- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Clauss, M. J.
- Articles by Mitchell-Olds, T.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Clauss, M. J.
- Articles by Mitchell-Olds, T.
Functional Divergence in Tandemly Duplicated Arabidopsis thaliana Trypsin Inhibitor Genes
M. J. Claussa and T. Mitchell-Oldsaa Department of Genetics and Evolution, Max Planck Institute of Chemical Ecology, 07745 Jena, Germany
Corresponding author: M. J. Clauss, Max Planck Institute of Chemical Ecology, Beutenberg Campus, Hans Knöll Str. 8, 07745 Jena, Germany., clauss{at}ice.mpg.de (E-mail)
Communicating editor: J. BERGELSON
| ABSTRACT |
|---|
In multigene families, variation among loci and alleles can contribute to trait evolution. We explored patterns of functional and genetic variation in six duplicated Arabidopsis thaliana trypsin inhibitor (ATTI) loci. We demonstrate significant variation in constitutive and herbivore-induced transcription among ATTI loci that show, on average, 65% sequence divergence. Significant variation in ATTI expression was also found between two molecularly defined haplotype classes. Population genetic analyses for 17 accessions of A. thaliana showed that six ATTI loci arranged in tandem within 10 kb varied 10-fold in nucleotide diversity, from 0.0009 to 0.0110, and identified a minimum of six recombination events throughout the tandem array. We observed a significant peak in nucleotide and indel polymorphism spanning ATTI loci in the interior of the array, due primarily to divergence between the two haplotype classes. Significant deviation from the neutral equilibrium model for individual genes was interpreted within the context of intergene linkage disequilibrium and correlated patterns of functional differentiation. In contrast to the outcrosser Arabidopsis lyrata for which recombination is observed even within ATTI loci, our data suggest that response to selection was slowed in the inbreeding, annual A. thaliana because of interference among functionally divergent ATTI loci.
NATURAL selection and neutral evolutionary processes can shape functionally important genetic variation at individual genes. In multigene families, we are further challenged to distinguish the contribution of variation among loci and among alleles to functional diversification (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Evolutionary inferences based on patterns in molecular sequence data have been the topic of a large number of recent studies (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Proteinase inhibitors (PIs) are widespread and highly diverse in the plant kingdom. The physiological function of plant proteinase inhibitors includes protection against the proteolytic enzymes of herbivores and pathogens, as well as the regulation of endogenous storage proteinases during seed dormancy and reserve protein mobilization (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Functional investigation of Sinapis trypsin inhibitors has demonstrated expression in immature seeds and in wounded leaves (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The loci encoding A. thaliana trypsin inhibitors (ATTIs) are members of a multigene family. Six ATTI loci are arranged in tandem within 10 kb on chromosome II and appear to have undergone duplication subsequent to a genome duplication event 2440 million years ago (![]()
| MATERIALS AND METHODS |
|---|
A. thaliana trypsin inhibitors:
Six ATTI loci have been identified in the Columbia accession of A. thaliana on the basis of sequence homology to mustard trypsin inhibitor (MTI2; ![]()
![]()
![]()
|
The ATTI1 locus encodes an 89-amino-acid precursor with 27 amino acids in the amino terminus not represented in the mature protein (![]()
![]()
Herbivory experiment and expression analysis:
Seeds of seven A. thaliana accessions chosen randomly from two sequence-defined haplotype classes (A, Gö-0, Ler-0, Nd-1, and Rsch-0; B, Cvi-1, Fe-1a, and Wei-0; see below for haplotype classification) were sown onto a sterilized potting soil/vermiculite mix (3:1), vernalized at 4° for 1 week, placed in a randomized design into a short-day growth chamber, and reduced to a single individual per pot after germination. Four and 6 weeks after germination, six randomly selected plants per accession were placed into a separate growth chamber for 9 hr; three plants were subjected to the herbivory treatment and three individuals were control plants. The herbivory treatment consisted of one third instar Plutella xylostella (Leptidoptera) larva per plant. The larvae originate from line G88 (Cornell University) and were reared on an artificial diet (![]()
![]()
For each of 12 plants per accession (two ages, two herbivore treatments, and three replicates), RNA was extracted from
100 mg of leaf tissue using a standard protocol employing cell lysis with TRIZOL reagent (GIBCO BRL, Gaithersburg, MD) and RNA purification with phenol-chloroform and ethanol precipitation. Approximately 1 µg of total RNA was used for cDNA synthesis, as described by ![]()
5 ng/µl (RAN; Ras-related nuclear small GTP-binding protein; At5g55190). RAN primers were 5' ACCAGCAAACCGTGGATTACC and 3' CCACAAAGTGAAGATTAGCGTCC (57°; see RT-PCR conditions below). To assess trypsin inhibitor expression, one master mix was made for RT-PCR conducted with primers for all six ATTI loci and RAN. A standard PCR protocol was used with the following cycling scheme: 2 min at 94°; 30 cycles of 30 sec at 94°, 20 sec at primer-specific annealing temperature, and 40 sec at 72°; and a final extension at 72° for 10 min. Locus-specific primers were designed to span the intron, such that PCR products derived from the cDNA could be differentiated from genomic contaminants (primer sequences available upon request). The PCR products were visualized on a 2% agarose gel in a standardized manner. Band intensity provides a semiquantitative measure of the transcription level (ImageQuant 5.1; Molecular Dynamics, Sunnyvale, CA). Prior to analysis of transcription level, each RT-PCR band was standardized to the intensity of the 400-bp band of 2 µl of the Low Mass Ladder (Invitrogen, San Diego) loaded in every ninth well to control for gel effects. For the ATTI RT-PCR products, we standardized bands by the intensity of the RAN band for the given individual and by the PCR efficiency of the primers for that ATTI locus amplifying genomic DNA.
Statistical analysis of transcription:
An analysis of variance was performed on the log-transformed standardized transcript level and, because transcription was sometimes zero, 100 was added to each standardized data point prior to log transformation (PROC GLM; version 8, SAS Institute). Haplotype class, herbivory, locus, age, and accession nested within haplotype class were fixed effects (e.g., ![]()
ATTI tandem arrayamplification and sequencing:
A single individual was sampled from 17 accessions of A. thaliana (L.) Heynh. (Brassicaceae) originating from Eurasia, North Africa, and North America: Col-0, USA; Cvi-1, Cape Verde Islands; Di-0, France; Fe-1a, Germany; Gö-0, Germany; Ita-0, Morocco; Kas-1, India; Le-0, The Netherlands; Ler-0, Germany; Nd-1, Germany; Nok-0, The Netherlands; Rsch-0, Russia; Sah-0, Spain; Ta-0, Czech Republic; Wei-0, Switzerland; Wil-2, Lithuania; and Ws-0, Belarus. All A. thaliana seeds were obtained from the Nottingham Arabidopsis Stock Center. After harvest, young leaf material from each accession was placed in liquid nitrogen and DNA extraction from 0.1 g of tissue followed the protocol for the Nucleon PhytoPure plant DNA extraction kit (Amersham, Arlington, Heights, IL). Primers for PCR amplification were placed in the exons of genes flanking the ATTI array in Columbia (AC002335; arrayF, 5' GGACGGGTCGTTTCAGCTG, and arrayR, 5' GACGTGAGCTTAGAGTTCATAC; 58°). PCR of up to 10 kb of chromosome II was conducted using ELONGase Enzyme mix (GIBCO BRL) with hotstart and an 8-min extension time. PCR products were gel purified and cloned using pCR-Blunt II TOPO vector (Invitrogen). Three clones per accession were sequenced on a 3700 ABI capillary sequencer using primers spaced approximately every 400 bp and designed from the Columbia accession (available upon request). For Ita-0, the ATTI region was amplified in two overlapping segments due to the presence of a large insertion. The ATTI array was amplified from one individual of A. lyrata ssp. petraea from Plech in Bavaria, Germany (49° 54' 99'' N; 11° 30' 64'' E; same as KOCH, Pfaffenhofen b. Neuhaus, Bavaria, Germany, leg. KOCH; ![]()
![]()
Sequence analysis:
Sequences were assembled with SeqMan 5.0 (DNASTAR) and all variable sites were checked manually during the construction of a consensus sequence from three clones for each A. thaliana accession and one A. lyrata individual. Only one allele per accession was included in the population genetic analysis of A. thaliana because individuals are derived from multiple generations of inbreeding in the laboratory. For the outgroup A. lyrata, we sequenced one of two alleles. All sequences were aligned with MegAlign 5.03 set to default gap penalty parameters (DNASTAR). Pairwise BLAST searches confirmed insertion/deletion (indel) breakpoints in regions of high polymorphism and repetitive nucleotide sequence. Coding and noncoding regions were inferred according to homology with MTI2, GenBank annotation, and sequenced cDNA clones in A. thaliana (M. J. CLAUSS, unpublished data). The DnaSP program version 3.84 (![]()
, was estimated according to ![]()
according to ![]()
![]()
![]()
![]()
![]()
Sequences were tested for departure from equilibrium-neutral expectations using statistics from ![]()
![]()
![]()
![]()
per gene (estimated as the average number of nucleotide differences), (2) the sample size, (3) the estimated recombination parameter per gene (R), and (4) the estimated value of Fay and Wu's H. Homogeneity of diversity and divergence in silent sites along the tandem array was tested using a multilocus Hudson, Kreitman, and Aguadé (HKA) test for eight nonoverlapping, artificially defined loci each encompassing
500 nongapped positions (multilocus HKA; distributed by Jody Hey through http://www.lifesci.rutgers.edu/heylab/).
| RESULTS |
|---|
Heterogeneous ATTI expression:
Semiquantitative RT-PCR estimating mRNA levels of ATTI loci in rosette leaves for seven accessions of A. thaliana demonstrated that five of the six ATTI loci were transcribed. Although positive controls for three primer pairs with genomic DNA resulted in ATTI5 amplification, we never observed ATTI5 bands in RT-PCR analyses for any accession or tissue type (including basal leaves, flowers, fruits, and roots; results not shown). Consequently, the ATTI5 locus was excluded from subsequent analyses. The ATTI5 locus was identified here for the first time on the basis of sequence similarity and position within the tandem array from the accessions Cvi-1, Fe-1a, Nd-1, and Wei-0 (see below). The ATTI4 locus, presently not annotated in the Col-0 sequence as a member of the trypsin inhibitor gene family, was transcribed in all accessions tested.
There was differential regulation among ATTI loci, among haplotype classes, and in response to herbivory, as seen by the significant main effects in the ANOVA of log-transformed transcript levels (Table 1). Gene regulation differed among loci with ATTI3 and ATTI6 having the highest transcript levels (Table 1; Fig 2A). The haplotype classes differed significantly in transcription; overall, haplotype A (HA) had higher transcript levels (Table 1; Fig 2B). Only ATTI6 showed the opposite response, with haplotype B (HB) having more transcripts (Fig 2B). Accessions were assigned to haplotype class on the basis of the presence (HB) or absence (HA) of the ATTI5 region, as well as >150 nucleotide polymorphisms in linkage disequilibrium throughout the array (see below). The effect of accession nested within haplotype class explained no additional variation in transcript levels (Table 1). The herbivory treatment accounted for the largest source of variation in the model, with herbivore-induced plants having, on average, 4.5 times greater transcript levels than uninduced control plants (Table 1; Fig 2C). Loci were induced differently by herbivory, such that transcription plasticity was greater than average for ATTI3 and lower than average for ATTI2 (Table 1, linear contrasts; Fig 2C). Plant age did not account for significant variation in expression. However, the two-way interaction of locus and age was significant, indicating the potential for age-specific regulation among loci (Table 1; Fig 2A). The remaining two-way as well as all three- and four-way interaction terms were not significant and, therefore, were removed from the model for clarity.
|
|
Nucleotide variation in the ATTI array:
The alignment of 17 accessions of A. thaliana for the ATTI tandem array located on chromosome II spanned 9019 bp (from 3' of the preceding to 5' of the succeeding gene). An analysis based on 7016 nongapped sites identified 239 polymorphic sites (including 59 singletons), 16 haplotypes, nucleotide diversity estimates of
= 0.0107 and
= 0.0102, and a minimum of six recombination events. Unless otherwise stated, analyses and references to position are based on a 10,352-bp global alignment of 17 A. thaliana accessions with A. lyrata as the outgroup.
Under neutrality, nucleotide sequences exhibiting high divergence among species are also predicted to evolve at high rates within species. In the ATTI region, however, diversity and divergence were uncorrelated (rSpearman = 0.137; P = 0.996; n = 17 nonoverlapping 300-bp windows), and a multilocus HKA test rejected homogeneity of polymorphism and divergence (eight nonoverlapping loci of
500 bp;
2 = 24.71; P < 0.001). In relation to divergence, polymorphism was disproportionately lower in the 5' and 3' ends of the region and higher flanking ATTI4, in the middle of the array (Fig 3).
|
Significant linkage disequilibrium was evident throughout the entire tandem array (55% of comparisons by Fisher's exact test significant at P < 0.001; Fig 4), giving rise to two haplotype clades (Fig 5). In addition to the six recombination events identified via the ![]()
|
|
Within the ATTI array, a peak in species-wide diversity centered on ATTI5 was the result of a large number of fixed differences among haplotypes (Fig 6A;
> 0.04 in one 400-bp window; n = 17 accessions). Diversity within each haplotype was similarly low throughout the array (HA
= 0.0032; HB
= 0.0027) and showed no underlying peaks in polymorphism near ATTI5 (Fig 6A). Using 2 accessions that are representative of HA and HB (Col-0 and Fe-1, respectively), we polarized each polymorphism in the array using the A. lyrata sequence as the outgroup. Equal numbers of derived nucleotide substitutions were found in the two lineages (62 in each Col-0 and Fe-1a). Even within the largest nonrecombining region in the array interior (Fig 4), derived and ancestral substitutions were evenly distributed among haplotypes (Table 2).
|
|
We tested whether the species-wide frequency spectrum of polymorphisms deviated from expectations under neutral equilibrium population dynamics. A sliding window analysis of the ATTI region demonstrated that, on average, Tajima's D was not different from zero (D = 0.22; P > 0.10). However, two 400-bp segments did deviate significantly from zero: D = 2.08 (P < 0.05) and D = 2.26 (P < 0.05), corresponding to the 5' regions of ATTI2 and ATTI6, respectively (Fig 6B; see Single-locus analysis below). A sliding window analysis of Fay and Wu's H demonstrated that, within the context of an overall excess of high-frequency-derived polymorphisms (H = 36.06; P < 0.001), distinct deviations from neutrality were associated with ATTI2 and ATTI4 (Fig 6C).
Insertion/deletion variation in the ATTI array:
The pattern of insertions and deletions contains valuable population genetic information and simultaneously can be the source of hidden biases in the analysis of nucleotide diversity. Alignment algorithms employing a high or low gap penalty can result in elevated or reduced diversity parameters within the resulting alignments, respectively. Indels were found throughout the ATTI array, with an indel peak roughly coinciding with the peak of polymorphism (rSpearman = 0.48; P = 0.049; n = 17 nonoverlapping 400-bp windows; Fig 7). This positive correlation is not expected if high diversity were simply an alignment artifact. When we polarized 230 gapped sites in accessions representative of haplotypes A and B relative to the A. lyrata outgroup (Col-0 and Fe-1a, respectively), we observed approximately equal numbers of insertion and deletion events (20 and 23, respectively), although 2.7 times more sites were deleted (163) than were inserted (67). Derived indels were distributed evenly among haplotype clades surrounding the ATTI5 deletion (Table 2).
|
In the Ita-0 accession, we identified a 4857-bp indel that appears to be a class II (DNA) transposable element insertion as evidenced by the presence of an 11-bp terminal inverted repeat, flanking 5-bp target site duplication, and sequence similarity to A. thaliana MuDR-like elements. The element was located within the 5' untranslated region (UTR) of ATTI4 (85 bp of ATG, with no discernible effect on transcription; M. J. CLAUSS, unpublished data) and was lacking in the remaining 16 accessions as well as in the A. lyrata outgroup. The second largest indel was a 1505-bp deletion observed in 13 of 17 accessions, which includes the previously undescribed ATTI5 locus (Fig 1). The ATTI5+ allele was 43% diverged from the most similar locus; hence ATTI5 probably represents the recent deletion of an old gene family member. Consistent with this hypothesis, diversity within the ATTI5 region (
= 0.0034 for positions 72738777) was not reduced relative to average diversity across the entire tandem array (
= 0.0027 for positions 19710,548) when only the four accessions with ATTI5+ (haplotype B; Fig 6A) were considered. Comparison with the outgroup A. lyrata was not informative because ATTI5, as well as ATTI3, were deleted in all alleles surveyed thus far (M. J. CLAUSS, unpublished data). Although the ATTI5 deletion site in A. thaliana and A. lyrata was within 100 bp, homology of the deletion was uncertain because of ambiguous alignment in this highly repetitive and polymorphic region.
Single-locus analysis:
The six ATTI loci differ in their level of diversity within A. thaliana, the frequency distribution of polymorphisms, and among-species divergence (Table 3, Table 4, and Table 5; Fig 7). The consensus sequence of all ATTI loci was in frame, with no pseudogene signatures. Variation in sequence diversity among the five expressed ATTI loci was positively correlated with variability in transcript levels among accessions (Fig 8). For the nontranscribed ATTI5 locus only, a GA microsatellite located 313 bp 5' to the ATG in each TI locus was large and variable (up to 25 repeats), and there was a single missense replacement substitution in one accession (Cvi-1). As expected for functional genes, average diversity at ATTI loci (
= 0.0057) was lower than diversity across the
10 kb spanning the array (
total = 0.0107 or
silent = 0.0135; Table 3 and Table 4). Within this chromosomal context, diversity for ATTI1 and ATTI2 was extremely low (
= 0.0009), whereas
for ATTI4 was high (0.0110), approaching that of silent-site diversity. Differences in the extent of haplotype structure were responsible for some of this diversity: ATTI1 and ATTI2 had only singleton polymorphisms, whereas the two dominant haplotypes could be identified in the remaining loci (e.g., Wall's B for ATTI4 and ATTI6 was 0.54 and 0.44, respectively; Table 4). Among functional regions, exon 1, coding for most of the signal peptide, had the greatest average diversity, even higher than that of the 5'-UTR (Table 3). Significant deviation in the frequency spectra from equilibrium-neutral expectations was observed for the ATTI2 locus (including flanking region; Tajima's D = 2.02; P < 0.002) and ATTI6 (coding sequence only; D = 2.20; P < 0.01; Table 4). After a sequential Bonferroni correction (![]()
|
|
|
|
Although average ATTI divergence between A. thaliana and A. lyrata was similar to divergence across the entire chromosomal region (K = 0.100), K ranged from 0.0661 to 0.1671 among loci (Table 3). Among coding positions (
270 bp per gene) in the four ATTI loci for which an outgroup comparison was possible, divergence and diversity were positively correlated (rSpearman = 0.9487; P = 0.05; n = 4; Table 3). Although the significant HKA test reported above rejected homogeneity for the entire 10-kb region, HKA was nonsignificant when only the coding regions were compared (results not shown). Among functional regions, the lowest divergence, on average, was seen for coding sequences (8%), whereas the 5'-UTR was on average 17% divergent (Table 3). High- frequency-derived polymorphisms were in significant excess for ATTI2 (Fay and Wu's H; Table 4).
A comparison of synonymous (Ks) and amino acid replacement (Ka) substitutions can provide evidence of the evolutionary rate of functionally important changes on three levels in gene families: intraspecific diversity within loci, species divergence within loci, and divergence among loci. For ATTI, we found lower replacement than synonymous rates of evolution at each level. First, within A. thaliana,
a/
s varied from 0.29 (ATTI1) to 0.76 (ATTI6) along the array, suggesting different levels of purifying selection among loci (Table 5). Second, among species, the Ka/Ks ratio was lower than
a/
s within A. thaliana (Table 5). It is notable that Ka/Ks for ATTI6 was the lowest observed (0.14). Third, comparisons among all pairs of ATTI loci for one representative accession (Fe-1a) also illustrated overall selective constraint in trypsin inhibitor evolution (Ka/Ks << 1): average Ka/Ks ratios for all comparisons including ATTI1 through ATTI6 were 0.33, 0.40, 0.44, 0.43, 0.61, and 0.21, respectively. Thus, ATTI5 was under the least selective constraint (0.61), whereas amino acid evolution appears most constrained for ATTI1 and ATTI6.
Of particular interest for understanding changes in inhibitory function are replacement changes in the reactive site loop (Fig 1). While there were synonymous changes between the P3 to P3' positions in some loci, no within-species replacement polymorphisms were observed within this critical region. The most common residue at the P1 position for ATTI, arginine, was replaced by lysine in ATTI4 and ATTI6 (Fig 1).
| DISCUSSION |
|---|
We found a significant association between gene expression and haplotype class for loci of the A. thaliana trypsin inhibitor (ATTI) tandem gene family. Membership in two molecularly defined haplotype classes explained a significant proportion of the variation in transcription, whereas the contribution of accession nested within haplotype was not significant (Table 1). Haplotype classes differed up to sixfold in transcript level (Fig 2B). Within A. thaliana, linkage disequilbrium generally extends over <250 kb; hence a significant association between haplotype and function suggests cis-regulation at or near the tandemly arrayed ATTI loci, whereas unlinked trans-acting regulation is less likely (![]()
![]()
![]()
An association between naturally occurring sequence haplotypes and function has been observed in A. thaliana for several qualitative phenotypes relating to pathogen resistance (![]()
![]()
![]()
![]()
ATTI loci in the chromosomal landscape:
Tandemly duplicated genes located in close proximity to one another not only share a demographic and functional history, but also exist within a shared chromosomal landscape. For 10,352 aligned nucleotide positions, we observed: (1) average levels of overall polymorphism within A. thaliana and divergence to A. lyrata, (2) two distinct haplotype classes in A. thaliana with similar nucleotide diversity within each class, (3) significant linkage disequilibrium, (4) abnormally low levels of diversity associated with ATTI1 and ATTI2, and (5) a peak of polymorphism spanning the presence/absence polymorphism of the previously undescribed ATTI5 locus. Significant heterogeneity of polymorphism relative to divergence allowed us to reject the hypothesis that the genomic region encompassing the ATTI tandem array has evolved according a homogeneous neutral model (Fig 3; multilocus HKA; P < 0.001).
The co-occurrence of a peak of polymorphism at one functional locus and distinct haplotype classes has previously been reported in several studies of A. thaliana molecular evolution and may indicate balancing or frequency-dependent selection (![]()
![]()
![]()
![]()
![]()
First, the polymorphism peak in the ATTI tandem array spans >1.2 kb of nongapped sequence, including three genes, their promoter regions, and intergenic sequences (Fig 3 and Fig 6). The genes are part of a tandem array of duplicated loci that are functionally differentiated and thus represent several linked targets of selection (e.g., ![]()
![]()
Second, the peak of nucleotide polymorphism in the ATTI array centers on a presence/absence polymorphism for an old, apparently nonfunctional, gene copy (ATTI5). Whereas evidence in favor of an indel polymorphism maintained by selection is strengthened by the presence of at least one functional allele (e.g., RPM1; ![]()
Third, although the peak of polymorphism reflects fixed differences among two haplotype classes spanning several ATTI loci, the allele frequency spectrum does not provide statistical support for a balanced polymorphism. The worldwide frequency of the ancestral haplotype B (estimated by the frequency of the ATTI5+ allele) was 0.17, and nucleotide polymorphisms in linkage disequilibrium with ATTI5 did not deviate significantly from expectations under a neutral equilibrium model (Fig 6B). Diversity across the sampled 10 kb was similar for both ATTI haplotype classes (HA
= 0.0032 and HB
= 0.0027; or if accessions with interhaplotype recombination are excluded, HA
= 0.0017 and HB
= 0.0015), suggesting coexisting allele classes with segregating variation of similar age. The even distribution of derived sites among haplotypes also argues strongly against introgression of a divergent allele (Table 2). One possible explanation for this pattern is frequency-dependent selection for the maintenance of long-lived and divergent clades as proposed by ![]()
![]()
![]()
![]()
![]()
Functional evolution in closely linked ATTI loci:
ATTI loci exhibit substantial sequence divergence (65%), differences in reactive site residues determining functional specificity, and variation in constitutive as well as induced transcription (Fig 1 and Fig 2). In A. thaliana there was an association of nucleotide polymorphism with ATTI transcript level as demonstrated by significant haplotype and locus x haplotype effects on transcription (Table 1; Fig 2) and by the positive correlation between sequence diversity and variability in transcription among loci (Fig 8). This functional and molecular diversity, together with multiple recombination events (Fig 4), suggests the potential for independent adaptive evolution among tandem duplicates in A. thaliana. However, the coding sequences of ATTI loci are in close physical linkage (neighboring genes are separated on average by only 716 bp), and we estimated significant linkage disequilibrium, particularly among polymorphisms in the interior of the tandem array (Fig 4). Below, we interpret the patterns of polymorphism and divergence in functionally differentiated TI loci within the constraints of their genetic backgrounds.
Unique patterns of sequence diversity and expression for the first two TI loci indicate an evolutionary history distinct from the remaining gene family members. ATTI1 and ATTI2 exhibit extremely low levels of intraspecific polymorphism in comparison to other A. thaliana loci (Table 3 and Table 4; Fig 2A; ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
/K ratio (Fig 3) and an excess of high-frequency-derived polymorphisms concentrated in the signal peptide and 5'-UTR of ATTI2 are consistent with recent positive selection (Fig 6B and Fig C; Table 4; ![]()
ATTI3, ATTI4, and ATTI5 are located in a region with excess species-wide polymorphism, excess indels, and almost complete linkage disequilibrium (Fig 4, Fig 6, and Fig 7). Nonetheless, ATTI3 and ATTI4 were functional and show evidence of selective constraint (
a/
s < 1; Table 5). ATTI3 has the common trypsin inhibitor P1 reactive site residue (arginine) and was the most highly transcribed ATTI locus in both control and herbivore-induced treatments (Table 1; Fig 2C). ATTI4 has lysine at the P1 position and showed a low-to-intermediate transcription profile (Fig 2C). Lysine at the P1 position also results in trypsin inhibition (![]()
![]()
![]()
![]()
The function of ATTI6 in A. thaliana and A. lyrata appears to be modified in comparison to upstream TI loci. ATTI6 has lysine in place of arginine at the P1 position (as in ATTI4) and two additional amino acid substitutions in the P3-P3' reactive site loop in comparison to ATTI1 and ATTI2. The potential for independent functional evolution of ATTI6 in A. thaliana was suggested by three recombination events within and flanking this locus (Fig 4). ATTI6 is functionally unique among ATTI loci in that transcript levels for haplotype B exceeded those of haplotype A (Fig 2B). An interhaplotype recombination event located
880 bp 5' of ATTI6 was associated with a switch from haplotype A to B downstream and a concordant dramatic switch in expression. This result identifies candidate polymorphisms for regulatory control of haplotype-specific ATTI6 expression and is consistent with promoter-deletion experiments that have identified the 520 bp 5' of MTI2 essential for gene expression (![]()
a/
s observed at ATTI6, because demographic processes are expected to be pervasive throughout the genome and affect all site categories (Table 3 and Table 4). The role of balancing selection or frequency-dependent selection favoring alternate alleles at ATTI6 must be further explored via ecologically informed functional studies (e.g., ![]()
Interference or traffic occurs when variants are positively selected but fail to go to fixation because of conflicts among multiple linked segregating sites (![]()
![]()
![]()
![]()
![]()
![]()
Population genetics of defense:
Patterns of nucleotide polymorphism in plant defense-related genes can be divided into three categories. First, we find examples that are consistent with selective sweeps, as predicted by models of a coevolutionary arms race between plants and their enemies (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
In gene-for-gene pathogen resistance, selection appears to result overwhelmingly in rapid adaptive evolution among both alleles and paralogs (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Conclusions:
The patterns of variability among tandemly duplicated ATTI loci capture a snapshot of the process of diversification through subfunctionalization. The identical P1 trypsin inhibitor reactive site, arginine, has been maintained in three ATTI loci that, nonetheless, differed in constitutive and herbivore-induced expression. A change in reactive site residue and an extended C-terminal sequence appear to modify function in two other ATTI loci. After being maintained for millions of years, a sixth ATTI locus has recently become a pseudogene and was segregating as an insertion/deletion polymorphism in A. thaliana. While physical linkage has not inhibited divergence over the evolutionary history of this gene family, linkage disequilibrium in the current population genetic context of A. thaliana may limit the opportunity for natural selection at some ATTI loci due to interference. The loci at the periphery of the tandem array (e.g., ATTI1 and ATTI6) were separated from the remaining ATTI loci by several recombination events and had greater opportunity for independent evolution by natural selection than did loci in the array interior. In the population genetic context of the self-incompatible, outcrossing perennial A. lyrata, recombination is widespread even within ATTI loci, suggesting that the constraints against functional evolution of the trypsin inhibitor gene family seen in A. thaliana may be ephemeral.
| FOOTNOTES |
|---|
Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under accession nos.
AJ632250,
AJ632251,
AJ632252,
AJ632253,
AJ632254,
AJ632255,
AJ632256,
AJ632257,
AJ632258,
AJ632259,
AJ632260,
AJ632261,
AJ632262,
AJ632263,
AJ632264,
AJ632265,
AJ632266,
AJ632267. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank S. Dietel, A. Figuth, and D. Schnabelrauch for technical assistance and J. Kroymann and H. Vogel for scientific support, as well as A. Lawton-Rauh and E. Schranz for useful comments on an earlier version of the manuscript. Financial support was provided by the Max-Planck Gesellschaft, European Union contract no. QLRT-2000-01097, the Bundesministerium fuer Bildung und Forschung, and grant DEB-9527725 from the U.S. National Science Foundation.
Manuscript received August 17, 2003; Accepted for publication November 24, 2003.
| LITERATURE CITED |
|---|
AGUADÉ, M., 2001 Nucleotide sequence variation at two genes of the phenylpropanoid pathway, the FAH1 and F3H genes, in Arabidopsis thaliana.. Mol. Biol. Evol. 18:1-9.
ASCENZI, P., M. RUOPPOLO, A. AMORESANO, P. PUCCI, and R. CONSONNI et al., 1999 Characterization of low-molecular-mass trypsin isoinhibitors from oil-rape (Brassica napus var. oleifera) seed. Eur. J. Biochem. 261:275-284.[Medline]
BAINES, J. F., Y. CHEN, A. DAS, and W. STEPHAN, 2002 DNA sequence variation at a duplicated gene: excess of replacement polymorphism and extensive haplotype structure in the Drosophila melanogaster bicoid region. Mol. Biol. Evol. 19:989-998.
BAUKE, A., 2002 Untersuchung zur Regulation von Chitinasen und Serin-Proteinase-Inhibitoren aus Arabis drummondii. Thesis, Friedrich-Schiller-Universitaet, Jena, Germany.
BERGELSON, J., M. KREITMAN, E. A. STAHL, and D. C. TIAN, 2001 Evolutionary dynamics of plant R-genes. Science 292:2281-2285.
BETANCOURT, A. J. and D. C. PRESGRAVES, 2002 Linkage limits the power of natural selection in Drosophila.. Proc. Natl. Acad. Sci. USA 99:13616-13620.
BITTNER-EDDY, P. D., I. R. CRUTE, E. B. HOLUB, and I. L. BEYNON, 2000 RPP13 is a simple locus in Arabidopsis thaliana for alleles that specify downy mildew resistance to different avirulence determinants in Peronospora parasitica. Plant J. 21(2):177-188.[CrossRef][Medline]
BLANC, G., K. HOKAMP, and K. WOLFE, 2003 A recent polyploidy superimposed on older large-scale duplications in the Arabidopsis genome. Genome Res. 13:137-144.
BROADWAY, R., 1995 Are insects resistant to plant proteinase inhibitors? J. Insect Physiol. 41:107-116.[CrossRef]
BROADWAY, R., 1996 Dietary proteinase inhibitors alter complement of midgut proteases. Arch. Insect Biochem. Physiol. 32:39-53.
BROADWAY, R., 1997 Dietary regulation of serine proteinases that are resistant to serine proteinase inhibitors. J. Insect Physiol. 43:855-874.[CrossRef][Medline]
CECI, L., M. VOLPICELLA, Y. RAHBE, R. GALLERANI, and J. BEEKWILDER et al., 2003 Selection by phage display of a variant mustard trypsin inhibitor toxic against aphids. Plant J. 33:557-566.[CrossRef][Medline]
CECI, L. R., N. SPOTO, M. DEVIRGILIO, and R. GALLERANI, 1995 The gene coding for the mustard trypsin inhibitor-2 is discontinuous and wound-inducible. FEBS Lett. 364:179-181.[CrossRef][Medline]
CECILIANI, F., F. BORTOLOTTI, E. MENEGATTI, S. ROCHI, and P. ASCENZI et al., 1994 Purification, inhibitory properties, amino acid sequence and identification of the reactive site of a new serine proteinase inhibitor from oil-rape (Brassica napus) seed. FEBS Lett. 342:221-224.[CrossRef][Medline]
CHARLESWORTH, D., 2003 Effects of inbreeding on the genetic diversity of populations. Philos. Trans. R. Soc. Lond. B Biol. Sci. 358:1051-1070.
CHARLESWORTH, D., P. AWADALLA, B. K. MABLE, and M. H. SCHIERUP, 2000 Population-level studies of multiallelic self-incompatibility loci, with particular reference to Brassicaceae. Ann. Bot. 85:227-239.
CLAUSS, M. and T. MITCHELL-OLDS, 2003 Population genetics of tandem trypsin inhibitor genes in Arabidopsis species with contrasting ecology and life history. Mol. Ecol. 12:1287-1299.[CrossRef][Medline]
COLLINS, N., H. THORDAL-CHRISTENSEN, V. LIPKA, S. BAU, and E. KOMBRINK et al., 2003 SNARE-protein-mediated disease resistance at the plant cell wall. Nature 425:973-977.[CrossRef][Medline]
COMERON, J. M. and M. KREITMAN, 2002 Population, evolutionary and genomic consequences of interference selection. Genetics 161:389-410.
DE LEO, F., M. A. BONADE-BOTTINO, L. R. CECI, R. GALLERANI, and L. JOUANIN, 1998 Opposite effects on Spodoptera littoralis larvae of high expression level of a trypsin proteinase inhibitor in transgenic plants. Plant Physiol. 118:997-1004.
DE LEO, F., L. CECI, L. JOUANIN, and R. GALLERANI, 2001a Analysis of mustard trypsin inhibitor-2 gene expression in response to developmental or environmental induction. Planta 212:710-717.[CrossRef][Medline]
DE LEO, F., M. BONADE-BOTTINO, L. R. CECI, R. GALLERANI, and L. JOUANIN, 2001b Effects of a mustard trypsin inhibitor expressed in different plants on three lepidopteran pests. Insect Biochem. Mol. Biol. 31:593-602.[CrossRef][Medline]
DUDA, T. F. and S. R. PALUMBI, 2000 Evolutionary diversification of multigene families: allelic selection of toxins in predatory cone snails. Mol. Biol. Evol. 17:1286-1293.
ELLIS, J., G. LAWRENCE, E. FINNEGAN, and P. ANDERSON, 1995 Contrasting complexity of two rust resistance loci in flax. Proc. Natl. Acad. Sci. USA 92:4185-4188.
ELLIS, J., P. DODDS, and T. PRYOR, 2000 Structure, function, and evolution of plant disease resistance genes. Curr. Opin. Plant Biol. 3:279-284.
FAY, J. C. and C.-I WU, 2000 Hitchhiking under positive Darwinian selection. Genetics 155:1405-1413.
FAY, J. C., G. J. WYCKOFF, and C.-I WU, 2002 Testing the neutral theory of molecular evolution with genomic data from Drosophila.. Nature 415:1024-1026.[CrossRef][Medline]
FERRARI, S., D. VAIRO, F. M. AUSUBEL, F. CERVONE, and G. DE LORENZO, 2003 Tandemly duplicated Arabidopsis genes that encode polygalacturonase-inhibiting proteins are regulated coordinately by different signal transduction pathways in response to fungal infection. Plant Cell 15:93-106.
FORCE, A., M. LYNCH, F. B. PICKETT, A. AMORES, and Y. L. YAN et al., 1999 Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151:1531-1545.
FORD, M. J., 2002 Application of selective neutrality tests to molecular ecology. Mol. Ecol. 11:1245-1262.[CrossRef][Medline]
FROHMAN, M. A., M. K. DUSH, and G. R. MARTIN, 1988 Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85:8998-9002.
GLAWE, G., J. ZAVALA, A. KESSLER, N. VAN DAM, and I. BALDWIN, 2003 Ecological costs and benefits correlated with trypsin protease inhibitor production in Nicotiana attenuata.. Ecology 84:79-90.[CrossRef]
GREEN, T. R. and C. A. RYAN, 1972 Wound-induced proteinase inhibitor in plant leavespossible defense mechanism against insects. Science 175:776-777.
GU, Z., A. CAVALCANTI, F. CHEN, P. BOUMAN, and W. LI, 2002 Extent of gene duplication in the genomes of Drosophila, nematode, and yeast. Mol. Biol. Evol. 19:256-262.
HANFSTINGL, U., A. BERRY, E. A. KELLOG, J. T. COSTA, and W. RUDIGER et al., 1994 Haplotypic divergence coupled with lack of diversity at the Arabidopsis thaliana alcohol dehydrogenase locus: Roles for both balancing and directional selection? Genetics 138:811-828.[Abstract]
HARUTA, M., I. MAJOR, M. CHRISTOPHER, J. PATTON, and C. CONSTABEL, 2001 A kunitz trypsin inhibitor gene family from trembling aspen (Populus tremuloides Michx.): cloning, functional expression, and induction by wounding and herbivory. Plant Mol. Biol. 46:347-359.[CrossRef][Medline]
HAUBOLD, B., J. KROYMANN, A. RATZKA, T. MITCHELL-OLDS, and T. WIEHE, 2002 Recombination and gene conversion in a 170-kb genomic region of Arabidopsis thaliana.. Genetics 161:1269-1278.
HAUSER, M. T., B. HARR, and C. SCHLOTTERER, 2001 Trichome distribution in Arabidopsis thaliana and its close relative Arabidopsis lyrata: molecular analysis of the candidate gene GLABROUS1. Mol. Biol. Evol. 18:1754-1763.
HILL, W. G. and A. ROBERTSON, 1966 The effect of linkage on limits to artificial selection. Genet. Res. 8:269-294.[Medline]
HILL, W. G. and A. ROBERTSON, 1968 Linkage disequilibrium in finite populations. Theor. Appl. Genet. 38:226-231.[CrossRef]
HOLM, S., 1979 A simple sequentially rejective multiple test procedure. Scand. J. Stat. 6:65-70.
HUDSON, R., 1990 Gene geneologies and the coalescence process. Oxf. Surv. Evol. Biol. 7:1-45.
HUDSON, R. R., 1987 Estimating the recombination parameter of a finite population model without selection. Genet. Res. 50:245-250.[Medline]
HUDSON, R. R. and N. L. KAPLAN, 1985 Statistical properties of the number of recombination events in the history of a sample of DNA sequences. Genetics 111:147-164.
HUDSON, R. R., M. KREITMAN, and M. AGUADÉ, 1987 A test of neutral molecular evolution based on nucleotide data. Genetics 116:153-159.
JONGSMA, M. A. and C. BOLTER, 1997 The adaptation of insects to plant protease inhibitors. J. Insect Physiol. 43:885-895.[CrossRef][Medline]
JONGSMA, M. A., P. L. BAKKER, J. PETERS, D. BOSCH, and W. J. STIEKEMA, 1995 Adaptation of Spodoptera exigua larvae to plant proteinase inhibitors by induction of gut proteinase activity insensitive to inhibition. Proc. Natl. Acad. Sci. USA 92:8041-8045.
KAWABE, A. and N. MIYASHITA, 1999 DNA variation in the basic chitinase locus (ChiB) region of the wild plant Arabidopsis thaliana. Genetics 153:1445-1453.
KAWABE, A., H. INNAN, R. TERAUCHI, and N. T. MIYASHITA, 1997 Nucleotide polymorphism in the acidic chitinase locus (ChiA) region of the wild plant Arabidopsis thaliana.. Mol. Biol. Evol. 14:1303-1315.[Abstract]
KIM, Y. and W. STEPHAN, 2000 Joint effects of genetic hitchhiking and background selection on neutral variation. Genetics 155:1415-1427.
KIM, Y. and W. STEPHAN, 2002 Detecting a local signature of genetic hitchhiking along a recombining chromosome. Genetics 160:765-777.
KIM, Y. and W. STEPHAN, 2003 Selective sweeps in the presence of interference among partially linked loci. Genetics 164:389-398.
KIRBY, D. A. and W. STEPHAN, 1996 Multi-locus selection and the structure of variation at the white gene of Drosophila melanogaster.. Genetics 144:635-645.[Abstract]
KOCH, M., B. HAUBOLD, and T. MITCHELL-OLDS, 2001 Molecular systematics of the Brassicaceae: evidence from coding plastidic matK and nuclear Chs sequences. Am. J. Bot. 88:534-544.
KOIWA, H., R. A. BRESSAN, and P. M. HASEGAWA, 1997 Regulation of protease inhibitors and plant defense. Trends Plant Sci. 2:379-384.[CrossRef]
KROYMANN, J., S. DONNERHACKE, D. SCHNABELRAUCH, and T. MITCHELL-OLDS, 2003 Evolutionary dynamics of an Arabidopsis insect resistance quantitative trait locus. Proc. Natl. Acad. Sci. USA 1073:1-10.
KUITTINEN, H. and M. AGUADÉ, 2000 Nucleotide variation at the CHALCONE ISOMERASE locus in Arabidopsis thaliana.. Genetics 155:863-872.
LASKOWSKI, M., JR. and I. KATO, 1980 Protein inhibitors of proteinases. Annu. Rev. Biochem. 49:593-626.[CrossRef][Medline]
LING, M., H. QI, and C. CHI, 1993 Protein, cDNA, and genomic DNA sequences of the towel gourd trypsin inhibitor. A squash family inhibitor. J. Biol. Chem. 268:810-814.
LONG, A. D., R. F. LYMAN, C. H. LANGLEY, and T. F. C. MACKAY, 1998 Two sites in the delta gene region contribute to naturally occurring variation in bristle number in Drosophila melanogaster. Genetics 149:999-1017.
LYNCH, M. and J. S. CONERY, 2003 The evolutionary demography of duplicate genes. J. Struct. Funct. Genomics 3:35-44.[CrossRef][Medline]
LYNCH, M. and A. G. FORCE, 2000 The origin of interspecific genomic incompatibility via gene duplication. Am. Nat. 156:590-605.[CrossRef]
LYNCH, M., M. O'HELY, B. WALSH, and A. FORCE, 2001 The probability of preservation of a newly arisen gene duplicate. Genetics 159:1789-1804.
MAURICIO, R., E. A. STAHL, T. KORVES, D. TIAN, and M. KREITMAN et al., 2003 Natural selection for polymorphism in the disease resistance gene Rps2 of Arabidopsis thaliana.. Genetics 163:735-746.
MCDONALD, J. H. and M. KREITMAN, 1991 Adaptive protein evolution at the Adh locus in Drosophila.. Nature 351:652-654.[CrossRef][Medline]
MENEGATTI, E., G. TEDESCHI, S. RONCHI, F. BORTOLOTTI, and P. ASCENZI et al., 1992 Purification, inhibitory properties and amino acid sequence of a new serine proteinase inhibitor from white mustard (Sinapis alba L.) seed. FEBS Lett. 301:10-14.[CrossRef][Medline]
MEYERS, B., K. SHEN, P. ROHANI, B. GAUT, and R. MICHELMORE, 1998 Receptor-like genes in the major resistance locus of lettuce are subject to divergent selection. Plant Cell 10:1833-1846.
MIRALLES, R., P. GERRISH, A. MOYA, and S. F. ELENA, 1999 Clonal interference and the evolution of RNA viruses. Science 285:1745-1747.
MONDRAGON-PALOMINO, M., B. C. MEYERS, R. W. MICHELMORE, and B. S. GAUT, 2002 Patterns of positive selection in the complete NBS-LRR gene family of Arabidopsis thaliana.. Genome Res. 12:1305-1315.
NAVARRO, A. and N. H. BARTON, 2002 The effects of multilocus balancing selection on neutral variability. Genetics 161:849-863.
NEI, M., 1987 Molecular Evolutionary Genetics. Columbia University Press, New York.
NORDBORG, M. and H. INNAN, 2003 The genealogy of sequences containing multiple sites subject to strong selection in a subdivided population. Genetics 163:1201-1213.
NORDBORG, M., J. BOREVITZ, J. BERGELSON, C. BERRY, and J. CHORY et al., 2002 The extent of linkage disequilibrium in Arabidopsis thaliana.. Nat. Genet. 30:190-193.[CrossRef][Medline]
OHNO, S., 1970 Evolution by Gene Duplication. Springer, Heidelberg, Germany.
OLSEN, K. M., A. WOMACK, A. R. GARRETT, J. I. SUDDITH, and M. D. PURUGGANAN, 2002 Contrasting evolutionary forces in the Arabidopsis thaliana floral developmental pathway. Genetics 160:1641-1650.
PARSCH, J., C. D. MEIKLEJOHN, and D. L. HARTL, 2001 Patterns of DNA sequence variation suggest the recent action of positive selection in the janus-ocnus region of Drosophila simulans.. Genetics 159:647-657.
PAUTOT, V., F. HOLZER, and L. WALLING, 1991 Differential expression of tomato proteinase inhibitor I and II genes during bacterial pathogen invasion and wounding. Mol. Plant-Microbe Interact. 4:284-292.[Medline]
POLTICELLI, F., P. ASCENZI, M. BOLOGNESI, and B. HONIG, 1999 Structural determinants of trypsin affinity and specificity for cationic inhibitors. Protein Sci. 8:2621-2629.[Medline]
RAMOS-ONSINS, S. E., B. E. STRANGER, T. MITCHELL-OLDS, and M. AGUADÉ, 2004 Multilocus analysis of variation and speciation in the closely related species Arabidopsis halleri and A. lyrata. Genetics 166:373-388.
RASK, L., E. ANDRÉASSON, B. EKBOM, S. ERIKSSON, and B. PONTOPPIDAN et al., 2000 Myrosinase: gene family evolution and herbivore defense in Brassicaceae. Plant Mol. Biol. 42:93-113.[CrossRef][Medline]
ROZAS, J. and R. ROZAS, 1999 DnaSP version 3: an integrated program for molecular population genetics and molecular evolution analysis. Bioinformatics 15:174-175.
RUOPPOLO, M., A. AMORESANO, P. PUCCI, S. PASCARELLA, and F. POLTICELLI et al., 2000 Characterization of five new low-molecular-mass trypsin inhibitors from white mustard (Sinapis alba L.) seed. Eur. J. Biochem. 267:6486-6492.[Medline]
RYAN, C. A., 1990 Protease inhibitors in plants: genes for improving defenses against insects and pathogens. Annu. Rev. Phytopathol. 28:425-449.
SAVOLAINEN, O., C. H. LANGLEY, B. P. LAZZARO, and H. FREVILLE, 2000 Contrasting patterns of nucleotide polymorphism at the alcohol dehydrogenase locus in the outcrossing Arabidopsis lyrata and the selfing Arabidopsis thaliana.. Mol. Biol. Evol. 17:645-655.
SHELTON, A. M., R. J. COOLEY, M. K. KROENING, W. T. WILSEY, and S. D. EIGENBRODE, 1991 Comparative analysis of two rearing procedures for diamond-back moth (Lepidoptera: Plutellidae). J. Entomol. Sci. 26:17-26.
SHEPARD, K. and M. D. PURUGGANAN, 2003 Molecular population genetics of the Arabidopsis CLAVATA2 region. The genomic scale of variation and selection in a selfing species. Genetics 163:1083-1095.
STAHL, E. A., G. DWYER, R. MAURICIO, M. KREITMAN, and J. BERGELSON, 1999 Dynamics of disease resistance polymorphism at the RPM1 locus of Arabidopsis.. Nature 400:667-671.[CrossRef][Medline]
TAJIMA, F., 1989 Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585-595.
TELANG, M., A. SRINIVASAN, A. PATANKAR, A. HARSULKAR, and V. JOSHI et al., 2003 Bitter gourd proteinase inhibitors: potential growth inhibitors of Helicoverpa armigera and Spodoptera litura.. Phytochemistry 63:643-652.[CrossRef][Medline]
TEMPLETON, A. R., H. HOLLOCHER, and J. S. JOHNSTON, 1993 The molecular through ecological genetics of abnormal abdomen in Drosophila mercatorum. V. Female phenotypic expression on natural genetic backgrounds and in natural environments. Genetics 134:475-485.[Abstract]
TIAN, D., H. ARAKI, E. STAHL, J. BERGELSON, and M. KREITMAN, 2002 Signature of balancing selection in Arabidopsis.. Proc. Natl. Acad. Sci. USA 99:11525-11530.
TIAN, D. C., M. B. TRAW, J. Q. CHEN, M. KREITMAN, and J. BERGELSON, 2003 Pleiotropic cost of R-gene mediated resistance in Arabidopsis thaliana.. Nature 423:74-77.[CrossRef][Medline]
TIFFIN, P. and B. GAUT, 2001 Molecular evolution of the wound-induced serine protease inhibitor wip1 in Zea and related genera. Genetics 18:2092-2101.
VAN DER HOORN, R., P. DE WIT, and M. JOOSTEN, 2002 Balancing selection favors guarding resistance proteins. Trends Plant Sci. 7:67-71.[CrossRef][Medline]
VAN VALEN, L., 1973 A new evolutionary law. Evol. Theory 1:1-30.
VOLPICELLA, M., A. SCHIPPER, M. JONGSMA, N. SPOTO, and R. GALLERANI et al., 2000 Characterization of recombinant mustard trypsin inhibitor 2 (MTI2) expressed in Pichia pastoris.. FEBS Lett. 468:137-141.[CrossRef][Medline]
VOLPICELLA, M., L. CECI, J. CORDEWENER, T. AMERICA, and R. GALLERANI et al., 2003 Properties of purified gut trypsin from Helicoverpa zea, adapted to proteinase inhibitors. Eur. J. Biochem. 270:10-19.[Medline]
WALL, J., 1999 Recombination and the power of statistical tests of neutrality. Genet. Res. 74:65-79.[CrossRef]
WALSH, B., 2003 Population-genetic models of the fates of duplicate genes. Genetica 118:279-294.[CrossRef][Medline]
WATTERSON, G. A., 1975 On the number of segregating sites in genetical models without recombination. Theor. Popul. Biol. 7:256-276.[CrossRef][Medline]
WRIGHT, S., B. LAUGA, and D. CHARLESWORTH, 2003 Subdivision and haplotype structure in natural populations of Arabidopsis lyrata.. Mol. Ecol. 12:1247-1263.[CrossRef][Medline]
ZANG, X. and R. MAIZELS, 2001 Serine proteinase inhibitors from nematodes and the arms race between host and pathogen. Trends Biochem. Sci. 26:191-197.[CrossRef][Medline]
ZHANG, J., Y. ZHANG, and H. ROSENBERG, 2002a Adaptive evolution of a duplicated pancreatic ribonuclease gene in a leaf-eating monkey. Nat. Genet. 30:411-415.[CrossRef][Medline]
ZHANG, J., A. PEEK, D. DUNAMS, and B. GAUT, 2002b Population genetics of duplicated disease-defense genes, hm1 and hm2, in maize (Zea mays ssp. mays L.) and its wild ancestor (Zea mays ssp. parviglumis). Genetics 162:851-860.
ZHAO, Q., Y. CHAE, and J. MARKLEY, 2002 NMR solution structure of ATTp, an Arabidopsis thaliana trypsin inhibitor. Biochemistry 15:12284-12296.
This article has been cited by other articles:
![]() |
M.-H. Weech, M. Chapleau, L. Pan, C. Ide, and J. C. Bede Caterpillar saliva interferes with induced Arabidopsis thaliana defence responses via the systemic acquired resistance pathway J. Exp. Bot., June 1, 2008; 59(9): 2437 - 2448. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. K. Ingvarsson Molecular Population Genetics of Herbivore-induced Protease Inhibitor Genes in European Aspen (Populus tremula L., Salicaceae) Mol. Biol. Evol., September 1, 2005; 22(9): 1802 - 1812. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. de Meaux, U. Goebel, A. Pop, and T. Mitchell-Olds Allele-Specific Assay Reveals Functional Variation in the Chalcone Synthase Promoter of Arabidopsis thaliana That Is Compatible with Neutral Evolution PLANT CELL, March 1, 2005; 17(3): 676 - 690. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Schmid, S. Ramos-Onsins, H. Ringys-Beckstein, B. Weisshaar, and T. Mitchell-Olds A Multilocus Sequence Survey in Arabidopsis thaliana Reveals a Genome-Wide Departure From a Neutral Model of DNA Sequence Polymorphism Genetics, March 1, 2005; 169(3): 1601 - 1615. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Clauss, M. J.
- Articles by Mitchell-Olds, T.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Clauss, M. J.
- Articles by Mitchell-Olds, T.











