Genetics, Vol. 167, 663-672, June 2004, Copyright © 2004
doi:10.1534/genetics.103.026021

Caenorhabditis elegans lin-35/Rb, efl-1/E2F and Other Synthetic Multivulva Genes Negatively Regulate the Anaphase-Promoting Complex Gene mat-3/APC8

Department of Genetics, University of Pennsylvania, Philadelphia, Pennsylvania 19104-6100

2 Corresponding author: Department of Genetics, University of Pennsylvania, 446A Clinical Research Bldg., 415 Curie Blvd., Philadelphia, PA 19104-6145.
E-mail: sundaram{at}mail.med.upenn.edu

Manuscript received December 31, 2003. Accepted for publication March 12, 2004.

ABSTRACT

Retinoblastoma (Rb)/E2F complexes repress expression of many genes important for G1-to-S transition, but also appear to regulate gene expression at other stages of the cell cycle. In C. elegans, lin-35/Rb and other synthetic Multivulva (SynMuv) group B genes function redundantly with other sets of genes to regulate G1/S progression, vulval and pharyngeal differentiation, and other unknown processes required for viabilty. Here we show that lin-35/Rb, efl-1/E2F, and other SynMuv B genes negatively regulate a component of the anaphase-promoting complex or cyclosome (APC/C). The APC/C is a multisubunit complex that promotes metaphase-to-anaphase progression and G1 arrest by targeting different substrates for ubiquitination and proteasome-mediated destruction. The C. elegans APC/C gene mat-3/APC8 has been defined by temperature-sensitive embryonic lethal alleles that strongly affect germline meiosis and mitosis but only weakly affect somatic development. We describe severe nonconditional mat-3 alleles and a hypomorphic viable allele (ku233), all of which affect postembryonic cell divisions including those of the vulval lineage. The ku233 lesion is located outside of the mat-3 coding region and reduces mat-3 mRNA expression. Loss-of-function alleles of lin-35/Rb and other SynMuv B genes suppress mat-3(ku233) defects by restoring mat-3 mRNA to wild-type levels. Therefore, Rb/E2F complexes appear to repress mat-3 expression.


THE retinoblastoma (Rb) protein is an important tumor suppressor and regulator of gene expression (for reviews see HARBOUR and DEAN 2000; STEVAUX and DYSON 2002). Rb itself does not bind DNA; instead it binds to E2F transcription factors and recruits corepressor complexes to E2F target promoters, thereby repressing gene transcription. Some E2F proteins function as transcriptional activators in the absence of Rb, while other E2F proteins serve only as corepressors with Rb. Rb/E2F complexes inhibit G1-to-S phase progression by repressing target genes such as cyclin E and cyclin A (DEGREGORI et al. 1995; OHTANI et al. 1995; SCHULZE et al. 1995; REN et al. 2002). Rb/E2F complexes also regulate targets important for other stages of the cell cycle and for differentiation (LUKAS et al. 1999; DAHIYA et al. 2001; FAY et al. 2003). For example, microarray and chromatin immunoprecipitation experiments have identified spindle checkpoint genes and other mitotic genes as likely targets of E2F (ISHIDA et al. 2001; MULLER et al. 2001; REN et al. 2002; DIMOVA et al. 2003). However, the functional importance of these mitotic targets is not understood.

The anaphase-promoting complex or cyclosome (APC/C) is a multisubunit E3 ubiquitin ligase that plays multiple roles in cell-cycle progression (HARPER et al. 2002; PETERS 2002). For example, in conjunction with the regulatory subunit Cdc20/Fizzy (Fzy) the APC/C targets anaphase inhibitors such as Pds1/securin for destruction and thus allows metaphase-to-anaphase transition during meiosis and mitosis (DAWSON et al. 1995; SIGRIST et al. 1995; VISINTIN et al. 1997). In conjunction with a different regulatory subunit, Cdh1/Fizzy-related (Fzr), the APC/C targets mitotic cyclins for destruction and thus inhibits G1-to-S progression (SIGRIST and LEHNER 1997; VISINTIN et al. 1997). The APC/C is therefore important for both mitotic progression and G1 arrest.

In Caenorhabditis elegans, cell-cycle regulation by Rb/E2F and by the APC/C has often been studied in the context of vulval development (FURUTA et al. 2000; BOXEM and VAN DEN HEUVEL 2001). Vulval development involves stereotypical patterns of cell division that give rise to a total of 22 vulval descendants (Figure 1 ; WANG and STERNBERG 2001). Reduced or increased proliferation is easily detected in this tissue. Because vulval divisions occur relatively late in larval development (after maternally provided gene products have decayed), the vulva is one of the tissues most commonly affected in cell-cycle mutants. Vulval development is also controlled by several oncogene signaling pathways, including Ras, Wnt, and Notch pathways (WANG and STERNBERG 2001), and thus provides a convenient system to test how these signaling pathways coordinately influence cell fate patterning and cell-cycle progression.



View larger version (24K):
In this window
In a new window
Download PPT slide
 
FIGURE 1.—

Stages of vulval development. The vulval precursor vells (VPCs) P3.p–P8.p all divide to generate Pn.px daughters. VPCs that have been induced to adopt a vulval fate (P5.p, P6.p, and P7.p) undergo two additional rounds of division to generate at total of 22 Pn.pxxx nuclei (SULSTON and HORVITZ 1977; SULSTON and WHITE 1980).

 
C. elegans lin-35/Rb and efl-1/E2F function redundantly with other genes to control multiple aspects of development. First, lin-35/Rb and efl-1/E2F function redundantly with other cell-cycle regulators to inhibit G1-to-S progression of vulval and other cells. For example, although lin-35/Rb mutations alone do not cause obvious cell-cycle defects, they cause hyperproliferation in an fzr-1 (Fzr) mutant background (FAY et al. 2002) and enhance the hyperproliferative defects of cki-1,2 (cyclin kinase inhibitor) mutants (BOXEM and VAN DEN HEUVEL 2001). Second, lin-35/Rb and efl-1/E2F genes belong to a larger group of "synthetic multivulva" (SynMuv) genes, two sets of genes that function redundantly to inhibit Ras-mediated vulval fate induction (FERGUSON and HORVITZ 1989; LU and HORVITZ 1998; Ceol and HORVITZ 2001). Mutations in class A or class B SynMuv genes have little or no effect on vulval development, but class A/class B double mutants have excess vulval induction (multivulva phenotype), as do activated Ras pathway mutants. lin-35/Rb and efl-1/E2F are class B SynMuv genes and appear to inhibit vulval gene expression (LU and HORVITZ 1998; CEOL and HORVITZ 2001), although direct targets of these genes have not yet been identified. Finally, lin-35/Rb seems to have additional essential (but redundant) roles since a variety of mutations have been found to cause synthetic lethality in a lin-35/Rb mutant background (FAY et al. 2002, 2003).

Mutations in several C. elegans APC/C subunits have been identified in screens for temperature-sensitive maternal-effect lethal mutants that arrest at the one-cell stage (FURUTA et al. 2000; GOLDEN et al. 2000; DAVIS et al. 2002; RAPPLEYE et al. 2002; SHAKES et al. 2003). These include emb-27 (APC6/Cdc16), emb-30 (APC4), mat-1 (APC3/Cdc27), mat-2 (APC1/Tsg24), and mat-3 (APC8/Cdc23). Phenotypic analysis of these temperature-sensitive APC/C mutants has suggested an absolute requirement for the APC/C for metaphase-to-anaphase progression during germline meiosis and mitosis, but has not revealed significant somatic requirements. Null mutations in emb-30/APC4 do cause some somatic defects, but due to perdurance of maternally provided gene product, these defects are apparent only in late-proliferating tissues such as the gonad, germline, male tail, and hermaphrodite vulva (FURUTA et al. 2000). Null mutations of other APC/C subunit genes have not yet been described.

Here we describe new alleles of the APC8 gene mat-3, including a likely null allele (cs53) and a hypomorphic viable allele (ku233) that reduces mat-3 expression levels. Mutations in lin-35/Rb and other SynMuv B genes suppress ku233 developmental defects and restore mat-3 expression levels, suggesting that LIN-35/Rb and EFL-1/E2F normally repress mat-3/APC8 transcription.


MATERIALS AND METHODS

General methods and strains:

Standard methods were used for the handling and culturing of C. elegans (BRENNER 1974). Unless otherwise noted, experiments were performed at 20°. Mutations are described in RIDDLE et al. (1997) unless otherwise noted. Mutations used were:
  1. I: dpy-5(e61), lin-35(n745), lin-53(n833) (LU and HORVITZ 1998), unc-13(e51).
  2. II: dpl-1(n3643) (CEOL and HORVITZ 2001), fzr-1(ku298) (FAY et al. 2002), lin-8(n111), hDf35 (KITAGAWA et al. 2002), mIn1 (EDGLEY and RIDDLE 2001), unc-4(e120).
  3. III: daf-7(e1372), dpy-1(e1), lin-36(n766), mat-3(ax68) (GOLDEN et al. 2000), ruIs32 [unc-119(+) pie-1::GFP::H2B] (PRAITIS et al. 1999), unc-45(e286), wcDf1 (TERNS et al. 1997).
  4. IV: let-60(n1046gf).
  5. V: efl-1(n3318) (CEOL and HORVITZ 2001), him-5(e1490).
  6. X: lin-15(n309), unc-1(e538).

Isolation of mat-3 alleles:

ku233 was identified as an egg-laying defective mutant after gamma-irradiation (2400 rad) of strain MH620 [lin-45(ku112) dpy-20(e1282)] (M. SUNDARAM and M. HAN, unpublished results). Mapping experiments indicated that ku233 maps very close and likely to the left of unc-45 on chromosome III. Of 722 ku233 homozygotes segregating from ku233/unc-45 mothers, none were unc-45/+. Of 62 ku233 not daf-7 recombinants segregating from ku233 daf-7/unc-45 mothers, none were unc-45/+. ku233 was outcrossed with N2 six times to generate strain UP63, on which all phenotypic analyses were performed.

cs53 and cs54 were isolated in a noncomplementation screen. him-5 males were mutagenized with 50 mM EMS (BRENNER 1974) and crossed to mat-3(ku233) daf-7; unc-1 hermaphrodites. Approximately 3500 non-Unc cross-progeny were screened for egg-laying defective (Egl) or protruding vulva phenotypes. Both cs53 and cs54 were outcrossed twice and balanced over unc-45 to generate strains UP666 and UP668 on which all phenotypic analyses were performed.

Molecular analysis and rescue of mat-3:

Genomic rescue fragments were generated by long-range PCR using Expand Long Template DNA polymerase (Roche Behringer). Primers oJD1 (GCCACGTGACTCTGCTGGAACCAA) and oDG43 (GGGAGGATAATCGACAAGGGG) and primers oDG55 (CCCCGCTGCTACTTCCTCTG) and oDG43 were used to generate rescuing fragments PCR.JD1 and PCR.JD2, respectively. Primers oJD1 and oDG8 (CCGGGTGCGTAAAGGCTATTC) were used to generate nonrescuing fragment PCR.JD3. To express cDNAs under the control of the eft-3 promoter, eft-3 promoter elements from TR#428 (MITROVICH and ANDERSON 2000) were cloned as a SphI-XbaI fragment into pPD49.26 (kindly provided by A. Fire) to generate pRH40. The full-length mat-3 cDNA was amplified from clone yk459d5 with primers oJD12 (CTAGCTAGCAAAATGAACGTGAGTTTTTCAACT) and OJD13 (CGGGGTACCTCAAAACGAGAAATCATCCTC) and cloned as an NheI-KpnI fragment into pRH40 to generate pJD10. PCR fragments (100 ng/µl) or pJD10 (10 ng/µl) were injected into mat-3(ku233) animals along with 100 ng/µl of the rol-6D transformation marker pRF4 (MELLO et al. 1991). pRF4 alone had no effect on the mat-3(ku233) phenotype (data not shown).

To identify the ku233 lesion, we PCR amplified and sequenced the mat-3 genomic region between primers oDG55 and oDG43 from ku233 mutant worms. The 2-bp changes found (Figure 2) are not present in the parental MH620 strain. To identify the cs53 and cs54 lesions we PCR amplified and sequenced all exons and exon/intron boundaries from mutant worms. cs53 changes codon 274 (TGG, tryptophan) to TGA (stop). cs54 changes the intron 7 splice donor from GT to AT.



View larger version (18K):
In this window
In a new window
Download PPT slide
 
FIGURE 2.—

The mat-3(ku233) lesion affects a conserved element upstream of the mat-3 operon. (A) mat-3 rescue constructs. F10C5.2 and mat-3/F10C5.1 appear to be part of an operon (DAVIS et al. 2002). Another predicted gene, Y55B1BR.4, is located close by on the opposite strand. ku233 mutants contain 2-bp substitutions ~450 bp upstream of the F10C5.2 gene (asterisk). ku233 Egl and sterile defects were rescued by PCR.JD1 and PCR.JD2, long-range PCR products containing the mat-3 gene, and by pJD10, a plasmid containing the mat-3 cDNA ubiquitously expressed under the control of the eft-3 promoter (see MATERIALS AND METHODS). The percentage of fertile, egg-laying competent hermaphrodites was restored from <15% in ku233 controls to >90% in transgenic animals. (B) Alignment of the ku233 mutant regions between C. elegans and C. briggsae. TRANSFAC analysis (MATYS et al. 2003) did not detect any known transcription factor binding sites in this sequence.

 

Phenotypic characterization of mat-3 mutants:

General characterization of vulval development as normal vs. abnormal was based on differential interference contrast (DIC) observations of mid-L4 stage hermaphrodites. Vulval development was scored as normal if the vulval invagination was symmetric and contained 22 nuclei and abnormal if the vulval invagination was asymmetric or contained <22 nuclei. Vulval cell divisions in wild-type, mat-3(ku233), and lin-35(n745) mutants were also followed by DIC microscopy. To assess the length of mitosis in Pn.p or Pn.px cells, we recorded the time intervals between the completion of nucleolar breakdown, the appearance and disappearance of metaphase chromosomes, and the appearance of daughter nuclei. Only P5.p–P7.p (or their descendants) were followed. 4',6-Diamidino-2-phenylindole (DAPI) staining was performed by incubating L4 or adult-stage hermaphrodites in 200 mg/ml DAPI in ethanol for 30 min at room temperature.

RNAi experiments:

RNAi was performed by microinjection essentially as described (FIRE et al. 1998). DNA templates were generated by PCR of cDNA clones yk434b7 (cki-1), yk131f10 (fzr-1), yk435e2 (fzy-1), yk117a4 (lin-15A), yk62g9 (lin-15B), yk13c4 (lin-35), pRH18 (lin-36), and yk143c11 (lin-53). Double-strand RNAs (dsRNAs) were prepared by in vitro transcription with T3 and T7 RNA polymerases [Ambion (Austin, TX) Megascript kit]. The effectiveness of dsRNA for each SynMuv gene was verified by testing for the ability to elicit a SynMuv phenotype in an appropriate genetic background [lin-15A(n767) or lin-36(n766)]. For all experiments, multiple adult hermaphrodites were injected with dsRNA and F1 progeny laid >3 hr postinjection were scored.

Real-time PCR:

Synchronized L1 larvae were obtained by hypochlorite treatment to select for embryos and subsequent culture in M9 buffer for 24–36 hr. L1 larvae were distributed onto plates with food and allowed to grow for 32 hr, at which point most animals were at the mid-L3 stage. Larvae were then collected and RNA extracted using TRIZOL reagent (GIBCO-BRL, Gaithersburg, MD). A total of 650–1200 ng of total RNA from each strain was reverse transcribed using oligo-dT primer [Invitrogen (San Diego) Superscript First Strand Synthesis System for RT-PCR). A total of 120–230 ng of first-strand cDNA was then used as template for real-time PCR using Taqman Universal PCR master mix (Applied Biosystems, Foster City, CA), probes labeled with the 5' reporter dye FAM and 3' quencher dye TAMRA, and a Perkin-Elmer (Norwalk, CT) ABI 7700 machine. Primers for mat-3 were oJD16 (CGACTTGCGTTGATTCAACAG) and oJD19 (CCGCGCAAGTTGGTATCTT). Probe for mat-3 was CGCCAGCCGGACAATACCGTG. Primers for reference mRNA mek-2 were oJD23 (TGATTGATTCGATGGCCAACT) and oJD24 (CAGGCACTGGATATCGTCCAA). Probe for mek-2 was TTATATGGCGCCCGAACGACTCACA. mek-2 levels were comparable across different samples with similar RNA inputs, indicating that the genotypes tested do not significantly alter mek-2 expression (data not shown). Standard curves for mat-3 and mek-2 were generated using known concentrations of the cDNA-containing plasmids pJD10.2 and pMS73. Sequence Detector software 1.9.1 (Applied Biosystems) was used to calculate the copy numbers of mat-3 and mek-2 cDNAs.


RESULTS

Isolation of mat-3 alleles:

mat-3(ku233) was identified in a genetic screen for Egl mutants (MATERIALS AND METHODS). mat-3(ku233) homozygotes are viable and show incompletely penetrant Egl and sterile phenotypes. Both phenotypes are cold sensitive, being more highly penetrant at 15° or 20° than at 25° (Table 1) . ku233 appears to be a weak hypomorphic allele since the Egl and sterile phenotypes are recessive and sterility becomes more severe when ku233 is placed in trans to wcDf1 (a deficiency that removes the mat-3 region; TERNS et al. 1997) or to other mat-3 alleles (Table 1; see below). The ku233 Egl and sterile phenotypes are rescued by introduction of a genomic transgene containing the mat-3 operon as well as by ubiquitous expression of a mat-3 cDNA construct (Figure 2A). We did not find any lesion within the mat-3 coding region in ku233 mutants; however, we did identify two adjacent base-pair changes ~400 bp upstream of the mat-3 operon (Figure 2). These lesions affect a 16-bp potential cis-regulatory element conserved between C. elegans and the related species C. briggsae (Figure 2B). Real-time PCR experiments showed that ku233 mutants have 5- to 10-fold lower levels of mat-3 mRNA compared to wild type (WT; Table 2) . Thus ku233 mutants are likely to have reduced expression levels of an otherwise normal MAT-3 protein.


View this table:
In this window
In a new window

 
TABLE 1

Genetic and phenotypic analyses of mat-3 mutants

 

View this table:
In this window
In a new window

 
TABLE 2

lin-35/Rb and dpl-1/DP mutations restore mat-3 mRNA levels in ku233 mutants

 
MAT-3 is a tetratricopeptide (TPR) repeat-containing protein orthologous to Saccharomyces cerevisiae Cdc23p and mammalian APC8 (DAVIS et al. 2002) and would be expected to be an essential subunit of the APC/C. All previously described mat-3 alleles are temperature-sensitive embryonic lethals and cause few or no defects in postembryonic somatic development (GOLDEN et al. 2000; RAPPLEYE et al. 2002). A noncomplementation screen with ku233 (MATERIALS AND METHODS) identified two strong nonconditional mat-3 alleles, cs53 and cs54. Homozygotes for either allele are viable but have a variety of developmental defects and are completely sterile (Table 1). cs53 is a nonsense mutation predicted to truncate the MAT-3 protein after the first TPR repeat (MATERIALS AND METHODS). cs54 affects a splice donor site (MATERIALS AND METHODS). Both the molecular lesion and deficiency experiments (Table 1) suggest that cs53 is likely null.

Phenotypic characterization of mat-3 mutants:

Embryonic and early larval development appear normal even in the strongest mat-3 mutants, apparently due to perdurance of maternally provided gene product. However, all three mat-3 alleles cause developmental defects in late-proliferating tissues such as the gonad, germline, male tail, and hermaphrodite vulva (Figures 3 and 4) .



View larger version (68K):
In this window
In a new window
Download PPT slide
 
FIGURE 3.—

Germline phenotypes of mat-3 mutants. (A–D) The average number of metaphase nuclei (arrows) per gonad arm was assessed in DAPI-stained L4 hermaphrodites. (A) WT (1.8 ± 1.0, n = 20). (B) cs53 (7.2 ± 2.7). (C) cs54 (not quantitated). (D) ku233 (1.8 ± 1.4, n = 17). (E and F) DAPI-stained adult hermaphrodites. (E) WT, showing normal mitotic and meiotic (pachytene) nuclei and mature oocytes (arrows). (F) cs53, showing deteriorated germline. (G and H) Adult hermaphrodites expressing the histone2B::GFP reporter ruIs32 (PRAITIS et al. 1999). (G) WT, with six bivalents visible in proximal oocyte (arrow). (H) ku233, with more than six bivalents visible in oocyte (arrow). The distal gonad (dorsal) is on the top in all images.

 


View larger version (78K):
In this window
In a new window
Download PPT slide
 
FIGURE 4.—

Vulval defects of mat-3 mutants and suppression by fzr-1 and SynMuv mutations. (A) WT, late L3, with four equally sized P6.pxx nuclei (lines). (B) ku233, late L3, showing unequally sized P6.pxx nuclei (lines). (C) WT, early L4. (D) ku233, early L4, showing disorganized invagination and some unresolved cell divisions (arrows). (E) WT, mid-L4. (F) cs53, mid-L4, showing widespread unresolved cell divisions (arrows). (G) cs54, mid-L4, showing undivided P7.pp nucleus (arrowhead). (H) ku233, mid-L4, showing undivided P5.pp and P7.pp nuclei (arrowheads). (I) ku233, mid-L4, showing multiple disorganized invaginations. (J) fzy-1(RNAi), mid-L4, showing multiple disorganized invaginations and undivided P6.px nuclei (arrowheads). (K) fzr-1(ku298); ku233, mid-L4, showing suppression of vulval defects (compare to E). (L) lin-35(n745); ku233, mid-L4, showing suppression of vulval defects (compare to E).

 
mat-3(cs53) animals have the most severe defects. At the L4 stage, cs53 mutant germlines contain an increased number of mitotic germ nuclei arrested at metaphase as assessed by DAPI staining (approximately fourfold greater than that of wild type; Figure 3B). By adulthood, mutant germlines appear to disintegrate such that no germ nuclei are present in the distal part of the gonad (Figure 3F) and no sperm or oocytes are ever formed. Males lack rays and spicules (data not shown), and hermaphrodites show severely reduced numbers of vulval nuclei (Figure 4F). These defects are similar to those reported for null mutations in emb-30/APC4 (FURUTA et al. 2000) and are consistent with a requirement for the APC/C during somatic and germline mitosis.

mat-3(ku233) animals have weaker defects and can be propagated as a homozygous strain. ku233 hermaphrodites do not have obvious defects in germline mitosis (Figure 3D) and most animals produce morphologically normal sperm and oocytes and give rise to live progeny. However, some animals have mislocalized sperm within the uterine cavity or distal gonad (data not shown) and/or accumulate oocytes with abnormal chromosome morphologies (Figure 3H). Embryonic and early larval development is apparently normal, but most ku233; him-5 males have abnormal spicules (78%, n = 27) and most ku233 hermaphrodites have abnormal vulvae (85%, n = 186; Figure 4, B, D, H, and I). The development of these sex-specific structures therefore seems particularly sensitive to the reduction in mat-3 expression.

By observing the vulval lineages (see Figure 1) in ku233 mutants, we found that the vulval precursor cells P3.p–P8.p appear morphologically normal and divide with a lengthened mitosis (see below) to generate morphologically normal Pn.px daughter cells. Some Pn.px cells occasionally fail to divide (Figure 4H), but most divide with a lengthened mitosis (see below) to generate Pn.pxx daughters of variable nuclear size and positioning (Figure 4B). The last round of vulval divisions is highly abnormal and Pn.pxxx nuclei sometimes fail to resolve (Figure 4D). By the mid-L4 stage, the vulval invagination appears grossly disorganized (Figure 4I).

To characterize further the mitotic delays seen during vulval cell divisions, we compared the timing of mitotic progression in wild-type vs. ku233 mutants (Table 3) . In wild type, nucleolar breakdown is the first observable indication of mitotic entry. Within a few minutes of nucleolar breakdown, metaphase chromosomes become visible as two parallel lines and then persist for ~5 min before separating at anaphase and disappearing from view. Approximately 5 min later, the daughter nuclei appear. In ku233 mutants, nucleolar breakdown is followed closely by the appearance of metaphase chromosomes, which then persist for more than twice the normal time (Table 3). There is also a delay between the disappearance of the chromosomes following anaphase and the appearance of the daughter nuclei (Table 3). Thus ku233 mutants appear to be defective at the metaphase-to-anaphase transition as well as in subsequent exit from mitosis.


View this table:
In this window
In a new window

 
TABLE 3

mat-3(ku233) mutants have delays in mitotic progression

 

mat-3(ku233) defects are mimicked by reducing fzy-1 and are suppressed by reducing fzr-1:

Core APC/C components such as APC8 associate with different regulatory subunits, Fzy or Fzr, to regulate different steps of the cell cycle (see Introduction). The extended metaphase observed during mat-3(ku233) vulval development suggests a defect in APC/C-Fzy function. Consistent with this hypothesis, fzy-1(RNAi) caused ku233-like vulval defects (Table 4 , Figure 4J). In contrast, the hypomorphic allele fzr-1(ku298) caused few vulval defects (Table 4). Surprisingly, both fzr-1(ku298) and fzr-1(RNAi) partly suppressed the ku233 vulval defects (Table 4, Figure 4K). Real-time PCR experiments demonstrated that fzr-1 slightly increases the level of mat-3 mRNA (Table 2), but it is not clear if this modest effect is sufficient to explain the observed suppression. In other systems, APC/C-Fzr has been shown to target Fzy for proteasome-mediated destruction (HARPER et al. 2002; PETERS 2002). If fzr-1 mutations elevate FZY-1 levels, this would be a potential alternative mechanism to explain how fzr-1 suppresses ku233. These experiments demonstrate that APC/C-Fzr activity is largely intact in ku233 mutants and that APC/C-Fzy is more sensitive than APC/C-Fzr to the reduction in mat-3 expression.


View this table:
In this window
In a new window

 
TABLE 4

Suppression of mat-3(ku233) defects by fzr-1 and SynMuv B mutations

 

lin-35/Rb and other synthetic multivulva mutations suppress mat-3(ku233) defects:

We discovered that certain class B SynMuv mutations are strong suppressors of mat-3(ku233) defects (Table 4, Figure 4L). We initially found that the Multivulva mutant lin-15(n309) efficiently suppresses ku233 sterile, Egl, and vulval defects. lin-15 is a complex locus containing two SynMuv genes, lin-15A and lin-15B (CLARK et al. 1994; HUANG et al. 1994). Suppression by lin-15(n309) can be attributed to a loss of lin-15B activity since lin-15B(RNAi), but not lin-15A(RNAi), efficiently suppressed ku233 vulval defects. A subset of other class B SynMuv mutations (but no class A SynMuv mutations) also suppresses ku233 vulval defects (Table 4); these include lin-35/Rb and efl-1/E2F as well as dpl-1/DP (an E2F dimerization partner; CEOL and HORVITZ 2001). A dominant-negative allele of lin-53/RbAp48 (an Rb-binding protein; LU and HORVITZ 1998) suppresses ku233 defects but lin-53(RNAi) does not (Table 4), suggesting that suppression is not due to loss of lin-53/RbAp48 function. Notably, although the class B synMuv gene lin-36 acts with lin-35/Rb to inhibit G1-to-S progression (BOXEM and VAN DEN HEUVEL 2002; FAY et al. 2002), mutations in lin-36 do not suppress ku233 (Table 4). Reduction of the G1/S regulator cki-1 (a cyclin kinase inhibitor; HONG et al. 1998) also does not suppress ku233 (Table 4). The let-60 ras gain-of-function allele n1046 also does not suppress ku233 (Table 4). Therefore, suppression of ku233 is not a general property of mutations that bypass G1 arrest or that increase vulval fate induction or Ras signaling, but is instead a specific property of a subset of SynMuv B genes.

Suppression appears specific to the mat-3(ku233) allele since lin-15(n309) does not suppress the vulval or sterile defects of mat-3(cs53) or mat-3(cs54) mutants (Table 4); lin-15(n309), lin-35(n765), or lin-35(RNAi) do not suppress the embryonic lethality of mat-3(ax68) temperature-sensitive mutants (data not shown); and lin-35(RNAi) does not suppress the embryonic lethality of mat-3(or180) temperature-sensitive mutants (data not shown). Therefore, SynMuv mutations do not bypass the requirement for mat-3. Instead, SynMuv mutations may compensate for reduced mat-3 activity in ku233 mutants or may restore mat-3 activity to more wild-type levels.

lin-35/Rb and dpl-1/DP mutations restore mat-3 mRNA levels in ku233 mutants:

Since LIN-35/Rb and other SynMuv gene products are likely transcriptional regulators, one possible model to explain our findings is that these proteins normally repress mat-3 gene expression. In this case, mutations in SynMuv B genes would suppress mat-3(ku233) by increasing mat-3 expression levels. In support of this model, real-time PCR revealed that both lin-35/Rb and dpl-1/DP mutations increase mat-3 mRNA levels in mat-3(ku233) mutants to near wild-type or greater than wild-type levels (Table 2). In contrast, a lin-36 mutation that does not suppress mat-3(ku233) defects does not significantly increase mat-3 mRNA expression (Table 2). Thus changes in mat-3 expression levels correlate well with phenotypic suppression.

lin-35/Rb and dpl-1/DP mutations slightly increase mat-3 gene expression in a mat-3(+) background, but the effect is not as dramatic as that seen in the ku233 background and is similar to that caused by a lin-36 mutation (Table 2). Thus, as for many other effects of SynMuv genes, the repressive effects of lin-35/Rb and dpl-1/DP on mat-3 are detected only in a sensitized genetic background—in this case in the context of the ku233 mutation that reduces mat-3 expression. We propose that a positive regulatory element affected by the ku233 lesion normally counteracts the repressive influence of lin-35/Rb, dpl-1/DP, efl-1/E2F, and other SynMuv B gene products.


DISCUSSION
We have shown that lin-35/Rb and a subset of other SynMuv B genes (efl-1/E2F, dpl-1/DP, and lin-15B) negatively regulate mat-3/APC8 expression. Reducing the activity of these SynMuv B genes can suppress mitotic defects caused by inadequate mat-3. Although our data do not distinguish between direct and indirect effects, it is possible that Rb/E2F complexes directly repress mat-3 transcription. This study shows that Rb and E2F can affect mitotic progression in vivo and further expands the known roles of these proteins outside of G1/S regulation.

Transcriptional regulation of mat-3:

The mat-3(ku233) lesion disrupts a conserved sequence element important for mat-3 expression. It appears that this positive element normally counteracts the repressive influence of lin-35/Rb, dpl-1/DP, efl-1/E2F, and other SynMuv B gene products. In ku233 mutants that lack the positive element, mat-3 expression is strongly repressed by SynMuv proteins. Removing the SynMuv proteins restores mat-3 expression and suppresses ku233 mutant defects. In wild-type animals where the positive element is intact, SynMuv proteins appear to have a smaller (but still detectable) impact on mat-3 expression, possibly because they are inhibited or antagonized by factors binding to the positive element. We do not know what factors normally bind to the positive element. TRANSFAC analysis (MATYS et al. 2003) did not detect any known transcription factor binding sites in this sequence.

Our data do not distinguish between direct and indirect effects of the SynMuv proteins. It is possible that Rb/E2F complexes directly repress mat-3 transcription since there is one perfect E2F consensus binding site (GCGCGAAAA) ~130 bp upstream of the mat-3 operon, and the TRANSFAC program (MATYS et al. 2003) predicts >40 other potential E2F binding sites within the noncoding regions of the genomic mat-3 rescue fragment PCR.JD2 (data not shown). Alternatively, it is possible that Rb/E2F regulate other factors that ultimately impact on mat-3 expression. We are confident that phenotypic suppression of ku233 is a result and not a cause of the elevated mat-3 mRNA levels since we have identified a novel suppressor of ku233 that has no detectable effect on mat-3 mRNA levels (our unpublished data). Further studies will be needed to determine if Rb/E2F complexes act directly or indirectly on the mat-3 gene promoter and whether regulation of mat-3 varies in different stages of the cell cycle.

Redundant functions of lin-35/Rb:

lin-35 appears to be the only Rb-related gene in C. elegans (LU and HORVITZ 1998), so it is somewhat surprising that lin-35 mutants have very few defects. Multiple studies have now shown that lin-35 functions redundantly with other genes to control a variety of different processes. lin-35 functions redundantly with cyclin kinase inhibitors and fzr-1 to inhibit G1-to-S progression (BOXEM and VAN DEN HEUVEL 2001; FAY et al. 2002), with SynMuv A genes to inhibit vulval fate induction (LU and HORVITZ 1998), and with ubc-18 to promote proper pharyngeal development (FAY et al. 2003). The work described here raises the possibility that lin-35 may also function redundantly with other unknown genes to regulate mitosis (see below).

lin-35/Rb acts with distinct subsets of partners to regulate different processes:

lin-35/Rb appears to act with different subsets of genes to regulate different processes. For example, lin-35 acts with a set of more than a dozen other SynMuv B genes to inhibit vulval fate induction (THOMAS et al. 2003), but acts with only a subset of these SynMuv B genes to regulate G1/S progression (BOXEM and VAN DEN HEUVEL 2002). We have shown that lin-35 acts with a distinct subset of SynMuv B genes to regulate mat-3. Since Rb, E2F, and orthologs of some other SynMuv B gene products are known to form protein complexes that remodel chromatin and alter transcription (HARBOUR and DEAN 2000; STEVAUX and DYSON 2002), a reasonable model based on the genetic observations is that LIN-35/Rb participates in distinct protein complexes at different gene promoters. The presence of unique components in these different complexes could target the complex to distinct promoters and/or could allow for specific regulation of the core complex (for example, by signaling pathways or cell-cycle factors). Screens for suppressors of mat-3(ku233) defects may identify additional gene products that act with lin-35/Rb to repress mat-3.

Potential mitotic requirements for lin-35/Rb:

Our finding that lin-35/Rb represses mat-3 expression is consistent with microarray and chromatin precipitation experiments in mammalian cells and in Drosophila showing that Rb/E2F regulate transcription of a variety of mitotic and spindle checkpoint genes (ISHIDA et al. 2001; MULLER et al. 2001; REN et al. 2002; DIMOVA et al. 2003). The functional significance of this regulation is not understood, but it is possible that by regulating the expression of mitotic genes such as mat-3/APC8, Rb/E2F could control the timing of mitotic progression during development and/or protect cells against chromosome damage or loss caused by inappropriate mitotic progression. We have not found evidence for altered mitotic timing in lin-35/Rb single mutants (Table 3). However, as has been found for its other roles, any mitotic or spindle checkpoint roles of lin-35/Rb may be redundant or detectable only under certain stressful conditions. It will be interesting to determine if any of the mutations that cause synthetic lethality with lin-35 (FAY et al. 2002) result in mitotic disregulation.


ACKNOWLEDGEMENTS
We are very grateful for the support of Min Han, in whose lab ku233 was originally isolated. We also thank Craig McKinnon and Ben Williams for sharing pat-4 map information and alleles, Yuji Kohara for cDNA clones, Phil Anderson, Andy Fire, and Robyn Howard for vectors, Farida Shaheen and the Center for Aids Research at the University of Pennsylvania for help with real-time PCR, Bruce Wightman and Chris Rocheleau for comments on the manuscript, and Andy Golden and members of our laboratory for helpful discussions and advice. Some strains were provided by the Caenorhabditis Genetics Center, which is supported by a grant from the National Center for Research Resources. This work was supported by a March of Dimes grant to M.S.


FOOTNOTES
1 These authors contributed equally to this work. Back


LITERATURE CITED

BOXEM, M., and S. VAN DEN HEUVEL, 2001 lin-35 Rb and cki-1 Cip/Kip cooperate in developmental regulation of G1 progression in C. elegans. Development 128: 4349–4359.[Abstract/Free Full Text]

BOXEM, M., and S. VAN DEN HEUVEL, 2002 C. elegans class B synthetic multivulva genes act in G1 regulation. Curr. Biol. 12: 906–911.[CrossRef][Medline]

BRENNER, S., 1974 The genetics of Caenorhabditis elegans. Genetics 77: 71–94.[Abstract/Free Full Text]

CEOL, C. J., and H. R. HORVITZ, 2001 dpl-1 DP and efl-1 E2F act with lin-35 Rb to antagonize Ras signaling in C. elegans vulval development. Mol. Cell 7: 461–473.[CrossRef][Medline]

CLARK, S. G., X. LU and H. R. HORVITZ, 1994 The Caenorhabditis elegans locus lin-15, a negative regulator of a tyrosine kinase signaling pathway, encodes two different proteins. Genetics 137: 987–997.[Abstract]

DAHIYA, A., S. WONG, S. GONZALO, M. GAVIN and D. C. DEAN, 2001 Linking the Rb and Polycomb pathways. Mol. Cell 8: 557–568.[CrossRef][Medline]

DAVIS, E. S., L. WILLE, B. A. CHESTNUT, P. L. SADLER, D. C. SHAKES et al., 2002 Multiple subunits of the Caenorhabditis elegans anaphase-promoting complex are required for chromosome segregation during meiosis I. Genetics 160: 805–813.[Abstract/Free Full Text]

DAWSON, I. A., S. ROTH and S. ARTAVANIS-TSAKONAS, 1995 The Drosophila cell cycle gene fizzy is required for normal degradation of cyclins A and B during mitosis and has homology to the CDC20 gene of Saccharomyces cerevisiae. J. Cell Biol. 129: 725–737.[Abstract/Free Full Text]

DEGREGORI, J., T. KOWALIK and J. R. NEVINS, 1995 Cellular targets for activation by the E2F1 transcription factor include DNA synthesis and G1/S-regulatory genes. Mol. Cell. Biol. 15: 4215–4224.[Abstract]

DIMOVA, D. K., O. STEVAUX, M. V. FROLOV and N. J. DYSON, 2003 Cell cycle-dependent and cell cycle-independent control of transcription by the Drosophila E2F/RB pathway. Genes Dev. 17: 2308–2320.[Abstract/Free Full Text]

EDGLEY, M. L., and D. L. RIDDLE, 2001 LG II balancer chromosomes in Caenorhabditis elegans: mT1(II;III) and the mIn1 set of dominantly and recessively marked inversions. Mol. Genet. Genomics 266: 385–395.[CrossRef][Medline]

FAY, D. S., S. KEENAN and M. HAN, 2002 fzr-1 and lin-35/Rb function redundantly to control cell proliferation in C. elegans as revealed by a nonbiased synthetic screen. Genes Dev. 16: 503–517.[Abstract/Free Full Text]

FAY, D. S., E. LARGE, M. HAN and M. DARLAND, 2003 lin-35/Rb and ubc-18, an E2 ubiquitin-conjugating enzyme, function redundantly to control pharyngeal morphogenesis in C. elegans. Development 130: 3319–3330.[Abstract/Free Full Text]

FERGUSON, E. L., and H. R. HORVITZ, 1989 The multivulva phenotype of certain Caenorhabditis elegans mutants results from defects in two functionally redundant pathways. Genetics 123: 109–121.[Abstract/Free Full Text]

FIRE, A., S. XU, M. K. MONTGOMERY, S. A. KOSTAS, S. E. DRIVER et al., 1998 Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391: 806–811.[CrossRef][Medline]

FURUTA, T., S. TUCK, J. KIRCHNER, B. KOCH, R. AUTY et al., 2000 EMB-30: an APC4 homologue required for metaphase-to-anaphase transitions during meiosis and mitosis in Caenorhabditis elegans. Mol. Biol. Cell 11: 1401–1419.[Abstract/Free Full Text]

GOLDEN, A., P. L. SADLER, M. R. WALLENFANG, J. M. SCHUMACHER, D. R. HAMILL et al., 2000 Metaphase to anaphase (mat) transition defective mutants in Caenorhabditis elegans. J. Cell Biol. 151: 1469–1482.[Abstract/Free Full Text]

HARBOUR, J. W., and D. C. DEAN, 2000 The Rb/E2F pathway: expanding roles and emerging paradigms. Genes Dev. 14: 2393–2409.[Free Full Text]

HARPER, J. W., J. L. BURTON and M. J. SOLOMON, 2002 The anaphase-promoting complex: it's not just for mitosis any more. Genes Dev. 16: 2179–2206.[Free Full Text]

HONG, Y., R. ROY and V. AMBROS, 1998 Developmental regulation of a cyclin-dependent kinase inhibitor controls postembryonic cell cycle progression in Caenorhabditis elegans. Development 125: 3585–3597.[Abstract]

HUANG, L. S., P. TZOU and P. W. STERNBERG, 1994 The lin-15 locus encodes two negative regulators of Caenorhabditis elegans vulval development. Mol. Biol. Cell 5: 395–411.[Abstract]

ISHIDA, S., E. HUANG, H. ZUZAN, R. SPANG, G. LEONE et al., 2001 Role for E2F in control of both DNA replication and mitotic functions as revealed from DNA microarray analysis. Mol. Cell. Biol. 21: 4684–4699.[Abstract/Free Full Text]

KITAGAWA, R., E. LAW, L. TANG and A. M. ROSE, 2002 The Cdc20 homolog, FZY-1, and its interacting protein, IFY-1, are required for proper chromosome segregation in Caenorhabditis elegans. Curr. Biol. 12: 2118–2123.[CrossRef][Medline]

LU, X., and H. R. HORVITZ, 1998 lin-35 and lin-53, two genes that antagonize a C. elegans Ras pathway, encode proteins similar to Rb and its binding protein RbAp48. Cell 95: 981–991.[CrossRef][Medline]

LUKAS, C., C. S. SORENSON, E. KRAMER, E. SANTONI-RIGIU, C. LINDENEG et al., 1999 Accumulation of cyclin B1 requires E2F and cyclin-A-dependent rearrangement of the anaphase-promoting complex. Nature 401: 815–818.[CrossRef][Medline]

MATYS, V., E. FRICKE, R. GEFFERS, E. GOSSLING, M. HAUBROCK et al., 2003 TRANSFAC: transcriptional regulation, from patterns to profiles. Nucleic Acids Res. 31: 374–378.[Abstract/Free Full Text]

MELLO, C. C., J. M. KRAMER, D. STINCHCOMB and V. AMBROS, 1991 Efficient gene transfer in C. elegans after microinjection of DNA into germline cytoplasm: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10: 3959–3970.[Medline]

MITROVICH, Q. M., and P. ANDERSON, 2000 Unproductively spliced ribosomal protein mRNAs are natural targets of mRNA surveillance in C. elegans. Genes Dev. 14: 2173–2184.[Abstract/Free Full Text]

MULLER, H., A. BRACKEN, R. VERNELL, M. C. MORONI, F. CHRISTIANS et al., 2001 E2Fs regulate the expression of genes involved in differentiation, development, proliferation, and apoptosis. Genes Dev. 15: 267–285.[Abstract/Free Full Text]

OHTANI, K., J. DEGREGORI and J. R. NEVINS, 1995 Regulation of the cyclin E gene by transcription factor E2F1. Proc. Natl. Acad. Sci. USA 92: 12146–12150.[Abstract/Free Full Text]

PETERS, J. M., 2002 The anaphase-promoting complex: proteolysis in mitosis and beyond. Mol. Cell 9: 931–943.[CrossRef][Medline]

PRAITIS, V., E. CASEY, D. COLLAR and J. AUSTIN, 1999 Creation of low-copy integrated transgenic lines in Caenorhabditis elegans. Genetics 157: 1217–1226.

RAPPLEYE, C. A., A. TAGAWA, R. LYCZAK, B. BOWERMAN and R. V. AROIAN, 2002 The anaphase promoting complex and separin are required for embryonic anterior-posterior axis formation. Dev. Cell 2: 195–206.[CrossRef][Medline]

REN, B., H. CAM, Y. TAKAHASHI, T. VOLKERT, J. TERRAGNI et al., 2002 E2F integrates cell cycle progression with DNA repair, replication, and G(2)/M checkpoints. Genes Dev. 16: 245–256.[Abstract/Free Full Text]

RIDDLE, D. L., T. BLUMENTAL, B. J. MEYER and J. R. PRIESS (Editors), 1997 C. elegans II. Cold Spring Harbor Laboratory Press, Plainview, NY.

SCHULZE, A., K. ZERFASS, D. SPITKOVSKY, S. MIDDENDORP, J. BERGES et al., 1995 Cell cycle regulation of the cyclin A gene promoter is mediated by a variant E2F site. Proc. Natl. Acad. Sci. USA 92: 11264–11268.[Abstract/Free Full Text]

SHAKES, D. C., P. L. SADLER, J. M. SCHUMACHER, M. ABDOLRASULNIA and A. GOLDEN, 2003 Developmental defects observed in hypomorphic anaphase-promoting complex mutants are linked to cell cycle abnormalities. Development 130: 1605–1620.[Free Full Text]

SIGRIST, S. J., and C. F. LEHNER, 1997 Drosophila fizzy-related downregulates mitotic cyclins and is required for cell proliferation arrest and entry into endocycles. Cell 90: 671–681.[CrossRef][Medline]

SIGRIST, S., H. JACOBS, R. STRATMANN and C. F. LEHNER, 1995 Exit from mitosis is regulated by Drosophila fizzy and the sequential destruction of cyclins A, B and B3. EMBO J. 14: 4827–4838.[Medline]

STEVAUX, O., and N. J. DYSON, 2002 A revised picture of the E2F transcriptional network and RB function. Curr. Opin. Cell Biol. 14: 684–691.[CrossRef][Medline]

SULSTON, J. E., and H. R. HORVITZ, 1977 Post-embryonic cell lineages of the nematode Caenorhabditis elegans. Dev. Biol. 56: 110–156.[CrossRef][Medline]

SULSTON, J. E., and J. G. WHITE, 1980 Regulation and cell autonomy during postembryonic development of Caenorhabditis elegans. Dev. Biol. 78: 577–597.[CrossRef][Medline]

TERNS, R. M., P. KROLL-CONNOR, J. ZHU, S. CHUNG and J. H. ROTHMAN, 1997 A deficiency screen for zygotic loci required for establishment and patterning of the epidermis in Caenorhabditis elegans. Genetics 146: 185–206.[Abstract]

THOMAS, J. H., C. J. CEOL, H. T. SCHWARTZ and H. R. HORVITZ, 2003 New genes that interact with lin-35 Rb to negatively regulate the let-60 ras pathway in Caenorhabditis elegans. Genetics 164: 135–151.[Abstract/Free Full Text]

VISINTIN, R., S. PRINZ and A. AMON, 1997 CDC20 and CDH1: a family of substrate-specific activators of APC-dependent proteolysis. Science 278: 460–463.[Abstract/Free Full Text]

WANG, M., and P. STERNBERG, 2001 Pattern formation during C. elegans vulval induction. Curr. Top. Dev. Biol. 51: 189–220.[Medline]




This article has been cited by other articles:


Home page
DevelopmentHome page
E. C. Andersen and H. R. Horvitz
Two C. elegans histone methyltransferases repress lin-3 EGF transcription to inhibit vulval development
Development, August 15, 2007; 134(16): 2991 - 2999.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. M. Harrison, X. Lu, and H. R. Horvitz
LIN-61, One of Two Caenorhabditis elegans Malignant-Brain-Tumor-Repeat-Containing Proteins, Acts With the DRM and NuRD-Like Protein Complexes in Vulval Development but Not in Certain Other Biological Processes
Genetics, May 1, 2007; 176(1): 255 - 271.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
P. W. Reddien, E. C. Andersen, M. C. Huang, and H. R. Horvitz
DPL-1 DP, LIN-35 Rb and EFL-1 E2F Act With the MCD-1 Zinc-Finger Protein to Promote Programmed Cell Death in Caenorhabditis elegans
Genetics, April 1, 2007; 175(4): 1719 - 1733.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
K. K. Stein, E. S. Davis, T. Hays, and A. Golden
Components of the Spindle Assembly Checkpoint Regulate the Anaphase-Promoting Complex During Meiosis in Caenorhabditis elegans
Genetics, January 1, 2007; 175(1): 107 - 123.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
W. Chi and V. Reinke
Promotion of oogenesis and embryogenesis in the C. elegans gonad by EFL-1/DPL-1 (E2F) does not require LIN-35 (pRB)
Development, August 15, 2006; 133(16): 3147 - 3157.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
E. M. Davison, M. M. Harrison, A. J. M. Walhout, M. Vidal, and H. R. Horvitz
lin-8, Which Antagonizes Caenorhabditis elegans Ras-Mediated Vulval Induction, Encodes a Novel Nuclear Protein That Interacts With the LIN-35 Rb Protein
Genetics, November 1, 2005; 171(3): 1017 - 1031.
[Abstract] [Full Text] [PDF]