Genetics, Vol. 166, 171-186, January 2004, Copyright © 2004

The sys-1 and sys-3 Genes Cooperate With Wnt Signaling to Establish the Proximal-Distal Axis of the Caenorhabditis elegans Gonad

Kellee R. Siegfried1,a, Ambrose R. Kidd, IIIb, Michael A. Chesneyc, and Judith Kimblea,b,c,d
a Laboratory of Genetics, University of Wisconsin, Madison, Wisconsin 53706-1544
b Program in Cellular and Molecular Biology, University of Wisconsin, Madison, Wisconsin 53706-1544
c Department of Biochemistry, University of Wisconsin, Madison, Wisconsin 53706-1544
d Howard Hughes Medical Institute, University of Wisconsin, Madison, Wisconsin 53706-1544

Corresponding author: Judith Kimble, 433 Babcock Dr., University of Wisconsin, Madison, WI 53706-1544., jekimble{at}facstaff.wisc.edu (E-mail)

Communicating editor: B. J. MEYER


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

To form the proximal-distal axis of the C. elegans gonad, two somatic gonadal precursor cells, Z1 and Z4, divide asymmetrically to generate one daughter with a proximal fate and one with a distal fate. Genes governing this process include the lin-17 frizzled receptor, wrm-1/ß-catenin, the pop-1/TCF transcription factor, lit-1/nemo-like kinase, and the sys-1 gene. Normally, all of these regulators promote the distal fate. Here we show that nuclear levels of a pop-1 GFP fusion protein are less abundant in the distal than in the proximal Z1/Z4 daughters. This POP-1 asymmetry is lost in mutants disrupting Wnt/MAPK regulation, but retained in sys-1 mutants. We find that sys-1 is haplo-insufficient for gonadogenesis defects and that sys-1 and pop-1 mutants display a strong genetic interaction in double heterozygotes. Therefore, sys-1 is a dose-sensitive locus and may function together with pop-1 to control Z1/Z4 asymmetry. To identify other regulatory genes in this process, we screened for mutants resembling sys-1. Four such genes were identified (gon-14, -15, -16, and sys-3) and shown to interact genetically with sys-1. However, only sys-3 promotes the distal fate at the expense of the proximal fate. We suggest that sys-3 is a new key gene in this pathway and that gon-14, gon-15, and gon-16 may cooperate with POP-1 and SYS-1 at multiple stages of gonad development.


ORGANOGENESIS requires the careful orchestration of cell divisions, cell positions, and cell fates. An early step in organogenesis is the establishment of organ axes. Most organs are oriented with respect to the primary body axes (e.g., anterior-posterior, dorsal-ventral, and left-right), at least during early organ development. However, some organs acquire an organ-specific axis that does not correspond to primary body axes. For example, limbs or appendages acquire a proximal-distal (PD) axis (e.g., NISWANDER 2002 Down), as does the Caenorhabditis elegans gonad (e.g., HUBBARD and GREENSTEIN 2000 Down). The mechanisms for establishing organ axes that depart from primary body axes are poorly understood.

We have focused on C. elegans gonadogenesis to investigate controls governing early organogenesis and formation of a novel, organ-specific axis. The cellular events that establish the initial gonadal axes were revealed by early lineage studies (KIMBLE and HIRSH 1979 Down). Briefly, the gonad develops from a four-celled gonadal primordium, consisting of two somatic gonadal precursor cells called Z1 and Z4 and two primordial germ cells (PGCs; Fig 1A; HUBBARD and GREENSTEIN 2000 Down). Z1 occupies the anterior right pole and Z4 occupies the posterior left pole of the primordium; moreover, Z1 and Z4 extend processes ventrally to meet beneath the PGCs (Fig 1A and Fig B). Therefore, the gonadal primordium has anterior-posterior, dorsal-ventral, and left-right axes. Z1 and Z4 undergo coordinated and virtually invariant cell divisions, cell fate decisions, and patterning to generate the adult somatic gonad. In hermaphrodites, the mature gonad is a symmetrical structure, with two ovotestes, or "arms," emanating from central somatic tissues (i.e., uterus and spermatheca), whereas in males, the gonad is asymmetric, with a single testis extending from posterior somatic tissues (i.e., seminal vesicle, vas deferens). Nonetheless, the gonads of both sexes have related PD axes: the germ line is distal and somatic gonadal tissues are proximal (Fig 1D and Fig F). However, the hermaphrodite gonad possesses two opposing PD axes, while the male has a single PD axis (Fig 1D and Fig F, arrows).



View larger version (45K):
In this window
In a new window
Download PPT slide
 
Figure 1. Early gonad development in wild type and sys or Wnt/MAPK mutants. Anterior is to the left and dorsal is to the top. (A, B, D, and F) Wild type. (C, E, and G) Sys defects. (A) A wild-type newly hatched larva showing the anterior-posterior (AP) and dorsal-ventral (DV) body axes. The left-right body axis is not shown. The gonadal primordium consists of the two somatic gonadal precursors, Z1 and Z4, and the two primordial germ cells (PGCs), Z2 and Z3. In the gonadal primordium Z1 and Z4 reside at the anterior and posterior poles of the primordium and reach cytoplasmic processes ventrally (also shown in B, top). The primordial germ cells (PGCs) are central and dorsal to Z1 and Z4. (B) Z1 and Z4 divide asymmetrically in both sexes, each giving rise to a daughter cell with distal identity (gray nucleus) that lies at the poles of the organ, and a daughter cell with proximal identity (black nucleus) that lies more centrally. Each Z1/Z4 distal daughter generates a DTC, while one of the two proximal daughters generates the AC in hermaphrodites and the LC in males. (D) Hermaphrodite somatic primordium (SPh) formation. Most somatic gonadal cells migrate and coalesce centrally (dark gray), separating the germ line (gl) into two separate populations. The distal tip cells (DTCs; light gray) remain at the distal tips of the gonad, leading elongation of the gonadal arms. Each gonadal arm has a proximal-distal (PD) axis. The SPh occupies the proximal-most region of the gonad. (F) Male somatic primordium (SPm). Most somatic gonadal cells (dark gray) occupy the anterior end of the gonad. The germ line (gl) and DTCs lie more posterior. The male gonad has a single proximal-distal axis that coincides with the anterior-posterior axis at this stage in development. (C) The Sys mutant phenotype. Z1 and Z4 divide symmetrically, generating four daughters with proximal identity: all are capable of producing ACs (or LCs in males), but not DTCs. No PD axis is established. (E) In Sys hermaphrodites, somatic gonadal cells (dark gray) do not migrate centrally to form the SPh. Instead, they are arranged around the gonad periphery encasing the germ line (gl). (G) In males, the somatic gonadal cells (dark gray) still cluster anteriorly. However, these males are missing cells with distal fates (the DTCs) and have extra cells with proximal fates (the LCs).

The first step in establishing the gonadal PD axes is the asymmetric cell division of Z1 and Z4 (Fig 1). In each sex, Z1 and Z4 generate one daughter with a distal fate and one with a proximal fate (Fig 1B). In both hermaphrodites and males, the distal daughter generates a distal tip cell (DTC) and the proximal daughter generates either a cell with anchor cell (AC) potential in hermaphrodites or a cell with linker cell (LC) potential in males (Fig 1B, Fig D, and Fig F). The DTCs signal germline proliferation in both sexes (KIMBLE and WHITE 1981 Down). In hermaphrodites, the two DTCs also lead elongation to generate two gonadal arms, whereas in males, the single LC leads elongation to generate one gonadal arm (KIMBLE and WHITE 1981 Down). The AC is a hermaphrodite-specific cell type and induces vulval development (KIMBLE 1981 Down). Although each proximal daughter produces a cell with AC potential (or LC potential in males), lateral signaling selects one to adopt the AC (or LC) fate (GREENWALD 1998 Down). At the time of AC and LC determination, the DTCs reside at the distal pole(s) while the remaining somatic gonadal blast cells cluster proximally to form the somatic primordium of hermaphrodites (SPh; Fig 1D) or the somatic primordium of males (SPm; Fig 1D and Fig F).

Establishment of the gonadal PD axis relies on components of the Wnt and MAPK pathways (STERNBERG and HORVITZ 1988 Down; SIEGFRIED and KIMBLE 2002 Down). Specifically, the Z1/Z4 asymmetric division is governed by lin-17, a homolog of the frizzled (fz) receptor (STERNBERG and HORVITZ 1988 Down; SAWA et al. 1996 Down), as well as by wrm-1/ß-catenin, the pop-1/TCF transcription factor, and the mitogen-activated protein kinase (MAPK) regulator lit-1/nemo-like kinase (NLK; SIEGFRIED and KIMBLE 2002 Down). In addition, the sys-1 gene (for symmetrical sisters) governs Z1/Z4 polarity (MISKOWSKI et al. 2001 Down). Depletion of any one of these regulators can result in a symmetrical Z1/Z4 division, with both daughters adopting a proximal fate. The hallmarks of this fate transformation are a lack of DTCs and generation of extra ACs or LCs (Fig 1C, Fig E, and Fig F), as well as failure of SPh formation (Fig 1E; MISKOWSKI et al. 2001 Down). In males, the SPm forms, but distal cells are sometimes missing and extra LCs are produced, indicating that the PD axis is not specified (Fig 1G; MISKOWSKI et al. 2001 Down; SIEGFRIED and KIMBLE 2002 Down).

Wnt/MAPK signaling also controls asymmetric cell divisions along the AP axis (HERMAN and HORVITZ 1994 Down; LIN et al. 1995 Down, LIN et al. 1998 Down; SAWA et al. 1996 Down; KALETTA et al. 1997 Down; ROCHELEAU et al. 1997 Down, ROCHELEAU et al. 1999 Down; THORPE et al. 1997 Down; MENEGHINI et al. 1999 Down; SHIN et al. 1999 Down; WHANGBO et al. 2000 Down; HERMAN 2001 Down; PARK and PRIESS 2003 Down). This regulation occurs, at least in part, by controlling the abundance of nuclear POP-1 protein, the C. elegans homolog of TCF/LEF1 (LIN et al. 1995 Down, LIN et al. 1998 Down; HERMAN 2001 Down; MADURO et al. 2002 Down). Following an anterior-posterior (AP) asymmetric division, the daughter cell with activated Wnt/MAPK signaling has low nuclear POP-1 levels, and its sister has high nuclear POP-1 levels (LIN et al. 1995 Down, LIN et al. 1998 Down; ROCHELEAU et al. 1997 Down, ROCHELEAU et al. 1999 Down; THORPE et al. 1997 Down; MENEGHINI et al. 1999 Down; SHIN et al. 1999 Down; HERMAN 2001 Down; PARK and PRIESS 2003 Down). This phenomenon has been dubbed "POP-1 asymmetry" (MADURO et al. 2002 Down). Similarly, in Drosophila nuclear Pangolin/TCF is decreased in response to Wnt signaling (CHAN and STRUHL 2002 Down). Therefore, reduction of nuclear POP-1/TCF may be a conserved mechanism for modulating the ability of this transcription factor to control target genes.

Here we investigate the roles of sys-1, several regulators associated with Wnt/MAPK pathways, and four new genes in establishing the PD axis of the gonad. We use a rescuing green fluorescent protein (GFP)::POP-1 transgene to demonstrate that, in the gonad, POP-1 asymmetry reflects the PD axis rather than the AP axis. We also show that sys-1 is a dose-sensitive locus that interacts genetically with pop-1 to establish the proximal-distal axis, but that POP-1 asymmetry is not affected in sys-1 mutants. Finally, we identify sys-3, a new locus that, when mutated, has the full complement of Sys defects, genetically interacts with sys-1 and pop-1 mutations, and also does not affect POP-1 asymmetry. Mutations in three other genes, gon-14, gon-15, and gon-16, have only some Sys defects, but they also interact genetically with sys-1 and pop-1. Therefore, these gon (gonadogenesis defective) genes may affect Wnt/MAPK regulation of the gonadal proximal-distal axis, but also have other roles.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Strains:
Animals were grown at 20° unless otherwise noted. All strains were derivatives of Bristol strain N2 (BRENNER 1974 Down). The following mutations are described in HODGKIN 1997 Down or cited references. LG I, lin-17(n671), pop-1(q645 and q624) (SIEGFRIED and KIMBLE 2002 Down), mec-8(e398), unc-11(e47), mom-5(or57) (THORPE et al. 1997 Down), sys-1(q544) (MISKOWSKI et al. 2001 Down), lin-6(e1466), and lin-44(n1792); LG II, unc-4(e120); LG III, unc-32(e189), lin-12(n137gf,sd n720lf), unc-119(ed3), and lit-1(or131) (MENEGHINI et al. 1999 Down); LG IV, unc-24(e138), unc-33(e204), unc-5(e53), dpy-20(e1282), gon-4(e2575), him-8(e1489), and egl-20(n585); and LG V, rde-1(ne219) (TABARA et al. 1999 Down), unc-42(e270), sma-1(e30), emo-1(oz1), dpy-11(e224), snb-1(js124), and dpy-13(e184); LG X, mom-1(or10), unc-6(n102), and lon-2(e678). hT2[qIs48] and nT1[qIs51] were used as dominant green balancer chromosomes (GFP Bal). In addition, the following markers were used: qIs56 and qIs57 are lag-2::GFP insertions; syIs50 is a cdh-3::GFP insertion; and qIs65, qIs73, and qIs74 are GFP::POP-1 insertions.

Construction of POP-1 DNAs:
A pop-1 cDNA was generated by RT-PCR using the Expand High-Fidelity kit (Roche, Indianapolis) with a primer to the SL1 sequence and a primer in the pop-1 3'-UTR (5' CAAAGCATAGAAATAGGCGGG 3'). This cDNA was subcloned using the pT7Blue Perfectly Blunt cloning kit (Novagen) to produce pJK706.

The POP-1::GFP construct (Table 1) included ~3.5 kb of sequence upstream of the pop-1 gene, introns 1 and 2, and GFP fused at the C terminus of the protein; this construct was produced by a "PCR ligation" technique. First the pop-1 cDNA::GFP fusion was made by digestion of pJK706 with BbsI, end filling with Klenow, and then digesting with HindIII to remove the pop-1 fragment. The GFP vector pPD95.79 was digested with HindIII and SmaI and ligated with the HindIII BbsI(blunt) fragment from pJK706 to produce plasmid pJK909. The following fragments were then produced either by PCR using the Expand 20KbPLUS system (Roche) or by digestion and gel purification: (1) a genomic fragment consisting of ~3.5 kb upstream of the start codon and continuing through exon 2 (primer sequences: 5'-AGCAAGGTGTCTACTGTCGCCTGTC-3' and 5'-TTTTCGCCAATTTTTATGTGT-3'), (2) a genomic fragment containing exon 1 and continuing into exon 3 (primer sequences: 5'-ATGGCCTAACTTCCGC-3' and 5'-TTTCGCCTGTTCTTCCTTCGA-3'), and (3) a PvuI fragment of pJK909 that begins in exon 3 of the pop-1 cDNA::GFP fusion and continues through the unc-54 3'-UTR from pPD95.79. These three fragments were produced in duplicate and all were combined and used as the template in PCR reactions to amplify the entire POP-1::GFP product using the Expand 20KbPLUS system (Roche; primer sequences 5'-AGCAAGGTGTCTACTGTCGCCTGTC-3' and 5'-GAGGTTTTCACCGTCATCACC-3'). This construct was expressed in Z1 and Z4 and their descendants as well as other tissues known to express POP-1. However, the GFP did not show different nuclear levels between sister cells in any tissues (Table 1).


 
View this table:
In this window
In a new window

 
Table 1. Summary of POP-1 in the early gonad

Two GFP::POP-1 constructs, GFP::POP-1({Delta}1-5) and GFP::POP-1(FL) (Table 1), were made with GFP fused at the N terminus of the pop-1 cDNA. These reporters were placed under control of a promoter expressed in Z1 and Z4 as well as many other tissues, called jmp#1 (J. MISKOWSKI, personal communication). GFP::POP-1({Delta}1-5) was made by first amplifying GFP with primers containing SacI sites at the 5' ends. This GFP fragment was cloned in frame into the SacI site of pJK706, which inserts GFP upstream of amino acid 6 of the POP-1 protein. GFP::POP-1({Delta}1-5) was subcloned into pPD49.26 to add the unc-54 3'-UTR and then cloned into pDPMM0166 (MADURO and PILGRIM 1995 Down) to add the unc-119 gene for use as a selective marker when producing transgenics. The resulting plasmid is named pJK789. The second construct, POP-1::GFP(FL), differs from the first only in that GFP is fused in frame upstream of the first methionine of the pop-1 cDNA. This construct is called pJK908.

Antibody staining, transgenics, and RNAi:
Antibody staining on L1 larva was done essentially as described by HERMAN 2001 Down, using a POP-1 monoclonal antibody (LIN et al. 1998 Down), with the following modification: larvae were freeze cracked using two poly-L-lysine-coated slides rather than one slide and one cover slip. We found that staining was inconsistent and extremely weak in the gonad, even though hypodermal tissues stained well. In those animals with detectable POP-1 staining in the gonad, POP-1 was present in Z1 and Z4 and also in Z1/Z4 daughters. In particular, the Z1/Z4 daughters had more nuclear POP-1 staining in proximal than in distal daughters (not shown). Whole-mount techniques using Bouin's fix, collagenase treatment, and Finney-Ruvkin staining gave no visible staining in any tissues.

To produce animals carrying the POP-1::GFP transgene, a mixture of two independently produced POP-1::GFP PCR ligation products (see above) was injected into the distal germ line of unc-4 animals at 2 ng/µl with 100 ng/µl unc-4 genomic DNA. One stable transgenic line with weak transmittance of the array was produced, but eventually was lost.

Transgenes of GFP::POP-1({Delta}1-5) and GFP::POP-1(FL) were made using particle bombardment as described (PRAITIS et al. 2001 Down) with the following modification: gold beads were baked overnight at 186° before preparing. Plasmid DNA was prepared using the QIAGEN (Valencia, CA) plasmid midi kit. A total of 640 ng of pJK789 was used per bombardment, producing the insertion qIs65, and 780 ng of pJK908 was used per bombardment, producing insertions qIs72, qIs73, and qIs74. These four insertions show similar transgene expression.

RNA interference (RNAi) of wrm-1 and lit-1 was performed by injecting 1 mg/ml of dsRNA into qIs65; unc-32; rde-1 adult hermaphrodites followed by crossing with wild-type males. Injection into unc-32; rde-1 followed by crossing with wild-type males was always done in parallel. For RNAi of wrm-1 and lit-1 in qIs73 and qIs74 animals, unc-32; rde-1 animals were injected with 1 mg/ml of dsRNA followed by crossing with either qIs73/+ or qIs74/+ males. Crosses with wild-type males were also done in parallel.

Transgenes containing GFP::POP-1({Delta}1-5) and GFP::POP-1(FL) had some apparent dominant negative activity; however, GFP::POP-1(FL) could rescue gonadogenesis defects in pop-1(q624) animals (Table 1). Animals carrying GFP::POP-1({Delta}1-5) often had Sys-like gonadogenesis defects. These defects were not caused by loss of POP-1 asymmetry as all animals had higher POP-1 in the nuclei of proximal Z1/Z4 daughters than in distal Z1/Z4 daughters. GFP::POP-1({Delta}1-5) could not be made homozygous in a sys-3 homozygous mutant background. Because the qIs65 insertion of GFP::POP-1({Delta}1-5) was linked to sys-1 and pop-1 it was not crossed into these backgrounds. However, an extrachromosomal array carrying GFP::POP-1({Delta}1-5) with very weak expression did not rescue pop-1(q645) mutants and enhanced the gonadogenesis defects in pop-1(q624) mutants. Animals carrying the GFP::POP-1(FL) transgene had no Sys-like gonadogenesis defects. However, animals heterozygous for sys-1(q544) and homozygous for qIs74 were occasionally missing one gonadal arm [gonadal arms are missing at a higher frequency than in sys-1(q544) heterozygotes alone]. In addition, the qIs74 insertion could not be made homozygous in a sys-3 homozygous background. Despite weak dominant negative activity, qIs74 could rescue gonadogenesis defects in pop-1(q624) mutants, although pop-1(q645) mutants were not rescued by this transgene (Table 1).

Identification and characterization of sys-3, gon-14, gon-15, and gon-16:
The sys-3, gon-14, gon-15, and gon-16 mutants were isolated in F2 screens following treatment with ethyl methanesulfonate (EMS); F2 were raised at 25°. From 8316 mutagenized haploid genomes, we isolated sys-3(q632), gon-14(q552 and q631), gon-15(q574), and gon-16(q568) alleles. The gon-14(q10, q12, and q686) alleles were isolated in other EMS mutagenesis screens (J. KIMBLE and L. MATHIES, unpublished data). All mutations were outcrossed at least five times before further analyses. Males were produced by mating XX hermaphrodites with XO males. For analysis at 25°, XO males raised at 20° were crossed with XX hermaphrodites raised at 25°, and crosses were maintained at 25°.

The sys-3, gon-14, and gon-16 mutations are all recessive, and the gon-15 mutation shows minor dominance (Table 8, row 1). We used nDf32, which deletes the gon-14 locus, to ask if gon-14(q686) and gon-14(q631) are loss-of-function mutations. The hemizygous phenotype of either allele was more severe than its homozygous phenotype. Therefore, these two gon-14 alleles are likely hypomorphic mutations. There are no existing deficiencies that remove the sys-3, gon-15, or gon-16 loci for similar experiments.


 
View this table:
In this window
In a new window

 
Table 2. Summary of genetic interactions


 
View this table:
In this window
In a new window

 
Table 3. Double heterozygotes of sys-1 and Wnt/MAPK mutants


 
View this table:
In this window
In a new window

 
Table 4. sys-1 is a dominant enhancer of lin-17/fz


 
View this table:
In this window
In a new window

 
Table 5. sys, pop, and gon effects on hermaphrodite DTC and T cells


 
View this table:
In this window
In a new window

 
Table 6. sys, pop, and gon effects on anchor cells


 
View this table:
In this window
In a new window

 
Table 7. Comparison of sys, pop, and gon hermaphrodite and male defects


 
View this table:
In this window
In a new window

 
Table 8. Tests for genetic interactions in double heterozygotes

For growth assays, synchronized L1's, obtained by bleaching gravid adults and hatching eggs in M9 buffer, were plated on prewarmed 25° plates; larval stages were then scored every 24 hr. Most sys-3(q632), gon-15(q574), and gon-16(q568) animals grew at about the same rate as wild-type worms. Most gon-14(q12) animals arrested at about the L2 or L3 stage of development. gon-14(q686) animals did not arrest, but about half of the animals reached adulthood 24 hr later than wild-type animals.

The four new genes were mapped as follows.

  1. sys-3 resides at +2.8 on LG V: from sys-3/unc-42 sma-1 animals 3/7 Unc non-Sma carried sys-3 and 1/2 Sma non-Unc carried sys-3; from sys-3/emo-1 sma-1 animals 11/11 Sma non-Emo carried sys-3. The following deficiencies complemented sys-3(q632): nDf31, sDf35, sDf29, and ctDf1.

  2. gon-14 resides at +0.1 on LG V: from gon-14/dpy-11 unc-42 animals 1/22 Dpy non-Unc recombinants carried gon-14; from gon-14/dpy-11 snb-1 animals 2/6 Dpy non-Snb recombinants carried gon-14. The deficiency nDf32 failed to complement gon-14 mutants.

  3. gon-15 resides at position 0 on LG IV: from gon-15/dpy-13 unc-24 animals 0/17 Dpy non-Unc carried gon-15 and 3/3 Unc non-Dpy carried gon-15; from gon-15/unc-33 dpy-13 animals 0/32 Dpy non-Unc recombinants carried gon-15 and 3/3 Unc non-Dpy carried gon-15; from gon-15/dpy-13 unc-5 animals 0/11 Dpy non-Unc recombinants carried gon-15 and 15/15 Unc non-Dpy recombinants carried gon-15. The following deficiencies complemented gon-15(q574): mDf10, mDf4, mDf8, mDf9, and nDf41.

  4. gon-16 resides at +3.6 on LG IV: from gon-16/unc-24 dpy-20 animals 2/29 Unc non-Dpy carried gon-16 and 19/21 Dpy non-Unc recombinants carried gon-16. The following deficiencies complemented gon-16(q568): eDf19, sDf60, sDf2, and mDf7. In addition, gon-16 complemented gon-3(e2548), which maps nearby.

Generation of strains to test double-heterozygous interactions:
Animals heterozygous for mutations in both sys-1 and one other gene were generated in one of five ways. Methods 1–3 used sys-1(q544); methods 4 and 5 used the sys-1 deficiency qDf14: (1) lin-6 sys-1/hT2[qIs48] h x gene-x/GFP Bal or gene-x/gene-x m (strains used for this test were lin-17/hT2[qIs48] and lit-1; him-8); (2) gene-x/GFP Bal or gene-x/gene-x h x lin-6 sys-1/hT2 m (strains used were dpy-11 sys-3 and pop-1 mec-8/ hT2[qIs48]); (3) gene-x/GFP Bal h x sys-1/hT2[qIs48] m (strains used were pop-1 unc-11/hT2[qIs48], gon-14 unc-42/nT1[unc-?(n754) let-? qIs51], gon-15 unc-5/nT1[qIs51]); (4) gene-x/GFP Bal or gene-x/gene-x h x qDf14/hT2[qIs48] m (strains used were pop-1 mec-8/hT2[qIs48], unc-42 sys-3, gon-14 unc-42/nT1[qIs51], gon-15 unc-5/nT1[qIs51], unc-24 gon-16/nT1[unc-?(n754) let-? qIs51]); and (5) qDf14/hT2[qIs48] h x gene-x/GFP Bal or gene-x/gene-x m (strains used were unc-42 sys-3/nT1[qIs51], lin-17/ hT2[qIs48], lit-1; him-8). For all crosses with lit-1, homozygous lit-1 males were raised at 15° and crosses were done at 20°.

Animals heterozygous for mutations in both pop-1 and one other gene were generated by crosses similar to those described above for sys-1. For all tests except sys-1 (see above) and mom-1 (see below) the following cross was done: gene-x/GFP Bal or gene-x/gene-x h x pop-1/hT2[qIs48] m. Strains used were: sys-3 unc-42, gon-14 unc-42/nT1[unc-?(n754) let-? qIs51], gon-15 unc-5/nT1[qIs51], and unc-24 gon-16/nT1[qIs51].

Animals heterozygous for mutations in other genes were generated by the following crosses: sys-3 unc-42 h x gon-14/nT1[qIs51] or gon-15/nT1[qIs51] or gon-16/nT1[qIs51] m, gon-15 unc-5/nT1[qIs51] or unc-24 gon-16/nT1[qIs51] h x gon-14/nT1[qIs51] m, and gon-15 unc-5/nT1[qIs51] h x unc-24 gon-16/nT1[qIs51] m.

Because no dominant balancers are available for chromosome X, the following crosses were done to generate double heterozygotes with mom-1: mom-1 unc-6/szT1(lon-2) f (feminized by fog-1(RNAi)) x sys-1/hT2[qIs48]; lon-2/0, qDf14/hT2[qIs48]; lon-2/0, or pop-1/hT2[qIs48]; lon-2/0 m. Non-Lon, non-qIs48 progeny were scored for gonadal arms. For all double heterozygotes, control crosses were performed in a similar manner as test crosses. All tests for double heterozygous interactions were done at 20°.

Generation of strains to test dominant enhancement of homozygotes:
Dominant enhancement tests were done by segregating sys-1/+; gene-x/gene-x from sys-1/GFP Bal; marker gene-x/+ mothers. As controls, +/GFP Bal; marker gene-x/marker gene-x were scored. For example, from sys-1/hT2[qIs48]; dpy-11 sys-3/+ + hermaphrodites, Dpy Green progeny were scored by differential interference contrast (DIC) optics for number of gonadal arms. This number is compared to the number of gonadal arms scored in Dpy Green animals from +/hT2[qIs48]; dpy-11 sys-3/+ + hermaphrodites. All other dominant enhancement tests, except lin-17, lin-44, and egl-20, were done in this way using the following mutant chromosomes: gon-14 unc-42, gon-15 unc-5, unc-24 gon-16, gon-4 dpy-20, and mom-1 unc-6. To test for dominant enhancement of lin-17 by sys-1 the progeny from lin-17 sys-1/hT2[qIs48] f (feminized by fog-1(RNAi)) x lin-17/hT2[qIs48] m were compared with the progeny from lin-17/hT2[qIs48] f (feminized by fog-1(RNAi)) x lin-17/hT2[qIs48]. Dominant enhancement of lin-44 was done in a similar way to lin-17. Dominant enhancement of egl-20 by sys-1 was done by scoring Glowing progeny from sys-1/hT2[qIs48]; egl-20 h. The tests for pop-1 as a dominant enhancer were done in the same way, with pop-1 in the place of sys-1. All tests for dominant enhancement were done at 20°.

For all genetic interactions null alleles were used when possible. The mom-1, sys-1, and pop-1 alleles used are strong loss of function; lit-1(or131) is a temperature-sensitive allele known to have gonadal defects when grown at 25°; and the lin-17, lin-44, and egl-20 alleles used are null.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The Wnt and MAPK signaling pathways control POP-1 asymmetry to establish the gonadal proximal-distal axes:
In many tissues, POP-1 is more abundant in nuclei of anterior than in posterior sister cells after asymmetric divisions along the AP axis (see Introduction). To investigate how POP-1 is regulated in PD divisions in the early gonad, we examined the relative abundance of POP-1 in the nuclei of Z1, Z4, and their daughters. Table 1 summarizes our results.

To examine POP-1 expression, we first used a reporter driven by the pop-1 promoter, called pop-1::GFP (Table 1, MATERIALS AND METHODS), and found GFP in many cells throughout the animal, including Z1, Z4, and their daughters. However, GFP levels were equivalent in the nuclei of Z1/Z4 daughters (Table 1) as well as in anterior and posterior daughters of asymmetric divisions in the hypodermis (not shown). We also attempted to use POP-1 monoclonal antibodies (LIN et al. 1998 Down), but staining in the gonad was weak and inconsistent, perhaps due to permeabilization problems (data not shown, see MATERIALS AND METHODS). Nonetheless, in some animals, POP-1 staining was weakly detectable in Z1 and Z4 and their immediate descendants. From these analyses, we conclude that POP-1 is normally present in Z1 and Z4 and their daughters.

During the course of these studies, MADURO et al. 2002 Down reported that GFP fused to the POP-1 N terminus mimicked the asymmetry of endogenous POP-1 in early embryos. We therefore constructed two GFP::POP transgenes under control of a promoter that drives expression at the same apparent level in many cells, including Z1, Z4, and their descendants (J. MISKOWSKI, personal communication; see MATERIALS AND METHODS). One transgene, GFP::POP({Delta}1-5), has GFP-coding sequences fused in frame to the sixth codon of pop-1 cDNA, while the other, GFP::POP(FL), fuses GFP to the full-length pop-1 cDNA (Table 1). Both transgenes displayed similar expression levels and response to Wnt/MAPK signaling (discussed below). In addition, both transgenes exhibited similar POP-1 asymmetry in the Z1/Z4 daughters (Table 1). GFP::POP({Delta}1-5) had dominant negative activity and was not viable in certain mutant backgrounds (Table 1; see MATERIALS AND METHODS); by contrast, GFP::POP(FL) had only marginal dominant negative effects and rescued a pop-1 mutant (Table 1; see MATERIALS AND METHODS).

We examined both the developing hypodermis and the early gonad using the GFP::POP reporters. As seen in previous studies (LIN et al. 1998 Down; HERMAN 2001 Down), GFP was more abundant in anterior than in posterior daughters in hypodermal lineages (Fig 2A and Fig B). Expression in the early gonad departed from this anterior-posterior asymmetry: the nucleus of Z1.p was brighter than that of Z1.a (Fig 2C and Fig D), and the nucleus of Z4.a was brighter than that of Z4.p (Fig 2E and Fig F). We also noted that proximal daughters contained nuclear GFP puncta (Fig 2D, arrowheads) similar to those described in the anterior daughters of asymmetric divisions in the embryo (MADURO et al. 2002 Down). We conclude that, in the gonad, the proximal daughters of Z1 and Z4 have more nuclear GFP::POP-1 than do the distal daughters, reflecting the proximal-distal axis of the gonad rather than the anterior-posterior axis of the animal.



View larger version (109K):
In this window
In a new window
Download PPT slide
 
Figure 2. GFP::POP-1 localization in the Z1/Z4 daughters. All panels show L1 larvae expressing GFP::POP-1({Delta}1-5) [animals expressing GFP::POP-1(FL) show similar localization]. The gonad is indicated by the dashed circle. Nuclei of sister cells are indicated by brackets. Images alongside each other are of the same animal: DIC on the left and fluorescence on the right. Bars, 5 µm. (A and B) The T daughters are posterior; (C–J) anterior is to the left. (A and B) In the V and T cell daughters, GFP::POP-1 shows more GFP in nuclei of anterior sister cells than in posterior sister cells. (C–F) GFP::POP-1 is higher in nuclei of the proximal Z1/Z4 daughters than in the distal daughters. GFP-positive puncta are present in the nuclei of the proximal daughters (D, arrowheads). (G–J) lit-1(RNAi) or wrm-1(RNAi) results in similar nuclear levels of GFP::POP-1 in Z1/Z4 daughters. GFP-positive puncta are often seen in both Z1/Z4 daughters (H, arrowheads). The Z1 daughters are shown.

To investigate the effect of Wnt/MAPK pathways on POP-1 asymmetry in the gonad, we used RNAi or mutants to block regulation of Wnt or MAPK signaling in GFP::POP transgenic animals. POP-1 asymmetry was lost in the early gonad using either wrm-1(RNAi) or lit-1(RNAi): Z1 and Z4 daughters displayed apparently equivalent levels of nuclear POP-1 when either of these two genes was reduced (Fig 2, G–J). In this experiment, we assessed the relative level of POP-1::GFP between sister cells in the same animal, rather than the absolute level. Although the level in both mutant nuclei can appear somewhat lower than that of the wild-type proximal sister, GFP puncta are often observed in both mutant daughters (Fig 2H, arrowheads). In wild type, these puncta are observed in nuclei with high nuclear GFP::POP-1. Additionally, lin-17(n671) animals displayed equivalent levels of nuclear POP-1 in 31% of Z1 and Z4 daughters (data not shown). This penetrance is consistent with the penetrance of distal to proximal transformations in this mutant (STERNBERG and HORVITZ 1988 Down; SIEGFRIED and KIMBLE 2002 Down). Therefore, the asymmetry exhibited by GFP::POP({Delta}1-5) and GFP::POP(FL) in the daughters of Z1 and Z4 is regulated by Wnt/MAPK signaling.

sys-1 interacts genetically with pop-1 and lin-17 to control Z1/Z4 asymmetry:
The proximal-distal axis of the gonad is affected similarly in Wnt/MAPK and sys-1 mutants (STERNBERG and HORVITZ 1988 Down; MISKOWSKI et al. 2001 Down; SIEGFRIED and KIMBLE 2002 Down). This similarity suggested that sys-1 might influence Wnt and/or MAPK signaling. To explore this hypothesis, we analyzed genetic interactions between sys-1 and Wnt/MAPK genes. First, we assayed double heterozygotes, which are animals heterozygous for mutations in both sys-1 and one of the Wnt/MAPK genes. This classic test for nonallelic noncomplementation asks if animals of the genotype gene-x/+; gene-y/+ have more severe defects than that predicted for the additive effect of each heterozygote individually. Second, we assayed animals heterozygous for sys-1, but homozygous for a second mutation. This test, for dominant enhancement of homozygous mutants, is more sensitive than that relying on double heterozygotes. Our results are summarized in Table 2 and detailed in Table 3 and Table 4.

We first focused on genetic interactions between sys-1 and pop-1. Hermaphrodites homozygous for either sys-1(q544) or pop-1(q645) have a fully penetrant loss of DTCs, representing complete loss of the distal fate (MISKOWSKI et al. 2001 Down; SIEGFRIED and KIMBLE 2002 Down); furthermore, both mutations are essentially recessive: DTCs were missing in <=1% of sys-1(q544)/+ and pop-1(q645)/+ single heterozygotes (Table 3). The pop-1(q624) mutation is fully recessive (SIEGFRIED and KIMBLE 2002 Down) and a deficiency that deletes sys-1, qDf14, has mild haplo-insufficiency (2%, Table 3). A marked genetic interaction was seen between sys-1 and pop-1: + sys-1(q544)/pop-1(q645) + double heterozygotes resulted in a 21% loss of DTCs (Table 3), + sys-1(q544)/pop-1(q624) + were missing 15% of their DTCs (n = 68), and qDf14 in trans to pop-1(q645) had a 55% DTC loss (Table 3). A deletion internal to the sys-1 locus had the same effect as qDf14 in this assay (A. KIDD and K. SIEGFRIED, unpublished results), suggesting that qDf14 represents the effect of a sys-1 null. We conclude that sys-1 and pop-1 interact genetically and that sys-1 is a dose-sensitive gene.

We next asked if sys-1 interacted with other Wnt/MAPK genes, focusing on genes with known Sys-like gonadogenesis defects: mom-1/porcupine (porc), lin-17/fz, and lit-1/NLK (STERNBERG and HORVITZ 1988 Down; SIEGFRIED and KIMBLE 2002 Down). We found that, as double heterozygotes, none had a significant interaction with sys-1 (Table 2 and Table 3). We therefore used the more sensitive test of dominant enhancement. Specifically, we asked if sys-1 could dominantly enhance mom-1/porc, egl-20/Wnt, lin-44/Wnt, or lin-17/fz homozygotes (lit-1 could not be tested due to balancer constraints) and if pop-1 could dominantly enhance mom-1 or egl-20 mutants (dominant enhancement of lin-17 by pop-1 was not tested because these genes are closely linked; Table 2 and Table 4). Only one interaction was found: whereas lin-17 homozygotes had 12% DTC loss, lin-17 sys-1/lin-17 + mutants had 29% DTC loss (Table 4). We conclude that sys-1 interacts genetically with both pop-1 and lin-17. However, the interaction between sys-1 and pop-1 is substantially stronger than that between sys-1 and lin-17.

Identification of additional genes regulating Z1 and Z4:
To identify other genes controlling Z1/Z4 asymmetry, we screened for mutants with a Sys-like phenotype (see MATERIALS AND METHODS). The initial screen focused on mutants that lacked gonadal arm elongation and failed to make an SPh, two features typical of sys-1. Five additional genes were identified in this screen: pop-1 (SIEGFRIED and KIMBLE 2002 Down), sys-3, gon-14, gon-15, and gon-16 (see MATERIALS AND METHODS). The gon-14 locus is represented by five alleles, and sys-3, gon-15, and gon-16 are each represented by a single allele. None of these loci mapped genetically to positions that encode known Wnt/MAPK components (Fig 3).



View larger version (28K):
In this window
In a new window
Download PPT slide
 
Figure 3. The sys-3, gon-14, gon-15, and gon-16 genes do not map to Wnt/MAPK signaling components. Approximate genetic map location of canonical Wnt pathway components and MAPK members that regulate Wnt signaling are shown. Linkage groups (LG) are designated by Roman numerals and X for the sex chromosome. Corresponding C. elegans gene names are as follows, from LG I left (top) to LG X right (bottom): mig-1/fz, lin-17/fz, pop-1/TCF, lin-44/Wnt, apr-1/APC, mom-4/TAK1, mom-5/fz, pry-1/Axin, sgg-1/GSK3ß, hmp-2/ß-catenin, cwn-1/Wnt, C27A2.6/dsh, C34F11.9/dsh, mig-5/dsh, wrm-1/ß-catenin, lit-1/NLK, egl-20/Wnt, cwn-2/Wnt, cfz-2/fz, mom-2/Wnt, mom-1/porc, and bar-1/ß-catenin. Although sys-1 mapped near mom-5/fz, mutations in these two genes complemented each other, and a deficiency distinguished the two loci: qDf14 removed sys-1, but not mom-5.

To learn if the newly identified genes affected Z1/Z4 asymmetry, we scored mutations in each for loss of DTCs, which mark the distal fate, and extra ACs, which mark the proximal fate. To score DTCs, we used the lag-2::GFP reporter (Fig 4A and Fig D; BLELLOCH et al. 1999 Down), and to score ACs, we used cdh-3::GFP (PETTITT et al. 1996 Down). As expected, sys-3, gon-14, gon-15, and gon-16 mutants failed to make DTCs (Table 5; Fig 4B and Fig E), but DTC loss was not fully penetrant and was temperature sensitive (Table 5). Analysis of AC formation gave an unexpected result. Whereas most sys-1 and pop-1 mutants made two or more ACs, as described previously (MISKOWSKI et al. 2001 Down; SIEGFRIED and KIMBLE 2002 Down), most sys-3, gon-15, gon-16, and many gon-14 mutants had only one AC, although a few had more (Table 6). We next asked if the percentage of animals with extra ACs could be enhanced by removal of lin-12 activity. The rationale for this experiment was as follows. Normally, only one of two potential AC precursors adopts the AC fate due to lateral signaling mediated by the lin-12/Notch receptor; however, in lin-12 mutants, both AC precursors adopt the AC fate (GREENWALD 1998 Down). Therefore, our assay for AC production might underestimate the production of extra proximal cells. We examined all four mutants in a lin-12(0) background so that all Z1/Z4 daughters with proximal fate could give rise to ACs. The extra AC defect was dramatically enhanced in sys-1 and pop-1 mutants as well as in sys-3 mutants (Table 6). We conclude that the sys-3 locus affects Z1/Z4 asymmetry.



View larger version (42K):
In this window
In a new window
Download PPT slide
 
Figure 4. Gonadogenesis defects of sys-3, gon-14, gon-15, and gon-16. (A–F) L3 hermaphrodites; (A–C) DIC; (D–F) fluorescence; asterisk, center of animal; DTC, distal tip cell; sc, somatic cells. Bars, 10 µm. (A and D) Wild-type posterior gonad. The somatic gonadal cells (sc) are clustered centrally. The elongating germ line (gl) is led by the DTC, which expresses lag-2::GFP. (B and E) sys-3 mutant, the entire gonad is shown. The gonad is not elongated and no lag-2::GFP-expressing DTCs are seen. Residual lag-2::GFP is present in all somatic gonadal cells upon overexposure (arrowheads). Somatic gonadal cells (arrowheads) are arranged around the periphery of the gonad surrounding the germ line (gl). Cells expressing GFP ventral to the gonad are cells in the ventral nerve cord. (C and F) The gon-16 mutant can have weakly expressing DTCs. The anterior DTC has normal lag-2::GFP expression, while the posterior DTC has very weak expression. A similar phenomenon is seen in gon-14 and gon-15 mutants.

For gon-14, gon-15, or gon-16, the percentage of animals with extra ACs was not enhanced by reduction of lin-12 activity (Table 6). The apparent loss of ACs in gon-14, gon-15, or gon-16 mutants, in either a lin-12(+) or a lin-12(0) background, may be caused by production of fewer than normal AC precursors, defects in AC specification, or defects in AC maintenance. An exploration of the loss of ACs in these mutants is beyond the scope of this work.

While scoring gon-14, gon-15, and gon-16 mutants for DTC loss and extra ACs, we noticed additional gonadogenesis defects. For example, DTCs often migrated more slowly than normal, and gonadal arms could be unusually short. In addition, the DTC expression of lag-2::GFP was often lower than normal (Fig 4F), and AC expression of cdh-3::GFP was often abnormally weak or not detectable. On the basis of the reduced DTC function and the poor DTC and AC reporter expression, we suggest that DTCs and ACs may not develop properly in gon-14, gon-15, and gon-16 mutants.

sys-3, gon-14, gon-15, and gon-16 function in male gonadogenesis:
To ask if the sys-3, gon-14, gon-15, and gon-16 mutants have similar gonadogenesis defects in males as in hermaphrodites, we compared DTC production in the two sexes. To detect DTCs in males, we used a functional assay. Normally, male DTCs are essential for germ-line proliferation: males with no DTCs have only a few germ cells, a defect called Glp (germ-line proliferation defective; KIMBLE and WHITE 1981 Down). We compared the percentage of hermaphrodites missing both DTCs (using lag-2::GFP) to the percentage of Glp males (Table 7). By these assays, gon-14, gon-15, and gon-16 mutant hermaphrodites apparently lacked DTCs somewhat more often than did mutant males (Table 7). This result is similar to that observed for sys-1 and pop-1 (MISKOWSKI et al. 2001 Down; SIEGFRIED and KIMBLE 2002 Down). By contrast, 93% of sys-3 males lacked both DTCs, whereas only 12% of sys-3 hermaphrodites were missing both DTCs (Table 7). Therefore, sys-1, pop-1, gon-14, gon-15, and gon-16 appear to be more critical for hermaphrodite gonadogenesis, while sys-3 appears to be more important for male gonadogenesis.

In addition to the Glp phenotype, gon-14, gon-15, and gon-16 mutant males often had disorganized gonads with elongation defects and gon-14(q686) mutant males occasionally produced a vulva (6%, n = 47, 25°). No defect in elongation was detected in sys-3 male gonads, but somatic gonadal tissues were sometimes positioned abnormally within the gonad, as has been seen in sys-1 and pop-1 males (K. SIEGFRIED, unpublished observation). The elongation defects in both hermaphrodite and male gonads suggest that gon-14, gon-15, and gon-16 affect leader cell function.

T cell polarity and other nongonadal defects:
To ask if sys-1, sys-3, gon-14, gon-15, and gon-16 were gonad specific, we assayed each for a role in nongonadal development. We first examined their growth rate and found that all mutants except gon-14 progressed through larval development at a rate similar to wild-type animals (see MATERIALS AND METHODS). For gon-14, most animals homozygous for the strong loss-of-function allele gon-14(q12) arrested at midlarval development (L2 or L3), but animals homozygous for the temperature-sensitive allele, gon-14(q686), developed to adulthood more slowly than wild type (see MATERIALS AND METHODS). In addition, whereas sys-3 mutant adults attained a normal size, gon-14, gon-15, and gon-16 adults were typically about one-half to two-thirds the length of wild-type adults. Therefore, gon-14, gon-15, and gon-16 all affect growth and therefore are unlikely to act specifically in gonadogenesis.

We next asked if sys-3, gon-14, gon-15, or gon-16 acts in other Wnt/MAPK-dependent cell fate decisions. To do this, we examined production of functional phasmid socket cells by the T cell, a precursor in the tail hypodermis. Normally, the posterior T cell daughter gives rise to the phasmid socket cells, while its anterior daughter makes primarily hypodermis (SULSTON and HORVITZ 1977 Down). Wnt/MAPK signaling controls this asymmetric T cell division: abrogation of Wnt/MAPK signaling causes either a reversal of cell polarity or both daughters to adopt an anterior identity (HERMAN and HORVITZ 1994 Down; SAWA et al. 1996 Down; ROCHELEAU et al. 1999 Down; HERMAN 2001 Down). We assayed for the production of phasmid socket cells, using a dye-filling assay (HERMAN and HORVITZ 1994 Down). The sys-1, sys-3, gon-15, and gon-16 mutants had little effect on phasmid socket cells, but the gon-14(q686) temperature-sensitive mutant raised at restrictive temperature sometimes failed to take up dye into the phasmids (Table 5). The gon-14 effect on phasmid socket cells may reflect a lack of socket cells due to a lineage defect or a failure of socket cells to function properly.

Finally, gon-15 and gon-16 males raised at 25° were often missing some or all sensory rays (data not shown), a phenotype seen in lin-17 mutants, in pop-1(RNAi) animals, and occasionally in sys-1 mutants (STERNBERG and HORVITZ 1988 Down; SIEGFRIED and KIMBLE 2002 Down; this work). No obvious male tail defects were observed in gon-14(q686) mutants raised at 25° or in sys-3 mutant males raised at 20°.

Genetic interactions among sys-1, pop-1, sys-3, gon-14, gon-15, and gon-16:
The genetic interactions observed between sys-1 and components of the Wnt pathway (Table 2) provided a sensitive assay for gene function in Z1/Z4 asymmetry (see above). We therefore asked whether sys-3, gon-14, gon-15, and gon-16 might interact genetically with either sys-1 or pop-1. First, we looked for interactions between double heterozygotes and found that sys-3 did indeed interact with sys-1 in this test, but no other interactions were observed (Table 2 and Table 8). This result provides further support for a role of sys-3 in Z1/Z4 asymmetry.

As a more sensitive assay for genetic interactions, we next asked if sys-1 or pop-1 could dominantly enhance sys-3, gon-14, gon-15, or gon-16 mutants. Intriguingly, either sys-1/+ or pop-1/+ enhanced the 20° phenotype of each of these mutants (Table 2 and Table 9). As a control, we tested gon-4 for dominant genetic interactions with sys-1 and pop-1. In gon-4 mutants, cell divisions are severely delayed during gonadogenesis, and DTCs and ACs are often missing (FRIEDMAN et al. 2000 Down). Therefore, gon-4 mutants have defects in gonadogenesis that are distinct from those in the mutants under study here, but sufficiently similar to serve as a reasonable control. We observed no dominant enhancement of gon-4 by either sys-1/+ or pop-1/+ (Table 5 and Table 9). Therefore, genetic interactions between sys-1 or pop-1 and sys-3, gon-14, gon-15, or gon-16 appear to be specific.


 
View this table:
In this window
In a new window

 
Table 9. Dominant enhancement by sys-1 and pop-1

sys-1, sys-3, gon-14, gon-15, and gon-16 do not regulate POP-1 asymmetry:
Wnt/MAPK regulators control POP-1 asymmetry in Z1 and Z4 daughters, as assayed by our GFP::POP-1 reporter (see above, Fig 2). To investigate how sys-1, sys-3, gon-14, gon-15, and gon-16 cooperate with Wnt/MAPK regulators, we assayed GFP::POP-1 localization in these mutants. In contrast to the Wnt/MAPK mutants, which eliminate POP-1 asymmetry, sys-1, sys-3, gon-14, gon-15, and gon-16 mutants did not affect POP-1 asymmetry (Fig 5). Therefore, these genes are likely to function either downstream of or in parallel to the regulation of POP-1 asymmetry by Wnt and MAPK signaling.



View larger version (122K):
In this window
In a new window
Download PPT slide
 
Figure 5. GFP::POP-1 in sys and gon mutants. The sys-1, sys-3, gon-14, gon-15, and gon-16 mutants are not required for GFP::POP-1 asymmetry in the gonad. The gonad is indicated by the dashed circle. Nuclei of Z1 daughters are shown (brackets). Images alongside each other are of the same animal: DIC on the right and fluorescence on the left. Bars, 5 µm. (A–J) All mutants have normal POP-1 nuclear asymmetry (compare to Fig 2C and Fig D); proximal Z1/Z4 daughters have higher nuclear POP-1 levels than distal daughters. GFP::POP-1({Delta}1-5) was used for gon-14, gon-15, and gon-16, each raised at 25°. GFP::POP-1(FL) was used for sys-1 and sys-3, each raised at 20°. gon-14(q686) is shown; similar results were seen in gon-14(q12) raised at 25°.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

In this work, we investigate the control of the asymmetric division of Z1 and Z4 that sets up the PD axis during early gonadogenesis. Previous work showed that the sys-1 gene and Wnt/MAPK regulators were critical for this asymmetric division (STERNBERG and HORVITZ 1988 Down; MISKOWSKI et al. 2001 Down; SIEGFRIED and KIMBLE 2002 Down). Here we explore the subcellular localization of POP-1 in Z1/Z4 daughters and its regulation by Wnt/MAPK regulators. We also report that sys-1 is a dose-sensitive locus that interacts genetically with Wnt signaling regulators as well as a group of four newly identified genes affecting early gonadogenesis. The new genes include sys-3, which controls Z1/Z4 asymmetry, and gon-14, gon-15, and gon-16, which control development more broadly.

POP-1 asymmetry in the gonad reflects the proximal-distal axis:
The POP-1 transcription factor is required for proximal-distal fate specification among the Z1/Z4 daughters (SIEGFRIED and KIMBLE 2002 Down). By contrast, in several nongonadal tissues, POP-1 controls sister cell fates along the AP body axis (HERMAN and HORVITZ 1994 Down; LIN et al. 1995 Down, LIN et al. 1998 Down; SAWA et al. 1996 Down; KALETTA et al. 1997 Down; ROCHELEAU et al. 1997 Down, ROCHELEAU et al. 1999 Down; THORPE et al. 1997 Down; MENEGHINI et al. 1999 Down; SHIN et al. 1999 Down; WHANGBO et al. 2000 Down; HERMAN 2001 Down; PARK and PRIESS 2003 Down). In AP asymmetric divisions, POP-1 is more abundant in anterior nuclei than in posterior nuclei (LIN et al. 1995 Down, LIN et al. 1998 Down; ROCHELEAU et al. 1997 Down, ROCHELEAU et al. 1999 Down; THORPE et al. 1997 Down; MENEGHINI et al. 1999 Down; SHIN et al. 1999 Down; HERMAN 2001 Down; PARK and PRIESS 2003 Down), a phenomenon dubbed POP-1 asymmetry (MADURO et al. 2002 Down). To ask if POP-1 asymmetry is seen in Z1/Z4 daughters, we used reporter transgenes to assay POP-1 localization. We found that POP-1 is indeed asymmetric in Z1/Z4 daughters, but that this asymmetry did not follow the AP axis. Instead POP-1 asymmetry in the early gonad reflects the PD axis. Thus, distal nuclei (Z1.a and Z4.p) have less nuclear POP-1, and proximal nuclei (Z1.p and Z4.a) have more nuclear POP-1.

The POP-1 asymmetry in Z1/Z4 daughters is controlled by Wnt/MAPK regulators. We have shown that lin-17/frizzled, wrm-1/ß-catenin, and lit-1/NLK each regulate POP-1 asymmetry in these cells. These same regulators control distal fates in the early gonad (STERNBERG and HORVITZ 1988 Down; SIEGFRIED and KIMBLE 2002 Down). Therefore, Wnt/MAPK regulators are likely to control both POP-1 asymmetry and POP-1 activity.

How do Wnt/MAPK regulators control anterior-posterior asymmetries in the main body and proximal-distal asymmetries in the gonad? We suggest three possibilities. One idea is that POP-1 is activated by different ligands in the two situations. Three of the five Wnt homologs have been identified as critical for AP divisions: mom-2, lin-44, and egl-20 (HERMAN and HORVITZ 1994 Down; ROCHELEAU et al. 1997 Down; THORPE et al. 1997 Down; WHANGBO et al. 2000 Down). However, no function has been attributed to the other two Wnts, cwn-1 and cwn-2. Perhaps one or both of these control the PD asymmetric cell division of Z1 and Z4. However, RNAi to either of these two genes gave no gonadogenesis defects (SIEGFRIED and KIMBLE 2002 Down). A second possibility is that a Wnt ligand common to AP cell divisions also controls Z1/Z4 polarity. In this scenario the initial signal by the Wnt may be refined by other factors or communication between Z1 and Z4 such that PD polarity rather than AP polarity is established. Third, a Wnt homolog may not be involved in controlling Z1/Z4 polarity. In this model, a cue inherent to the gonad is established on the basis of the AP and dorsal-ventral (DV) axes of the gonadal primordium (SIEGFRIED and KIMBLE 2002 Down).

Is a Wnt ligand involved in Z1/Z4 polarity?
No Wnt ligand has been found to affect the polarity of the Z1/Z4 divisions (SIEGFRIED and KIMBLE 2002 Down; this work). Specifically, Z1/Z4 asymmetry was not affected by depletion of any of five known Wnt ligands or by depletion of two to three of these ligands in combination (SIEGFRIED and KIMBLE 2002 Down). Additionally, the single porcupine (porc) homolog, mom-1, which is required for Wnt function in the C. elegans embryo and in Drosophila (VAN DEN HEUVEL et al. 1993 Down; ROCHELEAU et al. 1997 Down), has very minor defects in gonadogenesis (SIEGFRIED and KIMBLE 2002 Down). Because the gonadogenesis defects were rare in mom-1 mutants, it was not determined whether these defects were due to a symmetrical division of Z1 and Z4.

In this work, we utilized genetic analysis to search for a role of Wnt in the control of Z1/Z4 polarity. We asked if sys-1 or pop-1 might interact genetically with either of two Wnt ligands or with mom-1/porc. We reasoned that analysis of a mom-1/porc mutant should represent the effect of removing all five Wnt genes. Therefore, the low-penetrance mom-1 gonadogenesis defect might be dominantly enhanced by sys-1 or pop-1 if any of the Wnt ligands function in the asymmetric divisions of Z1 and Z4. However, no interactions were found. Although we cannot conclude that a Wnt ligand does not control Z1/Z4 polarity, at this time it seems unlikely.

Although a Wnt ligand may not function in the Z1/Z4 asymmetric division, there is precedence for a Wnt gene functioning more generally in gonadogenesis. A mutation affecting lin-44/Wnt was reported to enhance the gonadal defects in tcl-2 mutants, suggesting that lin-44 may have a role in gonadogenesis (ZHAO et al. 2003 Down). However, the tcl-2 gene on its own does not have a Sys phenotype: DTCs were missing but extra ACs were not made (ZHAO et al. 2003 Down). Therefore, the lin-44/Wnt gene functions cooperatively with tcl-2 in gonadogenesis; however, it may not control asymmetric division of Z1 and Z4.

Frizzled signaling decreases nuclear POP-1:
POP-1 promotes distal fates among the Z1/Z4 daughters (SIEGFRIED and KIMBLE 2002 Down). One might therefore expect POP-1 to be more abundant in the nuclei of the distal daughter cells. However, the opposite is observed. After the asymmetric Z1/Z4 division, POP-1 is less abundant in distal nuclei than in proximal nuclei (this work). A similar phenomenon was observed in daughters of the T cells: POP-1 promotes the posterior fate of T.p, but nuclear POP-1 is lower in T.p than in its sister T.a (MENEGHINI et al. 1999 Down; ROCHELEAU et al. 1999 Down; SHIN et al. 1999 Down; HERMAN 2001 Down). In both of these cases, loss of pop-1 function has the same developmental defect as the loss of Wnt/MAPK activities (SAWA et al. 1996 Down; ROCHELEAU et al. 1999 Down; HERMAN 2001 Down; SIEGFRIED and KIMBLE 2002 Down). Therefore, Wnt/MAPK signaling positively regulates POP-1 function but reduces nuclear levels of POP-1 protein.

Regulation of TCF nuclear localization by Wnt signaling may be a conserved mechanism for modulating the function of TCF transcription factors. Nuclear POP-1 in C. elegans and nuclear Pangolin, the Drosophila TCF homolog, are both decreased in response to Wnt signaling (LIN et al. 1995 Down, LIN et al. 1998 Down; ROCHELEAU et al. 1997 Down, ROCHELEAU et al. 1999 Down; THORPE et al. 1997 Down; SHIN et al. 1999 Down; HERMAN 2001 Down; CHAN and STRUHL 2002 Down; MADURO et al. 2002 Down; PARK and PRIESS 2003 Down; and this work). This phenomenon was first discovered in the C. elegans embryo, which is complicated by POP-1 acting as an essential repressor in this case (CALVO et al. 2001 Down; MADURO et al. 2002 Down). Thus, in the embryonic EMS daughter cells, Wnt/MAPK signaling negatively regulates POP-1 repression of target genes. This negative regulation of POP-1 in the posterior daughter allows development of posterior fate. Therefore, the upstream Wnt signaling components have effects on cell fate opposite those of POP-1: removal of the Wnt ligand, Frizzled receptor, or ß-catenin each results in both EMS daughters adopting the anterior fate, whereas removal of POP-1 results in both EMS daughters adopting the posterior fate (LIN et al. 1995 Down; ROCHELEAU et al. 1997 Down; THORPE et al. 1997 Down). Wnt signaling in the early embryo contrasts with that observed in postembryonic development. In postembryonic development, disruption of upstream Wnt signaling or POP-1 each has the same effect, suggesting that Wnt signaling positively regulates POP-1 function (SAWA et al. 1996 Down; ROCHELEAU et al. 1997 Down; HERMAN 2001 Down; SIEGFRIED and KIMBLE 2002 Down). Similarly, in Drosophila, nuclear Pangolin/TCF is reduced by Wnt signaling and this reduction corresponds with positive regulation of Pangolin by Wnt signaling (CHAN and STRUHL 2002 Down). The common theme is that Wnt signaling appears to decrease TCF in the nucleus of the activated cell. Depending on the context, reduction of nuclear TCF by Wnt signaling can either positively or negatively affect its function.

Models for regulation of POP-1 activation:
Why is the level of nuclear POP-1 lower in cells whose fates are specified by POP-1? Current models assume that the TCF transcription factors act autonomously in the cell requiring its activity. If POP-1 does indeed act autonomously, then, in the C. elegans Z1/Z4 and T cell daughters and in the Drosophila embryo, low nuclear POP-1 represents the active form. HERMAN 2001 Down suggests that LIT-1 phosphorylates POP-1 in response to Wnt signaling and that this modification leads to both degradation and activation of POP-1. However, more recently, work in the C. elegans embryo suggests that reduction of nuclear POP-1 is not due to degradation (MADURO et al. 2002 Down). CHAN and STRUHL 2002 Down have suggested that, in Drosophila, Armadillo/ß-catenin activates Pangolin/TCF either by selectively exporting a repressor form of Pangolin from the nucleus or by activating Pangolin in the cytoplasm.

We suggest a modified model to explain how a decreased level of nuclear POP-1 might favor an active form of the transcription factor (Fig 6C). This model incorporates our results with SYS-1, a dose-sensitive regulator of the pathway in Z1 and Z4. Both HERMAN 2001 Down and CHAN and STRUHL 2002 Down suggest that POP-1/Pangolin can exist in either an inactive or active form. Our model suggests that the ratio of active to inactive POP-1 is controlled by a coactivator that is present at a limiting concentration. By this model, POP-1 is not active when it is present at a high level, because most POP-1 is not bound to the limiting coactivator; instead, this form of POP-1 either is inactive or functions as a repressor. In contrast, POP-1 is active when present at a low level, because most POP-1 can bind to the limiting coactivator. An attractive idea is that SYS-1 might be the limiting transcriptional coactivator. Evidence supporting this idea is: (1) sys-1 specifies the same fate as Wnt/MAPK regulators; (2) sys-1 displays a dramatic genetic interaction with pop-1, which may indicate a physical interaction between SYS-1 and POP-1 proteins; (3) sys-1 is a dose-sensitive locus; and (4) sys-1 does not affect POP-1 asymmetry. Therefore, although the molecular role of SYS-1 is not known, its genetic properties are consistent with a role as a POP-1 coactivator present at limiting concentration. One test of this model might have been to increase sys-1 dosage using a duplication; however, duplications of this region are unstable. Instead, we recently cloned sys-1 (T. KIDD, unpublished data) and plan to test the model by overexpression of a sys-1 transgene.



View larger version (25K):
In this window
In a new window
Download PPT slide
 
Figure 6. Genetic and molecular models. (A and B) Two models of sys-1 and sys-3 in frizzled signaling. SYS-1 and SYS-3 do not control POP-1 asymmetry and therefore either function in parallel to WNT and MAPK signaling (A) or regulate POP-1 in the nucleus downstream of Wnt/MAPK regulation of POP-1 asymmetry (B). (C) SYS-1 may be a limiting coactivator of POP-1. POP-1 protein (solid circle) is less abundant in the nuclei of distal Z1/Z4 daughters compared to the proximal Z1/Z4 daughters. SYS-1 protein may be equally abundant in nuclei of all daughters, but present in limiting quantity. In the distal daughters the ratio of POP-1 to SYS-1 is about equal, and together these proteins activate distal genes. In the proximal daughters, POP-1 is more abundant than SYS-1 in the nucleus and less activator complex is made. On its own, POP-1 may repress distal genes and therefore outcompetes any SYS-1/POP-1 activator complex made.

sys-1 and sys-3 function in parallel with or downstream of POP-1 to regulate Z1/Z4 asymmetric divisions:
In this work we report identification of a new gene, sys-3, that controls Z1/Z4 polarity. We provide evidence suggesting that sys-1 and sys-3 act together with Wnt/MAPK signaling in the Z1/Z4 daughters. Specifically, we have shown that sys-1 has dominant genetic interactions with pop-1 and lin-17 while sys-3 has dominant genetic interactions with sys-1 and pop-1. The similar mutant phenotypes shared by sys-1, sys-3, pop-1, and lin-17 together with the dominant genetic interactions suggest that sys-1 and sys-3 function in the Wnt signaling cascade with pop-1 and lin-17. Alternatively, one or both of the sys-1 and sys-3 genes function in a parallel pathway that is required for Wnt signaling. For example, these pathways may converge to cooperatively activate target genes.

The function of sys-1 and sys-3 appears to be distinct from that of upstream Wnt/MAPK regulators of POP-1. Thus, lin-17, wrm-1, and lit-1 all promote POP-1 asymmetry (Fig 2), but sys-1 and sys-3 do not affect POP-1 asymmetry (Fig 5). Although the sys-1 and sys-3 alleles used in these assays may not be nulls, they nonetheless render the Z1/Z4 division symmetric without affecting POP-1 asymmetry (MISKOWSKI et al. 2001 Down; this work). Therefore, sys-1 and sys-3 are likely to act in parallel to the Wnt/MAPK regulators of POP-1 (Fig 6A), together with POP-1 (Fig 6B), or downstream of POP-1 (not shown).

gon-14, gon-15, and gon-16: a role in Z1/Z4 polarity?
We have isolated mutations in three genes, gon-14, gon-15, and gon-16, which are missing DTCs and display a Sys-like SPh defect. Furthermore, sys-1 and pop-1 mutations can dominantly enhance gonadal defects in gon-14, gon-15, and gon-16 homozygotes. Therefore, these genes may influence POP-1 and SYS-1 function. However, gon-14, gon-15, and gon-16 mutants do not produce extra cells with a proximal fate and therefore may not cause the distal-to-proximal fate transformations seen in sys mutants. Alternatively, gon-14, gon-15, and gon-16 genes may control Z1/Z4 polarity as well as later steps critical for gonadogenesis, such as DTC and AC differentiation or maintenance. Such a later function is suggested by weak lag-2:GFP expression in some DTCs and weak cdh-3::GFP expression in some ACs.


*  FOOTNOTES

1 Present address: Max-Planck-Institut für Entwicklungsbiologie, Abt. Genetik, Spemannstrasse 35, 72076 Tübingen, Germany. Back


*  ACKNOWLEDGMENTS

We thank Laura Mathies, Finn-Hugo Markussen, Peggy Kroll-Conner, and Lisa Friedman for participation in the gonadogenesis screen that generated mutations in sys-3, gon-14, gon-15, and gon-16. We thank Joel Rothman and Morris Maduro for providing plasmids and discussing unpublished data, Jennifer Miskowski for providing jmp#1, and Andy Fire for plasmids. We also thank Laura Mathies and Daniel Hesselson for critical comments on the manuscript and Alison Blackwelder and Joseph Anderson for technical assistance. Some strains used in this work were supplied by the C. elegans stock center (Caenorhabditis Genetics Center). K.R.S., A.R.K., and M.A.C. were trainees of National Institutes of Health training grants, Genetics (GM07133), Molecular Biosciences (GM07215), and Biotechnology (GM08349), respectively. J.K. is an investigator with the Howard Hughes Medical Institute.

Manuscript received July 22, 2003; Accepted for publication October 10, 2003.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

BLELLOCH, R., S. SANTA ANNA-ARRIOLA, D. GAO, Y. LI, and J. HODGKIN et al., 1999  The gon-1 gene is required for gonadal morphogenesis in Caenorhabditis elegans.. Dev. Biol. 216:382-393.[CrossRef][Medline]

BRENNER, S., 1974  The genetics of Caenorhabditis elegans.. Genetics 77:71-94.[Abstract/Free Full Text]

CALVO, D., M. VICTOR, F. GAY, G. SUI, and M. P.-S. LUKE et al., 2001  A POP-1 repressor complex restricts inappropriate cell type-specific gene transcription during Caenorhabditis elegans embryogenesis. EMBO J. 20:7197-7208.[CrossRef][Medline]

CHAN, S.-K. and G. STRUHL, 2002  Evidence that Armadillo transduces Wingless by mediating nuclear export or cytosolic activation of Pangolin. Cell 111:265-280.[CrossRef][Medline]

FRIEDMAN, L., S. SANTA ANNA-ARRIOLA, J. HODGKIN, and J. KIMBLE, 2000  gon-4, a cell lineage regulator required for gonadogenesis in Caenorhabditis elegans.. Dev. Biol. 228:350-362.[CrossRef][Medline]

GREENWALD, I., 1998  LIN-12/Notch signaling: lessons from worms and flies. Genes Dev. 12:1751-1762.[Free Full Text]

HERMAN, M. A., 2001  C. elegans POP-1/TCF functions in a canonical Wnt pathway that controls cell migration and in a noncanonical Wnt pathway that controls cell polarity. Development 128:581-590.[Abstract]

HERMAN, M. A. and H. R. HORVITZ, 1994  The Caenorhabditis elegans gene lin-44 controls the polarity of asymmetric cell divisions. Development 120:1035-1047.[Abstract]

HODGKIN, J., 1997 Appendix 1. Genetics, pp. 881–1047 in C. elegans II, edited by D. L. RIDDLE, T. BLUMENTHAL, B. J. MEYER and J. R. PRIESS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

HUBBARD, E. J. A. and D. GREENSTEIN, 2000  The Caenorhabditis elegans gonad: a test tube for cell and developmental biology. Dev. Dyn. 218:2-22.[CrossRef][Medline]

KALETTA, T., H. SCHNABEL, and R. SCHNABEL, 1997  Binary specification of the embryonic lineage in Caenorhabditis elegans.. Nature 390:294-298.[CrossRef][Medline]

KIMBLE, J., 1981  Alterations in cell lineage following laser ablation of cells in the somatic gonad of Caenorhabditis elegans.. Dev. Biol. 87:286-300.[CrossRef][Medline]

KIMBLE, J. and D. HIRSH, 1979  The postembryonic cell lineages of the hermaphrodite and male gonads in Caenorhabditis elegans.. Dev. Biol. 70:396-417.[CrossRef][Medline]

KIMBLE, J. E. and J. G. WHITE, 1981  On the control of germ cell development in Caenorhabditis elegans.. Dev. Biol. 81:208-219.[CrossRef][Medline]

LIN, R., S. THOMPSON, and J. R. PRIESS, 1995  pop-1 encodes an HMG box protein required for the specification of a mesoderm precursor in early C. elegans embryos. Cell 83:599-609.[CrossRef][Medline]

LIN, R., R. J. HILL, and J. R. PRIESS, 1998  POP-1 and anterior-posterior fate decision in C. elegans embryos. Cell 92:229-239.[CrossRef][Medline]

MADURO, M. and D. PILGRIM, 1995  Identification and cloning of unc-119, a gene expressed in the Caenorhabditis elegans nervous system. Genetics 141:977-988.[Abstract]

MADURO, M. F., R. LIN, and J. H. ROTHMAN, 2002  Dynamics of a developmental switch: recursive intracellular and intranuclear redistribution of Caenorhabditis elegans POP-1 parallels Wnt-inhibited transcriptional repression. Dev. Biol. 248:128-142.[CrossRef][Medline]

MENEGHINI, M. D., T. ISHITANI, J. C. CARTER, N. HISAMOTO, and J. NINOMIYA-TSUJI et al., 1999  MAP kinase and Wnt pathways converge to downregulate an HMG-domain repressor in Caenorhabditis elegans.. Nature 399:793-797.[CrossRef][Medline]

MISKOWSKI, J., Y. LI, and J. KIMBLE, 2001  The sys-1 gene and sexual dimorphism during gonadogenesis in Caenorhabditis elegans.. Dev. Biol. 230:61-73.[CrossRef][Medline]

NISWANDER, L., 2002  Interplay between the molecular signals that control vertebrate limb development. Int. J. Dev. Biol. 46:877-881.[Medline]

PARK, F. D. and J. R. PRIESS, 2003  Establishment of POP-1 asymmetry in early C. elegans embryos. Development 130:3547-3556.[Abstract/Free Full Text]

PETTITT, J., W. B. WOOD, and R. H. A. PLASTERK, 1996  cdh-3, a gene encoding a member of the cadherin superfamily, functions in epithelial cell morphogenesis in Caenorhabditis elegans.. Development 122:4149-4157.[Abstract]

PRAITIS, V., E. CASEY, D. COLLAR, and J. AUSTIN, 2001  Creation of low-copy integrated transgenic lines in Caenorhabditis elegans.. Genetics 157:1217-1226.[Abstract/Free Full Text]

ROCHELEAU, C. E., W. D. DOWNS, R. LIN, C. WITTMANN, and Y. BEI et al., 1997  Wnt signaling and an APC-related gene specify endoderm in early C. elegans embryos. Cell 90:707-716.[CrossRef][Medline]

ROCHELEAU, C. E., J. YASUDA, T. H. SHIN, R. LIN, and H. SAWA et al., 1999  WRM-1 activates the LIT-1 protein kinase to transduce anterior/posterior polarity signals in C. elegans.. Cell 97:717-726.[CrossRef][Medline]

SAWA, H., L. LOBEL, and H. R. HORVITZ, 1996  The Caenorhabditis elegans gene lin-17, which is required for certain asymmetric cell divisions, encodes a putative seven-transmembrane protein similar to the Drosophila Frizzled protein. Genes Dev. 10:2189-2197.[Abstract/Free Full Text]

SHIN, T. H., J. YASUDA, C. E. ROCHELEAU, R. LIN, and M. SOTO et al., 1999  MOM-4, a MAP kinase kinase kinase-related protein, activates WRM-1/LIT- 1 kinase to transduce anterior/posterior polarity signals in C. elegans.. Mol. Cell 4:275-280.[CrossRef][Medline]

SIEGFRIED, K. and J. KIMBLE, 2002  POP-1 controls axis formation during early gonadogenesis in C. elegans.. Development 129:443-453.

STERNBERG, P. W. and H. R. HORVITZ, 1988  lin-17 mutations of Caenorhabditis elegans disrupt certain asymmetric cell divisions. Dev. Biol. 130:67-73.[CrossRef][Medline]

SULSTON, J. E. and H. R. HORVITZ, 1977  Post-embryonic cell lineages of the nematode, Caenorhabditis elegans.. Dev. Biol. 56:110-156.[CrossRef][Medline]

TABARA, H., M. SARKISSIAN, W. G. KELLY, J. FLEENOR, and A. GRISHOK et al., 1999  The rde-1 gene, RNA interference, and transposon silencing in C. elegans.. Cell 99:123-132.[CrossRef][Medline]

THORPE, C. J., A. SCHLESINGER, J. C. CARTER, and B. BOWERMAN, 1997  Wnt signaling polarizes an early C. elegans blastomere to distinguish endoderm from mesoderm. Cell 90:695-705.[CrossRef][Medline]

VAN DEN HEUVEL, M., C. HARRYMAN-SAMOS, J. KLINGENSMITH, N. PERRIMON, and R. NUSSE, 1993  Mutations in the segment polarity genes wingless and porcupine impair secretion of the wingless protein. EMBO J. 12:5293-5302.[Medline]

WHANGBO, J., J. HARRIS, and C. KENYON, 2000  Multiple levels of regulation specify the polarity of an asymmetric cell division in C. elegans.. Development 127:4587-4598.[Abstract]

ZHAO, X., H. SAWA, and M. A. HERMAN, 2003  tcl-2 encodes a novel protein that acts synergistically with Wnt signaling pathways in C. elegans.. Dev. Biol. 256:276-289.[CrossRef][Medline]




This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Rudel, H. Tian, and R. J. Sommer
Wnt signaling in Pristionchus pacificus gonadal arm extension and the evolution of organ shape
PNAS, August 5, 2008; 105(31): 10826 - 10831.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
P. Sundaram, W. Han, N. Cohen, B. Echalier, J. Albin, and L. Timmons
Caenorhabditis elegans ABCRNAi Transporters Interact Genetically With rde-2 and mut-7
Genetics, February 1, 2008; 178(2): 801 - 814.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
S. Huang, P. Shetty, S. M. Robertson, and R. Lin
Binary cell fate specification during C. elegans embryogenesis driven by reiterated reciprocal asymmetry of TCF POP-1 and its coactivator {beta}-catenin SYS-1
Development, July 15, 2007; 134(14): 2685 - 2695.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. T. Phillips, A. R. Kidd III, R. King, J. Hardin, and J. Kimble
Reciprocal asymmetry of SYS-1/beta-catenin and POP-1/TCF controls asymmetric divisions in Caenorhabditis elegans
PNAS, February 27, 2007; 104(9): 3231 - 3236.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
B. J. Hwang, A. D. Meruelo, and P. W. Sternberg
C. elegans EVI1 proto-oncogene, EGL-43, is necessary for Notch-mediated cell fate specification and regulates cell invasion
Development, February 15, 2007; 134(4): 669 - 679.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
L. Schaheen, G. Patton, and H. Fares
Suppression of the cup-5 mucolipidosis type IV-related lysosomal dysfunction by the inactivation of an ABC transporter in C. elegans
Development, October 1, 2006; 133(19): 3939 - 3948.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
D. M. Raizen, K. M. Cullison, A. I. Pack, and M. V. Sundaram
A Novel Gain-of-Function Mutant of the Cyclic GMP-Dependent Protein Kinase egl-4 Affects Multiple Physiological Processes in Caenorhabditis elegans
Genetics, May 1, 2006; 173(1): 177 - 187.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. A. Chesney, A. R. Kidd III, and J. Kimble
gon-14 Functions With Class B and Class C Synthetic Multivulva Genes to Control Larval Growth in Caenorhabditis elegans
Genetics, February 1, 2006; 172(2): 915 - 928.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
H. Takeshita and H. Sawa
Asymmetric cortical and nuclear localizations of WRM-1/{beta}-catenin during asymmetric cell division in C. elegans
Genes & Dev., August 1, 2005; 19(15): 1743 - 1748.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
A. Yoda, H. Kouike, H. Okano, and H. Sawa
Components of the transcriptional Mediator complex are required for asymmetric cell division in C. elegans
Development, April 15, 2005; 132(8): 1885 - 1893.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
L. D. Mathies, M. Schvarzstein, K. M. Morphy, R. Blelloch, A. M. Spence, and J. Kimble
TRA-1/GLI controls development of somatic gonadal precursors in C. elegans
Development, September 1, 2004; 131(17): 4333 - 4343.
[Abstract] [Full Text] [PDF]