and BARLOWE 2000). Moreover, it is not known if Yip1p action in vivo requires Rab proteins, leaving open to question the apparent significance of the biochemical interactions observed between these proteins.
In this study we sought to further understand the two aspects of Yip1p function and determine if the interaction of Yip1p with Rab proteins is biologically significant. We report that there is a physiological requirement for Rab protein function in Yip1p action. We find that Rab-GDI and a critical subset of Rab proteins are crucial for the action of Yip1p and, moreover, that mutations in Yip1p that impact vesicle budding have lost the ability to interact with Rab proteins. A genetic analysis, comprising every Rab gene identified in S. cerevisiae, reveals that the requirement for Rab proteins is apparently confined to a subset of Rab proteins that operate at the level of the Golgi apparatus. In the DISCUSSION, we suggest hypotheses to reconcile in light of our discovery of roles for Yip1p on both Golgi and ER membranes.
Yeast strains and plasmid constructs:
The S. cerevisiae strains and plasmids used in these studies are listed in Table 1. For all plasmid shuffle experiments, plates used were synthetic complete media containing 1.5 mg/ml 5-fluoroorotic acid (5-FOA). To create the yip1
tester strains RCY1610 and RCY1612, a KANMX module (WACH et al. 1994) was PCR amplified with S1YIP1 (5' GCTACAAATTGGACGGGAAGTACTGCAAGACAACTATTAGTCCCTCTCGAGCGTACGCTGCAGGTCGAC 3') and S2YIP1 (5' GTTCAGAAAAACATATATACAAATATCGCCCCTAAGCCAATTCCCTTCAATCGATGAATTCGAGCTCG 3') primers (WACH et al. 1994). Site-directed deletions were carried out in a BY24 diploid strain to precisely eliminate the YIP1 ORF. Genomic PCR using internal deletion primers RNC228 (5' CTATGGAACTGCCTCGGTGA 3') and RNC263 (5' CAGAAACAACTCTGGCGCATC 3') paired with flanking primers YFYIP1 (5' CGGCCGCTCTAGAACTAGTGGATCCCGTATCTCGTTAGTACTTGTT 3')and YRYIP1 (5' TCACACAGGAAACAGCTATGACCATGAAGCTTGACCTTAGAGTACAGACGATG 3') was performed to check for correct integration of the KANMX cassette at both ends. Haploid yip1
strains were created after transformation with a URA3 YIP1 YCp50 plasmid (pRC1245). A gdi1
strain RCY883 was created in a similar fashion with the HIS3MX6 module (WACH et al. 1997) that was PCR amplified using primers S1GDI1 (5' TCCATCATAACTGTTAGTGAATAACCACTTATATAGCATAACACACGTACGCTGCAGGTC 3')and S2GDI1 (5' ACCCTCCAATTGCTGCTTTAGTCGTAAAGGTATGAATTTACTGATCGATGAATTCGAGCT 3'). Colonies were checked for correct HIS3MX6 integration via genomic PCR using primers 33942 (5' GCGATGGCAACGCTGA 3') and RNC233 (5' GACCATCATCGTGCTG 3') paired with flanking primers YFGDI1 (5' CGGCCGCTCTAGAACTAGTGGATCCCGTATCTCGTTAGTACTTGTT 3') and YRGDI1 (5' TACCGGGCCCCCCCTCGAGGTCGACAGACTGACAGTTATACCCAAG 3'). Haploid gdi1
strains were created after transformation with a GDI1 URA3 plasmid (pRC1052C) and sporulation. To obtain yip1
gdi1
double-deletion strains, RCY1612 was mated with RCY883 to create heterozygous yip1
and gdi1
diploids. The resulting diploid was plated on 5-FOA containing media to eliminate the URA3 plasmid, then transformed with plasmid pRC1908 containing both YIP1 and GDI1 cloned into pRS316, and sporulated to yield the yip1
gdi1
double-knockout strain RCY1718, as well as yip1
strains RCY1633 and RCY1634. Genomic PCR with primers CC14 (5' TGAGCGCTAGGAGTCACTGCC 3') and CC15 (5' TCGCTCAGTTCAGCCATAATATGAA 3') on RCY1718 confirmed the his3
200 auxotrophy in RCY1718. To create yip1
gdi1
double-knockout strains with additional auxotrophic markers, RCY1718 was mated to RCY1769. Both the gdi1
yip1
double-knockout strain RCY1880 and the yip1
single-knockout strain RCY2057 were isolated from this dissection. Strains for synthetic lethality analysis were constructed by mating yip1
tester strains with a strain bearing the mutant allele under consideration (Table 1). Diploids were sporulated to create a yip1
haploid strain that also contained the secondary gene defect. Copper-dependent protein expression was carried out using 281 bp from the CUP1 promoter region to drive the construct of interest. Induction was initiated with the addition of CuSO4 to the media. Plasmids are listed in Table 2.
|
|
Phenotypic analysis:
For analysis of each novel yip1 allele, at least two strains derived from independent transformants were examined. To analyze growth, nonlethal yip1 strains were plated onto YPD or YPD supplemented with 3% (vol/vol) formamide after passage on 5-FOA-containing media to eliminate the wild-type plasmid. Plates were incubated at 25°, 30°, 34°, and 37° for 3 days, at 15° for 11 days, and at 37° on YPD + 3% formamide for 5 days.
Yeast two-hybrid analysis:
The mutant yip1 sequences were subcloned into pACT2 for "prey" constructs and assayed with YIF1, YPT1, YPT31, or YPT32 as "bait" constructs in reporter yeast strain Y190. Due to variability in the Y2H system, two independently generated identical yip1 constructs were used to confirm interactions observed in our experiments. Plasmid pairs were cotransformed into the yeast strain and at least 30 independent colonies were assayed for ß-galactosidase activity. Filters were photographed using an Alpha Innotech DigiDoc system with Olympus C-4040 camera and settings of reflective white light, 15 msec exposure, and 105 mm zoom. ß-Galactosidase activity was quantified using ImageJ, a public domain National Institutes of Health imaging program (http://rsb.info.nih.gov/ij/), on a scale of 0255. Values plotted represent the mean difference between measurements taken on 10 colonies and background value.
Microscopy:
For fluorescence microscopy, the GFP NH2-terminal fusions of YIP1 and yip1 alleles were constructed in episomal vectors. Each construct contains 238 amino acids of yEGFP (CORMACK et al. 1997), fused to the start methionine of the tagged protein and preceded by a GGPGG linker. Cells containing GFP-fusion plasmids were examined with a Nikon Eclipse E600 equipped with a 60x objective and 1.5x optovar. A Spot-RT monochrome CCD camera with software version 3.5 was used for image capture. All images shown are representative images from cells during logarithmic phase growth in supplemented minimal media.
Western blotting:
Total cellular lysates were analyzed by SDS-PAGE and Western blotting onto BioTrace 0.45 µm polyvinylidene difluoride (Pall). Membranes were probed with MAB3580 anti-GFP antibody (Chemicon, Temecula, CA) at 1/6000 in Tris-buffered saline (TBS) containing 0.2% Tween-20 and 0.1% nonfat (NF)-milk to detect GFP-tagged proteins. Blots were developed with secondary alkaline phosphatase conjugated goat anti-mouse antibodies (Southern Biotechnology), diluted at 1/5000 in TBS with 0.2% Tween-20 and 5% NF-milk, followed by washing and chemiluminescent development with phenylphosphate substituted 1,2 dioxetane (CDP-Star; Perkin-Elmer, Norwalk, CT). To provide a membrane protein-loading control, blots were stripped with a 5-min incubation in 0.2 M NaOH and subsequently probed with monoclonal antibody 10D7 (Molecular Probes, Eugene, OR) against the membrane protein V-ATPase at a concentration of 0.25 µg/ml.
In vitro vesicle budding and transport assays:
Yeast semi-intact cells from wild-type and yip1 mutant strains were prepared as described (BAKER et al. 1988). Vesicle transport and budding assays following [35S]gp
f were carried out as previously described (BARLOWE 1997; CAO et al. 1998). For in vitro assays, data points are the average of duplicate determinations and the error bars represent the range. Mutagenesis of Yip1p reveals residues critical for function:
To define the minimal functional unit of Yip1p, we first performed Yip1p deletion analysis and discovered that we were able to delete approximately one-quarter of the protein with no detectable effect (Table 3). Progressive truncations revealed that the NH2-terminal 65 residues (Yip1p 248 residues total) were fully dispensable for growth. In contrast, a truncation of 18 residues at the COOH terminus resulted in a gene that was unable to complement a deletion of YIP1 (Table 3). These results defined a minimal functional unit consisting of 183 amino acids that could be used for more selective mutagenesis to identify critical residues.
|
As the basis of our mutagenesis study, we targeted residues that are conserved between human YIP1A and yeast YIP1. Our previous work has shown that the human sequence can functionally replace a deletion of yeast YIP1, indicating that a phylogenetic analysis would provide a rational approach for dissecting the molecular action of Yip1p (CALERO et al. 2003). An alignment of HsYIP1A and YIP1 is shown in Figure 1A. We also mutated each charged residue of Yip1p on the rationale that such residues have the highest probability of protein surface exposure and intermolecular contact; therefore their mutation is less likely to perturb the overall protein fold (CHOTHIA 1976). Silent restriction enzyme sites were included where possible to facilitate diagnostic analysis during mutant construct creation and verified with DNA sequencing. Constructs were transformed into the haploid yip1
tester strain (RCY1610) and streaked onto 5-FOA-containing media at 25° to assess for functionality in comparison to yeast transformed with empty vector as a negative control and with wild-type YIP1 as a positive control. Viable mutant yip1 constructs were tested on rich media at a range of temperatures and on YPD containing 3% formamide. The yip1-4 allele (E70K) has been described previously (CALERO et al. 2003). The yip1-2 allele was described as thermosensitive by Gallwitz and co-workers (YANG et al. 1998); however, it was found to be wild type on rich media when recreated in our strain background.
|
An overview of the mutagenesis data are shown in Figure 1B together with a detailed summary of our site-directed mutagenesis in Table 3. Of these mutants, three point mutants (yip1-41, yip1-9, yip1-19) were found to be recessive null mutants, one (yip1-6, Figure 1C) was a dominant-negative null allele, four (yip1-4, yip1-40, yip1-14, yip1-42; Figure 2A) were thermosensitive, and three alleles (yip1-43, yip1-12, yip1-2) were sensitive to formamide at 37°. The conditional temperature for the yip1-40 allele on YPD is 37° and 40° for yip1-42, whereas the yip1-4 allele is viable at 25° but lethal at 34° on rich media. Glutamic acid at position 70 is particularly interesting, because it is thermosensitive when mutated to a lysine or valine, lethal when mutated to glycine, and has a small effect when mutated to alanine. Glycine can be characterized as a "flexible" amino acid and might therefore disrupt secondary structure of Yip1p when inserted at position 70 (FERSHT 1999). However, the reason that a lysine at position 70 can substitute for glutamic acid, which is of opposite charge, was unclear. During the course of these studies, a conditional lethal allele of yip1, yip1-3, was reported by Ferro-Novick and colleagues (BARROWMAN et al. 2003). This allele was generated by random mutagenesis and contains four mutations that include a glycine residue at position 70. Knowing that E70G was a lethal mutation, we reasoned that one of the other mutations of yip1-3 must represent a second-site intragenic suppressor. Our attention was drawn to the residue at position 130 because this residue is conserved among Yip1p orthologs (Figure 1A). Figure 2B shows that cells bearing the double-mutation E70G, K130A are viable, although conditional lethal. These data demonstrate that residue 130 is in fact a suppressor of a lethal mutation at position 70, suggesting that the two residues directly or indirectly interact. Because the naturally occurring amino acids in positions 70 and 130 are of opposite charge, we sought to determine if they form a charge pair in the Yip1p tertiary structure. Although the single point mutation K130E was innocuous, with no apparent phenotype, charge reversal of both amino acids simultaneously gave a lethal phenotype (Figure 2B), leading us to conclude that these two residues interact only indirectly to contribute to the functionality of Yip1p.
|
Expression and localization of defective yip1 alleles:
To determine whether the growth defects associated with each yip1 allele are attributable to aberrant Yip1p levels, we analyzed whole-cell lysates expressing the GFP-tagged yip1 alleles with an affinity-purified antibody that recognizes GFP. Of the temperature conditional-lethal haploid yip1 strains, none displayed aberrant Yip1p levels at the permissive temperature (Figure 3A) or upon shift to restrictive temperature for a period of time known to be sufficient to elicit a terminal phenotype (Table 3 and our unpublished results). Of the null alleles, yip1-9 has reduced Yip1p levels with respect to a wild-type control strain at 25° (Figure 3A). Both yip1-9 and yip1-19 migrate at a faster rate than the wild-type Yip1p (Figure 3A), indicative of protein degradation, which would result in a defective protein with a null phenotype. The lack of correlation between Yip1p levels and the phenotypes of the conditional mutant strains indicates that the observed phenotypes are not due to altered Yip1p levels but result from defective Yip1p-protein interactions.
|
A combination of subcellular fractionation and in vivo fluorescence experiments has previously established that Yip1p cycles between the ER and the Golgi (HEIDTMAN et al. 2003). Because GFP-tagged Yip1p is fully functional as the sole cellular copy of Yip1p, indicating that the use of this tag does not impair function (HEIDTMAN et al. 2003), we GFP tagged the yip1 mutant alleles to determine their steady-state localization in live cells. To make comparisons between different constructs, both null alleles and alleles able to function at single copy were expressed at single copy in a background containing a wild-type copy of YIP1. The results of this analysis are shown in Figure 3B. GFP-yip1
N65, -yip1-4, -yip1-40, and -yip1-6 all showed localization similar to that previously established for the wild-type protein, namely numerous fluorescent Golgi puncta and nuclear rim staining indicative of ER, demonstrating that these yip1 alleles can be normally packaged into vesicles and delivered to the Golgi. The null alleles GFP-yip1-19 and -yip1-9 were not informative in this analysis as their expression level appeared somewhat reduced compared to wild type and they showed a diffuse cytoplasmic staining suggestive of incorrectly folded or membrane inserted proteins (Figure 3B) targeted for degradation, consistent with their apparent migration in SDS-PAGE gels (Figure 3A).
Directed test of yip1 suppression with high-copy plasmids:
To establish the possible sequence of events in which Yip1p functions, we asked if a yip1 mutant could be suppressed by multi-copy plasmids encoding several candidate genes, which may act in conjunction with YIP1.The mouse homolog of Yip1p, Yip1A, is localized to ER exit sites and vesicular-tubular structures, which carry cargo to the Golgi (TANG et al. 2001). Overexpression of the cytoplasmic portion of Yip1A inhibits transport of vesicular stomatitis virus envelope glycoprotein and physically associates with the mammalian Sec23 and Sec24 proteins (TANG et al. 2001). A conserved domain at the NH2 terminus of Yip1A is required for its interaction with Sec23p/Sec24p, and it is a residue in this domain that is mutated in the thermosensitive allele yip1-4. Sec23p and Sec24p are components of the COPII coat complex and are found in a heteromeric complex (BARLOWE 2002a,b). In contrast to the results obtained with mammalian YIP1A, we find no dominant-negative effect with overexpression of the cytoplasmic portion (data not shown). SEC23 and SEC24 had no effect on the growth of yip1-4 when expressed either singly or simultaneously from multi-copy plasmids.
Mutants defective in vesicle budding from the ER such as sec12 and sec23 appear to activate the unfolded protein response (BELDEN and BARLOWE 2001) and can be suppressed by IRE1 or activated HAC1 (HIGASHIO and KOHNO 2002; SATO et al. 2002). Yip1p has been implicated in ER vesicle budding and yip1-4 shows selective genetic interactions with this same subgroup of secretory genes; however, yip1-4 cannot be suppressed by activated HAC1, indicating that the role of Yip1p in ER vesicle biogenesis is distinct from that of COPII coat.
We also tested (i) multi-copy plasmids encoding Rab genes, (ii) plasmids encoding other proteins known to potentially interact with Yip1p, and (iii) the other YIP1 family paralogs in yeast, YIF1, YIP4, and YIP5 (CALERO et al. 2002). The former were selected on the basis that genes encoding interacting proteins may sometimes suppress defective alleles when overexpressed and the latter were selected to test possible functional overlap among YIP1 family members within a single organism. No genes in this deliberate suppression testing showed any level of suppression of yip1-4 (Table 3). These data indicate that the yip1-4 allele is defective in a unique function of Yip1p. The yip1-4 defect cannot be bypassed by other YIP1 family members, nor is Yip1p acting upstream of Rab proteins. In addition, other proteins reported to physically associate with Yip1p, namely Yop1p and Yip3p (CALERO et al. 2001, 2002), cannot restore the functionality lacking in the yip1-4 single point mutation.
Genetic analysis of yip1-4 reveals interaction with Rab and GDI mutants:
Yip1p binds to Rab proteins in cellular lysates with little discrimination (CALERO et al. 2002, 2003) and is also required for COPII vesicle biogenesis (HEIDTMAN et al. 2003), a process in which in vitro reconstitution studies have shown that Rab proteins do not play critical roles (CAO and BARLOWE 2000). To address this puzzle, we initiated a genetic analysis to determine if Rab genes are necessary for Yip1p function. In the secretory pathway, several analyses have demonstrated synthetic genetic interactions to be largely stage specific (KAISER and SCHEKMAN 1990; FINGER and NOVICK 2000). Even within the ER-to-Golgi stage of transport, genetic interactions occur among those mutations affected in vesicle budding from the ER or among mutants affected in fusion of ER-derived vesicles with the Golgi, but not between the two classes of mutations (KAISER and SCHEKMAN 1990). We have already made use of this approach to establish a role for YIP1 in the biogenesis of COPII vesicles from the ER (HEIDTMAN et al. 2003). In these experiments, we wished to evaluate the physiological relevance of Rab proteins for Yip1p function. We examined mutant alleles of Rab genes and also genes encoding proteins that regulate the function of Rab proteins, such as GTPase activators (GAPs) and guanine nucleotide exchange factors (GEFs; COLLINS 2003).
yip1-4 is especially suited for genetic studies as this mutant does not show revertants and is thermosensitive for growth over a wide range of temperatures and the protein product is stable at restrictive temperature. For each mutant tested, we created a strain with a deleted genomic copy of YIP1 together with a wild-type copy of YIP1 on an episomal URA3 plasmid that can be counterselected with the drug 5-FOA. Each strain was transformed with plasmids containing: (1) a yip1ts allele, (2) a YIP1 wild-type plasmid, or (3) a no-insert control plasmid. The resulting transformants were plated onto 5-FOA-containing media to determine if the double mutant was viable. The advantages of such an assay are that (i) several hundred double-mutant colonies can be analyzed on a single plate (see Figure 4A); (ii) comparisons are made in isogenic strains where the mutant or wild-type allele is introduced on an episomal plasmid, avoiding the necessity of multiple backcrosses to compare mutations from two different strain backgrounds; and (iii) the assay is flexible, so the impact of several different alleles can be tested simultaneously. Figure 4A shows the synthetic interaction assay with cells grown on plates. Synthetic interactions are revealed by the lack of growth in the presence of 5-FOA in the plate media with ypt31
yip1-4, ypt32A134D yip1-4 double mutants as examples of complete lethality between two mutants and with vps21
yip1-4, sec4-8 yip1-4, ypt11
yip1-4 double mutants shown by comparison as examples of specificity controls where no genetic interaction was observed. Figure 4B demonstrates comparisons with several different yip1 alleles simultaneously. In this example, genetic interactions are examined between ypt1A136D and several defective yip1 alleles. Only yip1-4 shows synthetic lethal interactions with ypt1A136D. Of the other conditional yip1 alleles, only yip1-42 appears to have a detrimental effect with the double mutant slightly sicker than the wild-type control. This rapid analysis of several alleles simultaneously helps to understand any genetic interactions observed, allowing one to dissect the individual contributions of various regions of the protein to overall function.
|
To provide a complete analysis, we investigated genetic interactions between yip1-4 and each Rab ORF identified in the yeast genome. There are 11 Rab genes in the complete S. cerevisiae genome (GARCIA-RANEA and VALENCIA 1998). Table 4 summarizes our analysis of genetic interactions between Rab-encoding genes and yip1. No synthetic lethality was observed with sec4-8, ypt10
, ypt11
, vps21
, ypt52
, ypt53
, or ypt7
. In contrast, synthetic lethality was observed with ypt1A136D, ypt31
, ypt6
, and ypt32A134D. The ypt1A136D allele confers a very tight block of growth at 37° without any defect at permissive temperature (JEDD et al. 1995); we also observed deleterious genetic interactions with another ypt1 allele, ypt1-3. Ypt1p, Ypt31/32p, and Ypt6p all operate in different membrane trafficking pathways: Ypt1p in ER to Golgi and early Golgi transport, Ypt31/32p in intra-Golgi and Golgi to vacuole transport (BENLI et al. 1996; JEDD et al. 1997), and Ypt6p in retrograde Golgi transport (LUO and GALLWITZ 2003). The feature that all these proteins have in common and that distinguishes them from the Rab genes that are not synthetically lethal with yip1-4 is that they are localized to the Golgi apparatus at steady-state levels. These data suggest that Yip1p action in vivo does indeed require Rab protein functionality and that this requirement is confined to a subset of Rab proteins that act at the Golgi apparatus.
|
Because of the known dependence of Yip1p-Rab protein interactions on prenylation (CALERO et al. 2003), we also examined the influence of defects in the prenyl machinery on yip1-4 using a mutant allele of the geranylgeranyl transferase, bet2-1 (ROSSI et al. 1991). Because yip1 defects also cause ER membrane proliferation, we examined interactions with opi1
and sec14ts, proteins involved in phospholipid metabolism that interact with or regulate other secretory pathway genes (HENRY and PATTON-VOGT 1998; CARMAN and HENRY 1999; LI et al. 2000). These mutants were negative for genetic interactions with yip1-4, as was sec7-1, an ADP-ribosylation factor exchange factor with profound effects on Golgi structure (RAMBOURG et al. 1993; Table 4). Genetic interactions between yip1-4 and known Rab regulators were also analyzed. As for other small GTPase superfamily members, Rab regulators modulate the GTPase nucleotide cycle or interact with the GTPase at defined stages and can be assigned to defined classes such as effectors, GEFs, and GAPs. We focused on Ypt1p because our previous work has established a synthetic lethal relationship between yip1-4 and uso1-1, which encodes a yeast homolog of p115, a Rab1 effector (ALLAN et al. 2000), and because both GEF and GAP proteins have been identified for this Rab protein. Mutations in BET3, the Ypt1p GEF (JONES et al. 2000; WANG et al. 2000) or Gyp1p, the GAP protein for Ypt1p (DU and NOVICK 2001), had no effect in combination with yip1-4, and neither did sec2-41, a mutant allele of the GEF for Sec4p, a close homolog of Ypt1p (WALCH-SOLIMENA et al. 1997).
We also tested mutant alleles of Rab-GDI in combination with yip1-4. Rab-GDI is involved in the membrane retrieval and attachment of Rab proteins (see Introduction) and is encoded in S. cerevisiae by the single gene GDI1. Both gdi1-11 and gdi1-29 were generated by random mutagenesis of GDI1 and have been proposed to be defective in the GDI-mediated extraction and loading of Rab proteins, respectively (GILBERT and BURD 2001). We were unable to recreate the gdi1-29 allele in a YIP1 tester strain and conclude that the strain bearing this allele grows with adaptations that unfortunately make it unsuitable for genetic analyses. However, the gdi1-11 mutant allele was lethal in combination with yip1-4 (Table 4). These data indicate that Yip1p action in vivo intersects with the activity of Rab-GDI and supports the suggestion that these two proteins act in a common pathway to influence Rab protein function.
To directly address the issue of whether Yip1p works in conjunction with Rab proteins or COPII proteins, we made a series of genetic crosses using the novel mutant alleles of yip1. Our results are summarized in Table 5. We found that the new alleles of yip1 failed to show synthetic lethality with the Rab mutants while still retaining synthetic lethality with the COPII mutants. Conversely, however, we did not find any yip1 alleles that showed synthetic lethality selectively with Rab GTPases and not with COPII mutants. Strikingly, every conditional yip1 allele tested showed synthetic lethality with the COPII mutant sec13-1. These data provide additional support for Yip1p acting in the COPII vesicle biogenesis pathway and also suggest that the action of Yip1p on Golgi Rab proteins cannot be distinguished from its role in COPII vesicle biogenesis.
|
Interaction analysis of yip1 alleles with Rab proteins:
To further investigate the basis of Rab and Yip1p interaction, we asked if the yip1 mutant alleles still retained an ability to interact with Rab proteins. For this test, we determined the ability of each yip1 mutant to interact with Rab proteins by yeast two hybrid (Y2H). Previous work from our laboratory has demonstrated that Yip1p Y2H assays reflect protein interactions that can be recapitulated in pull-down experiments from yeast lysates and represent a valid method for analysis of Yip1p-protein interactions (CALERO et al. 2002, 2003). We tested interactions between yip1 mutant alleles and the Rab proteins Ypt1p and Ypt31p, which our genetic analysis had shown to be physiologically relevant binding partners, and Yif1p, a YIP1 family member that binds Yip1p (MATERN et al. 2000; CALERO et al. 2002). For each mutant allele, we tested two independently created constructs as we have previously observed slight variations between individual constructs in this system. The results of this experiment are shown in Figure 5, where yip1 alleles containing mutations in the NH2 terminus are indicated by shaded bars and COOH-terminal alleles are indicated by solid bars (see Figure 1B for a representation of Yip1p domains). Rab proteins showed robust interactions with the positive control of wild-type Yip1p. In contrast, a subset of mutant yip1 alleles with diminished or abrogated yip1 function did not display Rab protein interactions. Diminished Rab protein interaction correlated strongly with point mutations in the hydrophobic COOH terminus of the protein. In contrast, point mutants in the hydrophobic COOH-terminal region still showed an ability to interact with Yif1p. All interactions required the COOH-terminal 18 amino acids that are critical for function (Table 3), and the only point mutant that showed no interaction for both Rab proteins and Yif1p was the null allele yip1-41. All other alleles of yip1 with point mutations in the NH2 terminus showed some level of interaction with Rab proteins, with the exception being the thermosensitive allele yip1-42 and the null mutant yip1-41 where no interaction with Rab proteins could be detected.
|
yip1-40 and yip1-42 cells display a defect in COPII vesicle budding in vitro:
To further investigate the correlation among Rab protein interaction, genetic analysis, and ER vesicle biogenesis, we examined the ability of membranes from yip1 mutant cells to produce COPII vesicles in vitro. For this purpose, we investigated the two mutant alleles yip1-40 and yip1-42 because these mutants show differences in Rab protein interaction and neither of these mutant alleles is defective in Yif1p interaction (Figure 5). As shown in Figure 6, yip1-40 exhibited a very mild defect and yip1-42 exhibited a significant defect in transport of [35S]gp
f to the Golgi complex in comparison to an isogenic wild-type strain at 23°. Specifically, the yip1-42 membranes displayed a reduction in [35S]gp
f transport that was
40% of the wild-type level. To identify the stage at which transport was compromised, we examined the ability of the yip1-42 strain to bud COPII vesicles (Figure 6C). We observed that upon the addition of COPII proteins, the wild-type membranes budded vesicles at an efficiency of 43%, whereas the yip1-42 membranes budded vesicles at an efficiency of only
11%. These data indicate that the transport defect in the yip1-42 strain, as previously observed for yip1-4 mutant strains (HEIDTMAN et al. 2003), is a defect in ER vesicle budding. Moreover, from an analysis of these two mutants, where yip1-40 has minimal and yip1-42 has severe defects in Rab protein interaction, it would appear that no distinction can be made between ER vesicle budding and Rab protein interaction. The degree of defect in ER vesicle budding thus appears to correlate with the Rab-interacting ability of the mutant allele.
|
Our data indicating that Yip1p is a factor that interacts with Golgi Rab proteins suggest that one site of action of Yip1p is at the Golgi complex. Previous studies have demonstrated that defects in Yip1p disrupt ER vesicle biogenesis (HEIDTMAN et al. 2003), a conclusion that is supported in this study with novel yip1 mutant alleles (Table 5). These results suggest two different models of Yip1p function, illustrated in Figure 7. One model is that Yip1p operates independently on both COPII vesicle biogenesis and Golgi Rab proteins. Another model is that Yip1p acts in a common pathway that involves both COPII vesicle proteins and Golgi Rab proteins. We favor the latter model for several reasons. First, after an extensive mutagenesis spanning the entire Yip1p protein, we were unable to generate any conditional allele that was selectively defective in either Golgi Rab or COPII gene interaction. Second, in vitro assays comparing membranes from yip1-40 and yip1-42 cells, two mutant alleles that share the same mutated residue (E70G with K130A in the case of yip1-40 and E70V in the case of yip1-42) indicate that the degree of severity of the ER vesicle biogenesis defect correlates positively with the ability to interact with Golgi Rab proteins by yeast two hybrid.
|
It may be that the cycling of Yip1p between the two compartments is critical for its function. Perhaps Golgi-localized Rab GTPases transmit a signal to Yip1p, a signal that Yip1p carries back to the ER. This signal in turn is required for the continued flow of membrane and material between the Golgi and the ER. Thus Yip1p may affect ER vesicle budding even though Yip1p is not part of the minimal machinery for COPII vesicles created in vitro with recombinant components (MATSUOKA et al. 1998). In this model, Yip1p is required for overall homeostasis of the anterograde and retrograde membrane-trafficking pathways, explaining why it appears to interact with Golgi Rab proteins that regulate diverse membrane-trafficking pathways. It is also possible that Yip1p may physically recycle a Rab protein back to the ER where, although the Rab protein does not participate in vesicle biogenesis, as an important component of vesicle targeting and fusion, it must be incorporated into the budding vesicle for downstream events. This is consistent with the model suggested by BARROWMAN et al. (2003), who propose that Yip1p is required for the fusion competence of ER-derived vesicles, and it makes sense that vesicle budding could be linked to its "programming" for targeting and fusion. In this respect, there appears to be a parallelism between Yip1p and Uso1p. Although Uso1p and its mammalian homolog p115 have a well-established function in tethering of ER-derived vesicles to the Golgi, it has been demonstrated more recently that Uso1p may have a second function of cargo sorting at the ER (ALLAN et al. 2000; MORSOMME and RIEZMAN 2002; KONDYLIS and RABOUILLE 2003). Thus cargo sorting, vesicle budding, targeting, and fusion in vivo may be more interconnected than previously appreciated, providing a precedent for Yip1p functionality on both the Golgi and the ER membranes.
Another possible hypothesis to reconcile the role of Yip1p in ER vesicle biogenesis and Golgi Rab action is to propose that Yip1p mediates interactions between SNARE and Rab proteins. However, there are no genetic interactions between Yip1p and various v- and t-SNARE proteins (sec22ts, bet1-1, bos1-1, sec5ts) operating in ER/Golgi transport or in genes involved in cis SNARE disassembly (sec17ts and sec18-1) although Yip1p has been reported to physically interact with the v-SNARE Bos1p in vitro (BARROWMAN et al. 2003). It is possible that Yip1p might "piggyback" on SNARE proteins to facilitate its transport between the ER and Golgi. No known COPII uptake signals are apparent on inspection of the primary amino acid sequence of Yip1p although recent discoveries demonstrating that the COPII coat has multiple independent sites of cargo recognition (MILLER et al. 2003; MOSSESSOVA et al. 2003) opens up the possibility that other sorting signals remain to be identified. It should be stressed that these are speculative models, many gaps remain in our understanding of YIP1 family function, and further studies are necessary to resolve these potential modes of Yip1p action.
Because Yip1p requires Rab proteins to be prenylated for productive interactions and defective alleles of yip1 also cause ER membrane accumulation, another possibility is that Yip1p influences membrane traffic through dysregulated lipid metabolism. However, no genetic interactions were observed between yip1-4 and opi1
or sec14ts and activated HAC1 is unable to suppress yip1-4 so we currently have no evidence that Yip1p plays a role in the interface between protein and lipid biogenesis in the secretory pathway or is involved in membrane proliferation.
A recent study has identified the mammalian Yip3 as a GDI-displacement factor for the Rab GTPase Rab9 (SIVARS et al. 2003). The yeast homolog of Yip3 has no sequence relationship with Yip1p; however, it does share several physical characteristics and the role of Yip1p as a possible GDI-displacement factor is very provocative. Because Yip1p is (i) a Rab-binding membrane protein, which (ii) recognizes the prenyl groups of Rab proteins and (iii) has no apparent nucleotide preference for the nucleotide-bound state of the Rab, we previously proposed that Yip1p can participate in the membrane retrieval pathway of Rab proteins from the cytosol. However, there is no apparent shift in membrane/cytosolic ratios of Rab proteins when a mild mutant allele of yip1 is examined by subcellular fractionation (BARROWMAN et al. 2003), although the yip1-4 allele has been found to mislocalize GFP-Ypt1p upon shift to restrictive temperature (CALERO et al. 2003). In this study, not only do we demonstrate that Rab proteins are required for the physiological function of Yip1p, but also we demonstrate complete synthetic lethality between yip1-4 and a mutant of Rab-GDI, gdi1-11. Taken together, these data support the idea that Yip1p and Rab-GDI participate in similar processes and are consistent with Yip1p as a potential candidate to participate in the process of Rab membrane attachment or detachment, although this remains to be proven. Yip1p on the ER may recruit the Ypt1p required for cargo sorting (MORSOMME and RIEZMAN 2002) and perform a similar task on the Golgi for Ypt6p and Ypt31/32p. Although it is clear that Rab proteins transit between membranes and cytosol, there may be a more complex cycle of membrane and organelle engagement than previously envisaged. For example, Ypt1p might be recruited onto Golgi membranes from the cytosol, travel on retrograde vesicles back to the ER, and not become released from membranes again until the ER-derived vesicle carrying Ypt1p docks at the Golgi. An analogy for these processes is suggested in the case of the small GTPase Ras, which has been recently appreciated to have a complex intracellular trafficking pathway that can be used for different regulatory purposes (BIVONA and PHILIPS 2003). In such a scenario, several different Rab-interacting factors might influence the organelle recruitment of Rab proteins (CALERO et al. 2003) at different stages in each round of membrane transport.
Further biochemical experiments will be required to understand the precise impact of Yip1p on the Rab GTPase cycle, the direct or indirect nature of the interactions between Yip1p and Rab proteins, and the relative role of Rab-GDI. Our studies provide a platform to direct future questions and the mutations we describe provide tools for continued genetic and biochemical studies aimed at understanding the precise function of Yip1p in cells.
AGUILERA, A., 1994 Formamide sensitivity: a novel conditional phenotype in yeast. Genetics 136: 8791.[Abstract]
ALLAN, B. B., B. D. MOYER and W. E. BALCH, 2000 Rab1 recruitment of p115 into a cis-SNARE complex: programming budding COPII vesicles for fusion. Science 289: 444448.
ALORY, C., and W. E. BALCH, 2001 Organization of the Rab-GDI/CHM superfamily: the functional basis for choroideremia disease. Traffic 2: 532543.[CrossRef][Medline]
BAKER, D., L. HICKE, M. REXACH, M. SCHLEYER and R. SCHEKMAN, 1988 Reconstitution of SEC gene product-dependent intercompartmental protein transport. Cell 54: 335344.[CrossRef][Medline]
BARLOWE, C., 1997 Coupled ER to Golgi transport reconstituted with purified cytosolic proteins. J. Cell Biol. 139: 10971108.
BARLOWE, C., 2002a COPII-dependent transport from the endoplasmic reticulum. Curr. Opin. Cell Biol. 14: 417422.[CrossRef][Medline]
BARLOWE, C., 2002b Three-dimensional structure of a COPII prebudding complex. Dev. Cell 3: 467468.[CrossRef][Medline]
BARROWMAN, J., W. WANG, Y. ZHANG and S. FERRO-NOVICK, 2003 The Yip1p.Yif1p complex is required for the fusion competence of endoplasmic reticulum-derived vesicles. J. Biol. Chem. 278: 1987819884.
BELDEN, W. J., and C. BARLOWE, 2001 Deletion of yeast p24 genes activates the unfolded protein response. Mol. Biol. Cell 12: 957969.
BENLI, M., F. DORING, D. G. ROBINSON, X. YANG and D. GALLWITZ, 1996 Two GTPase isoforms, Ypt31p and Ypt32p, are essential for Golgi function in yeast. EMBO J. 15: 64606475.[Medline]
BIVONA, T. G., and M. R. PHILIPS, 2003 Ras pathway signaling on endomembranes. Curr. Opin. Cell Biol. 15: 136142.[CrossRef][Medline]
CALERO, M., G. R. WHITTAKER and R. N. COLLINS, 2001 Yop1p, the yeast homolog of the polyposis locus protein 1, interacts with Yip1p and negatively regulates cell growth. J. Biol. Chem. 276: 1210012112.
CALERO, M., N. J. WINAND and R. N. COLLINS, 2002 Identification of the novel proteins Yip4p and Yip5p as Rab GTPase interacting factors. FEBS Lett. 515: 8998.[CrossRef][Medline]
CALERO, M., C. Z. CHEN, W. ZHU, N. WINAND, K. A. HAVAS et al., 2003 Dual prenylation is required for rab protein localization and function. Mol. Biol. Cell 14: 18521867.
CAO, X., and C. BARLOWE, 2000 Asymmetric requirements for a Rab GTPase and SNARE proteins in fusion of COPII vesicles with acceptor membranes. J. Cell Biol. 149: 5566.
CAO, X., N. BALLEW and C. BARLOWE, 1998 Initial docking of ER-derived vesicles requires Uso1p and Ypt1p but is independent of SNARE proteins. EMBO J. 17: 21562165.[CrossRef][Medline]
CARMAN, G. M., and S. A. HENRY, 1999 Phospholipid biosynthesis in the yeast Saccharomyces cerevisiae and interrelationship with other metabolic processes. Prog. Lipid Res. 38: 361399.[CrossRef][Medline]
CHOTHIA, C., 1976 The nature of the accessible and buried surfaces in proteins. J. Mol. Biol. 105: 112.[CrossRef][Medline]
COLLINS, R. N., 2003 Rab and ARF GTPase regulation of exocytosis. Mol. Membr. Biol. 20: 105115.[CrossRef][Medline]
CORMACK, B. P., G. BERTRAM, M. EGERTON, N. A. GOW, S. FALKOW et al., 1997 Yeast-enhanced green fluorescent protein (yEGFP): a reporter of gene expression in Candida albicans. Microbiology 143(Pt 2): 303311.[Abstract]
DU, L. L., and P. NOVICK, 2001 Yeast Rab GTPase-activating protein Gyp1p localizes to the Golgi apparatus and is a negative regulator of Ypt1p. Mol. Biol. Cell 12: 12151226.
FERSHT, A., 1999 Structure and Mechanism in Protein Science: A Guide to Enzyme Catalysis and Protein Folding. W. H. Freeman, San Francisco.
FINGER, F. P., and P. NOVICK, 2000 Synthetic interactions of the post-Golgi sec mutations of Saccharomyces cerevisiae. Genetics 156: 943951.
GARCIA-RANEA, J. A., and A. VALENCIA, 1998 Distribution and functional diversification of the Ras superfamily in Saccharomyces cerevisiae. FEBS Lett. 434: 219225.[CrossRef][Medline]
GILBERT, P. M., and C. G. BURD, 2001 GDP dissociation inhibitor domain II required for Rab GTPase recycling. J. Biol. Chem. 276: 80148020.
HARTMAN, J. L. IV, B. GARVIK and L. HARTWELL, 2001 Principles for the buffering of genetic variation. Science 291: 10011004.
HEIDTMAN, M., C. Z. CHEN, R. N. COLLINS and C. BARLOWE, 2003 A role for Yip1p in COPII vesicle biogenesis. J. Cell Biol. 163: 5769.
HENRY, S. A., and J. L. PATTON-VOGT, 1998 Genetic regulation of phospholipid metabolism: yeast as a model eukaryote. Prog. Nucleic Acid Res. Mol. Biol. 61: 133179.[Medline]
HIGASHIO, H., and K. KOHNO, 2002 A genetic link between the unfolded protein response and vesicle formation from the endoplasmic reticulum. Biochem. Biophys. Res. Commun. 296: 568574.[CrossRef][Medline]
JAYASINGHE, S., K. HRISTOVA and S. H. WHITE, 2001 Energetics, stability, and prediction of transmembrane helices. J. Mol. Biol. 312: 927934.[CrossRef][Medline]
JEDD, G., C. RICHARDSON, R. LITT and N. SEGEV, 1995 The Ypt1 GTPase is essential for the first two steps of the yeast secretory pathway. J. Cell Biol. 131: 583590.
JEDD, G., J. MULHOLLAND and N. SEGEV, 1997 Two new Ypt GTPases are required for exit from the yeast trans-Golgi compartment. J. Cell Biol. 137: 563580.
JONES, S., C. NEWMAN, F. LIU and N. SEGEV, 2000 The TRAPP complex is a nucleotide exchanger for Ypt1 and Ypt31/32. Mol. Biol. Cell 11: 44034411.
KAISER, C. A., and R. SCHEKMAN, 1990 Distinct sets of SEC genes govern transport vesicle formation and fusion early in the secretory pathway. Cell 61: 723733.[CrossRef][Medline]
KONDYLIS, V., and C. RABOUILLE, 2003 A novel role for dp115 in the organization of tER sites in Drosophila. J. Cell Biol. 162: 185198.
LAZAR, T., M. GOTTE and D. GALLWITZ, 1997 Vesicular transport: How many Ypt/Rab-GTPases make a eukaryotic cell? Trends Biochem. Sci. 22: 468472.[CrossRef][Medline]
LI, X., Z. XIE and V. A. BANKAITIS, 2000 Phosphatidylinositol/phosphatidylcholine transfer proteins in yeast. Biochim. Biophys. Acta 1486: 5571.[Medline]
LUO, Z., and D. GALLWITZ, 2003 Biochemical and genetic evidence for the involvement of yeast Ypt6-GTPase in protein retrieval to different Golgi compartments. J. Biol. Chem. 278: 791799.
MATERN, H., X. YANG, E. ANDRULIS, R. STERNGLANZ, H. H. TREPTE et al., 2000 A novel Golgi membrane protein is part of a GTPase-binding protein complex involved in vesicle targeting. EMBO J. 19: 44854492.[CrossRef][Medline]
MATSUOKA, K., L. ORCI, M. AMHERDT, S. Y. BEDNAREK, S. HAMAMOTO et al., 1998 COPII-coated vesicle formation reconstituted with purified coat proteins and chemically defined liposomes. Cell 93: 263275.[CrossRef][Medline]
MILLER, E. A., T. H. BEILHARZ, P. N. MALKUS, M. C. LEE, S. HAMAMOTO et al., 2003 Multiple cargo binding sites on the COPII subunit Sec24p ensure capture of diverse membrane proteins into transport vesicles. Cell 114: 497509.[CrossRef][Medline]
MORSOMME, P., and H. RIEZMAN, 2002 The Rab GTPase Ypt1p and tethering factors couple protein sorting at the ER to vesicle targeting to the Golgi apparatus. Dev. Cell 2: 307317.[CrossRef][Medline]
MOSSESSOVA, E., L. C. BICKFORD and J. GOLDBERG, 2003 SNARE selectivity of the COPII coat. Cell 114: 483495.[CrossRef][Medline]
OLOFSSON, B., 1999 Rho guanine dissociation inhibitors: pivotal molecules in cellular signalling. Cell. Signal. 11: 545554.[CrossRef][Medline]
PFEFFER, S. R., 2001 Rab GTPases: specifying and deciphering organelle identity and function. Trends Cell Biol. 11: 487491.[CrossRef][Medline]
RAMBOURG, A., Y. CLERMONT and F. KEPES, 1993 Modulation of the Golgi apparatus in Saccharomyces cerevisiae sec7 mutants as seen by three-dimensional electron microscopy. Anat. Rec. 237: 441452.[CrossRef][Medline]
ROSSI, G., J. A. YU, A. P. NEWMAN and S. FERRO-NOVICK, 1991 Dependence of Ypt1 and Sec4 membrane attachment on Bet2. Nature 351: 158161.[CrossRef][Medline]
SATO, M., K. SATO and A. NAKANO, 2002 Evidence for the intimate relationship between vesicle budding from the ER and the unfolded protein response. Biochem. Biophys. Res. Commun. 296: 560567.[CrossRef][Medline]
SEGEV, N., 2001a Ypt and Rab GTPases: insight into functions through novel interactions. Curr. Opin. Cell Biol. 13: 500511.[CrossRef][Medline]
SEGEV, N., 2001b Ypt/Rab GTPases: regulators of protein trafficking. Sci. STKE 2001: RE11.
SIVARS, U., D. ALVAZIAN and S. R. PFEFFER, 2003 Yip3 catalyses the dissociation of endosomal Rab-GDI complexes. Nature 425: 856859.[CrossRef][Medline]
SMYTHE, E., 2002 Direct interactions between rab GTPases and cargo. Mol. Cell 9: 205206.[CrossRef][Medline]
TANG, B. L., Y. S. ONG, B. HUANG, S. WEI, E. T. WONG et al., 2001 A membrane protein enriched in endoplasmic reticulum exit sites interacts with COPII. J. Biol. Chem. 276: 4000840017.
WACH, A., A. BRACHAT, R. POHLMANN and P. PHILIPPSEN, 1994 New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10: 17931808.[CrossRef][Medline]
WACH, A., A. BRACHAT, C. ALBERTI-SEGUI, C. REBISCHUNG and P. PHILIPPSEN, 1997 Heterologous HIS3 marker and GFP reporter modules for PCR-targeting in Saccharomyces cerevisiae. Yeast 13: 10651075.[CrossRef][Medline]
WALCH-SOLIMENA, C., R. N. COLLINS and P. J. NOVICK, 1997 Sec2p mediates nucleotide exchange on Sec4p and is involved in polarized delivery of post-Golgi vesicles. J. Cell Biol. 137: 14951509.
WANG, W., M. SACHER and S. FERRO-NOVICK, 2000 TRAPP stimulates guanine nucleotide exchange on Ypt1p. J. Cell Biol. 151: 289296.
WHITE, S. H., and W. C. WIMLEY, 1999 Membrane protein folding and stability: physical principles. Annu. Rev. Biophys. Biomol. Struct. 28: 319365.[CrossRef][Medline]
YANG, X., H. T. MATERN and D. GALLWITZ, 1998 Specific binding to a novel and essential Golgi membrane protein (Yip1p) functionally links the transport GTPases Ypt1p and Ypt31p. EMBO J. 17: 49544963.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
M. Heidtman, C. Z. Chen, R. N. Collins, and C. Barlowe Yos1p Is a Novel Subunit of the Yip1p-Yif1p Complex and Is Required for Transport between the Endoplasmic Reticulum and the Golgi Complex Mol. Biol. Cell, April 1, 2005; 16(4): 1673 - 1683. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire







