The Drosophila melanogaster importin 3 Locus Encodes an Essential Gene Required for the Development of Both Larval and Adult Tissues

Corresponding author: David S. Goldfarb, University of Rochester, Rochester, NY 14627., dasg{at}mail.rochester.edu (E-mail)

Communicating editor: K. ANDERSON

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

The nuclear transport of classical nuclear localization signal (cNLS)-containing proteins is mediated by the cNLS receptor importin . The conventional importin gene family in metazoan animals is composed of three clades that are conserved between flies and mammals and are referred to here as 1, 2, and 3. In contrast, plants and fungi contain only 1 genes. In this study we report that Drosophila importin 3 is required for the development of both larval and adult tissues. Importin 3 mutant flies die around the transition from first to second instar larvae, and homozygous importin 3 mutant eyes are defective. The transition to second instar larvae was rescued with importin 1, 2, or 3 transgenes, indicating that Importin 3 is normally required at this stage for an activity shared by all three importin 's. In contrast, an 3-specific biochemical activity(s) of Importin 3 is probably required for development to adults and photoreceptor cell development, since only an importin 3 transgene rescued these processes. These results are consistent with the view that the importin 's have both overlapping and distinct functions and that their role in animal development involves the spatial and temporal control of their expression.

MOST proteins targeted to the nucleus contain nuclear localization signals (NLSs) that are recognized by soluble receptors called karyopherins (MACARA 2001 ; BEDNENKO et al. 2003 ; WEIS 2003 ). Proteins containing classical NLSs (cNLSs) are imported bound to the importin /ß1 heterodimer. Importin serves as an adapter that links cNLS cargo to the karyopherin importin ß1, which ferries the complex through the nuclear pore complex (MACARA 2001 ; BEDNENKO et al. 2003 ; WEIS 2003 ).

The genomes of metazoan organisms encode multiple importin genes. For example, the human genome encodes six importin 's (KOHLER et al. 2002 ; CABOT and PRATHER 2003 ). Phylogenetic analyses of the importin gene family revealed that most importin 's belong to one of three evolutionarily conserved clades, designated by our nomenclature as conventional 1's, 2's, and 3's (KOHLER et al. 1997 , KOHLER et al. 1999 ; MALIK et al. 1997 ; MATHE et al. 2000 ; MASON et al. 2002 ). Conventional importin 's from plants and fungi are all 1's. In contrast, metazoan animals, with the exception of Caenorhabditis elegans (GELES and ADAM 2001 ), contain representatives from each of the three groups. Parsimony arguments suggest that metazoan 2 and 3 genes arose from 1 progenitors in ancestral single-cell eukaryotic lineages.

Vertebrate importin 's show distinct tissue- and cell-type-specific expression patterns (PRIEVE et al. 1996 ; KOHLER et al. 1997 , KOHLER et al. 2002 ; TSUJI et al. 1997 ; NACHURY et al. 1998 ; KAMEI et al. 1999 ), and human importin paralogs are differentially regulated in quiescent and proliferating cultured cells and tissue differentiation models (KOHLER et al. 2002 ). In vitro binding assays and permeabilized cell transport assays indicate that 1's, 2's, and 3's have both overlapping and distinct sets of transport cargoes (MIYAMOTO et al. 1997 ; NADLER et al. 1997 ; SEKIMOTO et al. 1997 ; PRIEVE et al. 1998 ; KOHLER et al. 1999 , KOHLER et al. 2001 ; WELCH et al. 1999 ; KUMAR et al. 2000 ; NEMERGUT and MACARA 2000 ; TALCOTT and MOORE 2000 ; JIANG et al. 2001 ; GUILLEMAIN et al. 2002 ; MELEN et al. 2003 ). For example, a vertebrate 3 has unique specificity for RCC1 (KOHLER et al. 1999 ; NEMERGUT and MACARA 2000 ; TALCOTT and MOORE 2000 ), Ran BP3 (WELCH et al. 1999 ), interferon regulatory factor 3 (KUMAR et al. 2000 ), and adenoviral E1A (KOHLER et al. 2001 ). An 2 selectively bound the glucose transporter GLUT2 (GUILLEMAIN et al. 2002 ) and an 1 specifically transported STAT1 and STAT2 transcription factors (SEKIMOTO et al. 1997 ; MELEN et al. 2003 ). Importantly, the preference of importin 's for NLS cargo can be altered when two different substrates are presented together in permeabilized cell transport assays (KOHLER et al. 1999 ). This latter finding underscores the complexity of the functional interactions between importin 's and different NLS cargo and indicates that in vivo studies are needed to unravel the physiological roles of individual importin 's.

In vivo studies are consistent with the notion that the different importin 's play distinct roles in animal development. The RNAi-mediated disruption of an 3 paralog, but not an 2, had a severe effect on the development of porcine embryos (CABOT and PRATHER 2003 ). Likewise, RNAi-mediated reductions in the expression of different importin 's caused distinct developmental defects in C. elegans (GELES and ADAM 2001 ; ASKJAER et al. 2002 ; GELES et al. 2002 ). Specifically, the C. elegans 3 paralog ima-3 is required for meiosis in the developing female germline (GELES and ADAM 2001 ), while the nonconventional ima-2 is required for mitosis (GELES et al. 2002 ). Proper spindle formation requires ima-2 but not ima-3 (ASKJAER et al. 2002 ).

The Drosophila genome encodes four importin 's (KUSSEL and FRASCH 1995 ; TOROK et al. 1995 ; DOCKENDORFF et al. 1999 ; ADAMS et al. 2000 ; MATHE et al. 2000 ; GIARRE et al. 2002 ; MASON et al. 2002 ), three of which contain conserved Importin ß1 (GORLICH et al. 1996 ; WEIS et al. 1996 ) and cNLS-binding domains (CONTI et al. 1998 ; DOCKENDORFF et al. 1999 ). The fourth predicted Drosophila importin , cg14708 (ADAMS et al. 2000 ), is extremely divergent, has a weakly conserved IBB domain, and is missing the conserved tryptophan-asparagine array that is crucial for binding to cNLS cargo (CONTI et al. 1998 ).

The three conventional Drosophila importin paralogs have different developmental stage- and cell-type-specific expression patterns (KUSSEL and FRASCH 1995 ; TOROK et al. 1995 ; DOCKENDORFF et al. 1999 ; MATHE et al. 2000 ; FANG et al. 2001 ; GIARRE et al. 2002 ). In addition, 1 and 2, but not 3, accumulate in the nucleus at the onset of mitosis (KUSSEL and FRASCH 1995 ; TOROK et al. 1995 ; MATHE et al. 2000 ; GIARRE et al. 2002 ). Null 2 mutations result in defects in gametogenesis that cause incompletely penetrant male sterility and complete female sterility (GIARRE et al. 2002 ; GORJANACZ et al. 2002 ; MASON et al. 2002 ). The 2 activity essential for female fertility appears to be unique to 2 since it cannot be replaced by the ectopic expression of 1 or 3 transgenes. In contrast, male sterility was rescued to a similar extent by the expression of 1, 2, and 3 (MASON et al. 2002 ).

Drosophila Importin 3 has been identified as a binding partner of germ cell-less (DOCKENDORFF et al. 1999 ), DNA polymerase (MATHE et al. 2000 ), and heat-shock factor (HSF; FANG et al. 2001 ). Importin 3 mRNA and protein were not detected in early embryos, coincident with the restriction of HSF to the cytoplasm (FANG et al. 2001 ). Finally, defects in 3 nuclear export correlate with specific cell fate transformations in mechano-sensory organs observed in hypomorphic mutations in the importin recycling factor Dcas (TEKOTTE et al. 2002 ). In this study we describe the developmental defects associated with severe mutations in 3 and conclude that 3 is required for the development of both larval and adult tissues. Transgene rescue studies demonstrate that the requirement for 3 in larval development can be partially replaced by ectopic expression of 1 or 2. In contrast, only ectopic 3 expression can support development to adults. In the eye, 1, but not 2, can partially replace 3 in at least some cell types, but 3 appears to be uniquely required for the proper differentiation of photoreceptor cells.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Genetic stocks and markers:
Flies were kept on standard cornmeal-dextrose media and grown at 25° unless indicated otherwise. The importin 3¹/TM6C stock is described in MATHE et al. 2000 . The FRT82B, 3^17-7/TM3 {Kr-GFP}, Sb¹ and FRT82B, 3^w73/TM3 {Kr-GFP}, Sb¹ stocks were created and provided by Tory Herman and Larry Zipursky [University of California (UCLA), Los Angeles]. The 2^D14/y⁺ CyO stock was created by Bernard Mechler (Department of Developmental Genetics, DKFZ, Heidelberg, Germany) and provided by István Kiss (Hungarian Academy of Sciences, Szeged, Hungary) (TOROK et al. 1995 ; GIARRE et al. 2002 ; GORJANACZ et al. 2002 ). The Gal4^pnos-VP16 stock (RORTH 1998 ) was provided by Pernille Rørth (EMBL, Heidelberg, Germany). The (1) Gal4^tubP (P{w + mC = tubP-GAL4}LL7)/TM3,Sb¹; (2) Gal4^Act5C (P{w[+mC] = Act5CGAL4} 17bFO1)/TM6B, Tb¹; (3) Gal4^arm (P{w[+m W.hs] = GAL4-armS}4a P{w[+mW.hs] + GAL4-arm.S}4b)/TM3, Sb¹; (4) Sb¹/TM3 P{w + mC = ActGFP}JMR2, Ser¹; (5) Df(3R)GB104/TM3, Sb¹; (6) Df(3R)by416/TM3, Sb¹; (7) Df(3R)by62/TM1; (8) TM3, Sb1, P{ry[+t7.2] = 2-3}99B/Df(3R)C7, ry[506]; and (9) Gal4^eye, UASt FLP/CyO ; FRT82B, GMR-hid, l(3)CL-R¹/TM2 (STOWERS and SCHWARZ 1999 ) stocks were obtained from the Bloomington Drosophila Stock Center at Indiana University.

PCR of importin 3¹:
Genomic DNA was prepped from single flies of the indicated genotypes and used for PCR. PCR conditions were: 2 µM primers; 1.5 mM MgCl₂; 2.5 units Taq DNA polymerase; and 2 mM dATP, dCTP, dGTP, and dTTP (annealing temperature is 62°, 30 cycles). The 5' P-element primer, PF-2 or primer 1 in Fig 1, had the sequence CGACGGGACCACCTTATGTTAT (EGGERT et al. 1998 ), and the 3' primer, 3 3'NsacII or primer 2 in Fig 1, had the sequence CGCACGCCGCGGCCTTTGCCAGCTTCTTCAGG. The resulting band that appears only when importin 3¹ is present was sequenced and shown to correspond to a P-element insertion 780 bp from the ATG of 3 (see also MATHE et al. 2000 ).

View larger version (45K): In this window In a new window Download PPT slide   Figure 1. PCR of importin 31 chromosomes and creation of deletion mutants in importin 3. (A) PCR to detect the P element in importin 31. Importin 3 and cg8273 coding regions are shown in white, the noncoding region is shown in gray, the P-element insertion in 31 is indicated by the black triangle, and primers used for PCR are indicated with arrows. Nucleotide numbers are indicated relative to the start of the 3 coding region (ATG = +1). To verify the presence of the P element in 31, DNA was isolated from single flies of the indicated genotypes and analyzed by PCR using a P-element primer (primer 1) and a primer in 3 (primer 2). Lane 1, 1-kb DNA ladder; lane 2, w1118; lane 3, 31/TM6C; lane 4, Gal4Act5C, 31/TM6B; lane 5, Gal4arm, 31/TM6B; lane 6, Gal4arm, 31/Gal4arm, 31; lane 7, Gal4arm/TM6B; lane 8, 31(R1)/TM6B; lane 9, 31(R1)/31(R1); lane 10, 31(R2)/TM6C. DNA size markers are shown in kilobases. (B) PCR to detect P-element excision-induced deletions in importin 3. DNA isolated from P-element-excised flies was analyzed by PCR using primers that flank the P-element insertion site (primers 2 and 3 in A). Two lines, importin 3D93 and 3D165, carrying small deletions in the 3 locus were identified (lanes containing bands <1.4 kb). DNA size markers are shown in kilobases. (C) Diagram of importin 3 alleles. Importin 3 and cg8273 coding regions are shown in white, the noncoding region is shown in gray, and deleted regions in 3D93 and 3D165 are indicated by black boxes. The 317-7 allele is also used in this study and contains a stop codon in place of amino acid W132 (T. HERMAN and L. ZIPURSKY, personal communication). Nucleotide numbers are indicated relative to the start of the 3 coding region (ATG = +1).

Expression constructs and germline transformations:
UASp Importin transgenes were created by cloning 1 (MASON et al. 2002 ), 2, or 3 PCR fragments containing a 5' Cavener consensus sequence (AAAATG; CAVENER 1987 ) and the 1.5-kb coding region into KpnI and NotI sites in the UASp P-element transformation vector (RORTH 1998 ). In contrast to transgenes used previously (MASON et al. 2002 ), the 2 and 3 transgenes do not contain any 2- or 3-specific 5' or 3' untranslated region (UTR) sequences. The UASp 1 transgene contains 1 nucleotide of 1 3'UTR. Transgenic UASp 1, 2, and 3 lines were created using standard germline transformation procedures (SPRADLING 1986 ). The UASp 1, 2, and 3 inserts used in this study were all located on the second chromosome.

Larval cuticle preps:
Importin 3 alleles were balanced with a green fluorescent protein (GFP)-tagged TM3 chromosome and the appropriate crosses were set up in egg-laying cups. Eggs were laid on apple juice plates overnight. Resulting first instar larvae were examined with a UV dissecting microscope and nonfluorescent larvae were removed to a plate containing standard cornmeal-dextrose media. After 24–48 hr dead larvae were isolated and larval cuticles were prepared as previously described (STERN and SUCENA 2000 ), except that 4% paraformaldehyde was used as the fixative. Cuticles were observed by differential interference contrast (DIC) imaging with a Leica TCS NT microscope equipped with UV, Ar, Kr/Ar, and He/Ne lasers. Digital images were processed using Adobe PhotoShop (Adobe Systems, San Jose, CA).

Northern and Western blots:
Total RNA and protein were isolated from Drosophila tissues with Tri-Reagent LS (Molecular Research Center, Cincinnati; CHOMCZYNSKI 1993 ) following the recommended protocols. Protein isolated from larvae of the indicated stage and genotype was analyzed by Western blot with rabbit anti-Importin 2 (TOROK et al. 1995 ) provided by Istvan Török (DKFZ, Heidelberg, Germany), rabbit anti-3 (MATHE et al. 2000 ), or a mouse anti--tubulin antibody (Amersham Biosciences, Piscataway, NJ). Blots were developed using alkaline phosophatase-tagged goat anti-rabbit secondary antibodies. The Fermentas Prestained Protein Ladder, an 10- to 180-kD size marker (Fermentas, Hanover, MD; Fig 3A and Fig C), or the GIBCO BRL (Gaithersburg, MD) benchmark size marker (Life Technologies, Grand Island, NY; Fig 3B) were used as size markers. RNA isolated from heterozygous and homozygous 3^D93 and 3^D165 mutant first instar larvae was analyzed by Northern blot with an 3 full-length random prime ³²P-labeled probe (not shown).

View larger version (179K): In this window In a new window Download PPT slide   Figure 2. Stage of lethality for importin 3 mutant larvae. Larval cuticles were prepared from (A) first instar larvae of the genotype importin 3D93/TM3 {GFP} or dead larvae of the genotypes (B) 3D93/3D93, (C) 3D165/3D165, and (D) 317-7/3D93. Note the duplicated mouth hooks in B–D.

View larger version (61K): In this window In a new window Download PPT slide   Figure 3. Importin 3 protein levels in importin 3 mutants and Importin transgene expression. (A) Protein isolated from first instar larvae of the indicated genotype was examined by Western blot with anti-Importin 3 or anti--tubulin antibodies. (B) Protein isolated from first instar larvae of the indicated genotype was examined by Western blot with anti-2, anti-3, or anti--tubulin antibodies. (C) Protein isolated from first or third instar larvae of the indicated genotype was examined by Western blot with anti-3 or anti--tubulin antibodies. The estimated sizes of the markers are indicated next to the arrows; the thick arrowhead indicates the size of the full-length 3 protein, and the thin arrowhead represents a smaller anti-3-cross-reactive band (A–C).*, the slower migrating anti-3-cross-reactive band that appears only when 1 transgenes are expressed (B); **, a second slower-migrating anti-3-cross-reactive band that appears only when an 2 transgene is expressed (B and C).

Scanning electron microscopy of adult eyes:
Flies of the indicated genotypes were dehydrated in a graded ethanol series and stored in 100% ethanol. Flies were critical point dried, coated with gold, and examined by scanning electron microscopy with a LEO 982 FESEM microscope. Digital images were processed using Adobe PhotoShop (Adobe Systems).

Eye sectioning:
Fly eyes of the indicated genotypes were embedded in Durcapan resin according to standard procedures (WOLFF 2000 ), sectioned to 1 µm thickness, stained with toluidine blue, and observed by DIC imaging. Digital images were processed using Adobe PhotoShop (Adobe Systems).

Immunofluorescence:
Ovaries were dissected from females of the indicated genotypes, fixed in 1x PBS, 4% paraformaldehyde, and blocked in PBS-saponin (1x PBS, 0.1% saponin, and 1% normal goat serum). Ovaries were incubated with a mouse anti-Kelch antibody (XUE and COOLEY 1993 ) diluted 1:1 (GORJANACZ et al. 2002 ) in PBS-saponin, followed by a goat anti-rabbit FITC-labeled secondary antibody diluted 1:300 in PBS-saponin. DNA was stained with 4',6-diamidino-2-phenylindole (DAPI) in PBS. Samples were examined by confocal microscopy and digital images were processed using Adobe PhotoShop (Adobe Systems). The anti-Kelch antibody was developed by L. Cooley and provided by the Developmental Studies Hybridoma Bank (Iowa City, IA).

Crosses:
Recombination of importin 3¹: Gal4^arm/TM3, Sb¹ or Gal4^Act5C/TM6B, Tb¹ males were crossed to importin 3¹/TM6C, Sb¹, Tb¹ virgin females. Gal4^arm/3¹ or Gal4^Act5C/3¹ virgin female offspring were collected and mated to TM3, Sb¹/TM6B, Tb¹ males. Resulting male offspring were selected for a dark red eye. These males were utilized to make stocks and the presence of the P element in 3¹ was verified by PCR (see above).

To allow importin 3¹ to recombine with a "wild-type" third chromosome, w¹¹¹⁸ males were crossed to 3¹/TM6C, Sb¹, Tb¹ females. Importin 3¹/+ virgin female offspring were collected and mated to TM3, Sb¹/TM6B, Tb¹ males. Recombinant 3¹/TM6B, Tb¹ males were mated individually to virgin females from the original 3¹/TM6C, Sb¹, Tb¹ stock. Crosses were incubated at room temperature and each vial was examined for the presence of non-Tb¹ pupal offspring. If non-Tb¹ pupae were observed the adult offspring from this cross were analyzed. Four recombinant 3¹ chromosomes were viable over the original 3¹ chromosome [designated 3^1(R1), 3^1(R2), 3^1(R3), and 3^1(R4)]. Stocks were made for the 3^1(R1) and 3^1(R2) chromosomes, and the presence of the P element was verified by PCR (Fig 1).

Analysis of importin 3¹ viability: Importin 3¹/TM6C, Sb¹, Tb¹ females were crossed to: (a) 3¹/TM6C, Sb¹, Tb¹; (b) 3^1(R1)/TM3, Sb¹; (c) 3^1(R2)/TM6C, Sb¹, Tb¹; (d) Df(3R)by416/TM3, Sb¹; (e) Df(3R)GB104/TM3, Sb¹; (f) Df(3R)by62/TM1; or (g) Gal4^arm, 3¹/TM6B, Tb¹ males. Likewise, 3^1(R1)/TM3, Sb¹ flies were crossed to (a) 3^1(R1)/TM3, Sb¹; (b) Df(3R)by416/TM3, Sb¹; (c) Df(3R)GB104/TM3, Sb¹; or (d) Df(3R)by62/TM1 flies. Finally, 3^1(R2)/TM6C, Sb¹, Tb¹ flies were crossed to (a) 3^1(R2)/TM6C, Sb¹, Tb¹ or (b) Df(3R)GB104/TM3, Sb¹. For all crosses offspring were analyzed for the presence of the appropriate markers on balancers and viability indices were calculated by dividing the number of observed offspring by the number of expected offspring if all nonhomozygous balancer genotypes were equally viable (Table 1). Offspring inheriting two copies of the same balancer (e.g., TM3, Sb¹/TM3, Sb¹) were assumed to be completely lethal. Offspring inheriting two different balancers (e.g., TM3, Sb¹/TM6C, Sb¹, Tb¹) were often lethal. However, in crosses in which these offspring were observed the viability was calculated assuming them to be fully viable.

View this table: In this window In a new window   Table 1. Viability of importin 31 chromosomes

Creating deletions in importin 3: Importin 3^1(R1)/TM3, Sb1 virgin females were crossed to TM3, Sb1, P{ry[+t7.2] = 2-3}99B/Df(3R)C7, ry[506]. "Jump start" male offspring of the genotype 3^1(R1)/TM3, Sb¹, P{ry[+t7.2] = 2-3}99B were collected and mated to TM3, Sb¹/TM6B, Tb¹ virgin females. Resulting white-eyed, non-ebony, TM3, Sb¹ or TM6B, Tb¹ male offspring were selected and mated individually to TM3, Sb¹/TM6B, Tb¹ virgin females. After 5 days of mating 10–20 males were pooled together for a genomic DNA extraction. Approximately 3 µl of this genomic DNA was then used in a PCR reaction (60° annealing temperature, 1.5 mM MgCl₂) with the 3 3'NSacII primer, primer 2 in Fig 1 (sequence above), and the 3 5' prom 2 primer, primer 3 in Fig 1 (3 5' prom 2 sequence, CCAGTTCATTGCTGTTGCTCC). Small deletions in 3 were detected by the presence of a smaller PCR product. If a pool of DNA was shown to contain an 3 deletion, DNA was extracted separately from offspring of each of the 10–20 males. This DNA was utilized in the PCR reaction as described above, enabling the identification of the specific line that contained the deletion. The shortened PCR products were gel purified with QiaQuick columns (QIAGEN, Valencia, CA) and sequenced.

Analysis of importin 3 mutant alleles: Importin 3^D93/TM3, Sb¹ flies were crossed to: (a) 3^D93/TM3, Sb¹; (b) FRT82B, 3^17-7/TM3 {GFP}, Sb¹; (c) FRT82B, 3^w73/TM3 {GFP}, Sb¹; (d) Df(3R)by416/TM3, Sb¹; (e) Df(3R)GB104/TM3, Sb¹; (f) Df(3R)by62/TM1; or (g) 3¹/TM6C, Sb¹, Tb¹ flies. Likewise, 3^D165/TM3, Sb¹ or TM6B, Tb¹ or TM3 {GFP}, Ser¹ flies were crossed to: (a) 3^D165/TM3, Sb¹; (b) FRT82B, 3^17-7/TM3 {GFP}, Sb¹; (c) FRT82B, 3^w73/TM3 {GFP}, Sb¹; (d) Df(3R)by416/TM3, Sb¹; (e) Df(3R)GB104/TM3, Sb¹; (f) Df(3R)by62/TM1; or (g) 3^D93/TM6B, Tb¹. Finally, Df(3R)GB104/TM3, Sb¹ flies were crossed to (a) FRT82B, 3^17-7/TM3 {GFP}, Sb¹ or (b) FRT82B, 3^w73/TM3 {GFP}, Sb¹ flies. For all crosses offspring were analyzed for the presence of the appropriate markers on balancers and viability indices were calculated as described above (Table 2).

View this table: In this window In a new window   Table 2. Viability of importin 3 mutants

To determine the approximate stage of lethality the importin 3 mutant alleles and deficiency chromosomes were balanced with TM3 {GFP} chromosomes and the appropriate crosses were repeated in egg-laying cups. Embryos were allowed to hatch and early first instar larvae were sorted by fluorescence. Nonfluorescent first instar larvae were collected on a cornmeal agar plate and their development was observed at 25°.

Rescue of importin 3^D93/3^D93 lethality: Male flies of the genotype UASp importin 1, 2 or 3/UASp 1, 2, or 3; FRT82B, 3^D93/TM3 {GFP}, Ser¹ (males carrying UASp 1 had the original 3^D93 chromosome instead of FRT82B, 3^D93) were crossed to virgin females of the genotype Gal4^tubP, 3^D93/TM3 {GFP}, Ser¹. Progeny were scored at the onset of pupariation for fluorescence when observed through the side of the vial with a UV dissecting microscope. The resulting adult progeny were scored for the presence of the Ser¹ marker on the TM3{GFP}, Ser¹ chromosome. Viability indices were calculated by dividing the number of observed offspring by the number of expected offspring if all nonhomozygous balancer genotypes were viable to the indicated stage (Table 3). Due to the partial penetrance of Ser¹, all non-Ser¹ flies were assayed for fluorescence with a UV dissecting microscope to conclusively determine their genotype. As a negative control, 3^D93/TM3{GFP}, Ser¹ males were mated to Gal4^tubP, 3^D93/TM3{GFP}, Ser¹ females.

View this table: In this window In a new window   Table 3. Rescue of importin 3D93/3D93 lethality

The approximate stage of lethality for UASp importin 1, 2, or 3;3^D93/Gal4^tubP, 3^D93 offspring was determined as previously described. FRT82B, 3^D93/Gal4^tubP, 3^D93 and 3^D93/Gal4^tubP, 3^D93 offspring served as negative controls.

Rescue of importin 3^D93/3^17-7 lethality: Male flies of the genotype UASp importin 1, 2, or 3/CyO; Gal4^tubP, 3^D93/TM3 {GFP}, Ser¹ were crossed to females of the genotype FRT82B, 3^17-7/TM3 {GFP}, Sb¹. Progeny were scored at the onset of pupariation as previously described. It was assumed that all nonfluorescent pupae had inherited the UASp importin transgene and not CyO. Adult offspring were scored for the presence of the CyO, TM3 {GFP}, Ser¹, and TM3 {GFP}, Sb¹ balancers using the appropriate markers. Viability indices were calculated as previously described, except we assumed that all CyO; Gal4^tubP, 3^D93/ FRT82B, 3^17-7 offspring died as first/second instar larvae and, therefore, zero offspring of this genotype were expected at later stages. The viability of adult progeny was calculated for (a) UASp 1, 2 or 3 ; Gal4^tubP, 3^D93/ FRT82B, 3^17-7 experimental flies and (b) UASp 1, 2, or 3; Gal4^tubP, 3^D93/TM3 {GFP}, Sb¹ positive control flies (Table 4). As a negative control Gal4^tubP, 3^D93/TM3 {GFP}, Ser¹ males were crossed to FRT82B, 3^17-7/TM3{GFP}, Sb¹ females and the viability of Gal4^tubP, 3^D93/FRT82B, 3^17-7 offspring was calculated at puparium, pharate adult, and adult stages (Table 4). Due to the partial penetrance of Ser¹, all non-Ser¹ flies were assayed for fluorescence with a UV dissecting microscope to conclusively determine their genotype. The approximate stage of lethality for UASp 1, 2, or 3;FRT82B, 3^17-7/Gal4^tubP, 3^D93 off-spring was determined as previously described. FRT82B, 3^17-7/Gal4^tubP, 3^D93 and FRT82B, 3^17-7/3^D93 offspring served as negative controls.

View this table: In this window In a new window   Table 4. Rescue of importin 3D93/317-7 lethality

Generating homozygous importin 3^D93 eyes using EGUF/hid: UASt FLP, Gal4^eye/CyO; FRT82B, GMR-hid, l(3)CL-R¹/TM6B females were crossed to: (a) FRT82B, 3⁺, 87E P-lacW [w⁺]/FRT82B, importin 3⁺, 87E P-lacW [w⁺] or (b) FRT82B, 3^D93/TM6B flies. Adult offspring of the genotype (a) UASt FLP, Gal4^eye/+; FRT82B, GMR-hid, l(3)CL-R¹/FRT82B, 3⁺, 87E P-lacW [w⁺] or (b)UASt FLP, Gal4^eye/+; FRT82B, GMR-hid, l(3)CL-R¹/FRT82B, 3^D93 were selected for and their eyes were analyzed by scanning electron microscopy (SEM) and tangential sectioning.

Rescue of homozygous importin 3^D93 eyes: UASt FLP, Gal4^eye/CyO; FRT82B, GMR-hid, l(3)CL-R¹/TM6B females were crossed to UASp importin 1, 2, or 3/CyO; FRT82B, 3^D93/TM6B males. Adult offspring of the genotype UASt FLP, Gal4^eye/UASp 1, 2, or 3 ; FRT82B, GMR-hid, l(3)CL-R¹/FRT82B, 3^D93 were selected for and their eyes were analyzed by SEM and tangential sectioning.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Phenotypes associated with importin 3¹ can be removed by recombination:
A Drosophila importin 3 hypomorphic mutation, 3¹, was reported to greatly reduce viability, and all surviving females were sterile (MATHE et al. 2000 ). The 3¹ allele is associated with a P-element insertion (P-lacW [w⁺]) located 780 bp upstream of the start codon (MATHE et al. 2000 ). To determine if UASp 1, 2, or 3 transgenes could rescue the homozygous 3¹ phenotypes a Gal4^arm driver was recombined onto the same chromosome as 3¹. Unexpectedly, the Gal4^arm, 3¹ chromosome was homozygous viable (Table 1) and homozygous females were fertile (not shown). The presence and correct position of the 3¹ P element was confirmed by PCR (Fig 1). Therefore, the low viability and female sterility of 3¹ flies is likely not due to the hypomorphic 3 mutation. Alternatively, it is possible that the chromosome containing the Gal4^arm driver carries a suppressor of the 3¹ mutation.

To distinguish between these possibilities we repeated the recombination experiment using an independent third chromosome from a "normal" w¹¹¹⁸ stock. This analysis showed that 4 out of 74 recombinant P-lacW [w⁺]-containing chromosomes [importin 3^1(R1), 3^1(R2), 3^1(R3), and 3^1(R4)] supported good viability over the original 3¹ chromosome (Table 1; not shown). The presence and position of the P-element insert was confirmed by PCR for two of the recombinant chromosomes [3^1(R1) and 3^1(R2); Fig 1]. Flies homozygous for 3^1(R1) were viable (Table 1) and the females were fertile (not shown). These results confirm that the original P-lacW[w⁺] insertion could not have been solely responsible for the reported phenotypes. For unknown reasons flies homozygous for 3^1(R2) were homozygous lethal despite the fact that they were viable over the original 3¹ allele (Table 1).

We also examined the viability of the original and recombinant importin 3¹ alleles over various deficiencies. Flies carrying the original 3¹ allele or the recombinant 3^1(R1) were viable and female progeny were fertile over Df(3R)by416, breakpoints 085D10–12;085E01–03; Df(3R)GB104, breakpoints 085D12;085E10; and Df(3R)by62, breakpoints 085D11–14; 085F06 (Table 1; MATHE et al. 2000 ; not shown). Further experiments demonstrated that all three of these deficiencies uncover 3 (Table 2; Fig 3; not shown). Taken together, these results indicate that a second site mutation(s) on the original 3¹ chromosome either caused or contributed strongly to the published phenotypes (MATHE et al. 2000 ). The discovery that the 3¹ allele is viable and female fertile over deficiencies and loss-of-function 3 alleles (see below) suggests that the second-site mutation is the major contributor to these phenotypes. Although 3¹ flies were demonstrably hypomorphic for 3 protein expression (MATHE et al. 2000 ), the reduced 3 levels are apparently not deleterious to the organism.

P-element excision-induced alleles of importin 3:
In search of more severe importin 3 mutations, a P-element excision mutagenesis was used to create small deletions in the 3 coding sequence. The P element in the clean 3^1(R1) stock was mobilized and offspring were selected for the loss of the P element (loss of white⁺). A PCR assay using primers flanking the P-element insertion site was used to screen for imprecise P-element excision events (Fig 1). Two small deletions in the 3 gene (3^D93 and 3^D165) were identified (Fig 1). Sequencing of the shortened PCR products revealed that the 3^D93 deletion removes 897 bp from the 5' region of 3, including the coding sequence for the first 20 amino acids. The 3^D165 deletion removes 619 bp but no coding sequence (Fig 1). Because the original 3¹ P element was inserted in the 5' region between 3 and the convergently transcribed predicted open reading frame cg8273 (ADAMS et al. 2000 ), only 125 nucleotides remain upstream of one of the predicted start sites of cg8273 in 3^D93 and 3^D165 (Fig 1). Thus, it is possible that the expression of cg8273 will be affected by 3^D93 and 3^D165 deletions.

The importin 3^D93 and 3^D165 mutations were both homozygous lethal and lethal over each other (Table 2). In addition, 3^D93 was lethal over Df(3R)by416, Df(3R)GB104, and Df(3R)by62 (Table 2). Importin 3^D93/3¹ flies were completely viable (Table 2) and the females were fertile (not shown), confirming our conclusion that the 3¹ allele does not yield severe phenotypes. In conclusion, this strategy produced recessive lethal 3 mutants, thereby demonstrating that 3 is an essential gene in flies.

Importin 3 deletion mutants do not develop past larval stages:
To determine when importin 3 mutant flies die, 3^D93 and 3^D165 chromosomes were balanced with a TM3 chromosome marked by GFP (TM3{GFP}, Ser¹). In this fashion homozygous mutant offspring could be distinguished from heterozygotes by GFP fluorescence. Homozygous 3^D93 and 3^D165 offspring completed embryogenesis and formed normal-appearing first instar larvae. Most homozygous mutant 3^D93 and 3^D165 first instar larvae were able to duplicate their mouth hooks in preparation for molting (Fig 2B and Fig C), but most died before completing ecdysis. Of the offspring that did begin ecdysis most died while still attached or immediately adjacent to their first instar cuticles. Rarely first instar cuticles were found that were not associated with dead larvae. These larvae presumably died as very early second instar larvae, since we never observed any crawling homozygous mutant second instar larvae. Offspring carrying 3^D93 or 3^D165 deletions over Df(3R)by416 or Df(3R)GB104 also died around the first instar molt (not shown). We conclude that 3 serves an essential role in larval development and that the majority of 3 mutant offspring die before or during ecdysis of the first instar larval molt.

importin 3^D93 and 3^D165 larvae express little if any full-length Importin 3 protein:
Since the phenotypes of importin 3^D93 and 3^D165 were no more severe over deficiencies than when homozygous, it is likely that both mutations are either null or strongly hypomorphic. This conclusion was supported by Northern blot analysis showing that 3^D93/3^D93 and 3^D165/3^D165 first instar larvae contained very little or no 3 mRNA (not shown, see MATERIALS AND METHODS). This was expected since the two deletions removed significant portions of the 3 5'UTR (MATHE et al. 2000 ; Fig 1C). Immunoblot analysis was used to investigate whether the first-second instar arrest phenotypes of homozygous 3^D93 and 3^D165 mutants are due to the complete or partial absence of 3 protein. Total protein was isolated from first instar larvae and examined by immunoblotting with an antiserum against the C-terminal domain of 3 (MATHE et al. 2000 ). As shown in Fig 3, homozygous 3^D93, 3^D165, and 3^D93/Df(3R)GB104 first instar larvae contained very little or no full-length 3 protein. Curiously, a faster-migrating anti-3 cross-reactive band appeared in both wild-type and mutant larvae (Fig 3A; see below). The identity of this band is currently unknown.

Rescue of importin 3^D93 larval lethality:
If the developmental defects of importin 3^D93 and 3^D165 mutants are due to the lack of 3 protein, the defects should be rescued by an 3 transgene. A Gal4^tubP driver was used to express a UASp 3 transgene in a homozygous 3^D93 background. As shown in Table 3, the 3 transgene rescued many 3^D93/3^D93 and 3^D93/3^D165 offspring to the pigmented pharate adult stage and 3^D93/Df(3R)GB104 offspring to pupal stages, but none to full adulthood. Some rescued larvae completed the second and third instar molts to form morphologically normal pupae before dying, and a few became well-developed pigmented pharate adults that never eclosed (Table 3). When expressed with a Gal4^Act5c driver the 3 transgene rescued 3^D93/3^D93 offspring to wandering third instar larvae. These partially rescued larvae sclerotized their cuticles but did not extend their spiracles and died before becoming puparia. Full rescue may require the expression of the 3 transgene in the correct tissues at the correct time and at appropriate levels. The fact that Gal4^tubP and Gal4^Act5c drivers rescued to different degrees supports this possibility. Another concern is the likelihood that the 3^D93 and 3^D165 deletions affected not only the expression of both 3's but also the divergently transcribed cg8273 (Fig 1). The partial rescue by the 3 transgene does, however, demonstrate that the death of 3^D93/3^D93 larvae around the first molt is due to defects in 3 and not in cg8273.

An objective of this study is to determine if importin 1's, 2's, and 3's have distinct and/or overlapping functions. Previously, using the Gal4/UAS expression system (BRAND and PERRIMON 1993 ), we showed that 1, 2, and 3 transgenes all rescued the partial male sterility of 2 null flies, but only 2 transgenes rescued the sterility of 2 null females (MASON et al. 2002 ). Thus the role of 2 in gametogenesis appears not to be redundant with 1 and 3 in females but is redundant in males. A similar approach was taken to determine if 1 and 2 transgenes could rescue the death of 3 mutant offspring.

For these rescue experiments to be meaningful it is important that the transgenes be expressed at reasonable levels in mutant first instar larvae. Extracts from homozygous importin 3^D93 first instar larvae expressing UASp 1, 2, or 3 transgenes were examined by Western blot using antibodies directed against 2 (TOROK et al. 1995 ), 3 (MATHE et al. 2000 ), or -tubulin (Fig 3B). As shown in Fig 3B, 2 and 3 were both expressed at high levels in first instar larvae carrying the UASp 2 or 3 transgenes, respectively. A slower-migrating anti-3 cross-reactive band in mutant first instar larvae expressing UASp 1 (* in Fig 3B) is consistent with results observed when UASp 1 was expressed in 2 mutant ovaries with the Gal4^pnos-VP16 driver (MASON et al. 2002 ). Since 1 is predicted to be 60 kD and 3 is predicted to be 56.6 kD, it is likely that this band represents a cross-reaction of 1 with the anti-3 antiserum. We conclude that all three transgenes are expressed at high levels in first instar larvae.

The expression of either the importin 1 or 2 transgene delayed the death of homozygous 3^D93 offspring. Many offspring expressing UASp 1 with the Gal4^tubP or Gal4^Act5c drivers completed the first instar molt before dying as late-stage second instar larvae, although some larvae appeared to survive to early third instar stages (not shown). Similarly, many 3^D93/3^D93 offspring expressing UASp 2 also survived the first instar larval molt before dying as late second or early third instar larvae. In some trials a few of these animals developed to puparia (not shown). We note that 3^D93/3^D93 offspring expressing 1 or 2 were not able to reach pupal stages as efficiently as mutant offspring expressing 3 (Table 3). We conclude that 1 and 2 can, at least partially, replace the function(s) of 3 during larval development.

Nonsense mutation alleles of importin 3:
The results described above suggest that 3 is important for developmental events during or after the first larval molt. There are two caveats to this conclusion. First, the 3^D93 and 3^D165 deletions may affect the expression of cg8273, a divergently transcribed gene whose possible role in development is not known. Second, it is not certain whether the 3^D93 and 3^D165 alleles are null or hypomorphic. If hypomorphic, it is possible that 3 is required for even earlier stages of development. To address these issues we used two nonsense alleles, 3^17-7 containing a stop codon after amino acid (aa) 131 in the second ARM repeat and 3^w73 containing a stop codon after aa 158 within the third ARM repeat (kindly provided by T. Herman and L. Zipursky). Since the nonsense mutations were isolated in a screen using heavy mutagenesis they may carry multiple mutations (T. HERMAN and L. ZIPURSKY, personal communications). However, by working with independently derived nonsense mutations over the 3^D93 deletion chromosome we can alleviate the possible contribution of recessive mutations in cg8273 or other loci to the phenotype. Both 3^17-7 and 3^w73 were completely lethal over 3^D93, 3^D165, and Df(3R)GB104 (Table 2; not shown). Importin 3^w73/3^D93 offspring died as mid to late second instar larvae, indicating that the 3^w73 allele may not be null. In contrast, many 3^17-7/3^D93 and 3^17-7/Df(3R)GB104 larvae died at the first/second instar molt with duplicated mouth hooks (Fig 2D; not shown), although some died as early second instar larvae. More 3^D93/3^17-7, like 3^D93/3^D165, offspring appeared to complete ecdysis and died as early second instar larvae compared to 3^D93/3^D93 and 3^D165/3^D165 mutants. This is possibly due to subtle genetic background differences. Generally, then, 3^17-7, 3^D93, and 3^D165 alleles all cause death at or soon after the first larval molt. Therefore, the larval deaths of 3^D93 and 3^D165 mutant flies reflect defects in 3 expression that are independent of cg8273.

As expected, levels of Importin 3 protein in first instar larvae carrying 3^17-7 over 3^D93 or Df(3R)GB104 were extremely low or undetectable (Fig 3C). The faster-migrating cross-reactive band described above is also apparent in extracts from 3^17-7/Df(3R)GB104 flies (Fig 3C). This finding rules out the possibility that this band is an N-terminal truncation expressed from the 3^D93 chromosome. The band is unlikely to be a degradation product of maternal 3 since the faster-migrating band is also present in extracts from 3^D93/3^D93 and 3^17-7/3^D93 larvae that were rescued to third instar by an 2 transgene (see below). The identity of this faster-migrating band is a mystery, since it appears in extracts from flies (potentially) expressing native, N-terminally truncated (3^D93 and 3^D165), and C-terminally truncated (3^17-7) 3 proteins, each of which has a different predicted mass. The simplest explanation is that the band is a spurious cross-reactive species that is unrelated to 3.

Importantly, expression of UASp importin 3 with Gal4^tubP was able to rescue 3^17-7/3^D93 and 3^w73/3^D93 offspring to fully viable fertile adults (Table 4; not shown). Thus, it is likely that the inability to rescue 3^D93/3^D93 flies to adulthood with an 3 transgene is due to disruption of cg8273 expression. In contrast, UASp 1 and 2 transgenes were both unable to rescue 3^17-7/3^D93 flies to adulthood (Table 4). However, the 2 transgene was able to rescue some offspring to abnormal pharate adults, although most died at earlier stages (Table 4). Dissecting these partially rescued pharate adults from the pupal cases revealed that some adult structures were at least partially formed, including wings, tergites, sternites, thorax, and bristles. Expression of the 1 transgene rescued less well, as these offspring survived at best to late second or early third instar larvae. It is worth noting that heterozygous 3^D93 flies expressing UASp 1 have a lower than expected viability (Table 4). Thus, it is possible that the overexpression of 1 causes a partial-dominant lethal phenotype. On the basis of these rescue experiments we conclude that 3 serves a mostly redundant function during larval development. However, since 1 and 2 transgenes do not rescue to adult stages it is likely that the role of 3 in the development of some adult tissues cannot be replaced by 1 or 2.

Analysis of importin 3^D93 mutant eyes:
The observation that importin 3 does not appear to play an exclusively paralog-specific role in larval development led us to examine the effects of the loss of 3 on the development of adult tissues. To address this issue we created an FRT82B, 3^D93 chromosome that can be used to create clones of homozygous 3^D93 cells in an otherwise heterozygous fly using the FLP/FRT recombinase system (XU and HARRISON 1994 ). We subsequently generated eyes that were homozygous for 3^D93 using a stock that expresses the FLP recombinase in the eye and contains a FRT82B, GMR-hid chromosome (STOWERS and SCHWARZ 1999 ). The GMR-hid element drives the expression of the apoptosis-inducing gene hid under the control of the eye-specific GMR enhancer. Consequently, any eye cell that contains one or two copies of GMR-hid undergoes apoptosis during early pupal stages. Therefore, only cells that have lost this chromosome through mitotic recombination survive to form adult eyes (STOWERS and SCHWARZ 1999 ; Fig 4A). Consistent with previous results, we observed that FRT82B, 3⁺/FRT82B, GMR-hid flies had well-formed eyes when FLP recombinase was expressed in the eye (STOWERS and SCHWARZ 1999 ; Fig 4B), although the photoreceptor patterning observed in eye sections appears to be slightly defective (Fig 5A).

View larger version (120K): In this window In a new window Download PPT slide   Figure 4. SEM of importin 3 mutant and rescued eyes. Flies of the genotypes (A) Gal4eye, UASt FLP; FRT82B, GMR-hid/TM6B; (B) Gal4eye, UASt FLP; FRT82B, GMR-hid/FRT82B, importin 3+; (C) Gal4eye, UASt FLP; FRT82B, GMR-hid/FRT82B, 3D93; (D) Gal4eye, UASt FLP/UASp 1; FRT82B, GMR-hid/FRT82B, 3D93; (E) Gal4eye, UASt FLP/UASp 2; FRT82B, GMR-hid/FRT82B, 3D93; and (F) Gal4eye, UASt FLP/UASp 3; FRT82B, GMR-hid/FRT82B, 3D93 were critical-point dried and examined by scanning electron microscopy.

View larger version (146K): In this window In a new window Download PPT slide   Figure 5. Tangential sections through importin 3 mutant and rescued eyes. Eyes dissected from flies of the genotypes (A) Gal4eye, UASt FLP ; FRT82B, GMR-hid/FRT82B,