- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Chick, W. S. H.
- Articles by You, Y.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Chick, W. S. H.
- Articles by You, Y.
Genetics, Vol. 167, 889-895, June 2004, Copyright © 2004
doi:10.1534/genetics.104.026468
Modification of an Existing Chromosomal Inversion to Engineer a Balancer for Mouse Chromosome 15
Wallace S. H. Chick*,
Sarah E. Mentzer
,
Donald A. Carpenter
,
Eugene M. Rinchik
,
and
Yun You
,1
* Graduate School of Genome Sciences and Technology, Cellular and Molecular Biology, The University of Tennessee, Knoxville, Tennessee 37996
Department of Biochemistry, Cellular and Molecular Biology, The University of Tennessee, Knoxville, Tennessee 37996
Mammalian Genetics and Genomics Group, Life Sciences Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831
1 Corresponding author: Oak Ridge National Laboratory, Bethel Valley Rd., Bldg. 1061, Room 206, Oak Ridge, TN 37831-6445.
E-mail: youy{at}ornl.gov
Chromosomal inversions are valuable genetic tools for mutagenesis screens, where appropriately marked inversions can be used as balancer chromosomes to recover and maintain mutations in the corresponding chromosomal region. For any inversion to be effective as a balancer, it should exhibit both dominant and recessive visible traits; ideally the recessive trait should be a fully penetrant lethality in which inversion homozygotes die before birth. Unfortunately, most inversions recovered by classical radiation or chemical mutagenesis techniques do not have an overt phenotype in either the heterozygous or the homozygous state. However, they can be modified by relatively simple procedures to make them suitable as an appropriately marked balancer. We have used homologous recombination to modify, in embryonic stem cells, the recessive-lethal In(15)21Rk inversion to endow it with a dominant-visible phenotype. Several ES cell lines were derived from inversion heterozygotes, and a keratin-14 (K14) promoter-driven agouti minigene was introduced onto the inverted chromosome 15 in the ES cells by gene targeting. Mice derived from the targeted ES cells carry the inverted chromosome 15 and, at the same time, exhibit lighter coat color on their ears and tails, making this modified In(15)21Rk useful as a balancer for proximal mouse chromosome 15.
INVERSIONS are chromosomal rearrangements that can be quite useful as genetic tools for recovery and maintenance of mutations in model organisms such as Drosophila (ASHBURNER 1989) and mice (LYON et al. 1982; RODERICK 1983; ZHENG et al. 1999; RINCHIK 2000). Progeny arising from single meiotic crossover within the inverted segment in inversion heterozygotes are normally not recovered, which allows one to use a dominant marker carried by the inversion to follow entire nonrecombined blocks of chromosome from generation to generation. This property makes appropriately visible marked inversions useful for recovering and/or maintaining mutations that are not easily recovered or kept as homozygotes (e.g., lethal and fertility mutations or other detrimental mutations). To be usable as this type of balancer chromosome, an inversion (In) must be marked with visible dominant and recessive phenotypes. The recessive phenotype can even be lethality, so that inversion homozygotes are never recovered while In/+ segregants are readily distinguishable from their +/+ counterparts by the dominant phenotypes associated with the inversion.
Investment in the production of inversions as an important component of mouse genetic resources has been proposed (JUSTICE et al. 1999; ZHENG et al. 1999; RINCHIK 2000). As gene-knockout, gene-trap, and large-scale ethylnitrosourea-mutagenesis programs worldwide produce a large number of lethal and detrimental mutations throughout the mouse genome, maintaining these mutants in genetic crosses will be a costly and potentially error-prone endeavor. Recently, with advances in embryonic stem (ES) cell technology and the Cre-loxP system, it has become possible to create inversions with preset endpoints anywhere in the mouse genome (ZHENG et al. 1999). Dominant markers (e.g., agouti coat color) can also be incorporated at one end of the inverted segment to endow the inversion with a dominant-visible phenotype. By careful selection of the endpoints, one may also make an inversion recessive lethal or endow it with an easily discerned recessive phenotype.
Gene-targeting technology now also makes it possible to revisit the use of existing mouse inversions to complement the Cre-loxP-generated inversion resource in mice. In pre-Cre-loxP years, mouse inversions were induced by radiation- or chemical-mutagenesis methods and recovered mainly by screening the progeny of mutagen-treated mice for meiotic anaphase bridges, a cytogenetic hallmark of inversion heterozygotes (RODERICK 1983). The largest collection of inversions came from the work of T. Roderick (RODERICK and HAWES 1974; RODERICK 1983; BEECHEY 1994). However, among the many inversions in the collection, only In(4)56Rk shows a dominant phenotype (RODERICK et al. 1997), although some were recessive lethal, presumably due to the interruption of an essential gene(s) by the inversion breakpoint(s) (RODERICK 1983). Thus, these original mutagen-induced mouse inversions were of limited utility as balancers.
With gene-targeting techniques, however, such existing inversions can be modified to acquire genetic attributes that can make them effective balancers. Here, we report the modification of one of Roderick's recessive-lethal inversions, In(15)21Rk, so that now it carries a dominant coat-color marker, namely the K14-Agouti minigene. Heterozygotes carrying this modified In(15)21Rk show light pigmentation/coloration on the tail and back of the ears, whereas homozygotes remain unrecoverable (RODERICK 1983). Thus, this modified inversion now possesses the favorable features of a balancer chromosome and should be useful for recovery and maintenance of mutations mapping to the proximal two-thirds of chromosome 15.
Stock maintenance:
Heterozygous In(15)21Rk/+ mice are outwardly normal, whereas homozygous In(15)21Rk/In(15)21Rk mice do not survive to birth. In(15)21Rk was imported from The Jackson Laboratory (Bar Harbor, ME) and was maintained at the Oak Ridge National Laboratory as a closed-colony stock of a/a; In(15)21Rk +/+ Matpuw compound heterozygotes. Matpuw is the prototypic recessive allele at the classical mouse coat-color locus underwhite (uw); the mutation is a 7-bp deletion identified in exon 3 of the Matp (membrane-associated transporter protein) gene (NEWTON et al. 2001; DU and FISHER 2002). Intercrosses of In(15)21Rk +/+ Matpuw mice yield three classes of offspring: (i) homozygous In(15)21Rk +/In(15)21Rk + mice, which are nonviable; (ii) compound heterozygous In(15)21Rk +/+ Matpuw mice, which have black coat color; and (iii) homozygous + Matpuw /+ Matpuw mice, which have creamy whitish coat color and eyes lacking pigmentation at birth (but darkening by weaning age).
Derivation and characterization of In(15)21Rk/+ ES cell line:
Mouse embryos for derivation of ES cells carrying In(15)21Rk were recovered from superovulated females. Five In(15)21Rk +/+ Matpuw females at 6 weeks of age were given 5 units (in 0.1 ml) of pregnant mare's serum (Sigma, St. Louis) and, after 46 hr, given 5 units (in 0.1 ml) of human chorionic gonadotropin (Calbiochem, San Diego), both intraperitoneally. They were mated to 129X1/SvJ males to increase the success rate of ES cell derivation (KRESS et al. 1998). Females were checked for vaginal plugs the next morning, at which time the embryos were regarded as 0.5 day postcoitum (dpc). Blastocysts were harvested on 3.5 dpc and washed at least five times in ES cell media [Dulbecco's modified Eagle medium (DMEM), high glucose, 15% fetal bovine serum (FBS), 1000 units/ml LIF (Chemicon, Temecula, CA), 0.1 mM nonessential amino acids, 1x nucleosides (Specialty Media, Phillipsburg, NJ), 55 µM ß-mercaptoethanol, 25 units/ml penicillin, and 25 µg/ml streptomycin] before they were seeded individually into culture wells of a 96-well plate coated with 0.1% (w/v) gelatin. Blastocysts were then cultured in ES cell medium for 72 hr, and hatched blastocysts with inner-cell-mass (ICM) outgrowth were trypsinized with 0.05% trypsin/EDTA. The cell suspensions were transferred to wells of a 96-well plate containing a feeder-cell monolayer of mitotically inactivated primary murine embryonic fibroblast (PMEF). ES cell lines were identified by observation of their colony morphology and established and expanded by trypsinization and replating of newly formed colonies. The sex of the ES cell line was determined by PCR of two male-specific genes: a Y chromosome-specific DNA fragment (forward primer MJ17, agtgctaagctgccagtt; reverse primer MJ18, acactgaactgagtgagg) and Sry (forward primer 422F, tagtgttcagccctacagcc; reverse primer 422R, cccgaattcgagtacaggtgtgcagctct; KING et al. 1994; LEVY et al. 1996). Since the inverted chromosome 15 of In(15)21Rk carries a wild-type Matp allele (Matp+), an ES cell line carrying the inversion should contain only wild-type Matp alleles, whereas one lacking the inversion should be heterozygous for Matp+ and the 7-bp Matpuw deletion. The wild-type and 7-bp deletion Matp alleles were differentiated by PCR (forward primer UW3-F, ttctctgccctggttctcat; reverse primer UW3-R, cgtattcatgcatcccactg; Figure 1) . Male In(15)21Rk ES cell lines thus obtained were injected into B6D2F1 x B6 blastocysts to produce chimeras, which were then crossed to C57BL/6 females to test for germline transmission.
|
Targeting construct for Matp:
The complete genomic sequence of the Matp wild-type allele was determined from the public databases (e.g., Ensembl; http://www.ensembl.org/Mus_musculus/). We planned to target a loxP-PGK-neo-loxP cassette and the K14-Agouti marker (KUCERA et al. 1996) into the Matp+ locus on the inverted chromosome 15 segment of the In(15)21Rk/+ ES cells (see Figure 3C). Since the inverted segment of In(15)21Rk was of DBA/2J origin (RODERICK 1983), DBA/2J genomic DNA (purchased from The Jackson Laboratory) was used as template to amplify, by PCR, a 6797-bp DNA fragment from intron 2 of the Matp+ allele. The PCR reaction (50 µl) contained 0.3 µM of forward primer (MatpF1-C, tacatcgatacagtgaaactgtggagggaca), 0.3 µM of reverse primer (MatpR1-N, tattgcggccgcctcccatgaggcagtaagacct), 1x Pfu turbo polymerase buffer, 0.5 mM dNTPs, 2.5 mM MgCl2, 2.5 units Pfu turbo polymerase (Stratagene, La Jolla, CA), and 200 ng DBA/2J genomic DNA using cycling parameters as follows: 95° initial denaturation for 2 min, 35 cycles of 95° denaturation for 30 sec, 58° annealing for 30 sec, 72° extension for 10 min, and a final extension at 72° for 10 min. The primer pair was designed such that the amplicon contained a ClaI site and a NotI site at the 5'- and 3'-end, respectively, which facilitated subcloning. The PCR product was gel purified using a gel-extraction kit (QIAGEN, Valencia, CA) and cloned into pBluescript SK+ to form pMatp. A loxP-PGK-neo-loxP cassette released from p1338 (a gift from T. J. Ley) by BamHI and EcoRV digestion was subcloned into the pMatp (digested with BamHI and EcoRV) to form pMatp-neo. Consequently, the left and right homology arms are 1796 and 4824 bp, respectively. Finally, a 4-kb K14-Agouti minigene (K14iA; KUCERA et al. 1996) was subcloned by blunt-end ligation into the vector pMatp-neo at the BamHI site between the PGK-neo marker and the right homology arm. The resulting targeting construct was designated as pMatp-neo-iA (Figure 2) .
|
|
Ten million In(15)21Rk/+ ES cells were electroporated with 15 µg of linearized targeting construct pMatp-neo-iA at 230 V and 500 µF. They were plated onto two 100-mm culture dishes with PMEF, cultured, and selected with G418 (300 µg/ml) for 7 days. A total of 192 neomycin-resistant clones were screened for homologous recombination events by PCR. The sequence of the forward primer was derived from the region outside of the left homology arm, with the reverse primer derived from within the neo marker. Genomic DNAs were isolated from the ES cells in 96-well plate format as described (RAMIREZ-SOLIS et al. 1993) and were used as DNA templates for PCR screening. The expected amplicon from a targeted recombinant should be 2.2 kb (Figure 2). Targeted ES cell clones were injected into B6D2F1 x B6 blastocysts to produce chimeras. Subsequently, male chimeras were mated to C57BL/6J females to produce mice carrying the In(15)21Rk inversion marked by K14-Agouti. These mice are designated as In(15)21Rk-Matp+tm(K14-Agouti)1R and abbreviated as LE21Rk (LE stands for light ear).
Genotyping LE21Rk:
Progeny from germline chimeras were genotyped with sequence-tagged site marker D15Mit6 (see Figure 3C) , which is polymorphic among the mouse strains DBA/2J, C57BL/6J, and 129X1/SvJ, yielding PCR products 141, 137, and 111 bp, respectively. Mice carrying the DBA/2J allele of D15Mit6 should contain the inversion whereas those carrying the 129 allele should not. PCR reactions were performed as described (DIETRICH et al. 1994) and analyzed on 3.5% Metaphor agarose gels (Cambrex Bio Science Rockland, Rockland, ME).
Fluorescent in situ hybridization:
Metaphase chromosome spreads were prepared from mouse splenocytes as described (FOX and POVEY 2000) with minor modifications. In brief, spleen cells were dissociated in Hank's balanced salt solution and were cultured in DMEM supplemented with 10% FBS, concanavalin A (3 µg/ml), and phytohemagglutinin (6 µg/ml) for 48 hr. The spleen culture was then treated with colchicine at a final concentration of 0.25 µM and incubated for 30 min prior to making chromosome spreads. Bacterial artificial chromosome (BAC) clone RP24-96K14 (BACPAC Resources Center, http://bacpac.chori.org/), which contains the Matp that mapped within the inversion, was fluorescein labeled with the Prime-It kit (Stratagene), and fluorescent in situ hybridization (FISH) was performed as described in the instruction manuals. The FISH results were observed using a Zeiss Axioskop 2 inverted fluorescent microscope with a Spot 100 digital camera linked to a Macintosh G4 computer. The images were processed using Adobe Photoshop v.5.5.ES cell lines from embryos generated from the cross In(15)21Rk +/+ Matpuw x 129X1/SvJ:
ES cell lines were generated from embryos of the cross In(15)21Rk +/+ Matpuw x 129X1/SvJ. The strain-129 genome was introduced because it is known to result in a higher success rate of deriving ES cell lines from the ICM of 3.5-dpc blastocysts (KRESS et al. 1998). Among 19 blastocysts harvested and cultured from five superovulated females, 15 gave rise to ICM outgrowths. From these ICMs, seven ES cell lines were established, of which four (two male, two female) contained In(15)21Rk (Table 1) as indicated by PCR genotyping of the Matp allele (see Figure 1 and MATERIALS AND METHODS). Clone 21Rk-7, a male inversion-bearing ES cell clone, was confirmed to transmit to the germline and used for subsequent gene-targeting experiments.
|
Insertion of the K14-Agouti minigene at the Matp+ locus in the inversion In(15)21Rk:
It has been documented that preferential homologous recombination occurs best when the homology arms of the targeting vector and the ES cell genome are isogenic (TE RIELE et al. 1992). Consequently, we generated homology arms of the agouti-minigene targeting vector from DBA/2J genomic DNA by PCR so that it would recombine preferentially with the inverted chromosome 15 (of DBA/2J origin) rather than with the noninverted 129 allele. Among 192 ES clones screened after electroporation of targeting vector pMatp-neo-iA and G418 selection, seven homologous recombinants (3.6%) were recovered that showed the PCR fragment (2.2 kb) expected for a successful targeting event. These targeted ES cell clones were expanded and frozen as stocks. One clone (D8) was injected into B6D2F1 x B6 blastocysts, resulting in four male germline chimeras that were subsequently used to generate the K14-Agouti-marked In(15)21Rk mice.
Production of K14-Agouti-marked In(15)21Rk mice:
Male germline chimeras derived from the targeted D8 ES cell lines were bred with C57BL/6J females. About 50% (25/52) of their progeny showed lighter pigmentation of the ears and tails, indicating expression of the agouti gene (Figure 3A; ZHENG et al. 1999). Genotyping of D15Mit6 for all the 52 progeny showed that each of the 25 lighter pigmented mice carried the DBA/2 and B6 alleles of chromosome 15. On the other hand, each of their wild-type littermates (27 genotyped) carried the 129 and B6 alleles at D15Mit6 (data not shown). These genotyping results clearly indicated that K14-Agouti had been successfully targeted into the DBA/2J allele of Matp in In(15)21Rk/+ ES cells, that is, into the inverted chromosome 15. FISH analysis of a mouse with light ears and tail, using the Matp-containing BAC clone RP24-96K14 as probe, confirmed the presence of a chromosome 15 inversion (Figure 3, B and C): the fluorescent signal (greenish dots) from the probe on the inverted chromosome 15 (Figure 3, B and C, Inv) is farther away from the centromere (CEN) compared to the signal on the wild-type chromosome 15 (WT).The lighter ear and tail color of mice heterozygous for the modified In(15)21Rk are readily observable around weaning age, starting from the 16th day after birth. The K14-Agouti-marked In(15)21Rk inversion is designated as In(15)21Rk-Matp+tm(K14-Agouti)1R and is abbreviated as LE21Rk.
Available genetic data indicate that the Matp (formerly, uw) locus is very close to both the proximal inversion breakpoint and the centromere (Figure 3C; SEARLE and BEECHEY 1989). We therefore targeted the K14-Agouti minigene into Matp in the inverted chromosome 15 to minimize double-crossing-over-mediated loss of the resulting coat-color marker from the inversion. By using isogenic DBA/2J DNA to develop the targeting construct, we increased the odds of successful insertion of the K14-Agouti minigene into the wild-type Matp allele carried within the inversion. The targeting frequency was 3.6%, which is comparable to other reports using PCR methods to generate the targeting vector (SHARP et al. 1996). While we did not molecularly test directly whether the K14-Agouti minigene had been targeted into the inverted chromosome 15 in the ES cells, segregation analysis of pups from the resulting chimeras unambiguously showed this to be the case. About 50% of pups from chimeric males derived from the targeted ES cells showed lighter ears and tails, a phenotype that cosegregated, without exception, with a DBA/2J allele of D15Mit6. On the other hand, all littermates lacking this lighter ear and tail color carried the 129 allele. FISH analysis of a LE21Rk mouse confirmed that the mouse does indeed carry a chromosome 15 inversion while its wild-type littermate does not (Figure 3B; the FISH result for a wild-type littermate is not shown). These FISH results also confirm that, as expected, Matp is indeed located within the inversion.
We have shown that an existing, unmarked inversion can be modified to carry a visible phenotype appropriate for its use as a balancer chromosome. Although it was not necessary for the inversion that we modified, which is already recessive lethal, one can readily place the dominant marker into an essential locus or into one whose disruption would result in a readily detectable recessive phenotype, thus simultaneously endowing the unmarked inversion with both independent dominant and recessive phenotypes. Unless an inversion with specific breakpoints is the goal, one may consider the modification of a subset of the existing, unmarked inversions (such as the Roderick/Jackson Laboratory inversion resource, which covers almost all the mouse chromosomes) to complement the marked-inversion resource created by chromosome-engineering techniques.
It should be noted that most existing radiation- or chemical-induced inversions are large, most likely a consequence of the way in which they were first identified in the progeny of mutagenized mice (i.e., by the presence of anaphase bridges in newly induced inversion heterozygotes, which would likely result in a bias toward ascertaining larger inversions since the longer the inverted segment, the higher the anaphase bridge frequency, and therefore the better it can be distinguished from the background noise). Whereas large inversions can cover a larger region as a balancer, they are also likely to permit an increased frequency of double crossing over with the wild-type chromosome, particularly in the midportion of the inversion, compared to smaller inversions. Because of this, larger inversions might, at first, appear to be unsuitable for marker modification and use as balancers. However, very little direct data still exist in mice to resolve the issue of inversion length vs. utility as a balancer. Analysis of a three-generation homozygosity screen using the In(1)1Rk inversion (
3550 cM long) showed that only 3.6% presumed double crossovers had occurred (54 of 1503 cases; RODERICK 1983). A gross estimation suggested that an inversion 50 cM long may have a maximum double-crossover frequency of 6.25% for loci that map to the middle of the inverted segment; the double-crossover frequency for most other loci within the inversion should be lower (RINCHIK 2000). This gross estimate, however, was made on the assumption of no crossover interference. Recent genome-wide analysis of 188 meioses from interspecific crosses (BROMAN et al. 2002) appears to validate the long-standing belief that there is considerable positive double-crossover interference in the mouse, which should decrease the occurrence of clustered double crossovers, which in turn should also decrease the overall double-crossover frequency per chromosome, even in large inversions. Particularly cogent in the BROMAN et al. (2002) study was the finding, in 188 meioses, of double-crossover frequencies ranging from 0 to 4.2% in chromosomes 10 and 1219. Thus, if one assumes these frequencies will be valid for inversion heterozygotes as they are for interspecific backcrosses, even large inversions covering most of the length of each of these chromosomes may be worthy of modification for use as balancers.
Modification of a long, existing inversion could also serve as an important intermediate step in the creation of a "true" balanceri.e., the type of multiply inverted chromosome, such as that used routinely in Drosophila, that will virtually eliminate recovery of any recombinant progeny, including double crossovers. For example, one could envision applying chromosome-engineering techniques to introduce smaller inversions into existing larger inversions that have been captured in ES cell lines. In this way, multiply inverted, marked balancers could be created with fewer of the ES cell manipulation steps that might otherwise compromise their germline pluripotency. These types of multiply inverted true balancers would be the tools of choice for phenotype-driven regional mutagenesis, as well as providing indispensable tools for maintaining all lethal or otherwise detrimental mutations induced anywhere in the mouse genome by any technique.
Genetic background often drastically affects phenotype of a mutation due to modifier genes (NADEAU 2001). Therefore, one must take genetic background of a balancer into consideration before using it to maintain a specific mutation. Ideally, a balancer should already be a congenic strain in the desired genetic background before it is used to maintain a specific mutation. Otherwise it should be bred into a desired genetic background first and then used as a balancer so that a specific phenotype can be maintained and studied later.
Chromosome 15 is now virtually covered by two well-marked inversions: In(15)21Rk-Matp+tm(K14-Agouti)1R, described here and covering the proximal two-thirds of the chromosome, and In(15)Eh2Rl (BANGHAM 1965, 1968; DAVISSON et al. 1990; RINCHIK 2000), which covers the distal one-half to one-third. Thus, any chromosome 15 mutation that cannot be maintained in homozygotes can now be easily and cost effectively maintained using one of these inversions. As the use of mutant mice becomes even more widespread to analyze gene function and complex biological systems in the postgenome era, newly available balancer chromosomes (ZHENG et al. 1999; RINCHIK 2000; NISHIJIMA et al. 2003) will serve as important tools for recovering new mutations and for maintaining lethal and otherwise detrimental as well as currently difficult-to-maintain genetic mutations, such as unmarked lethal deletions (KUSHI et al. 1998; THOMAS et al. 1998; YOU et al. 1997a,b).
ASHBURNER, M., 1989 Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
BANGHAM, J. W., 1965 Hairy ears Eh. Mouse News Lett. 33: 68.
BANGHAM, J. W., 1968 The mutant hairy ears, Eh, reported in MNL 33:68 is homozygous lethal. Mouse News Lett. 38: 32.
BEECHEY, C. V., 1994 List of chromosome anomalies. Mouse Genome 92: 336347.
BROMAN, K. W., L. B. ROWE, G. A. CHURCHILL and K. PAIGEN, 2002 Crossover interference in the mouse. Genetics 160: 11231131.
DAVISSON, M. T., T. H. RODERICK, E. C. AKESON, N. L. HAWES and H. O. SWEET, 1990 The hairy ears (Eh) mutation is closely associated with a chromosomal rearrangement in mouse chromosome 15. Genet. Res. 56: 167178.[Medline]
DIETRICH, W. F., J. C. MILLER, R. G. STEEN, M. MERCHANT, D. DAMRON et al., 1994 A genetic map of the mouse with 4006 simple sequence length polymorphisms. Nat. Genet. 7: 220245.[CrossRef][Medline]
DU, J., and D. E. FISHER, 2002 Identification of Aim-1 as the underwhite mouse mutant and its transcriptional regulation by MITF. J. Biol. Chem. 277: 402406.
FOX, M., and S. POVEY, 2000 Fluorescent in situ hybridization (FISH) to mouse chromosomes, pp. 154169 in Mouse Genetics and Transgenics: A Practical Approach, edited by I. JACKSON and C. ABBOTT. Oxford University Press, New York.
JUSTICE, M. J., J. K. NOVEROSKE, J. S. WEBER, B. ZHENG and A. BRADLEY, 1999 Mouse ENU mutagenesis. Hum. Mol. Genet. 8: 19551963.
KING, T. R., G. J. CHRISTIANSON, M. J. MITCHELL, C. E. BISHOP, D. SCOTT et al., 1994 Deletion mapping by immunoselection against the H-Y histocompatibility antigen further resolves the Sxra region of the mouse Y chromosome and reveals complexity of the Hya locus. Genomics 24: 159168.[CrossRef][Medline]
KRESS, C., S. VANDORMAEL-POURNIN, P. BALDACCI, M. COHEN-TANNOUDJI and C. BABINET, 1998 Nonpermissiveness for mouse embryonic stem (ES) cell derivation circumvented by a single backcross to 129/Sv strain: establishment of ES cell lines bearing the Omd conditional lethal mutation. Mamm. Genome 9: 9981001.[CrossRef][Medline]
KUCERA, G. T., D. M. BORTNER and M. P. ROSENBERG, 1996 Overexpression of an Agouti cDNA in the skin of transgenic mice recapitulates dominant coat color phenotypes of spontaneous mutants. Dev. Biol. 173: 162173.[CrossRef][Medline]
KUSHI, A., K. EDAMURA, M. NOGUCHI, K. AKIYAMA, Y. NISHI et al., 1998 Generation of mutant mice with large chromosomal deletion by use of irradiated ES cellsanalysis of large deletion around hprt locus of ES cell. Mamm. Genome 9: 269273.[CrossRef][Medline]
LEVY, N., P. DE BOER, J. MATTEI and M. J. MITCHELL, 1996 Molecular analysis of an isoYq chromosome in a sterile male mouse. Mamm. Genome 7: 608609.[CrossRef][Medline]
LYON, M. F., R. J. PHILLIPS and G. FISHER, 1982 Use of an inversion to test for induced X-linked lethals in mice. Mutat. Res. 92: 217228.[Medline]
NADEAU, J. H., 2001 Modifier genes in mice and humans. Nat. Rev. Genet. 2: 165174.[Medline]
NEWTON, J. M., O. COHEN-BARAK, N. HAGIWARA, J. M. GARDNER, M. T. DAVISSON et al., 2001 Mutations in the human orthologue of the mouse underwhite gene (uw) underlie a new form of oculocutaneous albinism, OCA4. Am. J. Hum. Genet. 69: 981988.[CrossRef][Medline]
NISHIJIMA, I., A. MILLS, Y. QI, M. MILLS and A. BRADLEY, 2003 Two new balancer chromosomes on mouse chromosome 4 to facilitate functional annotation of human chromosome 1p. Genesis 36: 142148.[CrossRef][Medline]
RAMIREZ-SOLIS, R. A., C. DAVIS and A. BRADLEY, 1993 Gene targeting in embryonic stem cells, pp. 855878 in Methods in Enzymology: Guide to Techniques in Mouse Development, edited by P. M. WASSARMAN and M. L. DEPAMPHILIS. Academic Press, San Diego.
RINCHIK, E. M., 2000 Developing genetic reagents to facilitate recovery, analysis, and maintenance of mouse mutations. Mamm. Genome 11: 489499.[CrossRef][Medline]
RODERICK, T. H., 1983 Using inversions to detect and study recessive lethals and detrimentals in mice, pp. 135167 in Utilizing of Mammalian Specific Locus Studies in Hazard Evaluation and Estimation of Genetic Risk, edited by F. J. DE SERRES and W. SHERIDAN. Plenum Press, New York/London.
RODERICK, T. H., and N. L. HAWES, 1974 Nineteen paracentric chromosomal inversions in mice. Genetics 76: 109117.
RODERICK, T. H., B. CHANG, N. L. HAWES and J. R. HECKENLIVELY, 1997 A new dominant retinal degeneration (Rd4) associated with a chromosomal inversion in the mouse. Genomics 42: 393396.[CrossRef][Medline]
SEARLE, A. G., and C. V. BEECHEY, 1989 Map of reciprocal translocations, inversions, and insertions, pp. 620625 in Genetic Variants and Strains of the Laboratory Mouse, edited by M. F. LYON and A. G. SEARLE. Oxford University Press, Oxford.
SHARP, M. G., D. FETTES, G. BROOKER, A. F. CLARK, J. PETERS et al., 1996 Targeted inactivation of the Ren-2 gene in mice. Hypertension 28: 11261131.
TE RIELE, H., E. MAANDAG and A. BERNS, 1992 Highly efficient gene targeting in embryonic stem cells through homologous recombination with isogenic DNA constructs. Proc. Natl. Acad. Sci. USA 89: 51285132.
THOMAS, J. W., C. LAMANTIA and T. MAGNUSON, 1998 X-ray-induced mutations in mouse embryonic stem cells. Proc. Natl. Acad. Sci. USA 95: 11141119.
YOU, Y., R. BERGSTROM, M. KLEMM, B. LEDERMAN, H. NELSON et al., 1997a Chromosomal deletion complexes in mice by radiation of embryonic stem cells. Nat. Genet. 15: 285288.[CrossRef][Medline]
YOU, Y., V. L. BROWNING and J. C. SCHIMENTI, 1997b Generation of radiation-induced deletion complexes in the mouse genome using embryonic stem cells. Methods 13: 409421.[CrossRef][Medline]
ZHENG, B., M. SAGE, W. W. CAI, D. M. THOMPSON, B. C. TAVSANLI et al., 1999 Engineering a mouse balancer chromosome. Nat. Genet. 22: 375378.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
K. A. Fantauzzo, M. Tadin-Strapps, Y. You, S. E. Mentzer, F. A.M. Baumeister, S. Cianfarani, L. Van Maldergem, D. Warburton, J. P. Sundberg, and A. M. Christiano A position effect on TRPS1 is associated with Ambras syndrome in humans and the Koala phenotype in mice Hum. Mol. Genet., November 15, 2008; 17(22): 3539 - 3551. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Chick, W. S. H.
- Articles by You, Y.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Chick, W. S. H.
- Articles by You, Y.





