eat-2 and eat-18 Are Required for Nicotinic Neurotransmission in the Caenorhabditis elegans Pharynx

Corresponding author: James P. McKay, University of Texas Southwestern Medical Center, 6000 Harry Hines Blvd., Dallas, TX 75390-9148., jim{at}eatworms.swmed.edu (E-mail)

Communicating editor: P. ANDERSON

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Mutations in eat-2 and eat-18 cause the same defect in C. elegans feeding behavior: the pharynx is unable to pump rapidly in the presence of food. EAT-2 is a nicotinic acetylcholine receptor subunit that functions in the pharyngeal muscle. It is localized to the synapse between pharyngeal muscle and the main pharyngeal excitatory motor neuron MC, and it is required for MC stimulation of pharyngeal muscle. eat-18 encodes a small protein that has no homology to previously characterized proteins. It has a single transmembrane domain and a short extracellular region. Allele-specific genetic interactions between eat-2 and eat-18 suggest that EAT-18 interacts physically with the EAT-2 receptor. While eat-2 appears to be required specifically for MC neurotransmission, eat-18 also appears to be required for the function of other nicotinic receptors in the pharynx. In eat-18 mutants, the gross localization of EAT-2 at the MC synapse is normal, suggesting that it is not required for trafficking. These data indicate that eat-18 could be a novel component of the pharyngeal nicotinic receptor.

THE Caenorhabditis elegans pharynx is a self-contained neuromuscular pump that is the feeding organ of the worm (Fig 1). Feeding consists of rapid cycles of contraction and relaxation, or pumping, of the pharyngeal muscle. The pumping action of the pharynx brings food into the worm, grinds it up, and transports it to the intestine. The pharynx in wild-type worms is capable of two pumping rates, depending on environmental conditions: in the absence of food, the pharynx pumps about once each second; in the presence of food, the pumping rate increases to about four pumps every second.

View larger version (66K): In this window In a new window Download PPT slide   Figure 1. The C. elegans pharynx is a neuromuscular pump used for feeding. The corpus brings food into the worm and concentrates it. The isthmus transports the food to the terminal bulb where it is ground up and then moved into the intestine. MC is the main excitatory motorneuron of the pharynx. It makes synapses with the pharyngeal muscle near the junction of the corpus and isthmus and is required for rapid pharyngeal pumping.

The excitatory pharyngeal motorneuron MC is responsible for rapid pumping (Fig 1; AVERY and HORVITZ 1989 ; RAIZEN et al. 1995 ). When MC is ablated with a laser, worms are incapable of rapid pumping regardless of the environmental conditions (AVERY and HORVITZ 1989 ). MC activity causes excitatory postsynaptic potentials (EPSPs) in the pharyngeal muscle that can be seen in electrical recordings of current flowing out of the worm's mouth (RAIZEN et al. 1995 ). During rapid pumping, every pharyngeal muscle action potential is preceded by an MC EPSP. Therefore, MC controls the rate of pharyngeal pumping.

To find genes involved in MC neurotransmission, RAIZEN et al. 1995 carried out a screen for mutants that were incapable of rapid pharyngeal pumping but had no other obvious defects. Mutations in two genes identified in that screen, eat-2 and eat-18, were characterized in detail. Mutations in both eat-2 and eat-18 lack MC neurotransmission. This observation is based on behavioral criteria: the mutants are incapable of rapid pumping and on electrophysiological criteria: there are no MC EPSPs. Fourteen recessive alleles of eat-2 were identified, and some of the alleles displayed complex intragenic complementation (RAIZEN et al. 1995 ). Two alleles of eat-18 were identified, one recessive and one semidominant. Interestingly, there is allele-specific genetic interaction between eat-2 and eat-18, indicating that the gene products might function together in the same protein complex (RAIZEN et al. 1995 ).

In this article we report the cloning of eat-2 and eat-18. We show that eat-2 encodes a non--nicotinic acetylcholine receptor subunit. EAT-2 functions postsynaptically in the pharyngeal muscle and is localized to the MC synapse. eat-18 encodes a small, transmembrane protein with no similarity to previously characterized proteins. The EAT-2 channel is correctly targeted to the MC synapse in eat-18 mutants, indicating that eat-18 is not required for trafficking of the receptor. Finally, using an -bungarotoxin (-BTX)-binding assay, we show that eat-18 affects most or all of the nicotinic receptors in the pharynx.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Worm culture:
Worms were grown at 20° using standard culture conditions (SULSTON and HODGKIN 1988 ) with slight modifications (AVERY 1993 ). The wild-type strain was N2. Worms were fed bacterial strain HB101 (BOYER and ROULLAND-DUSSIOX 1969 ).

YAC rescue:
Yeast containing yeast artificial chromosome (YAC) Y48B6A were grown overnight in selective media. QIAGEN (Chatsworth, CA) yeast genomic DNA prep kit was used to isolate genomic DNA following the manufacturer's instructions. Yeast genomic DNA was injected into eat-2(ad465) at a concentration of 100 µg/ml with rol-6 DNA at a concentration of 10 µg/ml as a co-injection marker using standard injection technique (MELLO and FIRE 1995 ).

Sequencing:
We amplified eat-2 and eat-18 from mutant alleles and sequenced the PCR products. Mutations in eat-2 were ad451, G-to-A change at nucleotide 627 resulting in an E-to-K change at amino acid 92; ad453, C-to-T change at nucleotide 2395 resulting in a P-to-S change at amino acid 295; ad465, G-to-A change at nucleotide 673 resulting in a stop codon at amino acid 107; ad692, T-to-G change at nucleotide 811 resulting in an M-to-R change at amino acid 153; ad1093, a C-to-T change at nucleotide 774 resulting in a P-to-S change at amino acid 141; ad1113, C-to-T change at nucleotide 2482 resulting in an R-to-T change at amino acid 324; ad1114, C-to-T change at nucleotide 796 resulting in an S-to-L change at amino acid 148; ad1115, G-to-A change at nucleotide 2395 resulting in a P-to-S change at amino acid 295.

Mutations in eat-18 were ad1110, G-to-T change at nucleotide 46 of exon 1b resulting in a stop codon at amino acid 16; ad820sd, G-to-A change at nucleotide 179 of exon 1b resulting in a G-to-E at amino acid 60. nu209 deletes nucleotides 1523–1965 of the Y105E8A.7 coding region.

eat-2 cDNA:
We obtained cDNA yk108h12, corresponding to Y48B6A.4, from Yuji Kohara. The sequence of yk108h12 is shown in Fig 2. The sequence confirms that the splicing pattern predicted by Genefinder and shown in Wormbase (release WS102) is correct.

View larger version (58K): In this window In a new window Download PPT slide   Figure 2. eat-2 cDNA sequence and predicted protein sequence. Horizontal bars below the sequence indicate transmembrane domains. Asterisks indicate nucleotides affected in eat-2 mutants. Resulting amino acid changes are indicated.

myo-2::eat-2 cDNA fusion:
PCR was used to amplify 1000 bp of DNA directly upstream from the myo-2 transcription start site. The sequence of the forward PCR primer for the myo-2 promoter was GGGTTTTGTGCTGTGGACG. The sequence of the reverse PCR primer was AATGCGATTTTCAAGGTCATTTCTGTGTCTGACGATCGA. The reverse primer contains 19 nucleotides just upstream of the ATG of myo-2 and the first 20 nucleotides of the open reading frame (ORF) of eat-2, including the ATG. The reverse complement of this primer was used as a forward primer to amplify the eat-2 cDNA using rtPCR. The reverse primer for the rtPCR reaction was CTGTTTATTCAATATCAACAATCGGAC. The two PCR products were fused using overlap extension PCR (HO et al. 1989 ) to create a fusion between the myo-2 promoter and the eat-2 cDNA. The fusion product was purified using a Qiaquick PCR purification kit and was injected into eat-2(ad465) at a concentration of 100 µg/ml with rol-6 as a co-injection marker. Two stable transgenic lines were isolated. The slow-pumping phenotype was rescued in all transgenic worms that were analyzed.

EAT-2::GFP fusion:
Green fluorescent protein (GFP) was inserted into the intracellular loop between the third and fourth transmembrane domains of eat-2 between leucine 377 and leucine 378. This was done by a three-part fusion reaction. PCR was used to amplify from 4 kb upstream of the eat-2 start site to nucleotide 2861 of the eat-2 coding region. The primers used in this reaction were CAAATCGGCAAACCGGCAAATACA and CAATCCCGGGGATCCTCTAAGCAACTTCGTGCCATCA. GFP was amplified from pPD95.77 from the 1995 Fire lab vector kit using primers GATGGCAACGAAGTTGCTTAGAGGATCCCCGGGATTG and TGGCTGATGTTGCTGGTTTTCAAGTTTGTATAGTTCATCCAT. The 3' end of eat-2 from nucleotide 2862 of the coding region to 400 bp downstream from the stop site was amplified using primers ATGGATGAACTATACAAACTTGAAAACCAGCAACATCAGCCA and CGTGGTGTGGTGTCAGACTG. GFP was fused to the 3' end of eat-2 by overlap extension PCR (HO et al. 1989 ). This fusion product was gel purified and fused to the 5' end of eat-2 by overlap extension PCR. The fusion construct was gel purified and injected into eat-2(ad465) at a concentration of 100 mg/ml with rol-6 as a co-injection marker.

eDf7 breakpoint identification:
To find the breakpoint of eDf7, we designed primers to the right of the eDf7 right breakpoint beginning in cosmid F47G4. We used these primers to amplify DNA from homozygous eDf7 embryos. We continued to design primers moving to the left, toward eat-18, until we found a pair that did not result in a PCR product, indicating that the left primer binding site was missing because of the deficiency. We determined that the right breakpoint was in cosmid zk270. We cut genomic DNA from CB2773 (eDf7/eDf3) with EcoRI, ligated it, and then amplified it with primers close to the breakpoint: zk270.51205 (CAATTATGGCATGTCTGACTC) and zk270.50999 (GTCCACCAAACTTTCCC). We next TA cloned the PCR product into pGEM-T (Promega, Madison, WI). Sequence analysis showed that the left breakpoint was in Y105E8A.7. The sequence of Y105E8A.7 at the left breakpoint of eDf7 is .......TTTTAGATCACAAAATCCGT. The sequence of the right breakpoint of eDf7 in zk270.1 is ACATTGCAATTTCGTG......... The novel junction of eDf7 is ....ATCCGTacattgc.... where the uppercase letter sequence is from Y105E8A.7 and the lowercase letter sequence is from zk270.1.

5' RACE:
RNA was isolated from wild-type worms using RNA Stat-60 (Tel-Test B, Friendswood, TX). We used a 5'/3' rapid amplification of cDNA ends (RACE) kit from Roche according to the manufacturer's instructions. Gene-specific race primers from Y105E8A.7 were r2 (TCGGACCGTCGAATATCGT) and r3 (GTAGGTTGGTGAGTAGAGGGTT). By our analysis, exon 1b begins at nucleotide 1625 of the Y105E8A.7 genomic sequence and ends at nucleotide 1821.

eat-18 Northern blot:
RNA was isolated from wild-type worms using Trizol (Invitrogen, San Diego). Poly(A)⁺ RNA was purified using RNAeasy mini kit (QIAGEN). A total of 10 µg of poly(A)⁺ RNA was run on a 1% agarose formaldehyde gel. The RNA was transferred to a nylon membrane by capillary action. The blot was probed with ³²P-labeled probe corresponding to exon 1b of Y105E8A.7.

eat-18 promoter::eat-18cDNA fusion:
The eat-18 promoter::eat-18cDNA fusion was made by overlap extension PCR. One kilobase of genomic DNA upstream of the start site of exon 1b was amplified using primers ATGGAAGAAGGGCATTTTGAG and TCAAAACTAGCAAACAGGCAATGA. RT-PCR was used to amplify a cDNA consisting of exons 1b, 2, and 3 using primers GTCATTGCCTGTTTGCTAGTTTTG and TCGGACCGTCGAATATCGT. The PCR products were gel purified using a Qiaquick gel extraction kit from QIAGEN and fused using overlap extension PCR (HO et al. 1989 ). Two independent transgenic lines were obtained. All transgenic worms that were analyzed had a wild-type pumping rate.

eat-18::GFP fusion:
The eat-18::GFP fusion was made by fusing GFP to exon 1b at nucleotide 1762 of Y105E8A.7. One kilobase of sequence upstream of the ATG of exon 1b was used as a promoter. The forward primer for the eat-18 promoter was CCGACTATATCCGACTCACCTC. The reverse primer located in exon 1b was CAATCCCGGGGATCCTCTAGCAAACAGGCAATGACAATAC. GFP, including 3' untranslated region from unc-54, was amplified from promoterless GFP vector pPD95.75 from the 1995 Fire lab vector kit (FIRE et al. 1990 ). The forward primer was CTATTGTCATTGCCTGTTTGCTAGAGGATCCCCGGGATTG and the reverse primer was CAAACCCAAACCTTCTTCCGATC. The PCR products were gel purified using a Qiaquick gel extraction kit and fused using overlap extension PCR (HO et al. 1989 ). The fusion product was injected into N2 worms at a concentration of 100 µg/ml with rol-6 as a marker.

eat-2::GFP in eat-18(ad1110):
eat-2(ad465) carrying the EAT-2::GFP transgene was crossed to eat-18(ad1110) males. Nonrescued transgenic F₂ progeny were singled. Complementation tests with eat-2(ad465) and eat-18(ad1110) were used to confirm that the genetic background was eat-18(ad1110).

-Bungarotoxin-binding assay:
For staining of cell-surface-exposed nicotinic acetylcholine receptors, rhodamine-labeled -bungarotoxin (Molecular Probes, Eugene, OR) was diluted to 1:200 in 1x injection buffer (20 mM K₃PO₄, 3 mM K citrate, 2% polyethylene glycol 6000, pH 7.5). This solution was injected into the pseudocoelom of young adult animals, which were mounted on dry agarose pads under halocarbon oil. To achieve consistent concentration of bungarotoxin from animal to animal, solution was injected until a few eggs were pushed out. Assuming that this is induced once a certain internal pressure is reached, roughly the same relative amount of bungarotoxin solution was injected. Animals were retrieved from the pads with M9 solution, transferred to nematode growth medium plates for 6 hr (which allowed the coelomocytes to take up excess bungarotoxin from the pseudocoelomic fluid), and subsequently analyzed by fluorescence microscopy.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

eat-2 encodes a nicotinic receptor subunit:
eat-2 maps to the right arm of chromosome II, to the left of unc-52 (RAIZEN et al. 1995 ). Previous work from our lab indicated that the MC neurotransmitter is acetylcholine and that it works by stimulating a nicotinic acetylcholine receptor (AVERY and HORVITZ 1990 ; RAIZEN et al. 1995 ). Therefore we searched this region of chromosome II for genes that were likely to be involved in nicotinic neurotransmission. One of the genes in this region is a nicotinic acetylcholine receptor subunit encoded by Y48B6A.4. When we injected the YAC clone Y48B6A (containing Y48B6A.4) into the eat-2 mutant ad465, we found that the slow-pumping phenotype was rescued. To determine if Y48B6A.4 was responsible for rescuing the eat-2 mutant, we used PCR to amplify genomic DNA that contained the nicotinic receptor coding region, plus 4 kb of upstream sequence and 500 bp of downstream sequence. We injected this PCR fragment into eat-2(ad465) and found that the slow-pumping phenotype was rescued in all transgenic animals. We then sequenced Y48B6A.4 from eat-2(ad465) and found an adenine-to-guanine change at nucleotide 673 (Fig 2). This change causes an early stop codon in the second exon that would result in the production of only the first 106 amino acids of the protein and it is unlikely that this truncated protein would have any activity. We therefore conclude that Y48B6A.4 is eat-2 and that the reference allele ad465 is a null allele.

EAT-2 protein:
eat-2 encodes a nicotinic acetylcholine receptor subunit with a predicted size of 474 amino acids (Fig 2). It has all the characteristics of a ligand-gated ion channel subunit: a large extracellular amino terminus containing a C loop (C128–C142), four transmembrane domains, and a large intracellular loop between the third and fourth transmembrane domains (CHANGEAUX and EDELSTEIN 1998 ). There are two broad categories of nicotinic receptor subunits, and non-. -subunits are characterized by a pair of adjacent cysteines in the amino-terminal extracellular portion of the protein near amino acid position 190 (CHANGEAUX and EDELSTEIN 1998 ). The adjacent cysteines are connected by a strained disulfide bond and contribute to the acetylcholine-binding site (SINE 2002 ). Non--subunits lack the pair of adjacent cysteines (CHANGEAUX and EDELSTEIN 1998 ). Because eat-2 lacks the adjacent cysteines, it is a non--nicotinic receptor subunit.

eat-2 functions in pharyngeal muscle:
Previously, we showed that eat-2 mutants are defective in MC neurotransmission (RAIZEN et al. 1995 ). eat-2 could function either presynaptically in MC or postsynaptically in the pharyngeal muscle. If eat-2 functions postsynaptically, we should be able to rescue eat-2 mutants by expressing the channel subunit specifically in the muscle. To test this, we fused a full-length eat-2 cDNA to the pharyngeal muscle-specific myo-2 promoter (OKKEMA et al. 1993 ) and injected eat-2 mutant worms with the fusion product. We found that in eat-2 mutants containing the fusion construct, the slow-pumping phenotype was rescued. This result demonstrates that eat-2 functions postsynaptically in the pharyngeal muscle.

EAT-2 is localized to the MC synapse:
To analyze the subcellular localization of EAT-2, we made a translational GFP fusion in which GFP is inserted in frame into the intracellular loop between the third and fourth transmembrane domains (Fig 3). We injected this GFP fusion into eat-2(ad465) and found that transgenic worms carrying the GFP fusion had wild-type pumping rates, showing that it is able to provide wild-type eat-2 activity. We examined the transgenic worms by fluorescence microscopy and observed that the EAT-2::GFP fusion protein is localized to small dots near the junction of pharyngeal muscles pm4 and pm5 (Fig 3). On the basis of electron microscope reconstruction of the C. elegans pharynx, this is the location of the most-posterior MC processes and of the MC synapse (ALBERTSON and THOMSON 1976 ; data not shown). This localization, combined with the observation that EAT-2 functions in pharyngeal muscle, is consistent with eat-2 being the postsynaptic receptor for the MC motor neuron.

View larger version (66K): In this window In a new window Download PPT slide   Figure 3. Localization of an EAT-2::GFP fusion. GFP was inserted into the intracellular loop between transmembrane segments 3 and 4. This GFP fusion rescues the slow-pumping defect of eat-2(ad465). The GFP fusion is localized at the MC synapse (arrows).

Cloning eat-18:
eat-18 maps to the right arm of chromosome I, left of unc-54, and was found to interact genetically with the breakpoint of deficiency eDf7: eDf7 fails to complement eat-18(ad820sd) but does complement eat-18(ad1110) (RAIZEN et al. 1995 ). These results suggested that the eDf7 breakpoint was close to or in eat-18. We cloned the left breakpoint of eDf7 and found that it is in the gene Y105E8A.7 (Fig 4A). To determine if Y105E8A.7 is eat-18, we used PCR to amplify DNA containing the coding region of this gene, 1 kb of upstream sequence and 200 bp of sequence downstream of the stop codon. We injected the PCR product into eat-18(ad1110) and found that it rescued the slow-pumping phenotype in all transgenic animals that were analyzed (two transgenic lines were established).

View larger version (12K): In this window In a new window Download PPT slide   Figure 4. (A) The eat-18 coding region. eat-18 is encoded by Y105E8A.7. The left breakpoint of eDf7 is in the middle of Y105E8A.7 and removes the 3' end of the gene. The deficiency is represented by the horizontal bar below eDf7 and the left breakpoint is represented by the vertical bar. The eat-18 transcript consists of the splice variant that includes exon 1b. Mutations in the three eat-18 alleles affect exon 1b: ad1110 introduces an early stop codon in exon 1b, ad820sd changes a glutamate to a glycine at amino acid 60, and nu209 deletes exon 1b. (B) Genomic fragments containing parts of the eat-18 coding region were generated by PCR. They are represented by horizontal black bars and are aligned with the coding region in A. The left end of the first three fragments is 731 bp downstream of the ATG of exon 1a. The right ends are at base pairs 4170, 3188, and 2782, respectively. The last PCR fragment begins 1.7 kb downstream of the exon 1a ATG and ends at base pair 4170. The PCR products were injected along with rol-6 as an injection marker. At least two transgenic lines were established for each fragment. Rescuing fragments restored pumping rates to wild-type levels in all transgenic animals analyzed. The smallest rescuing fragment begins at position 731 and ends at 3188.

Despite the fact that about half of the gene is missing from the eDf7 chromosome, it is able to complement eat-18(ad1110). Because of this observation, we wanted to determine what part of the gene is required for eat-18 activity. Using PCR, we generated a series of genomic clones that contained deletions at the 5' or 3' end of Y105E8A.7 (Fig 4B). We injected the PCR products into eat-18(ad1110) to see which ones could rescue the slow-pumping phenotype. The smallest rescuing piece begins 731 bp downstream of the ATG of Y105E8A.7 and includes DNA to 3188 bp downstream from the start codon (Fig 4B). This 2458-bp fragment rescued the slow-pumping phenotype of eat-18(ad1110) in all transgenic animals that were analyzed. This result is consistent with the observation that the eDf7 chromosome is able to complement eat-18(ad1110) and indicates that only a portion of the 5' end of Y105E8A.7 is needed for eat-18 activity.

The rescuing fragment does not contain the first exon of Y105E8A.7, suggesting that there might be one or more additional exons in the intron between the first two exons. We used 5' RACE to identify any additional exons that might be present. This analysis revealed an additional exon that begins 1625 bp downstream from the predicted start codon of Y105E8A.7 (Fig 4A). There is an ATG at the beginning of this exon and there are no good splice sites at the 5' end of this exon. We believe that this is an alternative first exon for Y105E8A.7 and that it is required for eat-18 activity. We refer to the upstream first exon as exon 1a and to the downstream first exon as exon 1b (Fig 4A). Analysis of RT-PCR products from Y105E8A.7 shows that transcripts are produced using either of the alternative first exons.

We sequenced cDNAs isolated from transcripts that use the alternative first exon 1b. When a transcript is made using this exon, a stop codon is generated in the second exon, resulting in an open reading frame that would produce a 70-amino-acid protein. Translation initiation from exon 1b is in a different frame from exon 1a, resulting in the stop codon in the second exon. To determine if this small open reading frame was eat-18, we fused a cDNA composed of exons 1b, 2, and 3 to 1 kb of genomic sequence upstream of exon 1b (Fig 4). We injected this fusion product into eat-18(ad1110) and found that it rescued the slow-pumping defect. All transgenic animals from two independent lines analyzed were rescued. This shows that eat-18 is encoded by this open reading frame and that the genomic sequence just upstream of exon 1b is the eat-18 promoter. Sequence analysis of the predicted protein from this transcript suggests that it contains a 40-amino-acid intracellular domain at the amino-terminal end, a transmembrane domain, and a 10-amino-acid, carboxy-terminal, extra cellular domain and has no similarities to previously described proteins (Fig 5; SONNHAMMER et al. 1998 ).

View larger version (32K): In this window In a new window Download PPT slide   Figure 5. eat-18 cDNA and protein sequence. Eat-18 encodes a predicted 70-amino-acid protein with an intracellular amino terminus, a transmembrane domain, and a short extracellular carboxy-terminal end. The transmembrane domain is indicated by a bar above the sequence. Asterisks above the sequence indicate nucleotides affected in eat-18 mutants.

A Northern blot was performed to determine the size of the eat-18 transcript. A sequence corresponding to exon 1b was used to probe RNA isolated from wild-type worms. This probe hybridized to a transcript of 3 kb (Fig 6). This is the same size as the full-length cDNAs that we isolated by RT-PCR from Y105E8A.7. This result shows that the small eat-18 ORF is part of a larger transcript that comes from Y105E8A.7.

View larger version (33K): In this window In a new window Download PPT slide   Figure 6. Northern analysis of the eat-18 transcript. A probe corresponding to exon 1b hybridized to a transcript of 3 kb.

We have three mutant alleles of eat-18. Two, ad1110 and nu209, are recessive, and one, ad820sd, is semidominant (RAIZEN et al. 1995 ). We sequenced the coding region of Y105E8A.7 in all three mutant alleles. Mutations in all three affect exon 1b (Fig 4). ad1110 results in a stop codon early in the exon, at amino acid 16. ad820sd is a G-to-E change at amino acid 60, and nu209 is a deletion that removes exon 1b. On the basis of the nature of the mutations, we conclude that ad1110 and nu209 are both null alleles. The fact that all three mutant alleles affect exon 1b is consistent with eat-18 activity being contained in the 5' end of the gene.

EAT-18 is expressed in pharyngeal muscle:
To determine where eat-18 is expressed, we fused GFP in frame to exon 1b and injected the fusion product into wild-type worms. We examined the transgenic worms and observed GFP expression in pharyngeal muscle and pharyngeal neuron M5 (Fig 7). There is also very faint GFP expression in five to six unidentified neurons in the extrapharyngeal nervous system (not shown). The expression pattern of EAT-18::GFP supports the conclusion that the pharyngeal muscle is the main site of eat-18 function.

View larger version (41K): In this window In a new window Download PPT slide   Figure 7. eat-18 is expressed in pharyngeal muscle. (A) A bright-field image of the pharynx. (B) Fluorescent image of the pharynx. The EAT-18::GFP fusion protein is expressed in pharyngeal muscle and pharyngeal neuron M5. Fluorescence posterior to the pharynx is auto-fluorescence from the intestine.

EAT-2 is correctly localized in eat-18 mutants:
One possible role for eat-18 is that it is required for folding or trafficking of the nicotinic receptor. To test this, we introduced the functional EAT-2::GFP fusion into eat-18(ad1110). We examined the transgenic worms and found that the EAT-2::GFP fusion is correctly localized in eat-18 mutants (Fig 8). This result indicates that eat-18 is not required for folding or trafficking of the EAT-2 channel.

View larger version (135K): In this window In a new window Download PPT slide   Figure 8. EAT-2::GFP is correctly localized in eat-18(ad1110). The functional EAT-2::GFP fusion was crossed into the eat-18(ad1110) mutant background. (Top) A differential interference contrast image of a worm pharynx. Arrow points to the location of the MC synapse. (Bottom) A fluorescence image showing the localization of the fusion protein at the MC synapse (arrow).

eat-18 is required for -bungarotoxin-binding in the pharynx:
RAIZEN et al. 1995 reported that eat-2 and eat-18 mutants differ significantly in their response to nicotine. Pharynxes that have been dissected from either wild-type or eat-2 mutant worms hypercontract in 100 µM nicotine. Pharynxes from eat-18 mutants, however, are resistant to this concentration of nicotine. A possible explanation for this result is that eat18 is required for the function of other nicotinic receptors in the pharynx in addition to eat-2. We used an -BTX-binding assay to look at the expression of nicotinic receptors throughout the pharynx. -BTX is a competitive inhibitor of nicotinic acetylcholine receptors and, when bound to the receptor, occupies part of the acetylcholine-binding site (SAMSON et al. 2002 ). Fluorescently labeled -bungarotoxin injected into the pseudocoelom of C. elegans binds to nicotinic receptors throughout the body. The location of the receptors can be seen by using fluorescence microscopy. In wild-type worms, there is extensive labeling of the pharynx (Fig 8). When -BTX was injected into two alleles of eat-2, ad453 and ad1113, there was extensive labeling of the pharynx similar to wild type (Fig 9). However, when -BTX was injected into eat-18(ad1110) mutants, staining of the pharynx was almost completely abolished (Fig 9). -Bungarotoxin still labeled eat-18(ad1110) worms outside the pharynx, suggesting that eat-18 is required for -bungarotoxin-binding to most or all pharyngeal nicotinic receptors.

View larger version (115K): In this window In a new window Download PPT slide   Figure 9. -Bungarotoxin-binding assay. Fluorescently labeled -bungarotoxin injected into the body cavity of worms binds to many sites in the pharynx of (A) wild-type worms and (C) eat-2(ad1113) and (B) eat-2(ad453) mutant worms. (D) -Bungarotoxin-binding sites are absent in the pharynx in eat-18(ad1110) mutants. Arrows point to staining in the pharynx and arrowheads point to staining outside the pharynx.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

MC mechanism:
Previous work in our lab led to the proposal that the MC neurotransmitter is acetylcholine (AVERY and HORVITZ 1990 ; RAIZEN et al. 1995 ). This is supported by the finding that eat-2 encodes a nicotinic acetylcholine receptor subunit. The observation that EAT-2 functions in the pharyngeal muscle demonstrates that MC stimulates the muscle directly, using fast synaptic transmission to control pharyngeal pumping rate. Stimulation by MC causes the EAT-2 channel to open, allowing current to flow in. This leads to the opening of a voltage-activated calcium channel and subsequent muscle contraction (LEE et al. 1997 ). The rate of MC firing controls the rate of pharyngeal pumping.

The role of eat-18 in nicotinic neurotransmission:
Mutations in eat-18 cause the same defect in pumping as mutations in eat-2: worms are incapable of rapid pharyngeal pumping and EPSPs from the excitatory motor neuron MC are not present (RAIZEN et al. 1995 ). eat-18 encodes a small transmembrane protein that does not have any similarity to previously described proteins, including proteins known to be involved in the function of nicotinic acetylcholine receptors. Several lines of evidence suggest that eat-18 could be a component of the pharyngeal nicotinic receptor. First, an eat-18::GFP fusion is expressed in pharyngeal muscle, suggesting that this may be the site of eat-18 activity. Also, we showed previously that pharynxes dissected from eat-18 mutants were resistant to bath-applied nicotine, indicating that nicotinic receptors in the pharyngeal muscle are defective (RAIZEN et al. 1995 ). We have observed allele-specific genetic interactions between eat-2 and eat-18, indicating that they could be members of the same protein complex. Worms heterozygous for the semidominant eat-18 mutant ad820sd have an intermediate slow-pumping phenotype of 90 pumps/min. Wild-type worms pump >200 times/min and worms completely defective in MC neurotransmission pump at 40 pumps/min. Worms that are trans-heterozygous for eat-18(ad820sd) and two alleles of eat-2, ad453 and ad1115, have a wild-type pumping rate. In this case, the eat-2 mutants are able to suppress the intermediate slow-pumping phenotype of eat-18(ad820). Another eat-2 allele, eat-2(ad1113), when trans-heterozygous with eat-18(ad820sd), enhances the intermediate slow-pumping phenotype. One interpretation of these allele-specific genetic interactions is that EAT-2 and EAT-18 physically interact. A functional EAT-2::GFP fusion appears to be correctly localized in eat-18 mutants, indicating that it is not required for trafficking of EAT-2. Taken together, these data indicate that EAT-18 could be a component of pharyngeal nicotinic receptor. This interpretation is supported by results from the -bungarotoxin-binding experiment. -Bungarotoxin is a competitive inhibitor of acetylcholine and has been shown to occupy the acetylcholine-binding site of nicotinic receptors (SAMSON et al. 2002 ). We found that -bungarotoxin bound to several sites on pharynxes from wild-type worms or eat-2 mutants, but its binding was greatly reduced in pharynxes from eat-18(ad1110) mutants. A possible reason for the lack of acetylcholine binding to eat-18 mutant pharynxes is that EAT-18 is required for the formation of the acetylcholine-binding site. This would also be consistent with the inability of MC to cause excitatory postsynaptic potentials in eat-18 mutants.

There are alternative possibilities for the role of eat-18 in the function of the nicotinic receptor. One alternative is that eat-18 could be required for inserting the nicotinic receptor into the postsynaptic membrane. In this model, the nicotinic receptor would be targeted correctly to the location of the synapse, but it would remain in a subsynaptic pool of receptors. The role of eat-18 could be to move the receptor from the subsynaptic pool and insert it into the postsynaptic membrane. This model is consistent with the apparent proper localization of the EAT-2::GFP fusion in eat-18 mutant worms. The resolution of the light microscope could not distinguish between receptors in the subsynaptic pool and those that had been inserted into the membrane. This model would also explain the inability of MC to activate the receptor: acetylchololine released by MC would not have access to receptors in the subsynaptic pool. Ultrastructural analysis of the MC synapse would be required to determine the exact location of EAT-2 in wild-type and eat-18 mutant worms.

eDf7 chromosome:
The eDf7 chromosome was an important tool in cloning eat-18. It is interesting that eDf7 complements eat-18(ad1110) but does not complement eat-18(ad820sd) although the deficiency breakpoint does not overlap the ad820sd lesion. We think several things are responsible for this. Although eat-18 is encoded by a small ORF, it is part of a large transcript. The 3' half of the transcript is removed by eDf7. We think that this reduces the amount of EAT-18 protein that is made because the shortened transcript from the deficiency chromosome is likely to be less stable than the full-length wild-type transcript. The decreased eat-18 expression from the deficiency chromosome is still enough to supply wild-type levels of eat-18 activity in the presence of the recessive allele ad1110. The semidominant allele, ad820sd, behaves like a dominant negative mutation (RAIZEN et al. 1995 ). If eat-18 expression from the eDf7 chromosome is reduced, there might not be enough activity to overcome the dominant negative effect of ad820sd, resulting in the slow-pumping phenotype.

Other genes required for ion channel function in C. elegans:
RIC-3 and MEC-6 are two other proteins involved in ion channel function that have recently been identified through genetic screens in C. elegans. ric-3 was identified in a screen for worms that are resistant to cholinesterase inhibitors and in a screen for suppressors of a dominant mutation in the nicotinic acetylcholine receptor subunit DEG-3 (HALEVI et al. 2002 ). ric-3 encodes a small protein with two transmembrane domains that localizes to the cell body of neurons and muscles. ric-3 appears to be required for receptor assembly or trafficking and affects the function of several nicotinic acetylcholine receptors in C. elegans, including eat-2 (HALEVI et al. 2002 ). Although EAT-18 is also a small transmembrane protein, in contrast to RIC-3, it appears to be required for formation of the acetylcholine-binding site. Additionally, although ric-3 is involved in nicotinic neurotransmission in several cell types, eat-18 appears to be specifically required for pharyngeal nicotinic acetylcholine receptors. MEC-6 is a single pass transmembrane domain protein required for the maturation or function of the degenerin/epithelial sodium channels (DEG/ENaC) in C. elegans (CHELUR et al. 2002 ). CHELUR et al. 2002 used biochemical methods to show that MEC-6 interacts with several DEG/ENaC in C. elegans and that coexpression of MEC-6 with the DEG/ENaC channels greatly increases current flow through them. Biochemical and electrophysiological experiments will be needed to further define the role that eat-18 plays in regulating pharyngeal nicotinic receptors.

	FOOTNOTES

Sequence data from this article have been deposited with the EMBL/GenBank Data Libaries under accession nos. 17537184 (eat-2) and 25145442 (eat-18).

	ACKNOWLEDGMENTS

We thank Renee McKay and members of the Avery lab for comments on the manuscript. We thank Tim Niacaris and Wayne Davis for technical help. Josh Kaplan provided eat-18(nu209). YAC clones were obtained from Alan Coulson at the Sanger Center. Yuji Kohara provided the eat-2 cDNA. J.P.M. was supported by National Institutes of Health training grant 5-T32-HL07360-24. J.P.M. and L.A. were supported by National Public Health Service grant HL46154 to L.A.

Manuscript received January 23, 2003; Accepted for publication October 1, 2003.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ALBERTSON, D. G. and J. M. THOMSON, 1976  The pharynx of Caenorhabditis elegans. Philos. Trans. R. Soc. Lond. Ser. B 275:299-325.[Medline]

AVERY, L., 1993  The genetics of feeding in Caenorhabditis elegans. Genetics 133:897-917.[Abstract]

AVERY, L. and H. R. HORVITZ, 1989  Pharyngeal pumping continues after laser killing of the pharyngeal nervous system of C. elegans.. Neuron 3:473-485.[CrossRef][Medline]

AVERY, L. and H. R. HORVITZ, 1990  Effects of starvation and neuroactive drugs on feeding in Caenorhabditis elegans.. J. Exp. Zool. 253:263-270.[CrossRef][Medline]

BOYER, H. W. and D. ROULLAND-DUSSIOX, 1969  A complementation analysis of the restriction modification of DNA in Escherichia coli.. J. Mol. Biol. 41:459-472.[CrossRef][Medline]

CHANGEAUX, J. P. and S. J. EDELSTEIN, 1998  Allosteric receptors after 30 years. Neuron 21:959-980.[CrossRef][Medline]

CHELUR, D. S., G. G. ERNSTROM, M. B. GOODMAN, C. A. YAO, and L. CHEN et al., 2002  The mechanosensory protein MEC-6 is a subunit of the C. elegans touch-cell degenerin channel. Nature 420:669-673.[CrossRef][Medline]

FIRE, A., S. W. HARRISON, and D. DIXON, 1990  A modular set of LacZ fusion vectors for studying gene expression in Caenorhabditis elegans. Gene 93:189-198.[CrossRef][Medline]

HALEVI, S., J. MCKAY, M. PALFREYMAN, L. YASSIN, and M. ESHEL et al., 2002  The C. elegans ric-3 gene is required for maturation of nicotinic acetylcholine receptors. The EMBO J. 21:1012-1020.[CrossRef][Medline]

HO, S., H. HUNT, R. HORTON, J. PULLEN, and L. PEASE, 1989  Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Genetics 77:51-59.

LEE, R. Y., L. LOBEL, M. HENGARTNER, H. R. HORVITZ, and L. AVERY, 1997  Mutations in the alpha1 subunit of an L-type voltage-activated calcium channel cause myotonia in C. elegans.. The EMBO J. 16:6066-6076.[CrossRef][Medline]

MELLO, C., and A. FIRE, 1995 DNA Transformation. Academic Press, San Diego.

OKKEMA, P. G., S. W. HARRISON, V. PLUNGER, A. ARYANA, and A. FIRE, 1993  Sequence requirements for myosin gene-expression and regulation in Caenorhabditis elegans. Genetics 135:385-404.[Abstract]

RAIZEN, D. M., R. Y. LEE, and L. AVERY, 1995  Interacting genes required for pharyngeal excitation by motor neuron MC in Caenorhabditis elegans. Genetics 141:1365-1382.[Abstract]

SAMSON, A. O., T. SCHERF, M. EISENSTEIN, J. H. CHILL, and J. ANGLISTER, 2002  The mechanism for acetylcholine receptor inhibition by alpha-neurotoxins and species-specific resistance to alpha-bungarotoxin revealed by NMR. Neuron 35:319-332.[CrossRef][Medline]

SINE, S. M., 2002  The nicotinic receptor ligand binding domain. J. Neurobiol. 53:431-446.[CrossRef][Medline]

SONNHAMMER, E., G. VON HEIJNE, and A. KROGH, 1998  A hidden Markov model for predicting transmembrane helices in protein sequences. Proc. Int. Conf. Intell. Syst. Mol. Biol. 6:175-182.[Medline]

SULSTON, J. E., and J. A. HODGKIN, 1988 Methods, pp. 587–606 in The Nematode Caenorhabditis elegans, edited by E. B. WOOD. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

This article has been cited by other articles:

				G. McColl, D. W. Killilea, A. E. Hubbard, M. C. Vantipalli, S. Melov, and G. J. Lithgow Pharmacogenetic Analysis of Lithium-induced Delayed Aging in Caenorhabditis elegans J. Biol. Chem., January 4, 2008; 283(1): 350 - 357. [Abstract] [Full Text] [PDF]

				A.-F. Ruaud and J.-L. Bessereau Activation of nicotinic receptors uncouples a developmental timer from the molting timer in C. elegans Development, June 1, 2006; 133(11): 2211 - 2222. [Abstract] [Full Text] [PDF]

				J.-T. A. Chiang, M. Steciuk, B. Shtonda, and L. Avery Evolution of pharyngeal behaviors and neuronal functions in free-living soil nematodes J. Exp. Biol., May 15, 2006; 209(10): 1859 - 1873. [Abstract] [Full Text] [PDF]

				Y. Zheng, P. J. Brockie, J. E. Mellem, D. M. Madsen, C. S. Walker, M. M. Francis, and A. V. Maricq SOL-1 is an auxiliary subunit that modulates the gating of GLR-1 glutamate receptors in Caenorhabditis elegans PNAS, January 24, 2006; 103(4): 1100 - 1105. [Abstract] [Full Text] [PDF]

				T. R. Gruninger, D. G. Gualberto, B. LeBoeuf, and L. R. Garcia Integration of Male Mating and Feeding Behaviors in Caenorhabditis elegans J. Neurosci., January 4, 2006; 26(1): 169 - 179. [Abstract] [Full Text] [PDF]

				B. B. Shtonda and L. Avery Dietary choice behavior in Caenorhabditis elegans J. Exp. Biol., January 1, 2006; 209(1): 89 - 102. [Abstract] [Full Text] [PDF]

				B. Shtonda and L. Avery CCA-1, EGL-19 and EXP-2 currents shape action potentials in the Caenorhabditis elegans pharynx J. Exp. Biol., June 1, 2005; 208(11): 2177 - 2190. [Abstract] [Full Text] [PDF]

				K. Evason, C. Huang, I. Yamben, D. F. Covey, and K. Kornfeld Anticonvulsant Medications Extend Worm Life-Span Science, January 14, 2005; 307(5707): 258 - 262. [Abstract] [Full Text] [PDF]

				K. A. Steger and L. Avery The GAR-3 Muscarinic Receptor Cooperates With Calcium Signals to Regulate Muscle Contraction in the Caenorhabditis elegans Pharynx Genetics, June 1, 2004; 167(2): 633 - 643. [Abstract] [Full Text] [PDF]