- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Du, X.
- Articles by Beutler, B.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Du, X.
- Articles by Beutler, B.
Velvet, a Dominant Egfr Mutation That Causes Wavy Hair and Defective Eyelid Development in Mice
Xin Dua, Koichi Tabetaa, Kasper Hoebea, Haiquan Liub, Navjiwan Manna, Suzanne Mudda, Karine Crozata, Sosathya Sovatha, Xiaohua Gongb, and Bruce Beutleraa Department of Immunology, Scripps Research Institute, La Jolla, California 92037
b School of Optometry and Vision Science Program, University of California, Berkeley, California 94720
Corresponding author: Bruce Beutler, Department of Immunology, IMM-31, 10550 N. Torrey Pines Rd., La Jolla, CA 92037., bruce{at}scripps.edu (E-mail)
Communicating editor: N. A. JENKINS
| ABSTRACT |
|---|
In the course of a large-scale program of ENU mutagenesis, we isolated a dominant mutation, called Velvet. The mutation was found to be uniformly lethal to homozygotes, which do not survive E13.5. Mice heterozygous for the Velvet mutation are born with eyelids open and demonstrate a wavy coat and curly vibrissae. The mutation was mapped to the proximal end of chromosome 11 by genome-wide linkage analysis. On 249 meioses, the locus was confined to a 2.7-Mb region, which included the epidermal growth factor receptor gene (Egfr). An A
G transition in the Egfr coding region of Velvet mice was identified, causing the amino acid substitution D833G. This substitution alters an essential triad of amino acids (DFG
GFG) that is normally required for coordination of the ATP substrate. As such, kinase activity is at least mostly abolished, but quaternary structure of the receptor is presumably maintained, accounting for the dominant effect. Velvet is the first known dominant representative of the Egfr allelic series that is fully viable, a fact that makes it particularly useful for developmental studies.
THE mammalian genome is believed to encompass
30,00040,000 genes (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Under normal circumstances, the eyelids begin to grow across the surface of the developing eye at E12.5. Between days 14 and 16 of gestation, the top and bottom eyelids continue to flatten, come to lie in close approximation to one another, and finally fuse tightly with each other at E16.5. They remain fused until
12 days after birth (![]()
, Egfr, MEKK-1, and Fgfr2 loci (![]()
![]()
![]()
![]()
![]()
![]()
![]()
and Egfr genes, respectively.
In the course of a large-scale ENU mutagenesis screening effort carried out in our laboratory, a dominant mutation (Velvet) was identified among a total of 16,606 F1 mice born to mutagenized C57BL/6 males and normal C57BL/6 females. The designation "Velvet" refers to the velvet-like texture of the coat of affected animals. However, Velvet mice are born with eyelids open and with curled vibrissae as well. They present a phenotype very similar to that of waved-1 and waved-2 mice. Although two similar phenotypes (so far unmapped) have been observed among 23,221 F3 animals generated and weaned to date, Velvet was the sole dominant mutation of its type. It quickly became evident that the mutation could not be maintained in the homozygous state (i.e., that it was homozygous lethal). We expanded the phenotype, creating a heterozygous stock, and cloned the mutation positionally.
| MATERIALS AND METHODS |
|---|
Animals:
The C57BL/6J animals used in ENU mutagenesis were purchased from Jackson Laboratories, and C3H/HeN mice used for outcrossing and mapping were purchased from Taconic Farm. All studies involving animals were carried out in accordance with institutional regulations.
ENU mutagenesis and breeding:
Six-week-old male C57BL/6J mice are treated with ENU administered in three weekly doses (90 mg/kg body weight) by intraperitoneal injection. After 12 weeks of recovery from infertility, each mouse is bred to normal C57BL/6J female mice so as to produce a maximum of 20 offspring. These F1 animals are either subjected to phenotypic screens or used to produce F2 mice, which in turn are backcrossed. Two F2 daughters per sire are backcrossed with the F1 male to generate F3 mice. A total of six F3 females and six F3 males are produced for screening. Approximately 50% of the mutations carried by each F1 mouse are transmitted to homozygosity in every panel of six F3 mice produced according to this scheme. To date, 16,606 F1 animals and 23,221 F3 germline mutants have been generated in our laboratory.
Morphological screening:
All animals are examined for abnormalities affecting the eyes, the color or quality of the coat, development of the limbs or tail, and neurological or behavioral status at birth and at weaning age. All viable F1 phenodeviants are examined to determine whether the phenotype is heritable. Once transmissibility has been confirmed, each mutation is expanded, bred to homozygosity if possible, and mapped.
Genomic linkage analysis:
Heterozygotes (first generation) were mated to wild-type C3H/HeN mice; the affected F1 hybrid mice (second generation) were then crossed with the wild-type C3H/HeN animal again. The offspring of the second generation were phenotyped and tailed for mapping. Genomic DNA was prepared from tail tips with the QIAGEN (Valencia, CA) DNeasy kit and adjusted to a concentration of 50 ng/µl. A total of 59 microsatellite markers were used for genome-wide linkage analysis. After chromosomal linkage was established and low-resolution confinement was achieved, a total of 39 microsatellites were surveyed across the critical region to identify informative markers. A total of 21 novel informative simple sequence length polymorphisms were identified in the Velvet region and are shown in Table 1.
|
DNA sequencing:
Total RNA was isolated from the liver of a Velvet heterozygote on the C57BL/6 background and from a wild-type C57BL/6J mouse, respectively, by the QIAGEN RNeasy mini kit. A total of 1.5 µg total RNA was used in RT-PCR to generate cDNA with the RETROscript kit (Ambion, Austin, TX). The coding region of Egfr was amplified and directly sequenced to detect mutations. Sequencing was carried out using nested primers on an ABI 3100 sequencer and covered both strands of the template. Contigs were assembled by the programs phred and Phrap, and possible mutations were examined with the aid of the consed and polyphred programs.
Embryonic studies:
For histological analysis of the eyelids, carriers of the Velvet mutation (C57BL/6J background) were bred with normal C57BL/6J mice. The presence of a vaginal plug was taken at 0.5 day of gestation. At E16.5, female animals were euthanized using CO2 asphyxiation, and embryos were dissected under a dissecting microscope. The heads of affected embryos, which were easily distinguished from those of unaffected embryos, were fixed in 4% paraformaldehyde and embedded in paraffin. Sections were stained with hematoxylin and eosin. The eyelids were examined in transverse section.
To examine the homozygous lethal effect of Velvet, heterozygotes (C57BL/6J background) were mated with each other. At specific embryonic stages (E10.5, E11.5, E12.5, E13.5, E15.5, and E17.5), embryos were dissected free of the uterine wall and subjected to genomic DNA isolation with the QIAGEN DNeasy tissue kit. A total of 100 ng of genomic DNA was used to amplify a 500-bp region that covers the Egfr mutation in question. The primers used for PCR were 5' GTCATTCATGCCAGATAATTCCAA 3' and 5' CCAAATGCCATTCACAAAGTAGAG 3'. Genotyping was accomplished by sequencing the PCR products.
To determine whether midgestational defects of the placenta might result in homozygous lethality, heterozygotes (C57BL/6J background) were mated with each other. At E12.5, embryos and corresponding placentas were dissected from the uterine wall. Placentas were fixed in 10% formalin and embedded in paraffin. Sections were stained with hematoxylin and eosin. The embryos were used for genotyping.
Embryonic fibroblast migration assay:
Velvet heterozygotes were mated with wild-type C57BL/6J mice. At E16.5 fetuses were isolated and pooled together by the phenotype. The fetal skin was peeled off and trypsinized at 4° overnight. Cell suspensions were centrifuged at 1200 rpm for 5 min and resuspended in DMEM (Dulbecco's modified eagle medium, GIBCO BRL, Gaithersburg, MD) supplemented with 10% fetal bovine serum. The fifth passage of cells was used for the migration assay.
The cell migration assay was performed using modified Boyden chambers (Transwell; Costar, Cambridge, MA) containing polycarbonate membranes as previously described (![]()
In vivo phosphorylation:
Wild-type and Velvet heterozygotes (1- to 2-day-old pups) were injected subcutaneously in the neck with phosphate-buffered saline (PBS) or with epidermal growth factor (EGF) dissolved in PBS, at a dose of 10 µg/g body weight. Ten minutes later, mice were killed, and their livers were harvested and homogenized in lysis buffer (20 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM sodium pyrophosphate, 1 mM ß-glycerolphosphate, 1 mM Na3VO4, 1 µg/ml leupeptin, and 1 mM phenylmethylsulfonyl fluoride) as described previously (![]()
EgfrVelvet expression construct and transfection of HEK293 cells:
The cDNA of EgfrVelvet with internal signal sequence removed was amplified using primers 5' CCCAAGCTTTTGGAGGAAAAGAAAGTCTGC 3' and 5' GGAAGATCTTCATGCTCCAATAAACTCGCTGCT 3'. The cDNA was then cloned into pFLAG-CMV-3 expression vector (Sigma) between HindIII and BglII sites. The construct was verified by DNA sequencing.
HEK293 cells were purchased from the American Type Culture Collection and grown in DMEM (GIBCO BRL) supplemented with 10% FBS, 2% penicillin/streptomycin. Cells were transfected with either pFLAG-CMV-3 vector or EgfrVelvet expression construct (amount indicated) using Fugene 6 (Roche). The cellular response to EGF stimulation was tested 48 hr posttransfection. At that time, transfected cells were serum starved for 24 hr and then stimulated with EGF (1 nM final concentration) for 10 min at 37°. Then whole cell lysates (12 µg/lane of protein) were subjected to Western blotting using antibodies against phospho-mitogen-activated protein kinase (phospho-MAPK), MAPK, and a Flag epitope.
Immunoblotting of activated MAPK:
Transfected 293 cells were serum starved for 24 hr before being stimulated with 1 nM EGF for 10 min at 37°. Cells were rinsed twice with PBS, lysed in lysis buffer, scraped from the plates, transferred into a microcentrifuge tube, and kept on ice. Samples were sonicated for 5 sec four times to shear genomic DNA and reduce viscosity. The lysate was clarified by centrifugation at 14,000 rpm for 10 min, and the amount of total protein was determined with Coomassie plus protein assay (Pierce). Equivalent amounts of protein were separated by a 10% SDS-PAGE gel and transferred to nitrocellulose membrane. The activation of MAPK was monitored by Western blotting using antibodies against the phosphorylated form of MAPK (Cell Signaling Technology). The amount of total endogenous MAPK loaded for each sample was verified by probing against MAPK with a nonphosphospecific antibody.
| RESULTS |
|---|
Velvet was identified in F1 mice born to an ENU-treated sire and was assumed to be a dominant mutation. The phenotype proved to be readily transmissible. Analysis of the transmission ratio, determined by counting the number of normal and Velvet pups on a hybrid background (C57BL/6J Velvet x C3H/HeN), was consistent with the conclusion that Velvet heterozygotes are fully viable to term. Among 360 animals produced in such crosses, 184 showed the Velvet phenotype. Hence, it also appears that the mutation is fully penetrant.
Heterozygous Velvet mice are born with eyelids open and with curly vibrissae. Their first coat is wavy; later, the pelage hair loses its wavy appearance and becomes disoriented, with individual shafts projecting in various directions relative to neighboring shafts. The eyes of adult Velvet mice are often small, with corneal opacity, and excessive secretions are always seen at the edges of eyelids. Aside from the eyelid and fur abnormalities, heterozygous animals appear healthy and show normal fertility. Compared to their littermates, Velvet mice have a normal body size and exhibit normal cage activities.
The eyelid defect as it appears in neonatal Velvet mice is depicted in Fig 1. As seen in histological sections (Fig 1C and Fig D), the upper and lower eyelids of normal mice become approximated and then fuse to a state of closure by E16.5, whereas the eyelids of Velvet embryos remain far apart, never coming into contact with one another. The protruding ridges of Velvet eyelids were well formed, and growth across the cornea seemed to be initiated in the presence of the mutation as well, but migration of epithelia cells was defective compared to that in normal mice.
|
Migration of eyelid epithelial cells is difficult to quantitate in vivo. To provide a numerical index of the migration defect, and to demonstrate that the mutation imparted a cellular phenotype in vitro, we analyzed the migration of embryonic fibroblasts isolated from wild-type and Velvet embryos. The fibroblasts from Velvet embryos demonstrate
53% of the migratory ability of wild-type embryos (Fig 2).
|
Aside from the eyelid defect, other structures of the eye seem normal. Since the open eyelids constantly leave the cornea exposed, the corneal opacity and excess secretion displayed by adult Velvet mice might not be due to developmental defects, but rather to infection, drying, and possibly trauma.
By analyzing 249 meioses, we were able to confine the Velvet mutation to an interval 3.2 cM in length, demarcated by the microsatellite markers Vel_6 and D11Mit227. The critical regions lie near the proximal end of chromosome 11, occupying a 2.7-Mb interval (11.914.6 Mb from the centromere; Celera distances; Fig 3). Within the critical region, 38 annotated genes are listed in the Celera database. Ten of these are pseudogenes and 28 are authentic genes. Among the authentic genes, Egfr was considered the most promising candidate, given the fact that the wa-2 phenotype (very similar to the Velvet phenotype) was caused by a spontaneous recessive mutation in Egfr (![]()
![]()
![]()
![]()
|
The complete coding region of Egfr was amplified from liver cDNA, prepared from normal C57BL/6 mice and Velvet heterozygotes, respectively. A single heterozygous nucleotide substitution was detected in the Velvet template (Fig 4). This, an A
G transition, typical of ENU mutations (![]()
![]()
|
Previous work has revealed that injection of EGF into a newborn mouse can rapidly induce EGFR tyrosine phosphorylation (![]()
![]()
|
The dominant effect of EgfrVelvet was observed in vitro as well (Fig 6). Human epithelial cell line 293 cells, known to express EGFR and Erbb2 protein (data not shown), were transiently transfected either with various amounts of an EgfrVelvet expression construct or with empty vector as a control. Upon 1 nM EGF stimulation, cells transfected with empty expression vector showed pronounced induction of the activated form of MAPK (phospho-MAPK, p42/p44); the EgfrVelvet expression construct caused a dose-dependent inhibitory effect on MAPK activation.
|
Because Velvet homozygotes were never observed at term throughout the course of our studies, we considered the mutation to be homozygous lethal. We wished to determine the stage at which death occurs in utero. We therefore intercrossed Velvet heterozygotes (C57BL/6 background) to determine whether homozygosity for Velvet was compatible with survival to a postembryonic stage of development (Table 2). Dividing gestation into windows of time, we observed that between E10.5 and E11.5, the genotypic distribution (+/+:+/V:V/V) was 5:9:3. Between E12.5 and E13.5, the distribution was 5:13:2. Between E15.5 and E17.5 the distribution was 5:18:0. And at term, the distribution was 11:17:0. These data (along with phenotypic assessments of a much larger number of mice, mentioned earlier) suggest that heterozygotes have no diminution in viability. However, homozygotes show a trend toward diminished viability during embryonic life and die between E13.5 and E15.5, a time that roughly corresponds to the transition between embryonic and postembryonic life (E14.5).
|
Histological analysis of E12.5 placentas revealed that the labyrinth trophoblast layer in homozygous placenta was disorganized. The cell number was greatly reduced when compared to the placenta of wild-type and heterozygous embryos, and a number of dead or dying cells were evident. The organization and cell number of the giant-cell layer of the trophoblast were fairly normal (Fig 7). Since fetal nutrition depends on the placental labyrinthine layer, we consider it likely that homozygosity for EgfrVelvet produces midgestation lethality due to a placental defect.
|
| DISCUSSION |
|---|
Velvet is a new member of the Egfr allelic series. Although an EGFR construct with at least some dominant negative properties has been expressed in mice as the product of a transgene (![]()
From the crystal structure of the EGF receptor tyrosine kinase domain, D833 lies within the "DFG motif," which defines the beginning of the "activation loop" and is important for ATP coordination (![]()
![]()
![]()
The outer root sheath of the hair follicle and the epidermal layer of the eyelid probably express EGFR in greater abundance than do most other tissues (![]()
![]()
![]()
and EGF), EGFR activates multiple signaling pathways to stimulate epithelial cell proliferation and migration (![]()
![]()
![]()
(PLC
)-protein kinase C (PKC) and the Ras-MAPK pathways. Once activated, PLC
catalyzes the hydrolysis of phosphatidylinositol (4,5)-bisphosphate to yield the second messengers diacylglycerol and inositol-1,4,5-triphosphate, which effect calcium release from intracellular stores and activate the PKC-mediated cascade (![]()
![]()
![]()
and Ras/MAPK signaling cascade, EGFR directly influences the motility machinery of the cell. These two signaling pathways are not only activated simultaneously but also interlinked with each other, presenting a complex but delicate regulatory system. Any mutation that disrupts signal transduction in these pathways will cause dysregulation of cell migration. This effect is likely manifested in defects of eyelid and hair development, as seen in mice with the wa-1, wa-2, MEKK1, and Velvet mutations.
Depending upon their genetic background, Egfr-/- mice die during the peri-implantation stage due to degeneration of the inner cell mass or during midgestation as a result of placental defects or are born with their eyes open but live only up to 3 weeks of postnatal life as a result of respiratory problems, epithelial immaturity, and multiorgan abnormalities (![]()
![]()
![]()
First, it is believed that EGFR activation involves the formation of an active homodimer upon ligand binding, and the activation is achieved by autophosphorylation that occurs in a "trans" mode in the receptor complex. Since normal levels of EGFR expression are observed in Velvet heterozygotes, it is likely that the integrity of dimer formation is undisturbed by the mutation; however, EGF signaling clearly is interrupted, consistent with the loss of three-quarters of receptor activity (to be expected with a kinase-dead dominant subunit residing in a dimeric protein) or perhaps even more.
Second, the interaction between EGFR and other cell surface protein kinases of the ErbB family leads to the formation of heterodimers or even hetero-oligomers. For example, ErbB2 is the preferred heteromeric partner for EGFR (![]()
![]()
![]()
In vitro, the inhibitory effect of the EgfrVelvet product on the EGF-induced MAPK activation was readily demonstrated, confirming that the mutant allele is capable of disrupting the function of the normal allele. Inhibition was dose dependent and consistent with the poison subunit model proposed.
We further note that homozygosity for the wa2 allele creates a phenotype approximately similar to that of heterozygosity for Velvet. Overall, we suggest that phenotypic severity of different genotypes might be graded as follows:

Not all genotypic components of the series (those that are not underlined) have yet been examined, and, in particular, the phenotypic effect of compound heterozygosity for Velvet and either the wa2 or null allele (not underlined above) remains a matter of speculation.
The fact that a heterozygous animal is morphologically marked and fully viable while homozygosity is embryonic lethal may make the Velvet mutation particularly useful for developmental studies. Moreover, differences between the phenotype of Velvet and the phenotype of other Egfr alleles may permit added insight into the role played by specific components of the EGFR/ErbB receptor family.
Note added in proof:
We have become aware of an independent dominant hypomorphic allele of Egfr, reported by C. THAUNG, K. WEST, B. J. CLARK, L. MCKIE, J. E. MORGAN et al. (2002, Novel ENU-induced eye mutations in the mouse: models for human eye disease. Hum. Mol. Genet. 11: 755767). The molecular defect responsible for this allele, Wa5, has not yet been reported.
| ACKNOWLEDGMENTS |
|---|
The authors are grateful for the assistance of Adrian Smith in the histologic analysis of embryonic placentas. This work was supported by funding from National Institutes of Health grants GM067759, GM60031, U54A154523, and 2P01-AI40682 and by a grant from the Defense Advanced Research Projects Agency.
Manuscript received July 9, 2003; Accepted for publication September 24, 2003.
| LITERATURE CITED |
|---|
BROWN, S. D. and R. BALLING, 2001 Systematic approaches to mouse mutagenesis. Curr. Opin. Genet. Dev. 11:268-273.[CrossRef][Medline]
BROWN, S. D. and J. PETERS, 1996 Combining mutagenesis and genomics in the mouseclosing the phenotype gap. Trends Genet. 12:433-435.[CrossRef][Medline]
CARPENTER, G. and S. COHEN, 1990 Epidermal growth factor. J. Biol. Chem. 265:7709-7712.
DONALDSON, R. W. and S. COHEN, 1992 Epidermal growth factor stimulates tyrosine phosphorylation in the neonatal mouse: association of a M(r) 55,000 substrate with the receptor. Proc. Natl. Acad. Sci. USA 89:8477-8481.
EHLING, U. H., D. J. CHARLES, J. FAVOR, J. GRAW, and J. KRATOCHVILOVA et al., 1985 Induction of gene mutations in mice: the multiple endpoint approach. Mutat. Res. 150:393-401.[Medline]
FINDLATER, G. S., R. D. MCDOUGALL, and M. H. KAUFMAN, 1993 Eyelid development, fusion and subsequent reopening in the mouse. J. Anat. 183(1):121-129.
GREEN, M. R., D. A. BASKETTER, J. R. COUCHMAN, and D. A. REES, 1983 Distribution and number of epidermal growth factor receptors in skin is related to epithelial cell growth. Dev. Biol. 100:506-512.[CrossRef][Medline]
HRABE DE ANGELIS, M. and R. BALLING, 1998 Large scale ENU screens in the mouse: genetics meets genomics. Mutat. Res. 400:25-32.[Medline]
HRABE DE ANGELIS, M. H., H. FLASWINKEL, H. FUCHS, B. RATHKOLB, and D. SOEWARTO et al., 2000 Genome-wide, large-scale production of mutant mice by ENU mutagenesis. Nat. Genet. 25:444-447.[CrossRef][Medline]
HUBBARD, S. R., M. MOHAMMADI, and J. SCHLESSINGER, 1998 Autoregulatory mechanisms in protein-tyrosine kinases. J. Biol. Chem. 273:11987-11990.
JHAPPAN, C., C. STAHLE, R. N. HARKINS, N. FAUSTO, and G. H. SMITH et al., 1990 TGF alpha overexpression in transgenic mice induces liver neoplasia and abnormal development of the mammary gland and pancreas. Cell 61:1137-1146.[CrossRef][Medline]
JORISSEN, R. N., F. WALKER, N. POULIOT, T. P. GARRETT, and C. W. WARD et al., 2003 Epidermal growth factor receptor: mechanisms of activation and signalling. Exp. Cell Res. 284:31-53.[CrossRef][Medline]
JURILOFF, D. M., M. J. HARRIS, K. G. BANKS, and D. G. MAH, 2000 Gaping lids, gp, a mutation on centromeric chromosome 11 that causes defective eyelid development in mice. Mamm. Genome 11:440-447.[CrossRef][Medline]
JUSTICE, M. J., J. K. NOVEROSKE, J. S. WEBER, B. ZHENG, and A. BRADLEY, 1999 Mouse ENU mutagenesis. Hum. Mol. Genet. 8:1955-1963.
KLEMKE, R. L., S. CAI, A. L. GIANNINI, P. J. GALLAGHER, and P. DE LANEROLLE et al., 1997 Regulation of cell motility by mitogen-activated protein kinase. J. Cell Biol. 137:481-492.
LANDER, E. S., L. M. LINTON, B. BIRREN, C. NUSBAUM, and M. C. ZODY et al., 2001 Initial sequencing and analysis of the human genome. Nature 409:860-921.[CrossRef][Medline]
LI, C., H. GUO, X. XU, W. WEINBERG, and C. X. DENG, 2001 Fibroblast growth factor receptor 2 (Fgfr2) plays an important role in eyelid and skin formation and patterning. Dev. Dyn. 222:471-483.[CrossRef][Medline]
LUETTEKE, N. C., T. H. QIU, R. L. PEIFFER, P. OLIVER, and O. SMITHIES et al., 1993 TGF alpha deficiency results in hair follicle and eye abnormalities in targeted and waved-1 mice. Cell 73:263-278.[CrossRef][Medline]
LUETTEKE, N. C., H. K. PHILLIPS, T. H. QIU, N. G. COPELAND, and H. S. EARP et al., 1994 The mouse waved-2 phenotype results from a point mutation in the EGF receptor tyrosine kinase. Genes Dev. 8:399-413.
MANN, G. B., K. J. FOWLER, A. GABRIEL, E. C. NICE, and R. L. WILLIAMS et al., 1993 Mice with a null mutation of the TGF alpha gene have abnormal skin architecture, wavy hair, and curly whiskers and often develop corneal inflammation. Cell 73:249-261.[CrossRef][Medline]
MIETTINEN, P. J., J. R. CHIN, L. SHUM, H. C. SLAVKIN, and C. F. SHULER et al., 1999 Epidermal growth factor receptor function is necessary for normal craniofacial development and palate closure. Nat. Genet. 22:69-73.[CrossRef][Medline]
MURILLAS, R., F. LARCHER, C. J. CONTI, M. SANTOS, and A. ULLRICH et al., 1995 Expression of a dominant negative mutant of epidermal growth factor receptor in the epidermis of transgenic mice elicits striking alterations in hair follicle development and skin structure. EMBO J. 14:5216-5223.[Medline]
NOLAN, P. M., J. PETERS, M. STRIVENS, D. ROGERS, and J. HAGAN et al., 2000 A systematic, genome-wide, phenotype-driven mutagenesis programme for gene function studies in the mouse. Nat. Genet. 25:440-443.[CrossRef][Medline]
PARIA, B. C. and S. K. DEY, 1990 Preimplantation embryo development in vitro: cooperative interactions among embryos and role of growth factors. Proc. Natl. Acad. Sci. USA 87:4756-4760.
SANDGREN, E. P., N. C. LUETTEKE, R. D. PALMITER, R. L. BRINSTER, and D. C. LEE, 1990 Overexpression of TGF alpha in transgenic mice: induction of epithelial hyperplasia, pancreatic metaplasia, and carcinoma of the breast. Cell 61:1121-1135.[CrossRef][Medline]
SCHLESSINGER, J., 2002 Ligand-induced, receptor-mediated dimerization and activation of EGF receptor. Cell 110:669-672.[CrossRef][Medline]
SIBILIA, M. and E. F. WAGNER, 1995 Strain-dependent epithelial defects in mice lacking the EGF receptor. Science 269:234-238.
STAMOS, J., M. X. SLIWKOWSKI, and C. EIGENBROT, 2002 Structure of the epidermal growth factor receptor kinase domain alone and in complex with a 4-anilinoquinazoline inhibitor. J. Biol. Chem. 277:46265-46272.
STEIN, K. F., B. E. NORRIS, and J. MASON, 1967 Development of an open eyelid mutant in mus musculus. Dev. Biol. 16:315-330.[CrossRef][Medline]
THREADGILL, D. W., A. A. DLUGOSZ, L. A. HANSEN, T. TENNENBAUM, and U. LICHTI et al., 1995 Targeted disruption of mouse EGF receptor: effect of genetic background on mutant phenotype. Science 269:230-234.
VENTER, J. C., M. D. ADAMS, E. W. MYERS, P. W. LI, and R. J. MURAL et al., 2001 The sequence of the human genome. Science 291:1304-1351.
WELLS, A., 1999 EGF receptor. Int. J. Biochem. Cell Biol. 31:637-643.[CrossRef][Medline]
WILSON, A. J. and P. R. GIBSON, 1999 Role of epidermal growth factor receptor in basal and stimulated colonic epithelial cell migration in vitro. Exp. Cell Res. 250:187-196.[CrossRef][Medline]
YARDEN, Y. and M. X. SLIWKOWSKI, 2001 Untangling the ErbB signalling network. Nat. Rev. Mol. Cell Biol. 2:127-137.[CrossRef][Medline]
YUJIRI, T., M. WARE, C. WIDMANN, R. OYER, and D. RUSSELL et al., 2000 MEK kinase 1 gene disruption alters cell migration and c-Jun NH2-terminal kinase regulation but does not cause a measurable defect in NF-kappa B activation. Proc. Natl. Acad. Sci. USA 97:7272-7277.
This article has been cited by other articles:
![]() |
M. R. Schneider, S. Werner, R. Paus, and E. Wolf Beyond Wavy Hairs: The Epidermal Growth Factor Receptor and Its Ligands in Skin Biology and Pathology Am. J. Pathol., July 1, 2008; 173(1): 14 - 24. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-H. Xia, H. Liu, D. Cheung, M. Wang, C. Cheng, X. Du, B. Chang, B. Beutler, and X. Gong A model for familial exudative vitreoretinopathy caused by LPR5 mutations Hum. Mol. Genet., June 1, 2008; 17(11): 1605 - 1612. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Wang, C. Cheng, L. Li, H. Liu, Q. Huang, C.-h. Xia, K. Yao, P. Sun, J. Horwitz, and X. Gong {gamma}D-Crystallin Associated Protein Aggregation and Lens Fiber Cell Denucleation Invest. Ophthalmol. Vis. Sci., August 1, 2007; 48(8): 3719 - 3728. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Crozat, K. Hoebe, S. Ugolini, N. A. Hong, E. Janssen, S. Rutschmann, S. Mudd, S. Sovath, E. Vivier, and B. Beutler Jinx, an MCMV susceptibility phenotype caused by disruption of Unc13d: a mouse model of type 3 familial hemophagocytic lymphohistiocytosis J. Exp. Med., April 16, 2007; 204(4): 853 - 863. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-h. Xia, H. Liu, B. Chang, C. Cheng, D. Cheung, M. Wang, Q. Huang, J. Horwitz, and X. Gong Arginine 54 and Tyrosine 118 Residues of {alpha}A-Crystallin Are Crucial for Lens Formation and Transparency. Invest. Ophthalmol. Vis. Sci., July 1, 2006; 47(7): 3004 - 3010. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-h. Xia, H. Liu, D. Cheung, C. Cheng, E. Wang, X. Du, B. Beutler, W.-K. Lo, and X. Gong Diverse gap junctions modulate distinct mechanisms for fiber cell formation during lens development and cataractogenesis Development, May 15, 2006; 133(10): 2033 - 2040. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mine, R. Iwamoto, and E. Mekada HB-EGF promotes epithelial cell migration in eyelid development Development, October 1, 2005; 132(19): 4317 - 4326. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Liu, X. Du, M. Wang, Q. Huang, L. Ding, H. W. McDonald, J. R. Yates III, B. Beutler, J. Horwitz, and X. Gong Crystallin {gamma}B-I4F Mutant Protein Binds to {alpha}-Crystallin and Affects Lens Transparency J. Biol. Chem., July 1, 2005; 280(26): 25071 - 25078. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Du, X.
- Articles by Beutler, B.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Du, X.
- Articles by Beutler, B.












