The DNA damage response is a protective mechanism that ensures the maintenance of genomic integrity. We have used Aspergillus nidulans as a model system to characterize the DNA damage response caused by the antitopoisomerase I drug, camptothecin. We report the molecular characterization of a p34^Cdc2-related gene, npkA, from A. nidulans. The npkA gene is transcriptionally induced by camptothecin and other DNA-damaging agents, and its induction in the presence of camptothecin is dependent on the uvsB^ATR gene. There were no growth defects, changes in developmental patterns, increased sensitivity to DNA-damaging agents, or effects on septation or growth rate in the A. nidulans npkA deletion strain. However, the npkA mutation can partially suppress HU sensitivity caused by the uvsB^ATR and uvsD153^ATRIP checkpoint mutations. We demonstrated that the A. nidulans uvsB^ATR gene is involved in DNA replication and the intra-S-phase checkpoints and that the npkA mutation can suppress its intra-S-phase checkpoint deficiency. There is a defect in both the intra-S-phase and DNA replication checkpoints due to the npkA inactivation when DNA replication is slowed at 6 mM HU. Our results suggest that the npkA gene plays a role in cell cycle progression during S-phase as well as in a DNA damage signal transduction pathway in A. nidulans.

---

CONTROL of cell cycle progression is dependent on serine/threonine kinases called cyclin-dependent kinases (Cdk's). Cdk's can be grouped into two types: those that have and those that do not have a known cyclin partner. Such partners have been identified for some, but not all, members of the Cdc2 family, and the role in the cell cycle of Cdk's lacking cyclin partners remains unclear (DE FALCO and GIORDANO 1998). Only some Cdk's have roles in regulating the cell cycle. Most of the other Cdk's (e.g., CDK7-9) have been implicated in the regulation of transcription as protein kinases that phosphorylate the C-terminal domain of RNA polymerase II. However, a number of other Cdc2-related kinases (Crk) either do not need to bind a cyclin to be active or have no cyclin partner that has been identified. When an activating cyclin partner is subsequently identified, the protein is reclassified as a Cdk (KO et al. 2001). The Crk family comprises a diverse set of proteins that have 42–55% identity with the kinase domain of Cdc2 (MEYERSON et al. 1992). Individual Crk family members are often referred to by the one-letter code of the amino acid sequence in the region corresponding to the "PSTAIRE" -helix of Cdc2 that interacts with the cyclin. These are denoted on the basis of their amino acid homology in the PSTAIRE region of Cdc2, such as PITSLRE (BRAMBILLA and DRAETTA 1994), PCTAIRE (MEYERSON et al. 1992), PITAIRE (LAPIDOT-LIPSON et al. 1992), and PISSLRE (BRAMBILLA and DRAETTA 1994; GRAñA et al. 1994).

The DNA damage response is a protective mechanism that ensures the maintenance of genomic integrity during cellular reproduction. DNA damage takes several general forms including single- and double-strand breaks, base damage, and DNA-protein crosslinks. If left unrepaired, DNA damage can result in cell cycle arrest, cell death, and, if repaired incorrectly, the loss of genetic information or the accumulation of mutations that lead to cancer in multicellular organisms. DNA replication, gene transcription, DNA repair, and cell cycle checkpoints must all interlink to promote cell survival following DNA damage (LEVITT and HICKSON 2002). The two main signal transduction pathways that respond to DNA damage are conserved across evolution: the ATM (mutated in ataxia telangiectasia) and the ATR (ATM-Rad3-related) pathways (ROTMAN and SHILOH 1998; ZHOU and ELLEDGE 2000; ABRAHAM 2001; YANG et al. 2003). The ATM pathway responds to the presence of double-strand breaks (DSBs). The ATR pathway also responds to DSBs, but more slowly than ATM. In addition, the ATR pathway can respond to agents that interfere with the function of replication forks, such as hydroxyurea (HU), ultraviolet light (UV), and DNA-alkylating agents such as methyl methanesulfonate (MMS; NYBERG et al. 2002; OSBORN et al. 2002). The ATM/ATR kinases phosphorylate and activate signal transduction pathways that ultimately interface with the Cdk/cyclin machinery (ABRAHAM 2001).

The filamentous fungus Aspergillus nidulans has been used as a model genetic system for the study of cell cycle control and the DNA damage response (for reviews, see AIST and MORRIS 1999; GOLDMAN et al. 2002; GOLDMAN and KAFER 2004; OSMANI and MIRABITO 2004). Two protein kinases, the NimX^Cdc2 and NimA, are coordinately required to initiate mitosis in A. nidulans (OSMANI and YE 1996; YE et al. 1996). As in other eukaryotic cells, the DNA damage checkpoint in A. nidulans functions via phosphorylation of the NimX^Cdc2 Y15 (YE et al. 1997). Loss of such checkpoint control regulation over mitosis can also cause DNA rereplication after mitosis (DE SOUZA et al. 1999). The Wee1 ortholog AnkA and the Cdc25 ortholog NimT regulate the Y15 phosphorylation of NimX (OSMANI et al. 1991; YE et al. 1997; KRAUS and HARRIS 2001), although it is not clear how their activity and/or localization are influenced by DNA damage. The DNA damage checkpoint also regulates septation in A. nidulans by modulating the activity of NimX^Cdc2 and requiring functional AnkA (HARRIS and KRAUS 1998; DE SOUZA et al. 1999).

We have used A. nidulans as a model system to genetically characterize the cellular response to the antitopoisomerase I drug, camptothecin (CPT; BRUSCHI et al. 2001; KRESS FAGUNDES et al. 2003; SEMIGHINI et al. 2003). The basic mechanism of action for CPT is well characterized (FROELICH-AMMON and OSHEROFF 1995). Briefly, CPT generates replication-mediated DNA double-strand breaks, which in turn induce reversible or permanent cell cycle arrest in G₂-M transition. In this study, we report the molecular characterization of A. nidulans npkA, a p34^Cdc2-related gene, which is transcriptionally induced by CPT and other DNA-damaging agents. We examined the role of the npkA gene in the DNA damage response. While npkA inactivation alone does not result in a clear phenotype, npkA can partially suppress HU sensitivity of uvsB^ATR and uvsD153^ATRIP mutations. In addition, the npkA genetically interacts with bimE^APC1 and ankA^wee1 genes during S-phase checkpoints. These results strongly suggest that the npkA gene plays a role in the DNA damage checkpoint during S-phase in A. nidulans.

Strains, media, and methods of UV treatment:

Escherichia coli strain KS272 [F^– lacX74 galE galK thi rpsL phoA (PvuII)] was used for propagation of the recombination vector pKOBEG and A. nidulans cosmids. E. coli strains were propagated in Luria-Bertani (LB) medium (1% bacto-tryptone, 0.5% yeast extract, 0.5% NaCl, pH 7.5) when selection for zeocin (Invitrogen, San Diego) resistance was applied. L-Arabinose or D-glucose was added as indicated to modulate expression of genes under control of the pBAD promoter (GUZMAN et al. 1995).

A. nidulans strains used are described in Table 1. Media were of two basic types—(1) a simple yeast extract "complete" medium with three variants: YAG (2% glucose, 0.5% yeast extract, 2% agar, trace elements); YUU, medium supplemented with 1.2 g/liter each of uracil and uridine; and liquid YG medium of the same compositions (but without agar); and (2) a modified minimal medium of 1% glucose, original high-nitrate salts, trace elements, 2% agar, pH 6.5, or minimal medium without glucose (MC). Trace elements, vitamins, and nitrate salts are described by KAFER (1977)(appendix available on request from the author). Standard genetic techniques for A. nidulans were used for all strain constructions (KAFER 1977).

View this table: In this window In a new window   TABLE 1 A. nidulans strains

 
For the UV light viability assays, conidiospores (dormant in a quiescent G₀ state) were suspended in 0.2% Tween-20 and plated out on YUU plates (100 conidia/plate). The plates were then irradiated immediately with UV using a UV Stratalinker 1800 (Stratagene, La Jolla, CA) and incubated at 32° for 48 hr to determine UV sensitivity of nondividing cells. To determine UV survival of dividing cells, conidiospores on YUU plates were first allowed to germinate for 4.5 hr in a 32° incubator for colony formation. By this time the germinated spores had entered the cell cycle and were about to undergo the first mitosis. These germlings were UV irradiated on the plates and then similarly incubated at 32° for 48 hr. Viability was determined as the percentage of colonies on treated plates compared to untreated controls.

Methods of intra-S-phase and DNA replication checkpoints:

For the intra-S-phase checkpoint, conidiospores were inoculated onto coverslips in YUU medium with 0, 6, or 100 mM of HU. After 5–7 hr of incubation at 30°, coverslips with adherent germlings were transferred to fixative solution (3.7% formaldehyde, 50 mM sodium phosphate buffer pH 7.0, 0.2% Triton X-100) for 30 min at room temperature. Then, they were briefly rinsed with PBS buffer (140 mM NaCl, 2 mM KCl, 10 mM NaHPO₄, 1.8 mM KH₂PO₄, pH 7.4) and incubated for 5 min in a solution with 100 ng/ml of 4',6-diamidino-2-phenylindole (DAPI; Sigma Chemical) and 100 ng/ml of calcofluor (fluorescent brightener, Sigma Chemical). After incubation with the dyes, they were washed with PBS buffer for 5 min at room temperature and then rinsed in distilled water and mounted in Citifluor. The material was photographed using a Zeiss epifluorescence microscope. The number of nuclei was assessed by DAPI staining. Germlings that had two or more nuclei after the HU incubation were scored as germlings that disrupted the S-phase blockage.

For the DNA replication checkpoint, 1.0 x 10⁸ conidia were inoculated in YUU medium with 0, 6, or 100 mM of HU and incubated in a reciprocal shaker (250 rpm) at 30° for 7 hr. The conidiospores were washed with water, conveniently diluted and plated on YUU, and incubated at 30° for 48 hr. Viability was determined as the percentage of colonies on treated plates compared to untreated controls.

Differential display-reverse transcriptase polymerase chain reaction procedure:

A total of 1.0 x 10⁷ conidia/ml of A. nidulans strain R21 were used to inoculate liquid cultures, which were incubated in a reciprocal shaker at 37° for 16 hr. Mycelia were aseptically transferred to a fresh YG medium in the presence or absence of 25 µM CPT and grown for 1 hr at 37°. A. nidulans mycelia were harvested by filtration through a Whatman filter no. 1, washed thoroughly with sterile water, quickly frozen in liquid nitrogen, and disrupted by grinding, and total RNA was extracted with Trizol (Life Technologies). The RNA was reverse transcribed using reverse transcriptase (SuperScript II, GIBCO BRL, Gaithersburg, MD) and the oligonucleotide C2, 5'-GAAGCTGGTAAACAAAAGG-3', for 30 min at 42°. PCR amplification of the cDNAs was done using the enzyme Taq-Gold (Applied Biosystems, Foster City, CA) and the oligonucleotide C2, using the following PCR conditions for amplification: 95° for 3 min, 42° for 1 min, 72° for 1 min for 35 cycles; and 72° for 5 min. The cDNAs were differentially displayed by running a polyacrylamide gel and staining it with silver nitrate. The bands that displayed differential expression were cut from the gel, eluted, and reamplified. They were subsequently cloned into pUC18 and the inserts were sequenced using M13 reverse and forward primers and BigDye terminator cycle sequencing (Applied Biosystems).

DNA manipulations were according to SAMBROOK et al. (1989). A chromosome-specific cosmid library was screened with the amplified 240-bp npkA fragment identified in the differential display-reverse transcriptase polymerase chain reaction (DD-RT-PCR) procedure. This fragment was labeled with [-³²P]dCTP using the kit RTS Rad Prime DNA labeling system (GIBCO-BRL). This screen yielded a single clone (plate 2, W28A05) located on chromosome I. Both genomic and cDNA fragments were fully sequenced using gene-specific primers and BigDye terminator cycle sequencing (Applied Biosystems).

Molecular cloning, deletion, and construction of a conditional mutant of the npkA gene:

To delete the npkA gene, we used the gene replacement method described by CHAVEROCHE et al. (2000). Electrocompetent cells of a transformant carrying pKOBEG (Cm^R) and cosmid W28A05 (Amp^R Km^R), a derivative of pWE15, which carries an A. nidulans genomic region encompassing the npkA gene, were prepared from a culture containing 0.2% arabinose to induce the expression of the red genes. Electrocompetent cells were electroporated with 100 ng of the gel-purified fragment of pCDA21, generated using the following oligonucleotides: npkAzeo (5'-TGCGGTGAGTGCATGTCGAAAATACTGAGCTCAGTGCTTATTGTTGGACGggaattctcagtcctgctcc-3) and npkApyr (5'-AAAGAACATACAAGAAGTAAAATGCAGGAATCATCGCCTGCGACGAAACCgaattcgcctcaaacaatgc-3'). These oligonucleotides have 50 bp of homology to the 5' or 3' noncoding region of the A. nidulans npkA (uppercase) followed by 20 bp of homology to the zeocin resistance or A. fumigatus pyrG genes carried by pCDA21 (lowercase), respectively. Shocked cells were plated on LB medium containing ampicillin (50 µg/ml) and zeocin (50 µg/ml) and incubated at 30°. Transformants were colony purified once at 42° on medium containing ampicillin and zeocin and then screened for chloramphenicol resistance to test loss of pKOBEG. The resulting cosmids were further characterized by restriction enzyme digestion and PCR analysis. Transformation of A. nidulans strains (pyrG89 recipient strains; UI224 and MV3, Table 1) was according to the procedure of OSMANI et al. (1987) using 5 µg of circular pnpkApyrG or palcA::npkA DNA, respectively. Transformants were scored for their ability to grow on minimal medium as the sole carbon source.

For the construction of alcA(p)::npkA fusion genes, the following procedure was used. The plasmid pRCP29, which possesses the argB selectable marker and the alcA promoter, was cut at the unique SmaI site, blunted with Klenow fragment, and dephosphorylated with calf intestinal phosphatase (CIP). The npkA gene was amplified by PCR using the primers anpk5, 5'-GATGCGCGGCCGCTCGACCTCTAAATCCAGATG-3' (the underlined region shows a single NotI site that was introduced at the 5'-end of the npkA gene), and anpk3, 5'-ACGCTGAATTCCCTAAATTTTGAAGGAGAAAA-3'. The fragment containing the npkA ORF sequence was gel purified and ligated into plasmid pRCP29. The resulting plasmid (palcA::npkA) was digested with NotI and dephosphorylated with CIP, and the hemagglutinin 3 (HA3) fragment (HOPP et al. 1988) with bordering NotI sites was ligated into this plasmid. The alcA(p)::HA3::npkA junction was sequenced to confirm sequence and orientation. This contruct was used to transform the npkA (argB2) strain to arginine prototrophy.

RNA isolation:

A total of 1.0 x 10⁷ conidia/ml were used to inoculate 50 ml of liquid cultures that were incubated in a reciprocal shaker at 37° for 16 hr. Mycelia were aseptically transferred to fresh YG medium in the presence or absence of drugs for 1, 2, 4, and 8 hr. The following concentrations of chemicals were used: 25 µM of CPT, 0.5 µg/ml of 4-nitroquinoline oxide (4-NQO), 0.003% of MMS, and 0.6 µg/ml of bleomycin (BLEO). Mycelia were harvested by filtration through no. 1 Whatman filter, washed thoroughly with sterile water, quickly frozen in liquid nitrogen, disrupted by grinding, and total RNA was extracted with Trizol (Life Technologies). Ten micrograms of RNA from each treatment was then fractionated in 2.2 M formaldehyde and 1.2% agarose gel, stained with ethidium bromide, and then visualized with UV light. The presence of intact 28S and 18S ribosomal RNA bands was used as a criterion to assess the integrity of the RNA. RNAse-free DNAse treatment was done as previously described by SEMIGHINI et al. (2002).

Real-time PCR reactions:

All the PCR and RT-PCR reactions were performed using an ABI Prism 7700 sequence detection system (Perkin-Elmer Applied Biosystem). Taq-Man EZ RT-PCR kits (Applied Biosystems) were used for RT-PCR reactions. The thermal cycling conditions comprised an initial step at 50° for 2 min, followed by 30 min at 60° for reverse transcription, 95° for 5 min, and 40 cycles at 94° for 20 sec and 60° for 1 min. The Taq-Man Universal PCR master mix kit was used for PCR reactions. The thermal cycling conditions comprised an initial step at 50° for 2 min, followed by 10 min at 95°, and 40 cycles at 95° for 15 sec and 60° for 1 min. The reactions and calculations were performed according to SEMIGHINI et al. (2002). The following primers and Taq-Man fluorescent probes (Applied Biosystems) were used in this work: for ß-tubulin (tubC), tubCfw, 5'-CGGAAACTGGCCGTCAATAT-3; tubCrv, 5'-GGGCAAACCCGACCATAAA-3'; tubCprobe, 6FAM-5'-TCCCTTCCCGCGGTTGCATTT-TAMRA; and for npkA, npkAfw, AATGGCACGCTACTACGGAGA; npkArv, 5'-GCGGTACCAAAGCGTCACA-3'; npkAprobe, TET-5'-CCTCCGCCAAAACTAACGCAACTCG-3'-TAMRA (6FAM, 6-carboxyfluorescein; TET, 6-carboxy-4,7,2',7'-tetrachlorofluorescein; and TAMRA, 6-carboxy-N,N,N',N'-tetramethylrhodamine).

Isolation of the A. nidulans npkA gene that encodes a p34^Cdc2-related serine/threonine kinase:

In an attempt to identify genes that are transcriptionally induced upon exposure to CPT, we performed a modified version of the mRNA differential display-reverse transcriptase polymerase chain reaction method of LIANG and PARDEE (1992). Two independent differential display experiments were performed with RNA from noninduced and CPT-induced mycelia, using a single nonanchored (random) primer. We identified several DNA fragments that were either repressed or induced in the presence of CPT (M. A. CASTRO DANI, data not shown). Among them was a DNA fragment of 240 bp, cig1 (camptothecin-induced gene; data not shown). Sequence analysis of this fragment showed that cig1 corresponded to a gene that encodes a serine/threonine kinase (data not shown).

The cig1 fragment was used to screen an A. nidulans chromosome-specific cosmid library. Sequence analysis of a genomic clone derived from chromosome I confirmed that the DNA fragment corresponded to a gene encoding a putative serine/threonine kinase, which we named npkA. When cig1 was used as a probe in a Northern blot, it recognized a single transcript of 1.3 kb (Figure 3C). The npkA gene does not have any introns, as determined by RT-PCR experiments using appropriate combinations of primers (data not shown). The npkA coding region is 1011 nucleotides long, encoding a predicted translation product 336 amino acids long with a calculated molecular weight of 38,409 D and a calculated isoelectric point of 5.99. Southern blots of total DNA using npkA as a probe and searches of the A. nidulans genome database (http://www-genome.wi.mit.edu/annotation/fungi/aspergillus/) indicated that npkA is a single-copy gene in the A. nidulans genome (data not shown).

View larger version (47K): In this window In a new window Download PPT slide   FIGURE 3.— Construction of deletion and overexpression strains. (A, left) The npkA gene was deleted by using the zeo-pyrG cassette (see text for details). (A, right) Southern analysis of the MV3 (npkA) and wild-type strains. DNA from MV3 and wild-type strains were isolated and cleaved with enzyme EcoRI; the npkA gene was used as hybridization probe. (B, left) Diagram showing the integration of the plasmid palcA::HA3::npkA into the argB locus. (B, right) Southern analysis of the integration of the plasmid palcA::HA3::npkA into the argB locus. DNA from the wild-type and MV4 strains was isolated and cleaved with enzyme BamHI; the argB gene was used as hybridization probe. (C) Northern blot analysis of the wild-type, MV3, and MV4 strains grown in the presence of either MC + 20 g/liter of glucose or MC + 200 mM of ethanol; npkA gene was used as a probe. The arrows indicate the respective nkpA transcript size in the wild-type and MV4 strains. (D) Real-time RT-PCR of the npkA mRNA expression of the wild-type strain grown in the presence of either MC + 200 mM ethanol or 20 g/liter glucose. The measured quantity of the npkA mRNA in each of the treated samples was normalized using the CT values obtained for the tubC RNA amplifications run in the same plate. The relative quantitation of npkA and tubulin gene expression was determined by a standard curve (i.e., Ct values plotted against the logarithm of the DNA copy number). Results of four sets of experiments were combined for each determination; means ± standard deviations are shown. The values represent the copies of the npkA cDNA divided by the copies of the tubC cDNA.

 
The predicted npkA protein product showed 55% identity with the carboxy-terminal domains of several kinases related to p34^Cdc2 (Cdc2-related kinases; Figure 1). All these Cdc2-related kinases belong to the PITSLRE kinase superfamily (for a review, see LAHTI et al. 1995). The PITSLRE domain in NpkA is from amino acids 153–160; there are two substitutions in the PITSLRE domain: an isoleucine by a valine and a serine by a glycine (Figure 1). NpkA shows 40% identity at the carboxy terminus with the A. nidulans NimX^Cdc2 (data not shown). Additional features of NpkA include a protein kinase domain (amino acids 112–336), including a serine/threonine protein kinase active-site signature (amino acids 232–244). In addition, the predicted sequence includes putative cAMP- and cGMP-dependent protein kinase phosphorylation sites (amino acids 71–74), protein kinase C phosphorylation sites (amino acids 3–5 and 333–335), and casein kinase II phosphorylation sites (amino acids 81–84, 133–136, 162–165, 199–202, and 222–225).

View larger version (96K): In this window In a new window Download PPT slide   FIGURE 1.— The NpkA protein shows high identity with several PITSLRE protein kinases. Alignment of the serine/threonine kinase domain deduced NpkA sequence (anpk) with Schizosaccharomyces pombe cell division cycle 2 homolog (gi/19112531; Sp kinase; 57% identity), Caenorhabditis elegans Cdc2 putative kinase (gi/17531375; Ce kinase; 55% identity), Drosophila melanogaster PITSLRE gene product (gi/21355495; Dm kinase; 53% identity), Homo sapiens Cdc2-like1 PITSLRE protein (gi/16332364; Hs kinase; 58% identity), H. sapiens p58 galactosyltransferase-associated protein kinase (gi/107255; p58clk1Hs; 58% identity), and A. thaliana putative protein kinase (gi/15220477; At kinase; 56% identity). Thick solid bar, serine/threonine kinase signature; dotted lines, PITSLRE domain.

 
We analyzed the mRNA expression of the npkA gene using real-time RT-PCR. Expression was analyzed in the presence of CPT, as well as other DNA-damaging agents, such as MMS, 4-NQO, and BLEO. Wild-type A. nidulans was grown in the absence of any drug, transferred to a specific concentration of one of the DNA-damaging agents for 1, 2, 4, and 8 hr, and then RNA was isolated and analyzed for the expression of the npkA gene (Figure 2). The npkA mRNA expression was induced 11-, 4-, and 10-fold after 4 hr growth in the presence of CPT, MMS, and 4-NQO, respectively; no increase in npkA mRNA levels was observed with the BLEO treatment (Figure 2). Interestingly, this induction is slow when compared to other A. nidulans DNA-damage-induced genes whose expression has been analyzed by real-time RT-PCR, such as scaA^NBS1, mreA^MRE11, and rad50 (SEMIGHINI et al. 2003). DD-RT-PCR had detected the cig1 DNA fragment in RNA isolated from cultures grown in the presence of CPT for 1 hr (data not shown). Real-time RT-PCR experiments detected a 3-fold increase in npkA RNA levels after 2 hr of growth in the presence of CPT. While the quantitative differences in the two experiments may be due to intrinsic peculiarities of each assay used, both experiments indicate that npKA is induced at the transcriptional level in the presence of CPT and other DNA-damaging agents, suggesting that npkA could be involved in the A. nidulans DNA damage response.

View larger version (16K): In this window In a new window Download PPT slide   FIGURE 2.— Fold increase in npkA RNA levels in response to DNA-damaging agents. The measured quantity of the npkA mRNA in each of the treated samples was normalized using the CT values obtained for the tubC RNA amplifications run in the same plate. The relative quantitation of npkA and tubulin gene expression was determined by a standard curve (i.e., Ct values plotted against the logarithm of the DNA copy number). Results of four sets of experiments were combined for each determination; means ± standard deviations are shown. The values represent the number of times the genes are expressed compared to the wild-type control grown without any drug (represented absolutely as 1.00).

 

Construction of a conditional npkA mutant strain:

To investigate the function of the npkA gene, an A. nidulans strain carrying a deletion of the npkA gene was generated using the method described by CHAVEROCHE et al. (2000) for A. nidulans. This method relies on the ability of E. coli strains expressing the red genes to carry out homologous recombination between homologous sequences of <60 bp. Cosmid W28A05, which contains the npkA gene and flanking genomic region, was introduced into an E. coli strain carrying pKOBEG. The resulting strain was transformed with a PCR product obtained through amplification of the zeo/pyrG cassette of pCDA21 using oligonucleotides with 50 bp of homology to the 5'- or 3'-end of the npkA coding region and 20 bp of homology in the zeo/pyrG cassette. Several hundred Zeo^R transformants were obtained and characterization of some of them by restriction enzyme and PCR analysis showed that most resulted from the expected npkA allelic exchange on cosmid W28A05. Protoplasts of A. nidulans strain UI224 were transformed using one of these plasmids (NPK1) in its circular form. Several transformants were obtained by their ability to grow in minimal medium without uracil and uridine but supplemented with arginine. Allelic replacement was obtained in at least one of these transformants (MV3 strain) as confirmed by Southern blot analysis (Figure 3A). The A. nidulans npkA deletion strain showed no growth defects or changes in developmental patterns (data not shown). In addition, the MV3 strain was neither more sensitive nor more resistant to DNA-damaging agents such as BLEO, CPT, MMS, and 4-NQO. Furthermore, it displayed nuclear kinetics, septation, and growth rate comparable to the wild-type strain (data not shown). These results suggest that either NpkA is not involved in these processes or other kinases are able to compensate for the lack of NpkA.

We used the MV3 strain to construct a conditional mutant by fusing the npkA ORF to the A. nidulans alcA alcohol dehydrogenase promoter in pRCP29, a derivative of the vector pAL5 (WARING et al. 1989) that has argB as a selectable marker. A 3xHA epitope was fused in frame at the N terminus of the npkA ATG (for details, see MATERIALS AND METHODS). This construction (palcA::HA3::npkA) was transformed into the MV3 strain and transformants were selected for arginine prototrophy and by Southern blot analysis. The palcA::HA3::npkA plasmid had integrated at the endogenous A. nidulans argB locus in one of these transformants (strain MV4; Figure 3B). Northern blot analysis and real-time RT-PCR confirmed that the npkA gene in MV4 was regulated by the alcA promoter, since expression was repressed on glucose, and induced at least 26-fold on ethanol (Figure 3, C and D). The differences in the size of mRNA transcripts recognized by the npkA probe in the wild-type (1.3-kb) and palcA::HA3::npkA (1.1-kb) strains in the Northern blot are consistent with the absence of the leader and tail sequences from the latter (Figure 3C).

Overexpression of the npkA gene in strain MV4, like deletion of npkA, did not cause any measurable growth defects, changes in developmental patterns, or sensitivity to BLEO, CPT, MMS, and 4-NQO. In addition, nuclear kinetics, septation, and growth rate remained unchanged in this strain (data not shown).

The npkA deletion can suppress uvsB^ATR and uvsD153^ATRIP sensitivity to HU:

In several eukaryotic organisms, DNA damage checkpoint activation is controlled by the conserved family of ATM/ATR kinases (SHILOH 2001; NYBERG et al. 2002), which includes A. nidulans UvsB^ATR (DE SOUZA et al. 1999). Recently, CLIBY et al. (2002) have shown that ATR is important in responding to the replication-associated DNA damage from topoisomerase poisons. Since npkA RNA levels are increased by treatment with the antitopoisomerase I poison CPT, we investigated whether npkA gene function was related to uvsB^ATR activity. First, we checked if the induction of npkA transcription in response to DNA damage is dependent on the uvsB^ATR gene. The uvsB^ATR deletion mutant and wild-type strains were grown in the absence of any drug, transferred to 25 µM of CPT for 4 hr, and RNA was isolated and analyzed for the expression of the npkA gene by real-time RT-PCR. Under these conditions, npkA mRNA levels were induced 10-fold in the control strain, whereas no induction of npkA transcription was detectable in the uvsB mutant (Figure 4). These results show that the highly induced transcript levels of the npkA gene in the presence of CPT require uvsB^ATR.

View larger version (15K): In this window In a new window Download PPT slide   FIGURE 4.— Expression of npkA mRNA is dependent on the uvsBATR gene when A. nidulans is grown in the presence of CPT. The wild-type and uvsB strains were grown in YG medium for 12 hr at 37° and then transferred to YG or YG + 25 µM of CPT. RNA was extracted, DNAse treated, and RT-PCR reactions were run. The measured quantity of the npkA mRNA in each of the treated samples was normalized using the CT values obtained for the tubC RNA amplifications run in the same plate. The relative quantitation of npkA and tubulin gene expression was determined by a standard curve (i.e., Ct values plotted against logarithm of the DNA copy number). Results of four sets of experiments were combined for each determination; means ± standard deviations are shown. The values represent the number of times the genes are expressed compared to the wild type or uvsB grown without any drug (represented absolutely as 1.00).

 
To analyze the genetic interactions of npkA and uvsB^ATR, we constructed an npkA uvsB^ATR double mutant (strain JL001). This JL001 strain was inhibited to the same degree as the uvsB^ATR strain when grown in the presence of CPT, 4-NQO, and MMS (data not shown). However, in the double mutant, the npkA mutation partially suppressed the HU sensitivity seen in the uvsB^ATR mutant (Figure 5A).

View larger version (99K): In this window In a new window Download PPT slide   FIGURE 5.— Growth phenotypes of the npkA uvsBATR and npkA uvsD153ATRIP double mutants. (A) Strains GR5 (wild type), MV3 (npkA), AAH14 (uvsBATR), and JL001 (npkA uvsBATR) were grown for 72 hr at 37° in YUU medium in the presence or absence of HU. (B) Strains GR5 (wild type), MV3 (npkA), ASH273 (uvsD153ATRIP), and JF001 (npkA uvsD153ATRIP) were grown for 72 hr at 37° in YUU medium in the presence or absence of HU.

 
Human ATR exists in a stable complex with a protein called ATRIP (CORTEZ et al. 2001). Fission yeast Rad3 and budding yeast Mec1 ATR orthologs also form similar complexes with the ATRIP-related factors Rad26 and Ddc2/Lcd2/Pie1, respectively (PACIOTTI et al. 2000; WOLKOW and ENOCH 2002). In human cells, ATR localizes with ATRIP in nuclear foci after damage, suggesting that the ATR-ATRIP complex may be recruited to the sites of DNA damage (CORTEZ et al. 2001). In A. nidulans, the Atrip/Rad26 homolog is UvsD (DE SOUZA et al. 1999). To find out about possible genetic interactions between npkA and uvsD153^ATRIP, we constructed an npkA uvsD153^ATRIP double mutant (strain JF001). As with uvsB^ATR, the growth of this npkA uvsD153^ATRIP strain in the presence of CPT, 4-NQO, and MMS was similar to the growth of the uvsD153^ATRIP single-mutant strain (data not shown). However, as with uvsB^ATR, npkA partially suppressed the HU sensitivity of the uvsD153^ATRIP mutation (Figure 5B). Taken together these results suggest that NpkA genetically interacts with the UvsB^ATR and UvsD^ATRIP complex during DNA damage caused specifically by HU.

HU is an inhibitor of ribonucleoside diphosphate reductase, the rate-limiting step enzyme in deoxyribonucleotide triphosphate (dNTP) biosynthesis. Depletion of dNTPs activates the DNA replication checkpoint, which slows progression through S-phase (DESANY et al. 1998). Furthermore, initiation of DNA replication in the presence of high levels of HU causes DNA DSBs (MERRILL and HOLM 1999). HU is an effective inhibitor of DNA synthesis in A. nidulans (BERGEN and MORRIS 1983). To better understand the npkA suppression of HU sensitivity in the ATR and ATRIP mutants, we examined the ability of the strains npkA uvsB^ATR and uvsB^ATR to survive a transient period of growth in the presence of HU. According to ALLEN et al. (1994), this acute treatment causes severe lethality in mutants that are specifically defective in the DNA replication checkpoint but not in mutants affected in DNA repair or in other DNA damage checkpoints. Thus, on the basis of HU hypersensitivity it is possible to distinguish between a mutant involved in the S-phase checkpoint and a mutant involved in DNA repair. Accordingly, two different assays were used to distinguish these differences. In the first one, the intra-S-phase checkpoint assay, the strains were incubated in 6 or 100 mM of HU for 5–7 hr. The number of nuclei was assessed by DAPI staining and if the germlings had two or more nuclei after the HU incubation, they were scored as defective in S-phase arrest (Table 2). In the second one, the DNA replication checkpoint assay, the germling viability was assessed after incubation for 7 hr in the presence and absence of 6 or 100 mM of HU (Table 3).

View this table: In this window In a new window   TABLE 2 A. nidulans double mutant uvsB npkA has intact intra-S-phase checkpoint

 

View this table: In this window In a new window   TABLE 3 A. nidulans uvsBATR is not involved in the DNA replication checkpoint

 
Interestingly, the npkA strain showed to have defects in the S-phase arrest at 6 mM while the uvsB^ATR germlings displayed defects at 6 and 100 mM (Table 2). However, the double-mutant uvsB npkA (JL001) strain has shown an intact intra-S-phase checkpoint at both 6 and 100 mM. The npkA (MV3) strain has shown an impaired response in the DNA replication checkpoint at 6 mM but not at 100 mM. The DNA replication checkpoint is impaired in the uvsB^ATR strain at both 6 and 100 mM of HU (Table 3). Remarkably, the double-mutant uvsB npkA (JL001) strain has shown a synergism with decreased viability at 6 mM but a comparable viability with the uvsB^ATR (AAH14) strain at 100 mM HU. These results suggest that there is a defect in both the intra-S-phase and DNA replication checkpoints due to the npkA inactivation when DNA replication is slowed at 6 mM HU. Furthermore, the uvsB^ATR is involved in both intra-S-phase and DNA replication checkpoints in A. nidulans. In addition, once more a genetic interaction is observed between npkA and uvsB^ATR since the npkA can suppress the uvsB^ATR intra-S-phase checkpoint deficiency and the double mutant npkA uvsB^ATR showed decreased viability after incubation at 6 mM HU.

Since the ATR pathway can also respond to UV light, an agent that interferes with the function of replication forks (NYBERG et al. 2002; OSBORN et al. 2002), we checked UV sensitivities of nondividing (quiescent) and dividing (germinating) npkA uvsB^ATR cells to UV irradiation. When UV irradiation was applied to quiescent conidia, the npkA uvsB^ATR double-mutant strain was not more sensitive than either of the single-mutant strains, npkA and uvsB^ATR, to UV irradiation (Figure 6). Likewise, germinating npkA uvsB^ATR conidia were as sensitive to UV irradiation as the uvsB^ATR (Figure 6). In the latter experiment, conidiospores were first allowed to germinate for 4.5 hr before UV irradiation was applied, by which time they had entered the first cell cycle. These results show that uvsB^ATR germinating conidiospores are more sensitive than quiescent conidiospores to UV irradiation and indicate that the npkA mutation does not affect the uvsB^ATR UV light sensitivity when conidiospores are either quiescent or germinating.

View larger version (23K): In this window In a new window Download PPT slide   FIGURE 6.— The npkA mutation cannot suppress the UV-light sensitivity of the uvsB mutant in quiescent (A) and germinating (B) conidiospores. Viability of germlings was scored after exposure to UV light. Viability was determined as the percentage of colonies on treated plates compared to untreated controls. The results were expressed by the average of three independent experiments and means are ± standard deviation. Statistical differences were determined by one-way analysis of variance (ANOVA) followed, when significant, by Newman-Keuls Multiple Comparison Test, using Sigma Stat statistical software (Jandel Scientific). The uvsB and uvsB npkA strains were significantly different from wild type and npkA; P < 0.01.

 

Possible genetic interactions with ankA^wee1 and bimE^APC1:

YE et al. (1996) have shown the existence of two S-phase checkpoint regulatory systems that control initiation in mitosis. One, which involves both Y15 phosphorylation of p34^Cdc2 and BimE, prevents initiation of mitosis when DNA replication is arrested and the other restrains mitosis via Y15 phosphorylation of p34^Cdc2 when DNA replication is slowed. Thus, we investigated possible genetic interactions among npkA and ankA^wee1 and bimE^APC1. Accordingly, we constructed double mutants npkA bimE (strain JL002) and npkA ankA (strain JF002). The double-mutant strain npkA bimE was inhibited to the same extent as the corresponding parental strains when grown in the presence of CPT, 4-NQO, MMS, and HU (data not shown). However, the double mutant npkA ankA is more sensitive than the parental strains to 4-NQO, MMS, and CPT (Figure 7) and as resistant to HU as MV3 and APK35 (data not shown).

View larger version (67K): In this window In a new window Download PPT slide   FIGURE 7.— Growth phenotypes of the npkA ankA double mutant. Strains R21 (wild type), MV3 (npkAwee1), APK35 (ankAwee1), and JF002 (npkA uvsBATR) were grown for 72 hr at 37° in YAG medium in the absence (first row) or presence of CPT (second row), MMS (third row), and 4-NQO (fourth row).

 
We also verified if the S-phase checkpoints were intact in these double-mutant strains (Tables 2 and 3). The bimE mutant has an impaired intra-S-phase checkpoint at 6 mM but an intact one at 100 mM while the DNA replication checkpoint is intact at both 6 and 100 mM (Tables 2 and 3). There is a synergism in the double-mutant npkA bimE^APC1 (JL002) strain during the intra-S-phase checkpoint with more germlings than the parental strains having two nuclei at both 6 and 100 mM HU (Table 2). Curiously, there is an intact DNA replication checkpoint in the JL002 strain at 6 mM but a synergism with a decrease in viability at 100 mM (Table 3). The ankA mutant strain (APK35) has impaired and intact intra-S-phase checkpoints at 6 and 100 mM, respectively. The double-mutant npkA ankA strain (JF002) has shown an increase in the number of germlings with two nuclei at both 6 and 100 mM (Table 2). However, the JF002 strain has not shown any defects in the DNA replication checkpoint (Table 3). These results strongly suggest that there are genetic interactions between npkA and bimE and npkA and ankA during S-phase checkpoints.

We have used DD-RT-PCR to isolate cDNAs that correspond to genes induced or repressed by the antitopoisomerase I drug CPT. This drug is an antitopoisomerase I poison and cytotoxic lesions are thought to occur when the advancing replication machinery encounters a CPT-stabilized topoisomerase I-DNA complex (HSIANG et al. 1985; LIU 1989, 1994; FROELICH-AMMON and OSHEROFF 1995; GUPTA et al. 1995; WANG 2002). The repair of a topoisomerase lesion presents special problems because the strand break is entangled with a covalently bound polypeptide. To restore the integrity of the chromosomal DNA, this polypeptide must be removed. Mutants defective in DNA repair show increased sensitivity to topoisomerase poisons and recently LIU et al. (2002) and VANCE and WILSON (2002) reported that in Saccharomyces cerevisiae multiple pathways could repair topoisomerase damage. LIU et al. (2002) showed that the MRE11 gene is more critical than the RAD52 gene for double-strand break repair of CPT lesions.

Using DD-RT-PCR, we isolated a cDNA fragment that corresponds to a gene encoding a protein (NpkA) whose transcription is induced in cells treated with CPT. NpkA exhibits 55% identity in the kinase domain to several members of the Cdc2-related PITSLRE family of protein kinases and thus is a member of the Crk family of kinases (MEYERSON et al. 1992). Deletion of the npkA did not cause any obvious phenotypic changes, suggesting that NpkA is functionally redundant with other kinases. In A. nidulans, NimX^Cdc2 is the only mitotic CDK, as in most eukaryotic cells. NimX^Cdc2 activation and entry into mitosis requires association of the nimE B-cyclin during interphase (OSMANI et al. 1994). SCHIER et al. (2001) have isolated the pcl-like cyclin PclA, which is involved in asexual sporulation in A. nidulans, and recently SCHIER and FISCHER (2002) showed that PclA interacts with NimX^Cdc2. A second A. nidulans CDK, PhoA, is homologous to the yeast Pho85 kinase and controls developmental responses to phosphorus-limited growth conditions (BUSSINK and OSMANI 1998). DOU et al. (2003) identified another nonessential cyclin-dependent kinase, PhoB, which is 77% identical to PhoA. Double mutant phoA phoB was able to germinate but had a limited capacity for nuclear division, suggesting a cell cycle defect. We have no evidence indicating that an A. nidulans cyclin interacts with NpkA. In fact, the double mutant npkA::pyrG; pclA::argB was viable and no more sensitive than the parental strains to DNA-damaging agents, suggesting that NpkA does not interact with PclA (data not shown).

A. nidulans npkA transcription is induced not only by CPT, but also by treatment with other DNA-damaging agents, such as the alkylating agent MMS and the UV-mimetic agent 4-NQO. All these agents interfere with the function of replication forks and the damage they cause can activate the ATR pathway (OSBORN et al. 2002). ATM/ATR are members of the family of phosphoinositide 3-kinase-related kinases and key regulators of the DNA damage response (CASPARI and CARR 1999; SHILOH 2001). They trigger responses that promote the maintenance of genome integrity by phosphorylating multiple target proteins. ATR inhibition results in hypersensitivity to the replication inhibitors HU and aphidicolin (CLIBY et al. 1998). These observations suggest that ATR responds to DNA damage occurring specifically during S-phase. DE SOUZA et al. (1999) and HOFMANN and HARRIS (2000) established that A. nidulans UvsB^ATR is a member of the family of ATM/ATR kinases. These authors suggested that UvsB functions as the central regulator of the A. nidulans DNA damage response. On the basis of these observations, we investigated the genetic interaction of npkA and uvsB^ATR. First, we found that the induction of npkA expression in response to CPT treatment requires uvsB^ATR. Second, we constructed a double mutant npkA uvsB^ATR and analyzed its growth in the presence of several DNA-damaging agents. The double mutant was more resistant than the uvsB^ATR strain to HU. In addition, the npkA mutation partially suppressed the HU sensitivity of the uvsD^ATRIP mutant.

HU stalls replication forks by depleting the dNTP pool. Another type of replication block might be associated with the DNA breaks generated during DNA replication. In theory, DSBs could arise if replication forks pass through nicked DNA or certain repair or recombination intermediates (OSBORN et al. 2002). Replication-associated DSBs also could be induced by agents such as topoisomerase I poisons (CLIBY et al. 2002). CLIBY et al. (2002) demonstrated that ATR kinase function is necessary for both G₂- and S-phase arrests induced by topoisomerase I poisons. These cellular responses to topoisomerase poisons appear to be independent of ATM function. The S-phase checkpoints respond to replicational interference by slowing down DNA replication to allow the damage to be repaired before polymerases encounter more DNA damage (OSBORN et al. 2002). Deletion of the ATR orthologs MEC1 and RAD3 in budding and fission yeasts, respectively, eliminates the DNA replication checkpoint (NYBERG et al. 2002). Using a Cre/lox-conditional system to study the effect of ATR loss, BROWN and BALTIMORE (2003) showed that mammalian ATR is an important regulator of checkpoint signaling pathways that phosphorylates Cdc2 in response to ionizing rays and stalled replication. We found that A. nidulans UvsB^ATR is involved in both intra-S-phase and DNA replication checkpoints. We determined that the npkA mutation could suppress the uvsB^ATR HU sensitivity by rescuing the intra-S-phase checkpoint in the uvsB^ATR mutation. Suppression of a null allele is expected to be due to downstream mutations that activate the pathway independent of the original (suppressed) gene product (PRELICH 1999). Thus, it is possible that NpkA is positioned downstream from UvsB^ATR in the intra-S-phase checkpoint pathway. Furthermore, the uvsB^ATR npkA double mutant showed decreased viability at lower HU concentration in the DNA replication checkpoint, suggesting that UvsB^ATR and NpkA function in parallel pathways to allow S-phase progression and/or recovery.

At least two S-phase checkpoint mechanisms control mitosis in A. nidulans (YE et al. 1996). The first S-phase checkpoint is activated during DNA replication that has been slowed by addition of HU to a level that does not arrest replication. It responds to the rate of DNA replication and inhibits mitosis via tyrosine phosphorylation of NimX^Cdc2. If DNA replication is arrested, a second checkpoint involves BimE^APC1 (the homolog of the anaphase promoting complex subunit, APC1). This second S-phase checkpoint occurs when DNA replication is completely inhibited by levels of HU higher than that stimulating the prolonged DNA replication checkpoint. This information was obtained through studies of double mutants of A. nidulans containing nimX^Cdc2AF [a mutated version in which the Thr14 is converted to an Ala (A) and Tyr15 to a Phe (F) residue] and the temperature-sensitive mutation bimE7 (OSMANI and YE 1997). Either the Cdc2AF or the bimE7 mutation alone has a limited capacity to promote mitosis when S-phase is arrested, but, in combination, these two defects allow cells to enter a lethal premature mitosis before completion of DNA replication.

We investigated the possible genetic interactions among NpkA and BimE^APC1 and NimX^Cdc2 by constructing the double mutants bimE^APC1 npkA and ankA^wee1 npkA. The AnkA is the ortholog of the fission yeast tyrosine kinase Wee1p that inhibits phosphorylation of Tyr-15 of NimX^Cdc2 (KRAUS and HARRIS 2001). As in fission yeast, the DNA damage checkpoint is regulated by tyrosine phosphorylation of NimX^Cdc2 (YE et al. 1997). The double mutant npkA ankA showed to be more sensitive to 4-NQO, MMS, and CPT. These genotoxins interfere with the function of replication forks and the DNA damage response to these agents is mediated via the ATR pathway (NYBERG et al. 2002; OSBORN et al. 2002). It is likely that nimX^Cdc2 and npkA function in parallel pathways downstream from uvsB^ATR, allowing cell cycle arrest upon DNA damage.

In lower and higher levels of HU, both BimE^APC1 and AnkA showed synergistic interaction with NpkA, suggesting that these genes also function in parallel pathways to allow intra-S-phase checkpoint. Nevertheless, a more complex behavior was seen during DNA replication checkpoint. In lower HU concentrations, BimE^APC1 has not interacted with NpkA while there is a decrease in the germling viability in the double mutant bimE^APC1 npkA at higher HU concentrations, also suggesting that these two genes also function in parallel pathways to allow DNA replication checkpoint. In lower concentrations of HU, npkA suppressed the low viability of the ankA mutation; however, in high HU concentrations, there is an intact DNA replication checkpoint.

In conclusion, our data are consistent with the possibility that in A. nidulans ATR is one of the sensors for replication-mediated DNA damage and we propose that NpkA, together with NimX^Cdc2 and BimE^APC1, monitors S-phase progression and/or recovery in response to DNA damage. Functional redundancy is most likely the reason why deletion of npkA did not result in a clear phenotype. However, NpkA appears to be a component of the ATM/ATR signaling pathway because: (i) npkA gene expression is dependent on uvsB^ATR in the presence of camptothecin, (ii) the npkA deletion can partially suppress the HU sensitivity of the uvsB^ATR and uvsD^ATRIP mutants, and (iii) the double mutant npkA ankA is more sensitive to genotoxins that interfere with the function of replication forks.

We thank Christophe D'Enfert for providing the plasmids pCDA21 and pKOBEG, Reinhard Fischer for providing the pclA deletion strains, Steven Harris for providing the ankA mutant strain, and Judith Berman, Etta Kafer, and two anonymous reviewers for critical reading of the manuscript. This research was supported by the Fundação de Amparo à Pesquisa do Estado de São Paulo, Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), Brazil.

Sequence data from this article have been deposited with the NCBI under accession no. AY166593.

ABRAHAM, R. T., 2001 Cell cycle checkpoint signaling through the ATM and ATR kinases. Genes Dev. 15: 2177–2196.[Free Full Text]

AIST, J. R., and N. R. MORRIS, 1999 Mitosis in filamentous fungi: how we got where we are. Fungal Genet. Biol. 27: 1–25.[CrossRef][Medline]

ALLEN, J. B., Z. ZHOU, W. SIEDE, E. C. FRIEBERG and S. J. ELLEDGE, 1994 The Sad1/Rad53 protein kinase controls multiple checkpoints and DNA damage-induced transcription in yeast. Genes Dev. 8: 2401–2415.[Abstract/Free Full Text]

BERGEN, L. G., and N. R. MORRIS, 1983 Kinetics of the nuclear division cycle of Aspergillus nidulans. J. Bacteriol. 156: 155–160.[Abstract/Free Full Text]

BRAMBILLA, R., and G. DRAETTA, 1994 Molecular cloning of PISSLRE, a novel putative member of the cdk family of protein serine/threonine kinases. Oncogene 9: 3037–3041.[Medline]

BROWN, E. J., and D. BALTIMORE, 2003 Essential and dispensable roles of ATR in cell cycle arrest and genome maintenance. Genes Dev. 17: 615–628.[Abstract/Free Full Text]

BRUSCHI, G. C. M., C. C. DE SOUZA, M. R. Z. K. FAGUNDES, M. A. C. DANI, M. H. S. GOLDMAN et al., 2001 Sensitivity to camptothecin in Aspergillus nidulans identifies a novel gene, scaA, related to the cellular DNA damage response. Mol. Genet. Genomics 265: 264–275.[CrossRef][Medline]

BUSSINK, H. J., and S. A. OSMANI, 1998 A cyclin-dependent kinase family member (PHOA) is required to link developmental fate to environmental conditions in Aspergillus nidulans. EMBO J. 17: 3990–4003.[CrossRef][Medline]

CASPARI, T., and A. M. CARR, 1999 DNA structure checkpoint pathways in Schizosaccharomyces pombe. Biochimie 81: 173–181.[Medline]

CHAVEROCHE, M.-K., J.-M. GHIGO and C. D'ENFERT, 2000 A rapid method for efficient gene replacement in the filamentous fungus Aspergillus nidulans. Nucleic Acids Res. 28: e97.[Abstract/Free Full Text]

CLIBY, W. A., C. J. ROBERTS, K. A. CIMPRICH, C. M. STRINGER, J. R. LAMB et al., 1998 Overexpression of a kinase-inactive ATR protein causes sensitivity to DNA-damaging agents and defects in cell cycle checkpoints. EMBO J. 17: 159–169.[CrossRef][Medline]

CLIBY, W. A., K. A. LEWIS, K. K. LILLY and S. H. KAUFMANN, 2002 S phase and G₂ arrests induced by topoisomerase I poisons are dependent on ATR kinase function. J. Biol. Chem. 277: 1599–1606.[Abstract/Free Full Text]

CORTEZ, D., S. GUNTUKU, J. QIN and S. J. ELLEDGE, 2001 ATR and ATRIP: partners in checkpoint signalling. Science 294: 1713–1716.[Abstract/Free Full Text]

DE FALCO, G., and A. GIORDANO, 1998 CDK9 (PITALRE): a multifunctional cdc-2 related kinase. J. Cell. Physiol. 177: 501–506.[CrossRef][Medline]

DESANY, B. A., A. A. ALCASABAS, J. B. BACHANT and S.J. ELLEDGE, 1998 Recovery from DNA replicational stress is the essential function of the S phase checkpoint pathway. Genes Dev. 12: 2956–2970.[Abstract/Free Full Text]

DE SOUZA, C. P. C., X. S. YE and S. A. OSMANI, 1999 Checkpoint defects leading to premature mitosis also cause endoreplication of DNA in Aspergillus nidulans. Mol. Biol. Cell 10: 3661–3674.[Abstract/Free Full Text]

DOU, X., D. WU, W. AN, J. DAVIES, S. B. HASHIMI et al., 2003 The PHOA and PHOB cyclin-dependent kinases perform an essential function in Aspergillus nidulans. Genetics 165: 1105–1115.[Abstract/Free Full Text]

FROELICH-AMMON, S. J., and N. OSHEROFF, 1995 Topoisomerase poisons: harnessing the dark side of enzyme mechanism. J. Biol. Chem. 270: 21429–21432.[Free Full Text]

GOLDMAN, G. H., and E. KAFER, 2004 Aspergillus nidulans as a model system to characterize the DNA damage response in eukaryotes. Fungal Genet. Biol. 41: 428–442.[CrossRef][Medline]

GOLDMAN, G. H., S. L. MCGUIRE and S. D. HARRIS, 2002 The DNA damage response in filamentous fungi. Fungal Genet. Biol. 35: 183–195.[CrossRef][Medline]

GRAñA, X., P. P. CLAUDIO, A. DE LUCA, A. SANG and A. GIORDANO, 1994 PISSLRE, a human novel Cdc2-related protein kinase. Oncogene 9: 2097–2103.[Medline]

GUPTA, M., A. FUJIMORI and Y. POMMIER, 1995 Eukaryotic DNA topoisomerases I. Biochim. Biophys. Acta 1262: 1–14.[Medline]

GUZMAN, L. M., D. BELIN, M. J. CARSON and J. BECKWITH, 1995 Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J. Bacteriol. 177: 4121–4130.[Abstract/Free Full Text]

HARRIS, S. D., and P. R. KRAUS, 1998 Regulation of septum formation in Aspergillus nidulans by a DNA damage checkpoint pathway. Genetics 148: 1055–1067.[Abstract/Free Full Text]

HOFMANN, A. F., and S. D. HARRIS, 2000 The Aspergillus nidulans uvsB gene encodes an ATM-related kinase required for multiple facets of the DNA damage response. Genetics 154: 1577–1586.[Abstract/Free Full Text]

HOPP, T. P., K. S. PRICKETT, V. L. PRICE, R. T. LIBBY, C. J. MARCH et al., 1988 A short polypeptide marker sequence useful for recombinant protein identification and purification. Biotechnology 6: 1204–1210.[CrossRef]

HSIANG, Y.-H., R. HERTZBERG, S. HECHT and L. F. LIU, 1985 Camptothecin induces protein-linked DNA breaks via mammalian DNA topoisomerase I. J. Biol. Chem. 260: 14873–14878.[Abstract/Free Full Text]

KAFER, E., 1977 Meiotic and mitotic recombination in Aspergilllus and its chromosomal aberrations. Adv. Genet. 19: 33–131.[Medline]

KO, T. K., E. KELLY and J. PINES, 2001 CrkRS: a novel conserved Cdc2-related protein kinase that colocalises with SC35 speckles. J. Cell Sci. 114: 2591–2603.

KRAUS, P. R., and S. D. HARRIS, 2001 The Aspergillus nidulans snt genes are required for the regulation of septum formation and cell cycle checkpoints. Genetics 159: 557–569.[Abstract/Free Full Text]

KRESS FAGUNDES, M. R. Z., L. FERNANDES, M. SAVOLDI, S. D. HARRIS, M. H. S. GOLDMAN et al., 2003 Identification of a topoisomerase I mutant, scsA1, as an extragenic suppressor of a mutation in scaA^NBS1, the apparent homolog of human nibrin in Aspergillus nidulans. Genetics 164: 935–945.[Abstract/Free Full Text]

LAHTI, J. M., J. XIANG and V. J. KIDD, 1995 The PITSLRE protein kinase family. Prog. Cell Cycle Res. 1: 329–338.[Medline]

LAPIDOT-LIPSON, Y., D. PATINKIN, C. A. PRODY, G. DHRLICH, S. SEIDMAN et al., 1992 Cloning and antisense oligodeoxynucleotides inhibition of a human homolog of Cdc2 required in hematopoiesis. Proc. Natl. Acad. Sci. USA 89: 579–583.[Abstract/Free Full Text]

LEVITT, N. C., and I. D. HICKSON, 2002 Caretaker tumour suppressor genes that defend genome integrity. Trends Mol. Med. 8: 179–186.[CrossRef][Medline]

LIANG, P., and A. B. PARDEE, 1992 Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257: 967–971.[Abstract/Free Full Text]

LIU, L. F., 1989 DNA topoisomerase poisons as antitumor drugs. Annu. Rev. Biochem. 58: 351–375.[CrossRef][Medline]

LIU, L. F., 1994 DNA Topoisomerases: Topoisomerase-Targeting Drugs (Advances in Pharmacology, Vol. 29B). Academic Press, San Diego.

LIU, C., J. J. POULIOT and H. A. NASH, 2002 Repair of topoisomerase I covalent complexes in the absence of the tyrosyl-DNA phosphodiesterase Tdp1. Proc. Natl. Acad. Sci. USA 99: 14970–14975.[Abstract/Free Full Text]

MERRILL, B. J., and C. HOLM, 1999 A requirement for recombinational repair in Saccharomyces cerevisiae is caused by DNA replication defects of mec1 mutants. Genetics 153: 595–605.[Abstract/Free Full Text]

MEYERSON, M., G. H. ENDERS, C. L. WU, L. K. SU, C. GORKA et al., 1992 A family of human Cdc2-related kinase protein kinases. EMBO J. 11: 2909–2917.[Medline]

NYBERG, K. A., R. J. MICHELSON, C. W. PUTNAM and T. A. WEINERT, 2002 Toward maintaining the genome: DNA damage and replication checkpoints. Annu. Rev. Genet. 36: 617–656.[CrossRef][Medline]

OSBORN, A. J., S. J. ELLEDGE and L. ZOU, 2002 Checking on the fork: the DNA-replication stress-response pathway. Trends Cell Biol. 12: 509–516.[CrossRef][Medline]

OSMANI, A. H., S. L. MCGUIRE and S. A. OSMANI, 1991 Parallel activation of the NIMA and p34^Cdc2 cell cycle-regulated protein kinases is required to initiate mitosis in Aspergillus nidulans. Cell 67: 283–291.[CrossRef][Medline]

OSMANI, A. H., N. VAN PEIJ, M. MISCHKE, M. J. O'CONNELL and S. A. OSMANI, 1994 A single p34^Cdc2 protein kinase (encoded by nimX^Cdc2) is required at G₁ and G₂ in Aspergillus nidulans. J. Cell Sci. 107: 1519–1528.[Abstract]

OSMANI, S. A., and P. MIRABITO, 2004 The early impact of genetics on our understanding of cell cycle regulation in Aspergillus nidulans. Fungal Genet. Biol. 41: 401–410.[CrossRef][Medline]

OSMANI, S. A., and X. S. YE, 1996 Cell cycle regulation in Aspergillus nidulans by two protein kinases. Biochem. J. 317: 633–641.

OSMANI, S. A., and X. S. YE, 1997 Targets of checkpoints controlling mitosis: lessons from lower eukaryotes. Trends Cell Biol. 7: 283–288.

OSMANI, S. A., G. S. MAY and N. R. MORRIS, 1987 Regulation of the mRNA levels of nimA, a gene required for the G2-M transition in Aspergillus nidulans. J. Cell Biol. 104: 1495–1504.[Abstract/Free Full Text]

PACIOTTI, V., M. CLERICI, G. LUCCHINI and M. P. LONGHESE, 2000 The checkpoint protein Ddc2, functionally related to S. pombe Rad26, interacts with Mec1 and is regulated by Mec1-dependent phosphorylation in budding yeast. Genes Dev. 14: 2046–2059.[Abstract/Free Full Text]

PRELICH, G, 1999 Suppression mechanisms: themes from variations. Trends Genet. 15: 261–266.[CrossRef][Medline]

ROTMAN, G., and Y. SHILOH, 1998 ATM: from gene to function. Hum. Mol. Genet. 7: 1555–1563.[Abstract/Free Full Text]

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual, Ed. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SCHIER, N., and R. FISCHER, 2002 The Aspergillus nidulans cyclin PclA accumulates in the nucleus and interacts with the central cell cycle regulator NimX^Cdc2. FEBS Lett. 523: 143–146.[CrossRef][Medline]

SCHIER, N., R. LIESE and R. FISCHER, 2001 A Pcl-like cyclin of Aspergillus nidulans is transcriptionally activated by developmental regulators and is involved in sporulation. Mol. Cell. Biol. 21: 4075–4088.[Abstract/Free Full Text]

SEMIGHINI, C. P., M. MARINS, M. H. S. GOLDMAN and G.H. GOLDMAN, 2002 Quantitative analysis of the relative transcript levels of ABC transporter Atr genes in Aspergillus nidulans by real-time reverse transcription-PCR assay. Appl. Environ. Microbiol. 68: 1351–1357.[Abstract/Free Full Text]

SEMIGHINI, C. P., M. R. VON ZESKA KRESS FAGUNDES, J. C. FERREIRA, R. C. PASCON, M. H. S. GOLDMAN et al., 2003 Different roles of the Mre11 complex in the DNA damage response in Aspergillus nidulans. Mol. Microbiol. 48: 1693–1709.[CrossRef][Medline]

SHILOH, Y., 2001 ATM and ATR: networking cellular responses to DNA damage. Curr. Opin. Genet. Dev. 11: 71–77.[CrossRef][Medline]

VANCE, J. R., and T. E. WILSON, 2002 Yeast Tdp1 and Rad1-Rad10 function as redundant pathways for repairing Top1 replicative damage. Proc. Natl. Acad. Sci. USA 99: 13669–13674.[Abstract/Free Full Text]

WANG, J. C., 2002 Cellular roles of DNA topoisomerases: a molecular perspective. Nature 3: 430–441.

WARING, R. B., G. S. MAY and N. R. MORRIS, 1989 Characterization of an inducible expression system in Aspergillus nidulans using alcA and tubulin-coding genes. Gene 79: 119–130.[CrossRef][Medline]

WOLKOW, T. D., and T. ENOCH, 2002 Fission yeast Rad26 is a regulatory subunit of the Rad3 checkpoint kinase. Mol. Biol. Cell 13: 480–492.[Abstract/Free Full Text]

YANG, J., Y. YU, H. E. HAMRICK and P. J. DUERKSEN-HUGUES, 2003 ATM, ATR and DNA-PK: initiators of the cellular genotoxic stress responses. Carcinogenesis 24: 1571–1580.[Abstract/Free Full Text]

YE, X. S., R. R. FINCHER, A. TANG, K. O'DONNELL and S. A. OSMANI, 1996 Two S-phase checkpoint systems, one involving the function of both BIME and Tyr15 phosphorylation of p34^Cdc2, inhibit NIMA and prevent premature mitosis. EMBO J. 15: 3599–3610.[Medline]

YE, X. S., R. R. FINCHER, A. TANG and S. A. OSMANI, 1997 The G2/M DNA damage checkpoint inhibits mitosis through Tyr 15 phosphorylation of p34^Cdc2 in Aspergillus nidulans. EMBO J. 16: 182–192.[CrossRef][Medline]

ZHOU, B. B., and S. J. ELLEDGE, 2000 The DNA damage response: putting checkpoints in perspective. Nature 408: 433–439.[CrossRef][Medline]

This article has been cited by other articles:

				B. C. Lamb, S. Mandaokar, B. Bahsoun, I. Grishkan, and E. Nevo Differences in spontaneous mutation frequencies as a function of environmental stress in soil fungi at "Evolution Canyon," Israel PNAS, April 15, 2008; 105(15): 5792 - 5796. [Abstract] [Full Text] [PDF]

				I. Malavazi, J. F. Lima, P. A. de Castro, M. Savoldi, M. H. de Souza Goldman, and G. H. Goldman Genetic Interactions of the Aspergillus nidulans atmAATM Homolog With Different Components of the DNA Damage Response Pathway Genetics, February 1, 2008; 178(2): 675 - 691. [Abstract] [Full Text] [PDF]

				I. Malavazi, M. Savoldi, S. M. Z. Di Mauro, C. F. M. Menck, S. D. Harris, M. H. d. S. Goldman, and G. H. Goldman Transcriptome Analysis of Aspergillus nidulans Exposed to Camptothecin-Induced DNA Damage. Eukaryot. Cell, October 1, 2006; 5(10): 1688 - 1704. [Abstract] [Full Text] [PDF]

				I. Malavazi, C. P. Semighini, M. R. von Zeska Kress, S. D. Harris, and G. H. Goldman Regulation of Hyphal Morphogenesis and the DNA Damage Response by the Aspergillus nidulans ATM Homolog AtmA Genetics, May 1, 2006; 173(1): 99 - 109. [Abstract] [Full Text] [PDF]

				C. P. Semighini, M. Savoldi, G. H. Goldman, and S. D. Harris Functional Characterization of the Putative Aspergillus nidulans Poly(ADP-Ribose) Polymerase Homolog PrpA Genetics, May 1, 2006; 173(1): 87 - 98. [Abstract] [Full Text] [PDF]

				J. F. Lima, I. Malavazi, M. R. von Zeska Kress Fagundes, M. Savoldi, M. H. S. Goldman, E. Schwier, G. H. Braus, and G. H. Goldman The csnD/csnE Signalosome Genes Are Involved in the Aspergillus nidulans DNA Damage Response Genetics, November 1, 2005; 171(3): 1003 - 1015. [Abstract] [Full Text] [PDF]

				M. R. v. Z. K. Fagundes, C. P. Semighini, I. Malavazi, M. Savoldi, J. F. de Lima, M. H. de Souza Goldman, S. D. Harris, and G. H. Goldman Aspergillus nidulans uvsBATR and scaANBS1 Genes Show Genetic Interactions during Recovery from Replication Stress and DNA Damage Eukaryot. Cell, July 1, 2005; 4(7): 1239 - 1252. [Abstract] [Full Text] [PDF]

International Access Link

Online ISSN: 1943-2361  Print ISSN: 0016-6731
Copyright 2009 by the Genetics Society of America
phone: 412-268-1812   fax: 412-268-1813   email: genetics-gsa{at}andrew.cmu.edu