- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Suter, B.
- Articles by Rine, J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Suter, B.
- Articles by Rine, J.
Genetics, Vol. 167, 579-591, June 2004, Copyright © 2004
doi:10.1534/genetics.103.024851
The Origin Recognition Complex Links Replication, Sister Chromatid Cohesion and Transcriptional Silencing in Saccharomyces cerevisiae
Bernhard Suter*,
Amy Tong
,
Michael Chang
,
Lisa Yu
,
Grant W. Brown
,
Charles Boone
and
Jasper Rine*,1
* Department of Molecular and Cell Biology, University of California, Berkeley, California 94720-3202
Banting and Best Department of Medical Research, University of Toronto, Toronto, Ontario M5G 1L6, Canada
Department of Biochemistry, University of Toronto, Toronto, Ontario M5S 1A8, Canada
1 Corresponding author: Department of Molecular and Cell Biology, University of California, 522 Barker Hall #3202, Berkeley, CA 94720-3202.
E-mail: jrine{at}uclink.berkeley.edu
Mutations in genes encoding the origin recognition complex (ORC) of Saccharomyces cerevisiae affect initiation of DNA replication and transcriptional repression at the silent mating-type loci. To explore the function of ORC in more detail, a screen for genetic interactions was undertaken using large-scale synthetic lethal analysis. Combination of orc2-1 and orc5-1 alleles with the complete set of haploid deletion mutants revealed synthetic lethal/sick phenotypes with genes involved in DNA replication, chromatin structure, checkpoints, DNA repair and recombination, and other genes that were unexpected on the basis of previous studies of ORC. Many of these genetic interactions are shared with other genes that are involved in initiation of DNA replication. Strong synthetic interactions were demonstrated with null mutations in genes that contribute to sister chromatid cohesion. A genetic interaction between orc5-1 and the cohesin mutant scc1-73 suggested that ORC function contributes to sister chromatid cohesion. Thus, comprehensive screening for genetic interactions with a replication gene revealed a connection between initiation of DNA replication and sister chromatid cohesion. Further experiments linked sister chromatid cohesion genes to silencing at mating-type loci and telomeres.
THE origin recognition complex (ORC) plays a central role in the initiation of DNA replication in eukaryotes. ORC consist of six subunits (Orc1p6p), all of which are required for viability. ORC, in combination with Cdc6p and a hexamer of minichromosome maintenance (MCM) proteins, forms the prereplicative complex (preRC) in the G1 phase of the cell cycle. During S phase, preRCs activate origins by the recruitment of the Cdc45 protein and the unwinding of the DNA, presumably through the helicase activity of the MCM complex. Tight cell-cycle-mediated regulation by Cdc7p/Dbf4p and Cdc28-cyclin dependent kinase ensures that initiation at different origins is properly coordinated during the cell cycle (reviewed in BELL and DUTTA 2002). Phenotypes of two temperature-sensitive mutants in Saccharomyces cerevisiae ORC2 and ORC5 genes, orc2-1 and orc5-1, are characterized by high plasmid-loss rates and reduced firing of chromosomal origins (BELL et al. 1993; FOSS et al. 1993; FOX et al. 1995; LIANG et al. 1995; LOO et al. 1995). In addition to its replication function, ORC has a role in transcriptional silencing of the HML and HMR mating-type loci in yeast (FOSS et al. 1993; BELL et al. 1995; FOX et al. 1995). The two roles are genetically separable (DILLIN and RINE 1997). The separate silencing function of ORC, combined with ORC's association with origins during the whole cell cycle, prompted us to consider whether ORC also contributes to other processes.
The proper segregation of sister chromatids during anaphase depends on the establishment of sister chromatid cohesion during S phase and chromosome condensation before mitosis (NASMYTH 2002). An evolutionary conserved cohesin complex is required for cohesive linkage of sister chromatids (GUACCI et al. 1997; MICHAELIS et al. 1997). The cohesin complex binds to chromosomes at distinct cohesion sites from late G1 phase until the metaphase-anaphase transition when the Scc1p cohesin subunits are degraded (UHLMANN et al. 1999). Cohesin binding is enriched at centromeres where cohesion counteracts the pulling force of the mitotic spindle before the onset of anaphase. Physical and genetic evidence indicates that establishment of sister chromatid cohesion is also closely linked to DNA replication, most likely mediated by components of the replication fork (CARSON and CHRISTMAN 2001). CTF7/ECO1 is an essential gene that is required in S phase for establishment of sister chromatid cohesion. Ctf7/Eco1 has been linked genetically and physically to the replication apparatus (SKIBBENS et al. 1999; TOTH et al. 1999; KENNA and SKIBBENS 2003). Another link between sister chromatid cohesion and DNA replication came with the discovery of an alternative replication fork clamp loader (RFC) complex, mutations of which lead to loss of sister chromatid cohesion (MAYER et al. 2001). The Ctf4 protein was originally identified through its binding to DNA polymerase
(MILES and FORMOSA 1992). Mutation of CTF4 also leads to a cohesion defect (HANNA et al. 2001). Likewise, a nucleotidyl-transferase activity (polymerase
) that is encoded by TRF4 and TRF5 contributes to sister chromatid cohesion (WANG et al. 2000). These proteins may contribute to the passage of the replication fork through a cohesion site (see CARSON and CHRISTMAN 2001). Finally, the pol2-12 mutation in DNA polymerase
also causes a cohesion defect, providing a direct connection between sister chromatid cohesion and a replicative polymerase (EDWARDS et al. 2003). Interesting links between cohesion and condensation of chromosomes to the epigenetic inheritance of transcriptional states have emerged in different organisms (reviewed in HAGSTROM and MEYER 2003). For example, in Schizosaccharomyces pombe, the high concentration of Scc1 protein at centromeres requires stable heterochromatin formation at centromeric repeats (BERNARD et al. 2001).
Synthetic lethal interactions have been used to establish functional relationships between genes (GUARENTE 1993; HARTMAN et al. 2001). In a previous synthetic lethal screen for genes that are required for viability of orc2-1 mutants, cdc7, cdc14, and orc3 mutants were isolated on the basis of the lethality of the double-mutant combinations (HARDY 1996). Strong genetic interactions between ORC and other replication genes have also been observed, but none of these studies approached genetic saturation of possible interactions (LIANG et al. 1995; LOO et al. 1995; KROLL et al. 1996; ZOU et al. 1997).
To provide a more comprehensive view of the processes linked to ORC and presumably therefore to origins of DNA replication, we used the synthetic genetic array (SGA) methodology to systematically evaluate double mutants between ORC genes and the deletion collection of nonessential genes. As expected, synthetic genetic interactions were seen between ORC mutants and mutations in genes involved in DNA replication. However, the combined network of interactions for ORC and other replication mutants reveals an extended link among replication initiation, sister chromatid cohesion, chromatin structure, checkpoint control, and DNA repair. Finally, new links were uncovered between the establishment of sister chromatid cohesion and transcriptional silencing.
Synthetic genetic array analysis:
To transfer the orc5-1 allele to strains marked for SGA, the orc5-1 allele was amplified from plasmid pJR1759 (orc5-1 clone in pRS414) using a forward primer that is complementary to the first 25 bp of the ORC5 open reading frame (5'-orc5-top, 5'-ATGAATGTGACCACTCCGGAAG-3') and a reverse primer annealing 184 bp downstream from the stop codon (3'-orc5-TEF, GGGACGAGGCAAGCTAAACAGATCTCTAGTGGACTGAATTAATAACGGT). The nourseothricin-MX4 that confers resistance to the antibiotic nourseothricin (clonNAT, Werner BioAgents) was amplified from plasmid pFA6::natMX4 using primers MX5' (5'-AGATCTGTTTAGCTTGCCTCG-3') and MX3'-orc5 (TGTTTCGAACGTATCCTGCCCTCTGGATACCTTCCAGGGAGATAAGAATTCGAGCTCGTTTAAACTGGA-3'. MX3'-orc5 contains 45 bp of complementary sequence from the ORC5 stop codon. DNA (10 ng) of the two fragments was combined and amplified using primers 5'-orc5-top and MX3'-orc5. The orc2-1 allele was amplified from plasmid pJR1675 (orc2-1 in pRS315) and marked with natMX by the same method but using primers that were specific for ORC2 (5'-orc2-top, 5'-ATGCTAAATGGGGAAGACTTTGT-3'; MX5'-orc2, GggacgaggcaagctaaacagatctGAGCTCATCAGACGTTTTTCAGT-3'; MX5', 5'-AGATCTGTTTAGCTTGCCTCG-3'; MX3'-orc2', CTAGCAAGCCTAGTACTATTACAATTGTTCGTGATATGTTACATgaattcgagctcgtttaaactgga-3'). All PCR reactions used the PfuTurbo DNA polymerase kit (Stratagene, La Jolla, CA) to increase fidelity of the PCR reaction. PCR fragments were purified using the QIAEX protocol and transformed in the starting strain for synthetic genetic array analysis (Y2454: MAT
mfa1
::MFA1pr-HIS3 can1
his3
1 leu2
0 ura3
0 MET15+ lys2
0). The identity of the orc-ts allele was confirmed by its phenotype and correct integration was confirmed by PCR or DNA blot. SGA screening procedure with the marked orc2-1 and orc5-1 alleles was done essentially as described previously (TONG et al. 2001). Double-mutant selection was done at 23°, 26°, and 30° for the orc5-1 strain and at 22°23° for orc2-1. Potential synthetic lethal/sick interactions were confirmed by tetrad analysis at different temperatures, 23° and 30° for orc2-1 and orc5-1, respectively. Positive results from the synthetic lethal screens were confirmed by tetrad dissection and growth at 23° and 30°, which are semipermissive temperatures for orc2-1 and orc5-1, respectively. For the orc5-1 screen, a MATa version of the orc5-1::natMX4 strain was crossed with the haploid
collection strains for the confirmation of the results. A minimum of 10 tetrads were dissected from each cross. Some results from the orc2-1 screen were also confirmed by random spore analysis as described by TONG et al. (2004).
Yeast strains:
The genotypes of all yeast strains used are in Table 1 . PCR fragments containing ctf4
::kanMX4, ctf18
::kanMX4, dcc1
::kanMX4, trf4
::kanMX4, and trf5
::kanMX4 were amplified by colony PCR from the knockout collection strains. PCR products were purified using the QIAEX buffer desalting protocol and transformed into a diploid strain derived from mating of JRY4012 and JRY3009. Gene disruption in haploid segregants was confirmed by PCR and characterization of phenotypes. The scc1-73::TRP1 allele was from strain ROY1063. Segregants from crosses with ROY1063 were tested for an intact HMR-I silencer by PCR.
|
Plasmid-loss assay:
To measure plasmid-loss rates, plasmids pDK243 and pDK368-7 (HOGAN and KOSHLAND 1992) were transformed into strains JRY4012, JRY4285 (orc5-1), JRY7716 (ctf4
::kanMX4), and JRY7717 (ctf18
::kanMX4). Plasmid-loss assays were done as described previously (LOO et al. 1995), except that growth in nonselective medium was for 9 or 10 generations at 30°.
Sister chromatid cohesion assay:
Tet repressor-green fluorescent protein (GFP)/Tet operator repeat constructs were used to visualize the URA3 region on chromosome V (MICHAELIS et al. 1997). TetR-GFP was expressed from K3524/yplac128tetR-GFP (URA3-5'NLStetR-SuperGlowGFP-ADH-T::LEU2::leu2-3,112). The K2524 construct was integrated into JRY4012 to generate JRY7468. JRY7469, JRY7470, and JRY7471 were generated from JRY7468 with JRY4285 (orc5-1) and ROY1063 (scc1-73). To mark the URA3 locus, these strains were transformed with plasmid pXH122 (p306tetO2X224 ChV-38; HE et al. 2000) that was linearized with EcoRV. Cells from overnight cultures were diluted to A600
0.1 and grown for 3 hr at 31° in SC-Ura or YPD. To monitor sister chromatid cohesion in G2/M phase, cells were transferred to A600 0.2 in YPD + 15 µg/ml nocodazole and arrested for
2.5 hr at 31°. To control for aneuploidy, cells were arrested at A600
0.2 in YPD + 5 µg/ml
-factor for 2.5 hr at 31°. Aliquots (0.9 ml) were fixed with 100 µl 37.5% formaldehyde for 10 min at 4°. Samples were washed twice with 1 ml ice-cold phosphate-buffered saline and sonicated for 10 sec. After the second wash, the pellets were resuspended in 200 µl phosphate-buffered saline and GFP dots were directly analyzed by fluorescence microscopy. The fraction of cells with two GFP dots was compared to the total number of arrested cells. Microscopy was done using a Nikon Eclipse E600 microscope, a Nikon x100 Plan Apo phase objective, and a Hamamatsu digital camera C4742-95. Slides were coded during scoring so that the scorer was blind to the genotype of the sample.
Silencing assays:
All silencing assays were done with ctf4
::kanMX4, ctf18
::kanMX4, and dcc1
::kanMX4 in the W303 background. To assay silencing at HMR, strain JRY5329 with HMR::2EDA replacing HMRa was used (SUSSEL et al. 1993). Cultures were grown to A600
1 in liquid YPD medium and 100 µl from 1:104 dilutions was plated on YPD plates. The deletion strains containing ADE2 at the HMR locus were analyzed for development of red or pink color after 3 days at 30° and 3 additional days at 4°. To assay telomeric silencing for the URA3-TRP1 reporter at telomere VII-L, cultures were grown to A600
0.5 in liquid YPD medium and spotted in fivefold serial dilutions on SC, SC + 0.1% fluoroorotic acid (FOA), and SC-TRP plates. Strains containing the ADE2 reporter gene at telomere V-L were grown to A600
1 in YPD and plated on SC medium to obtain 100200 colonies per plate. Photographs were taken after 3 additional days at 4°.
(Figure 1B). More interacting genes were recovered in the orc2-1 screen than in the orc5-1 screen (Table 2) . However, all results from the orc5-1 screen were also found in the orc2-1 screen. This complete overlap suggests that both Orc2p and Orc5p function in only one essential process. Lower recovery of interactions with orc5-1 was in part due to minor differences in the conditions of the screens using the two mutants and, perhaps, due to orc2-1 being more defective than orc5-1 at some temperatures. The results of the ORC screens overlapped extensively with those from the synthetic lethal screens with cdc45-1 and cdc7-1 (Figure 1C), which are described elsewhere (TONG et al. 2004). Considering the occurrence of false-negative results from the robotic screen, the overlap could be even more extensive. Thus, the pattern of synthetic lethal interactions clearly supported the common view that the major role of ORC is in DNA replication.
|
|
Genetic interactions with ORC:
Genetic interactions were observed between orc-ts mutants and null alleles of genes that collectively have many different cellular roles. A subset of these synthetic interactions can be understood in light of the known function of the interacting gene. POL32 encodes the only nonessential subunit of DNA polymerase
, so it was not surprising that a null allele of this gene was synthetically lethal with orc-ts mutants. Likewise, earlier work established that replication mutants become dependent on double-strand-break repair by homologous recombination (HARTWELL and SMITH 1985). Hence the synthetic lethality between orc-ts mutants and rad52
, rad55
, and hpr5
presumably reflected an inability to rescue stalled or collapsed replication forks by recombination mechanisms. MRC1 encodes a mediator of the DNA replication checkpoint and binds to Cdc45p as does the Tof1 protein (KATOU et al. 2003; OSBORN and ELLEDGE 2003); hence the synthetic lethal interactions between mutations in MRC1 and TOF1 and orc-ts mutants may reflect the contribution of the replication checkpoint to cell survival when origin firing becomes limiting. On the other hand, the genetic interaction of orc-ts with mrc1
could be caused by an active role of Mrc1p in the replication process (OSBORN and ELLEDGE 2003). Strong interactions of orc-ts mutations were also found with a deletion of CSM3 that encodes a newly identified component of the replication checkpoint (TONG et al. 2004). Compared with the replication checkpoint, DNA damage checkpoint mutants that exhibit reduced viability in combination with other replication mutants (see Figure 1C) were found to be only slightly sick in combination with orc2-1 (rad9
and rad24
; Table 2) or were not picked up in the orc-ts screens (chk1
, mec3
, rad17
, and ddc1
).
Other double-mutant combinations with orc-ts mutants revealed connections that were not anticipated. For example, FUN30 is a member of the Swi/Snf2 family, whose other members play a role in chromatin remodeling. Another possible link between replication and chromatin remodeling was revealed by the interaction with ISW1, an Snf2-related chromatin-remodeling factor. Factors that have a role in the deposition of nucleosomes onto newly replicated DNA were also prominent in the screens with orc2-1, orc5-1, and other replication mutants. Furthermore, different genes that have a role in histone modification were also identified, thus strengthening a link between replication and chromatin assembly or function. Growth defects in orc-ts strains were observed in combination with a null allele of the NAD+-dependent histone deacetylase gene HST3 and its paralog HST1. Interestingly, a synthetic sick interaction was also found when orc5-1 and orc2-1 were combined with the sum1
mutation. SUM1 encodes a repressor of middle meiotic genes and requires the deacetylase activity encoded by HST1 for its function (XIE et al. 1999). Several genes that have no known role in the replication process but have established roles in other cellular processes [e.g., LSM1 in mRNA capping (THARUN et al. 2000) and CIK1 and BIM1 in microtubule function (PAGE and SNYDER 1992; SCHWARTZ et al. 1997)] also caused synthetic sickness or lethality when combined with orc2-1 and orc5-1. The synthetic lethal screens also revealed interactions of cdc45-1 and cdc7-1 with mad1
and bfa1
, which are involved in the spindle checkpoint mechanism (see LEW and BURKE 2003). Activation of the spindle checkpoint at restrictive temperature by orc-ts and other replication mutations has been shown previously (GARBER and RINE 2002).
Links between ORC and sister chromatid cohesion:
Among the especially strong interactors with orc5-1 or orc2-1 alleles were null alleles of genes that are involved in the establishment of sister chromatid cohesion during S phase. These genetic interactions included CTF4 and three genes, CTF8, CTF18, and DCC1, that encode subunits of the alternate RFC complex that is important for sister chromatid cohesion (Figure 2A) . The double-mutant segregants grew to microcolonies that consisted of large budded cells. Strong genetic interactions of CTF sister chromatid cohesion genes were also found with cdc6-1 and mcm2-1 (Figure 2B) and cdc45-1 and cdc7-1 (Figure 1C and data not shown). Given the strong genetic interactions of orc-ts alleles with components of one alternative RFC complex that replaces the canonical Rfc1 subunit (MAYER et al. 2001), we also analyzed the genetic interaction between ORC and the canonical Rfc1 subunit gene, RFC1. The combination of the cdc44-5 mutation in RFC1 with orc5-1 was lethal (Figure 2C).
|
Previously, genetic interactions have linked CTF4 and CTF18 genes with components of the replication fork (HANNA et al. 2001). To determine whether the genetic interactions with initiation mutants revealed a role of CTF4 and CTF18 in the initiation of DNA replication, plasmid-loss rates were measured using plasmids that contain one (pDK243) or eight ARS1 sequences (pDK368-7) (HOGAN and KOSHLAND 1992). In orc-ts strains that have a defect in the initiation of DNA replication, a high plasmid-loss rate of plasmid pDK243 containing one ARS is suppressed by the addition of multiple ARSs (FOX et al. 1995). No suppression of plasmid loss by multiple ARSs was found in ctf4
and ctf18
strains. Plasmid-loss rates for pDK243 and pDK368-7 were 9.4 and 13.1% for ctf4
, 16.3 and 18.8% for ctf18
, 16.5 and 1.8% for orc5-1, and 0.3 and 0.07% for wild-type control strain. Thus, by this assay, no link was found between CTF4 and CTF18 and replication initiation.
Given the strong genetic interactions of orc5-1 and orc2-1 alleles with ctf4
and mutants in the CTF18-Rfc complex, the orc5-1 allele was also tested for genetic interactions with two genes, TRF4 and TRF5, that have overlapping roles in sister chromatid cohesion (WANG et al. 2000; EDWARDS et al. 2003). The trf4
orc5-1 segregants grew only slightly less well than the trf4
single mutants (Figure 2D). No genetic interaction was evident between orc5-1 and trf5
(Figure 2D). The weaker or nonexistent interactions between orc-ts mutations and trf4
or trf5
mutations may reflect a less direct role for Trf4p and Trf5p in the coupling of sister chromatid cohesion with DNA replication.
ORC function affects sister chromatid cohesion:
Given that the synthetic interaction between orc-ts mutations and mutations in sister chromatid cohesion genes did not seem to reflect roles for the cohesion proteins in replication initiation, we explored whether ORC might contribute in some way to efficient sister chromatid cohesion. The orc5-1 allele was combined with the scc1-73 mutation in the core cohesin complex. The scc1-73 mutation by itself leads to a precocious separation of sister chromatids before the onset of anaphase at its restrictive temperature (MICHAELIS et al. 1997). Both orc5-1 and scc1-73 have a restrictive temperature at 32°33°. At 31°, both single mutants showed robust growth. However, growth of the orc5-1 scc1-73 double mutant was compromised at this temperature, whereas at 23° and 26°, the orc5-1 scc1-73 double mutant grows as well as the orc5-1 single mutant (Figure 3A) . Thus, the combination of orc5-1 and scc1-73 revealed a synthetic growth defect at the maximum permissive temperature.
|
To determine whether the reduced growth of the scc1-73 orc5-1 double mutant reflected a more severe cohesion defect, strains expressing a tet repressor-GFP fusion protein and carrying tandem tet operator sequences integrated at the URA3 locus of chromosome V were used to evaluate cohesion at a specific locus. Premature loss of sister chromatid cohesion in nocodazole-arrested cells can be detected by the appearance of cells containing two GFP dots instead of one (Figure 3B). In three different experiments, the fraction of wild-type cells arrested at G2/M with nocodazole containing two GFP dots with tet operators at URA3 was
8%. In an scc1-73 strain, an elevated loss of sister chromatid cohesion (16% cells with two spots) was evident at the semipermissive temperature of 31° (Figure 3C). The orc5-1 scc1-73 double mutant exhibited a cohesion defect substantially greater than that of the scc1-73 single mutant (29% of cells with two spots). Thus, reduced ORC function enhanced the cohesion defect of scc1-73 cells. A potential source of artifacts in this analysis would be an extra copy of the chromosome containing the tet operator repeats. To determine whether the elevated level of cells with two spots resulted from a cohesion defect or from the presence of an extra chromosome, chromosomes marked at the URA3 locus were scored in cells that were arrested in G1 phase by
-factor. These cells are expected to contain only a single fluorescent dot, unless they have a second copy of the marked chromosome. The frequency of G1 cells containing two marked chromosomes was low in all cases. Some chromosome missegregation was observed in scc1-73 and scc1-73 orc5-1 strains (<5%; Figure 3D). However, the few G1 cells with two marked chromosomes could not account for the large number of chromosomes with two spots in G2/M phase that were therefore the consequence of a sister chromatid cohesion defect. A subtle cohesion defect was evident in the orc5-1 single mutant at semipermissive temperature (31°32°) compared to wild type. This small difference was reproducible but not statistically significant. A similar result was obtained for orc2-1 cells arrested at semipermissive temperature (not shown). Furthermore, we observed no increase in the number of separated sister chromatids in orc5-1 single mutants at the restrictive temperature of 36° (not shown). Thus, defective sister chromatid cohesion is not a major phenotype of orc-ts mutations. However, the reduction in the permissive temperature and the enhanced cohesion defect in the orc5-1 scc1-73 double mutant revealed some role of ORC in sister chromatid cohesion.
Sister chromatid cohesion genes and transcriptional silencing:
Silencing functions have been established for different DNA replication genes, including POL30, CDC44, POL2, CDC45, DPB4, and DPB11 (EHRENHOFER-MURRAY et al. 1999; ZHANG et al. 2000). Therefore, genes with new roles in DNA replication that were identified in our screens could, in principle, also have potential functions in silencing. Ctf4p and the alternative RFC complex are thought to help establish sister chromatid cohesion during the replication process and could connect establishment of cohesion with silencing. To study transcriptional repression in ctf4
and ctf18
strains at the HMR locus, strains with ADE2 inserted into HMR were used (HMR::2EDA; Figure 4)
. Complete repression of the ADE2 gene results in red colonies, whereas derepression of ADE2 produces white colonies, and partial derepression produces pink colonies. The colony color in ctf4
colonies with the HMR::2EDA reporter was pink, whereas wild-type colonies were red (Figure 4A). Colonies were also predominantly pink in a ctf18
mutant strain (Figure 4A). Derepression of ADE2 was also observed when ctf4
and ctf18
strains contained the ADE2 gene in the opposite orientation with a weakened HMR E silencer (HMR
B::ADE2; not shown). Thus, CTF4 and CTF18 contributed to silencing at the HMR locus.
|
The roles of ORC in replication and silencing are genetically separable (EHRENHOFER-MURRAY et al. 1995; DILLIN and RINE 1997). Strains containing the orc5-1R allele are competent in initiation of DNA replication but compromised in silencing HMR. An orc5-1R strain that contains the ADE2 gene at the HMR locus formed colonies with red and pink sectors, which indicated switching between repressed and derepressed states. This phenotype is also observed in strains lacking the ARS consensus sequence in the HMR E silencer or in strains with a mutation in the RAP1 gene (SUSSEL et al. 1993). When the ctf4
mutation was combined with orc5-1R, the colonies were white, indicating complete derepression of ADE2 (Figure 4A). Therefore, the effect of the ctf4
null mutation on transcriptional silencing was independent of ORC. Similarly, ctf4
led to an enhanced derepression of HMR::2EDA in combination with the rap1-12 allele (Figure 4B). The pink and white colony color was caused by the growth defect in the mutants since single- and double-mutant colonies are red in strains without ADE2. Furthermore, silencing in an orc5-1R ctf4
double mutant at the HML locus was also partially defective as judged by
-factor confrontation assay. About 10% of the double-mutant cells grew into small colonies after 14 hr at 23° in the presence of
-factor, whereas all wild-type or single-mutant cells remained arrested by
-factor (not shown).
To assay silencing at telomeres in cohesion mutants, strains were used that contained either the URA3::TRP1 reporter at telomere VII-L (Figure 5A)
or the ADE2 gene at telomere V-L (Figure 5B). When strains containing TELVII-L::URA3::TRP1 were assayed on 0.1% 5-FOA medium, selecting against URA3 function, ctf4
strains did not grow, whereas ctf18
and dcc1
strains formed small colonies. The wild-type control strain grew well, indicating that URA3 was silenced at this location, whereas the silencing defective sir2
strain did not. The TRP1 gene at telomere VII-L was also derepressed in ctf4
, ctf18
, and dcc1
mutants, although to a lesser extent than in the sir2
control strain. In wild-type cells, partial repression of the ADE2 gene at telomere V-L leads to a phenotype of red and white sectored colonies (Figure 5B). In contrast, ctf4
and ctf18
with this reporter were white. Thus, CTF4 and CTF18/DCC1 contributed to transcriptional silencing at two different telomeres.
|
Temperature-sensitive orc-ts mutations in combination with mutations in sister chromatid cohesion genes resulted in reduced viability at temperatures permissive for the individual mutations. These interactions did not appear to reflect a defect of cohesion mutants in replication initiation. Rather the reduced viability in an orc5-1 scc1-73 double mutant was likely caused by an enhanced cohesion defect. Synthetic lethal interactions are also observed for cohesion mutants in combination with mcm2-1, cdc6-1, cdc7-1, and cdc45-1 mutations, and hence we favor the notion that the interaction reflects a dependence of robust sister chromatid cohesion on initiation of DNA replication. A link between initiation of DNA replication and sister chromatid cohesion was found in S. pombe. Here, a mutation in hsk1+, which is the homolog of the S. cerevisiae CDC7 encoded serine threonine kinase, leads to a cohesion defect (TAKEDA et al. 2001; BAILIS et al. 2003).
However, orc5-1 alone showed no obvious cohesion defect compared to wild-type strain. Furthermore, the majority of chromosomal cohesin binding sites do not co-localize with origins (BLAT and KLECKNER 1999; LALORAYA et al. 2000). Thus, ORC's involvement in cohesion is presumably not completed at replication origins. Cohesion between sister chromatids is established at the time of replication, presumably by processes that occur at the replication fork. At permissive temperature, the orc2-1 mutation leads to a 30% reduction in the number of replication forks (SHIMADA et al. 2002), and presumably this loss is greater the closer to the restrictive temperature the mutant is grown. We speculate that there may be a limit to the amount of cohesion that can be established at any given fork. In this model, the reduction in the number of replication forks in the mutants leads to less cohesion, which becomes growth limiting in cells with temperature-sensitive Scc1p.
Although an enhanced cohesion defect provides an explanation for the reduced viability in the orc5-1 scc1-73 double mutant, other mechanisms might also contribute to the strong genetic interactions of ORC with cohesion genes. CTF4 and genes encoding components of the Ctf18-RFC are sensitive to different DNA-damaging agents (CHANG et al. 2002). Furthermore, cohesion is important for recombinational repair (SJOGREN and NASMYTH 2001). It is possible that the repair of broken replication forks could lead to a dependence of orc-ts mutants on cohesion genes. CTF18 also has an overlapping role with RAD24 in the replication checkpoint (NAIKI et al. 2001). Moreover, replication mutants strongly interact with the replication checkpoint genes MRC1, TOF1, and CSM3 (Figure 1C). Thus, proper replication checkpoint function could be important for viability of orc-ts and other replication mutants, and the cohesion phenotypes in the ctf mutants may be an indirect consequence of improper DNA replication or failure of the replication checkpoint. During the final stage of preparing this manuscript, work was in press that also demonstrated a cohesion function for other genes that were identified in our screens (MAYER et al. 2004; WARREN et al. 2004). Importantly, synthetic lethal screens for genes interacting with ctf4
and ctf8
also established a role in sister chromatid cohesion for the replication checkpoint genes MRC1, TOF1, and CSM3.
Only a slight interaction was observed between orc5-1 and trf4
and essentially none between orc5-1 and trf5
, suggesting that the roles of Trf4p and Trf5p are mechanistically distinct from those of Ctf4p, Ctf18-RFC, and other cohesion factors. Thus, it seems likely that some cohesion factors are more intimately connected to the replication process than others. Plasmid-loss experiments suggested that Ctf4p and Ctf18p did not directly affect initiation of DNA replication. However, this does not exclude the possibility that these proteins somehow couple the initiation of DNA replication with the establishment of sister chromatid cohesion.
We demonstrated that the genes important for the establishment of sister chromatid cohesion, CTF4, CTF18, and DCC1, also contributed to silencing of HMR, HML, and telomeres. A partial defect in telomeric silencing has also been observed in an scc1-73 strain at semipermissive temperature (P. KAUFMAN, personal communication). In principle, indirect effects on chromosome organization that occur in these mutants could explain such links. A mutation in a cohesin subunit removed a boundary for the spread of heterochromatin at the HMR locus (DONZE et al. 1999). Spreading of heterochromatic factors into the adjacent euchromatin might dilute heterochromatin components and decreases transcriptional silencing (MENEGHINI et al. 2003). Thus, sister chromatid cohesion could be important for the proper separation and distribution of euchromatin and heterochromatin.
More direct models are supported by the temporal coincidence of the establishment of sister chromatid cohesion in S phase with chromatin assembly and the establishment of silencing (MILLER and NASMYTH 1984; SHIBAHARA and STILLMAN 1999; ZHANG et al. 2000; KIRCHMAIER and RINE 2001; LI et al. 2001). Recent work suggests that cohesins have to be removed before silencing is complete (LAU et al. 2002), which implies an inhibitory role for cohesins in silencing. Our data present the reciprocal view that cohesion establishment contributes positively to silencing, suggesting a more complex interplay between proteins involved in the two processes. Defects in transcriptional silencing have been shown for chromatin assembly factors that are associated with the replication fork (KAUFMAN et al. 1998; TYLER et al. 1999; SHARP et al. 2001). Similarly, Ctf4p and the Ctf18-RFC complex could also affect silencing by their possible function at the replication fork. This also raises the question of whether the cohesion phenotypes in ctf4
and cf18
are a consequence of a defective organization of newly replicated chromatin. The involvement of cohesion factors in transcriptional silencing demonstrates therefore an interdependence of DNA replication, chromosome structure, and proper chromosome segregation.
DNA replication, like other DNA-dependent processes, must contend with the organization of DNA into nucleosomes and higher-order chromatin structures. Previous work established the contribution of positioned nucleosomes to replication initiation at ARS1 (SIMPSON 1990; LIPFORD and BELL 2001). The identification of multiple genes with roles in nucleosome remodeling and histone modification in our screens suggests that specific aspects of chromatin structure influence replication. Mobilization of nucleosomes by chromatin-remodeling factors may promote origin firing or fork progression. The recovery of histone acetyltransferases, NAD+-dependent protein deacetylase paralogs, and chromatin-remodeling factors in the screen implies a deep and potentially complex relationship between chromatin structure and DNA replication.
BAILIS, J. M., P. BERNARD, R. ANTONELLI, R. C. ALLSHIRE and S. L. FORSBURG, 2003 Hsk1-Dfp1 is required for heterochromatin-mediated cohesion at centromeres. Nat. Cell Biol. 5: 11111116.[CrossRef][Medline]
BELL, S. P., and A. DUTTA, 2002 DNA replication in eukaryotic cells. Annu. Rev. Biochem. 71: 333374.[CrossRef][Medline]
BELL, S. P., R. KOBAYASHI and B. STILLMAN, 1993 Yeast origin recognition complex functions in transcription silencing and DNA replication. Science 262: 18441849.
BELL, S. P., J. MITCHELL, J. LEBER, R. KOBAYASHI and B. STILLMAN, 1995 The multidomain structure of Orc1p reveals similarity to regulators of DNA replication and transcriptional silencing. Cell 83: 563568.[CrossRef][Medline]
BERNARD, P., J. F. MAURE, J. F. PARTRIDGE, S. GENIER, J. P. JAVERZAT et al., 2001 Requirement of heterochromatin for cohesion at centromeres. Science 294: 25392542.
BLAT, Y., and N. KLECKNER, 1999 Cohesins bind to preferential sites along yeast chromosome III, with differential regulation along arms versus the centric region. Cell 98: 249259.[CrossRef][Medline]
CARSON, D. R., and M. F. CHRISTMAN, 2001 Evidence that replication fork components catalyze establishment of cohesion between sister chromatids. Proc. Natl. Acad. Sci. USA 98: 82708275.
CHANG, M., M. BELLAOUI, C. BOONE and G. W. BROWN, 2002 A genome-wide screen for methyl methanesulfonate-sensitive mutants reveals genes required for S phase progression in the presence of DNA damage. Proc. Natl. Acad. Sci. USA 99: 1693416939.
COSTANZO, M. C., M. E. CRAWFORD, J. E. HIRSCHMAN, J. E. KRANZ, P. OLSEN et al., 2001 YPD, PombePD and WormPD: model organism volumes of the BioKnowledge library, an integrated resource for protein information. Nucleic Acids Res. 29: 7579.
DILLIN, A., and J. RINE, 1997 Separable functions of ORC5 in replication initiation and silencing in Saccharomyces cerevisiae. Genetics 147: 10531062.[Abstract]
DONZE, D., C. R. ADAMS, J. RINE and R. T. KAMAKAKA, 1999 The boundaries of the silenced HMR domain in Saccharomyces cerevisiae. Genes Dev. 13: 698708.
EDWARDS, S., C. M. LI, D. L. LEVY, J. BROWN, P. M. SNOW et al., 2003 Saccharomyces cerevisiae DNA polymerase epsilon and polymerase sigma interact physically and functionally, suggesting a role for polymerase epsilon in sister chromatid cohesion. Mol. Cell. Biol. 23: 27332748.
EHRENHOFER-MURRAY, A. E., M. GOSSEN, D. T. PAK, M. R. BOTCHAN and J. RINE, 1995 Separation of origin recognition complex functions by cross-species complementation. Science 270: 16711674.
EHRENHOFER-MURRAY, A. E., R. T. KAMAKAKA and J. RINE, 1999 A role for the replication proteins PCNA, RF-C, polymerase epsilon and Cdc45 in transcriptional silencing in Saccharomyces cerevisiae. Genetics 153: 11711182.
FOSS, M., F. J. MCNALLY, P. LAURENSON and J. RINE, 1993 Origin recognition complex (ORC) in transcriptional silencing and DNA replication in S. cerevisiae. Science 262: 18381844.
FOX, C. A., S. LOO, A. DILLIN and J. RINE, 1995 The origin recognition complex has essential functions in transcriptional silencing and chromosomal replication. Genes Dev. 9: 911924.
GARBER, P. M., and J. RINE, 2002 Overlapping roles of the spindle assembly and DNA damage checkpoints in the cell-cycle response to altered chromosomes in Saccharomyces cerevisiae. Genetics 161: 521534.
GUACCI, V., D. KOSHLAND and A. STRUNNIKOV, 1997 A direct link between sister chromatid cohesion and chromosome condensation revealed through the analysis of MCD1 in S. cerevisiae. Cell 91: 4757.[CrossRef][Medline]
GUARENTE, L., 1993 Synthetic enhancement in gene interaction: a genetic tool come of age. Trends Genet. 9: 362366.[CrossRef][Medline]
HAGSTROM, K. A., and B. J. MEYER, 2003 Condensin and cohesin: more than chromosome compactor and glue. Nat. Rev. Genet. 4: 520534.[CrossRef][Medline]
HANNA, J. S., E. S. KROLL, V. LUNDBLAD and F. A. SPENCER, 2001 Saccharomyces cerevisiae CTF18 and CTF4 are required for sister chromatid cohesion. Mol. Cell. Biol. 21: 31443158.
HARDY, C. F., 1996 Characterization of an essential Orc2p-associated factor that plays a role in DNA replication. Mol. Cell. Biol. 16: 18321841.[Abstract]
HARTMAN, J. L. T., B. GARVIK and L. HARTWELL, 2001 Principles for the buffering of genetic variation. Science 291: 10011004.
HARTWELL, L. H., and D. SMITH, 1985 Altered fidelity of mitotic chromosome transmission in cell cycle mutants of S. cerevisiae. Genetics 110: 381395.
HE, X., S. ASTHANA and P. K. SORGER, 2000 Transient sister chromatid separation and elastic deformation of chromosomes during mitosis in budding yeast. Cell 101: 763775.[CrossRef][Medline]
HODGES, P. E., A. H. MCKEE, B. P. DAVIS, W. E. PAYNE and J. I. GARRELS, 1999 The Yeast Proteome Database (YPD): a model for the organization and presentation of genome-wide functional data. Nucleic Acids Res. 27: 6973.
HOGAN, E., and D. KOSHLAND, 1992 Addition of extra origins of replication to a minichromosome suppresses its mitotic loss in cdc6 and cdc14 mutants of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 89: 30983102.
KATOU, Y., Y. KANOH, M. BANDO, H. NOGUCHI, H. TANAKA et al., 2003 S-phase checkpoint proteins Tof1 and Mrc1 form a stable replication-pausing complex. Nature 424: 10781083.[CrossRef][Medline]
KAUFMAN, P. D., J. L. COHEN and M. A. OSLEY, 1998 Hir proteins are required for position-dependent gene silencing in Saccharomyces cerevisiae in the absence of chromatin assembly factor I. Mol. Cell. Biol. 18: 47934806.
KENNA, M. A., and R. V. SKIBBENS, 2003 Mechanical link between cohesion establishment and DNA replication: Ctf7p/Eco1p, a cohesion establishment factor, associates with three different replication factor C complexes. Mol. Cell. Biol. 23: 29993007.
KIRCHMAIER, A. L., and J. RINE, 2001 DNA replication-independent silencing in S. cerevisiae. Science 291: 646650.
KROLL, E. S., K. M. HYLAND, P. HIETER and J. J. LI, 1996 Establishing genetic interactions by a synthetic dosage lethality phenotype. Genetics 143: 95102.[Abstract]
LALORAYA, S., V. GUACCI and D. KOSHLAND, 2000 Chromosomal addresses of the cohesin component Mcd1p. J. Cell Biol. 151: 10471056.
LAU, A., H. BLITZBLAU and S. P. BELL, 2002 Cell-cycle control of the establishment of mating-type silencing in S. cerevisiae. Genes Dev. 16: 29352945.
LEW, D. J., and D. J. BURKE, 2003 The spindle assembly and spindle position checkpoints. Annu. Rev. Genet. 37: 251282.[CrossRef][Medline]
LI, Y. C., T. H. CHENG and M. R. GARTENBERG, 2001 Establishment of transcriptional silencing in the absence of DNA replication. Science 291: 650653.
LIANG, C., M. WEINREICH and B. STILLMAN, 1995 ORC and Cdc6p interact and determine the frequency of initiation of DNA replication in the genome. Cell 81: 667676.[CrossRef][Medline]
LIPFORD, J. R., and S. P. BELL, 2001 Nucleosomes positioned by ORC facilitate the initiation of DNA replication. Mol. Cell 7: 2130.[CrossRef][Medline]
LOO, S., C. A. FOX, J. RINE, R. KOBAYASHI, B. STILLMAN et al., 1995 The origin recognition complex in silencing, cell cycle progression, and DNA replication. Mol. Biol. Cell 6: 741756.[Abstract]
MAYER, M. L., S. P. GYGI, R. AEBERSOLD and P. HIETER, 2001 Identification of RFC(Ctf18p, Ctf8p, Dcc1p): an alternative RFC complex required for sister chromatid cohesion in S. cerevisiae. Mol. Cell 7: 959970.[CrossRef][Medline]
MAYER, M. L., I. POT, M. CHANG, H. XU, V. ANELIUNAS et al., 2004 Identification of protein complexes required for efficient sister chromatid cohesion. Mol. Biol. Cell 15: 17361745.
MENEGHINI, M. D., M. WU and H. D. MADHANI, 2003 Conserved histone variant H2A.Z protects euchromatin from the ectopic spread of silent heterochromatin. Cell 112: 725736.[CrossRef][Medline]
MICHAELIS, C., R. CIOSK and K. NASMYTH, 1997 Cohesins: chromosomal proteins that prevent premature separation of sister chromatids. Cell 91: 3545.[CrossRef][Medline]
MILES, J., and T. FORMOSA, 1992 Evidence that POB1, a Saccharomyces cerevisiae protein that binds to DNA polymerase alpha, acts in DNA metabolism in vivo. Mol. Cell. Biol. 12: 57245735.
MILLER, A. M., and K. A. NASMYTH, 1984 Role of DNA replication in the repression of silent mating type loci in yeast. Nature 312: 247251.[CrossRef][Medline]
NAIKI, T., T. KONDO, D. NAKADA, K. MATSUMOTO and K. SUGIMOTO, 2001 Chl12 (Ctf18) forms a novel replication factor C-related complex and functions redundantly with Rad24 in the DNA replication checkpoint pathway. Mol. Cell. Biol. 21: 58385845.
NASMYTH, K., 2002 Segregating sister genomes: the molecular biology of chromosome separation. Science 297: 559565.
OSBORN, A. J., and S. J. ELLEDGE, 2003 Mrc1 is a replication fork component whose phosphorylation in response to DNA replication stress activates Rad53. Genes Dev. 17: 17551767.
PAGE, B. D., and M. SNYDER, 1992 CIK1: a developmentally regulated spindle pole body-associated protein important for microtubule functions in Saccharomyces cerevisiae. Genes Dev. 6: 14141429.
SCHWARTZ, K., K. RICHARDS and D. BOTSTEIN, 1997 BIM1 encodes a microtubule-binding protein in yeast. Mol. Biol. Cell 8: 26772691.
SHARP, J. A., E. T. FOUTS, D. C. KRAWITZ and P. D. KAUFMAN, 2001 Yeast histone deposition protein Asf1p requires Hir proteins and PCNA for heterochromatic silencing. Curr. Biol. 11: 463473.[CrossRef][Medline]
SHIBAHARA, K., and B. STILLMAN, 1999 Replication-dependent marking of DNA by PCNA facilitates CAF-1-coupled inheritance of chromatin. Cell 96: 575585.[CrossRef][Medline]
SHIMADA, K., P. PASERO and S. M. GASSER, 2002 ORC and the intra-S-phase checkpoint: a threshold regulates Rad53p activation in S phase. Genes Dev. 16: 32363252.
SIMPSON, R. T., 1990 Nucleosome positioning can affect the function of a cis-acting DNA element in vivo. Nature 343: 387389.[CrossRef][Medline]
SJOGREN, C., and K. NASMYTH, 2001 Sister chromatid cohesion is required for postreplicative double-strand break repair in Saccharomyces cerevisiae. Curr. Biol. 11: 991995.[CrossRef][Medline]
SKIBBENS, R. V., L. B. CORSON, D. KOSHLAND and P. HIETER, 1999 Ctf7p is essential for sister chromatid cohesion and links mitotic chromosome structure to the DNA replication machinery. Genes Dev. 13: 307319.
SUSSEL, L., D. VANNIER and D. SHORE, 1993 Epigenetic switching of transcriptional states: cis- and trans-acting factors affecting establishment of silencing at the HMR locus in Saccharomyces cerevisiae. Mol. Cell. Biol. 13: 39193928.
TAKEDA, T., K. OGINO, K. TATEBAYASHI, H. IKEDA, K. ARAI et al., 2001 Regulation of initiation of S phase, replication checkpoint signaling, and maintenance of mitotic chromosome structures during S phase by Hsk1 kinase in the fission yeast. Mol. Biol. Cell 12: 12571274.
THARUN, S., W. HE, A. E. MAYES, P. LENNERTZ, J. D. BEGGS et al., 2000 Yeast Sm-like proteins function in mRNA decapping and decay. Nature 404: 515518.[CrossRef][Medline]
TONG, A. H., M. EVANGELISTA, A. B. PARSONS, H. XU, G. D. BADER et al., 2001 Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science 294: 23642368.
TONG, A. H., G. LESAGE, G. D. BADER, H. DING, H. XU et al., 2004 Global mapping of the yeast genetic interaction network. Science 303: 808813.
TOTH, A., R. CIOSK, F. UHLMANN, M. GALOVA, A. SCHLEIFFER et al., 1999 Yeast cohesin complex requires a conserved protein, Eco1p(Ctf7), to establish cohesion between sister chromatids during DNA replication. Genes Dev. 13: 320333.
TYLER, J. K., C. R. ADAMS, S. R. CHEN, R. KOBAYASHI, R. T. KAMAKAKA et al., 1999 The RCAF complex mediates chromatin assembly during DNA replication and repair. Nature 402: 555560.[CrossRef][Medline]
UHLMANN, F., F. LOTTSPEICH and K. NASMYTH, 1999 Sister-chromatid separation at anaphase onset is promoted by cleavage of the cohesin subunit Scc1. Nature 400: 3742.[CrossRef][Medline]
WANG, Z., I. B. CASTANO, A. DE LAS PENAS, C. ADAMS and M. F. CHRISTMAN, 2000 Pol kappa: a DNA polymerase required for sister chromatid cohesion. Science 289: 774779.
WARREN, C. D., D. M. ECKLEY, M. S. LEE, J. S. HANNA, A. HUGHES et al., 2004 S-phase checkpoint genes safeguard high fidelity sister chromatid cohesion. Mol. Biol. Cell 15: 17241735.
XIE, J., M. PIERCE, V. GAILUS-DURNER, M. WAGNER, E. WINTER et al., 1999 Sum1 and Hst1 repress middle sporulation-specific gene expression during mitosis in Saccharomyces cerevisiae. EMBO J. 18: 64486454.[CrossRef][Medline]
ZHANG, Z., K. SHIBAHARA and B. STILLMAN, 2000 PCNA connects DNA replication to epigenetic inheritance in yeast. Nature 408: 221225.[CrossRef][Medline]
ZOU, L., J. MITCHELL and B. STILLMAN, 1997 CDC45, a novel yeast gene that functions with the origin recognition complex and Mcm proteins in initiation of DNA replication. Mol. Cell. Biol. 17: 553563.[Abstract]
This article has been cited by other articles:
![]() |
M. R. Koch and L. Pillus From the Cover: The glucanosyltransferase Gas1 functions in transcriptional silencing PNAS, July 7, 2009; 106(27): 11224 - 11229. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Rehman, D. Wang, G. Fourel, E. Gilson, and K. Yankulov Subtelomeric ACS-containing Proto-silencers Act as Antisilencers in Replication Factors Mutants in Saccharomyces cerevisiae Mol. Biol. Cell, January 1, 2009; 20(2): 631 - 641. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Peters, A. Tedeschi, and J. Schmitz The cohesin complex and its roles in chromosome biology Genes & Dev., November 15, 2008; 22(22): 3089 - 3114. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Brands and R. V. Skibbens Sister Chromatid Cohesion Role for CDC28-CDK in Saccharomyces cerevisiae Genetics, September 1, 2008; 180(1): 7 - 16. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Celic, A. Verreault, and J. D. Boeke Histone H3 K56 Hyperacetylation Perturbs Replisomes and Causes DNA Damage Genetics, August 1, 2008; 179(4): 1769 - 1784. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Diaz-Martinez, J. F. Gimenez-Abian, and D. J. Clarke Chromosome cohesion - rings, knots, orcs and fellowship J. Cell Sci., July 1, 2008; 121(13): 2107 - 2114. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. van Welsem, F. Frederiks, K. F. Verzijlbergen, A. W. Faber, Z. W. Nelson, D. A. Egan, D. E. Gottschling, and F. van Leeuwen Synthetic Lethal Screens Identify Gene Silencing Processes in Yeast and Implicate the Acetylated Amino Terminus of Sir3 in Recognition of the Nucleosome Core Mol. Cell. Biol., June 1, 2008; 28(11): 3861 - 3872. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Han, H. Zhou, Z. Li, R.-M. Xu, and Z. Zhang Acetylation of Lysine 56 of Histone H3 Catalyzed by RTT109 and Regulated by ASF1 Is Required for Replisome Integrity J. Biol. Chem., September 28, 2007; 282(39): 28587 - 28596. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Dershowitz, M. Snyder, M. Sbia, J. H. Skurnick, L. Y. Ong, and C. S. Newlon Linear Derivatives of Saccharomyces cerevisiae Chromosome III Can Be Maintained in the Absence of Autonomously Replicating Sequence Elements Mol. Cell. Biol., July 1, 2007; 27(13): 4652 - 4663. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Xu, C. Boone, and G. W. Brown Genetic Dissection of Parallel Sister-Chromatid Cohesion Pathways Genetics, July 1, 2007; 176(3): 1417 - 1429. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Han, H. Zhou, Z. Li, R.-M. Xu, and Z. Zhang The Rtt109-Vps75 Histone Acetyltransferase Complex Acetylates Non-nucleosomal Histone H3 J. Biol. Chem., May 11, 2007; 282(19): 14158 - 14164. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Han, H. Zhou, B. Horazdovsky, K. Zhang, R.-M. Xu, and Z. Zhang Rtt109 Acetylates Histone H3 Lysine 56 and Functions in DNA Replication Science, February 2, 2007; 315(5812): 653 - 655. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Nieduszynski, S.-i. Hiraga, P. Ak, C. J. Benham, and A. D. Donaldson OriDB: a DNA replication origin database Nucleic Acids Res., January 12, 2007; 35(suppl_1): D40 - D46. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Rehman, G. Fourel, A. Mathews, D. Ramdin, M. Espinosa, E. Gilson, and K. Yankulov Differential Requirement of DNA Replication Factors for Subtelomeric ARS Consensus Sequence Protosilencers in Saccharomyces cerevisiae Genetics, December 1, 2006; 174(4): 1801 - 1810. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Laha, S. P. Das, S. Hajra, S. Sau, and P. Sinha The budding yeast protein Chl1p is required to preserve genome integrity upon DNA damage in S-phase Nucleic Acids Res., November 6, 2006; 34(20): 5880 - 5891. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Matecic, K. Martins-Taylor, M. Hickman, J. Tanny, D. Moazed, and S. G. Holmes New Alleles of SIR2 Define Cell-Cycle-Specific Silencing Functions Genetics, August 1, 2006; 173(4): 1939 - 1950. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. Andreassen, G. P.H. Ho, and A. D. D'Andrea DNA damage responses and their many interactions with the replication fork Carcinogenesis, May 1, 2006; 27(5): 883 - 892. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Dhillon, M. Oki, S. J. Szyjka, O. M. Aparicio, and R. T. Kamakaka H2A.Z Functions To Regulate Progression through the Cell Cycle Mol. Cell. Biol., January 15, 2006; 26(2): 489 - 501. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-R. Chang, C.-S. Wu, Y. Hom, and M. R. Gartenberg Targeting of cohesin by transcriptionally silent chromatin Genes & Dev., December 15, 2005; 19(24): 3031 - 3042. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. D. Ganley, K. Hayashi, T. Horiuchi, and T. Kobayashi Identifying gene-independent noncoding functional elements in the yeast ribosomal DNA by phylogenetic footprinting PNAS, August 16, 2005; 102(33): 11787 - 11792. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Irlbacher, J. Franke, T. Manke, M. Vingron, and A. E. Ehrenhofer-Murray Control of replication initiation and heterochromatin formation in Saccharomyces cerevisiae by a regulator of meiotic gene expression Genes & Dev., August 1, 2005; 19(15): 1811 - 1822. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Williams and J. R. McIntosh Mcl1p Is a Polymerase {alpha} Replication Accessory Factor Important for S-Phase DNA Damage Survival Eukaryot. Cell, January 1, 2005; 4(1): 166 - 177. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Suter, B.
- Articles by Rine, J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Suter, B.
- Articles by Rine, J.















