- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Mason, D. A.
- Articles by Goldfarb, D. S.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Mason, D. A.
- Articles by Goldfarb, D. S.
The Drosophila melanogaster importin
3 Locus Encodes an Essential Gene Required for the Development of Both Larval and Adult Tissues
D. Adam Masona,
Endre Máthéb,
Robert J. Flemingc, and
David S. Goldfarba
a Department of Biology, University of Rochester, Rochester, New York 14627,
b CRC Cell Cycle Research Group, Department of Genetics, University of Cambridge, Cambridge CB2 3EH, United Kingdom
c Biology Department, Trinity College, Hartford, Connecticut 06106
Corresponding author: David S. Goldfarb, University of Rochester, Rochester, NY 14627., dasg{at}mail.rochester.edu (E-mail)
Communicating editor: K. ANDERSON
| ABSTRACT |
|---|
The nuclear transport of classical nuclear localization signal (cNLS)-containing proteins is mediated by the cNLS receptor importin
. The conventional importin
gene family in metazoan animals is composed of three clades that are conserved between flies and mammals and are referred to here as
1,
2, and
3. In contrast, plants and fungi contain only
1 genes. In this study we report that Drosophila importin
3 is required for the development of both larval and adult tissues. Importin
3 mutant flies die around the transition from first to second instar larvae, and homozygous importin
3 mutant eyes are defective. The transition to second instar larvae was rescued with importin
1,
2, or
3 transgenes, indicating that Importin
3 is normally required at this stage for an activity shared by all three importin
's. In contrast, an
3-specific biochemical activity(s) of Importin
3 is probably required for development to adults and photoreceptor cell development, since only an importin
3 transgene rescued these processes. These results are consistent with the view that the importin
's have both overlapping and distinct functions and that their role in animal development involves the spatial and temporal control of their expression.
MOST proteins targeted to the nucleus contain nuclear localization signals (NLSs) that are recognized by soluble receptors called karyopherins (![]()
![]()
![]()
/ß1 heterodimer. Importin
serves as an adapter that links cNLS cargo to the karyopherin importin ß1, which ferries the complex through the nuclear pore complex (![]()
![]()
![]()
The genomes of metazoan organisms encode multiple importin
genes. For example, the human genome encodes six importin
's (![]()
![]()
gene family revealed that most importin
's belong to one of three evolutionarily conserved clades, designated by our nomenclature as conventional
1's,
2's, and
3's (![]()
![]()
![]()
![]()
![]()
's from plants and fungi are all
1's. In contrast, metazoan animals, with the exception of Caenorhabditis elegans (![]()
2 and
3 genes arose from
1 progenitors in ancestral single-cell eukaryotic lineages.
Vertebrate importin
's show distinct tissue- and cell-type-specific expression patterns (![]()
![]()
![]()
![]()
![]()
![]()
paralogs are differentially regulated in quiescent and proliferating cultured cells and tissue differentiation models (![]()
1's,
2's, and
3's have both overlapping and distinct sets of transport cargoes (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
3 has unique specificity for RCC1 (![]()
![]()
![]()
![]()
![]()
![]()
2 selectively bound the glucose transporter GLUT2 (![]()
1 specifically transported STAT1 and STAT2 transcription factors (![]()
![]()
's for NLS cargo can be altered when two different substrates are presented together in permeabilized cell transport assays (![]()
's and different NLS cargo and indicates that in vivo studies are needed to unravel the physiological roles of individual importin
's.
In vivo studies are consistent with the notion that the different importin
's play distinct roles in animal development. The RNAi-mediated disruption of an
3 paralog, but not an
2, had a severe effect on the development of porcine embryos (![]()
's caused distinct developmental defects in C. elegans (![]()
![]()
![]()
3 paralog ima-3 is required for meiosis in the developing female germline (![]()
![]()
![]()
The Drosophila genome encodes four importin
's (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
, cg14708 (![]()
![]()
The three conventional Drosophila importin
paralogs have different developmental stage- and cell-type-specific expression patterns (![]()
![]()
![]()
![]()
![]()
![]()
1 and
2, but not
3, accumulate in the nucleus at the onset of mitosis (![]()
![]()
![]()
![]()
2 mutations result in defects in gametogenesis that cause incompletely penetrant male sterility and complete female sterility (![]()
![]()
![]()
2 activity essential for female fertility appears to be unique to
2 since it cannot be replaced by the ectopic expression of
1 or
3 transgenes. In contrast, male sterility was rescued to a similar extent by the expression of
1,
2, and
3 (![]()
Drosophila Importin
3 has been identified as a binding partner of germ cell-less (![]()
(![]()
![]()
3 mRNA and protein were not detected in early embryos, coincident with the restriction of HSF to the cytoplasm (![]()
3 nuclear export correlate with specific cell fate transformations in mechano-sensory organs observed in hypomorphic mutations in the importin
recycling factor Dcas (![]()
3 and conclude that
3 is required for the development of both larval and adult tissues. Transgene rescue studies demonstrate that the requirement for
3 in larval development can be partially replaced by ectopic expression of
1 or
2. In contrast, only ectopic
3 expression can support development to adults. In the eye,
1, but not
2, can partially replace
3 in at least some cell types, but
3 appears to be uniquely required for the proper differentiation of photoreceptor cells.
| MATERIALS AND METHODS |
|---|
Genetic stocks and markers:
Flies were kept on standard cornmeal-dextrose media and grown at 25° unless indicated otherwise. The importin
31/TM6C stock is described in ![]()
317-7/TM3 {Kr-GFP}, Sb1 and FRT82B,
3w73/TM3 {Kr-GFP}, Sb1 stocks were created and provided by Tory Herman and Larry Zipursky [University of California (UCLA), Los Angeles]. The
2D14/y+ CyO stock was created by Bernard Mechler (Department of Developmental Genetics, DKFZ, Heidelberg, Germany) and provided by István Kiss (Hungarian Academy of Sciences, Szeged, Hungary) (![]()
![]()
![]()
![]()
2-3}99B/Df(3R)C7, ry[506]; and (9) Gal4eye, UASt FLP/CyO ; FRT82B, GMR-hid, l(3)CL-R1/TM2 (![]()
PCR of importin
31:
Genomic DNA was prepped from single flies of the indicated genotypes and used for PCR. PCR conditions were: 2 µM primers; 1.5 mM MgCl2; 2.5 units Taq DNA polymerase; and 2 mM dATP, dCTP, dGTP, and dTTP (annealing temperature is 62°, 30 cycles). The 5' P-element primer, PF-2 or primer 1 in Fig 1, had the sequence CGACGGGACCACCTTATGTTAT (![]()
3 3'NsacII or primer 2 in Fig 1, had the sequence CGCACGCCGCGGCCTTTGCCAGCTTCTTCAGG. The resulting band that appears only when importin
31 is present was sequenced and shown to correspond to a P-element insertion
780 bp from the ATG of
3 (see also ![]()
|
Expression constructs and germline transformations:
UASp Importin
transgenes were created by cloning
1 (![]()
2, or
3 PCR fragments containing a 5' Cavener consensus sequence (AAAATG; ![]()
1.5-kb coding region into KpnI and NotI sites in the UASp P-element transformation vector (![]()
![]()
2 and
3 transgenes do not contain any
2- or
3-specific 5' or 3' untranslated region (UTR) sequences. The UASp
1 transgene contains 1 nucleotide of
1 3'UTR. Transgenic UASp
1,
2, and
3 lines were created using standard germline transformation procedures (![]()
1,
2, and
3 inserts used in this study were all located on the second chromosome.
Larval cuticle preps:
Importin
3 alleles were balanced with a green fluorescent protein (GFP)-tagged TM3 chromosome and the appropriate crosses were set up in egg-laying cups. Eggs were laid on apple juice plates overnight. Resulting first instar larvae were examined with a UV dissecting microscope and nonfluorescent larvae were removed to a plate containing standard cornmeal-dextrose media. After
2448 hr dead larvae were isolated and larval cuticles were prepared as previously described (![]()
Northern and Western blots:
Total RNA and protein were isolated from Drosophila tissues with Tri-Reagent LS (Molecular Research Center, Cincinnati; ![]()
2 (![]()
3 (![]()
-tubulin antibody (Amersham Biosciences, Piscataway, NJ). Blots were developed using alkaline phosophatase-tagged goat anti-rabbit secondary antibodies. The Fermentas Prestained Protein Ladder, an
10- to 180-kD size marker (Fermentas, Hanover, MD; Fig 3A and Fig C), or the GIBCO BRL (Gaithersburg, MD) benchmark size marker (Life Technologies, Grand Island, NY; Fig 3B) were used as size markers. RNA isolated from heterozygous and homozygous
3D93 and
3D165 mutant first instar larvae was analyzed by Northern blot with an
3 full-length random prime 32P-labeled probe (not shown).
|
|
Scanning electron microscopy of adult eyes:
Flies of the indicated genotypes were dehydrated in a graded ethanol series and stored in 100% ethanol. Flies were critical point dried, coated with gold, and examined by scanning electron microscopy with a LEO 982 FESEM microscope. Digital images were processed using Adobe PhotoShop (Adobe Systems).
Eye sectioning:
Fly eyes of the indicated genotypes were embedded in Durcapan resin according to standard procedures (![]()
Immunofluorescence:
Ovaries were dissected from females of the indicated genotypes, fixed in 1x PBS, 4% paraformaldehyde, and blocked in PBS-saponin (1x PBS, 0.1% saponin, and 1% normal goat serum). Ovaries were incubated with a mouse anti-Kelch antibody (![]()
![]()
Crosses:
Recombination of importin
31:
Gal4arm/TM3, Sb1 or Gal4Act5C/TM6B, Tb1 males were crossed to importin
31/TM6C, Sb1, Tb1 virgin females. Gal4arm/
31 or Gal4Act5C/
31 virgin female offspring were collected and mated to TM3, Sb1/TM6B, Tb1 males. Resulting male offspring were selected for a dark red eye. These males were utilized to make stocks and the presence of the P element in
31 was verified by PCR (see above).
To allow importin
31 to recombine with a "wild-type" third chromosome, w1118 males were crossed to
31/TM6C, Sb1, Tb1 females. Importin
31/+ virgin female offspring were collected and mated to TM3, Sb1/TM6B, Tb1 males. Recombinant
31/TM6B, Tb1 males were mated individually to virgin females from the original
31/TM6C, Sb1, Tb1 stock. Crosses were incubated at room temperature and each vial was examined for the presence of non-Tb1 pupal offspring. If non-Tb1 pupae were observed the adult offspring from this cross were analyzed. Four recombinant
31 chromosomes were viable over the original
31 chromosome [designated
31(R1),
31(R2),
31(R3), and
31(R4)]. Stocks were made for the
31(R1) and
31(R2) chromosomes, and the presence of the P element was verified by PCR (Fig 1).
Analysis of importin
31 viability:
Importin
31/TM6C, Sb1, Tb1 females were crossed to: (a)
31/TM6C, Sb1, Tb1; (b)
31(R1)/TM3, Sb1; (c)
31(R2)/TM6C, Sb1, Tb1; (d) Df(3R)by416/TM3, Sb1; (e) Df(3R)GB104/TM3, Sb1; (f) Df(3R)by62/TM1; or (g) Gal4arm,
31/TM6B, Tb1 males. Likewise,
31(R1)/TM3, Sb1 flies were crossed to (a)
31(R1)/TM3, Sb1; (b) Df(3R)by416/TM3, Sb1; (c) Df(3R)GB104/TM3, Sb1; or (d) Df(3R)by62/TM1 flies. Finally,
31(R2)/TM6C, Sb1, Tb1 flies were crossed to (a)
31(R2)/TM6C, Sb1, Tb1 or (b) Df(3R)GB104/TM3, Sb1. For all crosses offspring were analyzed for the presence of the appropriate markers on balancers and viability indices were calculated by dividing the number of observed offspring by the number of expected offspring if all nonhomozygous balancer genotypes were equally viable (Table 1). Offspring inheriting two copies of the same balancer (e.g., TM3, Sb1/TM3, Sb1) were assumed to be completely lethal. Offspring inheriting two different balancers (e.g., TM3, Sb1/TM6C, Sb1, Tb1) were often lethal. However, in crosses in which these offspring were observed the viability was calculated assuming them to be fully viable.
|
Creating deletions in importin
3:
Importin
31(R1)/TM3, Sb1 virgin females were crossed to TM3, Sb1, P{ry[+t7.2] =
2-3}99B/Df(3R)C7, ry[506]. "Jump start" male offspring of the genotype
31(R1)/TM3, Sb1, P{ry[+t7.2] =
2-3}99B were collected and mated to TM3, Sb1/TM6B, Tb1 virgin females. Resulting white-eyed, non-ebony, TM3, Sb1 or TM6B, Tb1 male offspring were selected and mated individually to TM3, Sb1/TM6B, Tb1 virgin females. After
5 days of mating 1020 males were pooled together for a genomic DNA extraction. Approximately 3 µl of this genomic DNA was then used in a PCR reaction (60° annealing temperature, 1.5 mM MgCl2) with the
3 3'NSacII primer, primer 2 in Fig 1 (sequence above), and the
3 5' prom 2 primer, primer 3 in Fig 1 (
3 5' prom 2 sequence, CCAGTTCATTGCTGTTGCTCC). Small deletions in
3 were detected by the presence of a smaller PCR product. If a pool of DNA was shown to contain an
3 deletion, DNA was extracted separately from offspring of each of the 1020 males. This DNA was utilized in the PCR reaction as described above, enabling the identification of the specific line that contained the deletion. The shortened PCR products were gel purified with QiaQuick columns (QIAGEN, Valencia, CA) and sequenced.
Analysis of importin
3 mutant alleles:
Importin
3D93/TM3, Sb1 flies were crossed to: (a)
3D93/TM3, Sb1; (b) FRT82B,
317-7/TM3 {GFP}, Sb1; (c) FRT82B,
3w73/TM3 {GFP}, Sb1; (d) Df(3R)by416/TM3, Sb1; (e) Df(3R)GB104/TM3, Sb1; (f) Df(3R)by62/TM1; or (g)
31/TM6C, Sb1, Tb1 flies. Likewise,
3D165/TM3, Sb1 or TM6B, Tb1 or TM3 {GFP}, Ser1 flies were crossed to: (a)
3D165/TM3, Sb1; (b) FRT82B,
317-7/TM3 {GFP}, Sb1; (c) FRT82B,
3w73/TM3 {GFP}, Sb1; (d) Df(3R)by416/TM3, Sb1; (e) Df(3R)GB104/TM3, Sb1; (f) Df(3R)by62/TM1; or (g)
3D93/TM6B, Tb1. Finally, Df(3R)GB104/TM3, Sb1 flies were crossed to (a) FRT82B,
317-7/TM3 {GFP}, Sb1 or (b) FRT82B,
3w73/TM3 {GFP}, Sb1 flies. For all crosses offspring were analyzed for the presence of the appropriate markers on balancers and viability indices were calculated as described above (Table 2).
|
To determine the approximate stage of lethality the importin
3 mutant alleles and deficiency chromosomes were balanced with TM3 {GFP} chromosomes and the appropriate crosses were repeated in egg-laying cups. Embryos were allowed to hatch and early first instar larvae were sorted by fluorescence. Nonfluorescent first instar larvae were collected on a cornmeal agar plate and their development was observed at 25°.
Rescue of importin
3D93/
3D93 lethality:
Male flies of the genotype UASp importin
1,
2 or
3/UASp
1,
2, or
3; FRT82B,
3D93/TM3 {GFP}, Ser1 (males carrying UASp
1 had the original
3D93 chromosome instead of FRT82B,
3D93) were crossed to virgin females of the genotype Gal4tubP,
3D93/TM3 {GFP}, Ser1. Progeny were scored at the onset of pupariation for fluorescence when observed through the side of the vial with a UV dissecting microscope. The resulting adult progeny were scored for the presence of the Ser1 marker on the TM3{GFP}, Ser1 chromosome. Viability indices were calculated by dividing the number of observed offspring by the number of expected offspring if all nonhomozygous balancer genotypes were viable to the indicated stage (Table 3). Due to the partial penetrance of Ser1, all non-Ser1 flies were assayed for fluorescence with a UV dissecting microscope to conclusively determine their genotype. As a negative control,
3D93/TM3{GFP}, Ser1 males were mated to Gal4tubP,
3D93/TM3{GFP}, Ser1 females.
|
The approximate stage of lethality for UASp importin
1,
2, or
3;
3D93/Gal4tubP,
3D93 offspring was determined as previously described. FRT82B,
3D93/Gal4tubP,
3D93 and
3D93/Gal4tubP,
3D93 offspring served as negative controls.
Rescue of importin
3D93/
317-7 lethality:
Male flies of the genotype UASp importin
1,
2, or
3/CyO; Gal4tubP,
3D93/TM3 {GFP}, Ser1 were crossed to females of the genotype FRT82B,
317-7/TM3 {GFP}, Sb1. Progeny were scored at the onset of pupariation as previously described. It was assumed that all nonfluorescent pupae had inherited the UASp importin
transgene and not CyO. Adult offspring were scored for the presence of the CyO, TM3 {GFP}, Ser1, and TM3 {GFP}, Sb1 balancers using the appropriate markers. Viability indices were calculated as previously described, except we assumed that all CyO; Gal4tubP,
3D93/ FRT82B,
317-7 offspring died as first/second instar larvae and, therefore, zero offspring of this genotype were expected at later stages. The viability of adult progeny was calculated for (a) UASp
1,
2 or
3 ; Gal4tubP,
3D93/ FRT82B,
317-7 experimental flies and (b) UASp
1,
2, or
3; Gal4tubP,
3D93/TM3 {GFP}, Sb1 positive control flies (Table 4). As a negative control Gal4tubP,
3D93/TM3 {GFP}, Ser1 males were crossed to FRT82B,
317-7/TM3{GFP}, Sb1 females and the viability of Gal4tubP,
3D93/FRT82B,
317-7 offspring was calculated at puparium, pharate adult, and adult stages (Table 4). Due to the partial penetrance of Ser1, all non-Ser1 flies were assayed for fluorescence with a UV dissecting microscope to conclusively determine their genotype. The approximate stage of lethality for UASp
1,
2, or
3;FRT82B,
317-7/Gal4tubP,
3D93 off-spring was determined as previously described. FRT82B,
317-7/Gal4tubP,
3D93 and FRT82B,
317-7/
3D93 offspring served as negative controls.
|
Generating homozygous importin
3D93 eyes using EGUF/hid:
UASt FLP, Gal4eye/CyO; FRT82B, GMR-hid, l(3)CL-R1/TM6B females were crossed to: (a) FRT82B,
3+, 87E P-lacW [w+]/FRT82B, importin
3+, 87E P-lacW [w+] or (b) FRT82B,
3D93/TM6B flies. Adult offspring of the genotype (a) UASt FLP, Gal4eye/+; FRT82B, GMR-hid, l(3)CL-R1/FRT82B,
3+, 87E P-lacW [w+] or (b)UASt FLP, Gal4eye/+; FRT82B, GMR-hid, l(3)CL-R1/FRT82B,
3D93 were selected for and their eyes were analyzed by scanning electron microscopy (SEM) and tangential sectioning.
Rescue of homozygous importin
3D93 eyes:
UASt FLP, Gal4eye/CyO; FRT82B, GMR-hid, l(3)CL-R1/TM6B females were crossed to UASp importin
1,
2, or
3/CyO; FRT82B,
3D93/TM6B males. Adult offspring of the genotype UASt FLP, Gal4eye/UASp
1,
2, or
3 ; FRT82B, GMR-hid, l(3)CL-R1/FRT82B,
3D93 were selected for and their eyes were analyzed by SEM and tangential sectioning.
| RESULTS |
|---|
Phenotypes associated with importin
31 can be removed by recombination:
A Drosophila importin
3 hypomorphic mutation,
31, was reported to greatly reduce viability, and all surviving females were sterile (![]()
31 allele is associated with a P-element insertion (P-lacW [w+]) located
780 bp upstream of the start codon (![]()
1,
2, or
3 transgenes could rescue the homozygous
31 phenotypes a Gal4arm driver was recombined onto the same chromosome as
31. Unexpectedly, the Gal4arm,
31 chromosome was homozygous viable (Table 1) and homozygous females were fertile (not shown). The presence and correct position of the
31 P element was confirmed by PCR (Fig 1). Therefore, the low viability and female sterility of
31 flies is likely not due to the hypomorphic
3 mutation. Alternatively, it is possible that the chromosome containing the Gal4arm driver carries a suppressor of the
31 mutation.
To distinguish between these possibilities we repeated the recombination experiment using an independent third chromosome from a "normal" w1118 stock. This analysis showed that 4 out of 74 recombinant P-lacW [w+]-containing chromosomes [importin
31(R1),
31(R2),
31(R3), and
31(R4)] supported good viability over the original
31 chromosome (Table 1; not shown). The presence and position of the P-element insert was confirmed by PCR for two of the recombinant chromosomes [
31(R1) and
31(R2); Fig 1]. Flies homozygous for
31(R1) were viable (Table 1) and the females were fertile (not shown). These results confirm that the original P-lacW[w+] insertion could not have been solely responsible for the reported phenotypes. For unknown reasons flies homozygous for
31(R2) were homozygous lethal despite the fact that they were viable over the original
31 allele (Table 1).
We also examined the viability of the original and recombinant importin
31 alleles over various deficiencies. Flies carrying the original
31 allele or the recombinant
31(R1) were viable and female progeny were fertile over Df(3R)by416, breakpoints 085D1012;085E0103; Df(3R)GB104, breakpoints 085D12;085E10; and Df(3R)by62, breakpoints 085D1114; 085F06 (Table 1; ![]()
3 (Table 2; Fig 3; not shown). Taken together, these results indicate that a second site mutation(s) on the original
31 chromosome either caused or contributed strongly to the published phenotypes (![]()
31 allele is viable and female fertile over deficiencies and loss-of-function
3 alleles (see below) suggests that the second-site mutation is the major contributor to these phenotypes. Although
31 flies were demonstrably hypomorphic for
3 protein expression (![]()
3 levels are apparently not deleterious to the organism.
P-element excision-induced alleles of importin
3:
In search of more severe importin
3 mutations, a P-element excision mutagenesis was used to create small deletions in the
3 coding sequence. The P element in the clean
31(R1) stock was mobilized and offspring were selected for the loss of the P element (loss of white+). A PCR assay using primers flanking the P-element insertion site was used to screen for imprecise P-element excision events (Fig 1). Two small deletions in the
3 gene (
3D93 and
3D165) were identified (Fig 1). Sequencing of the shortened PCR products revealed that the
3D93 deletion removes 897 bp from the 5' region of
3, including the coding sequence for the first 20 amino acids. The
3D165 deletion removes 619 bp but no coding sequence (Fig 1). Because the original
31 P element was inserted in the 5' region between
3 and the convergently transcribed predicted open reading frame cg8273 (![]()
125 nucleotides remain upstream of one of the predicted start sites of cg8273 in
3D93 and
3D165 (Fig 1). Thus, it is possible that the expression of cg8273 will be affected by
3D93 and
3D165 deletions.
The importin
3D93 and
3D165 mutations were both homozygous lethal and lethal over each other (Table 2). In addition,
3D93 was lethal over Df(3R)by416, Df(3R)GB104, and Df(3R)by62 (Table 2). Importin
3D93/
31 flies were completely viable (Table 2) and the females were fertile (not shown), confirming our conclusion that the
31 allele does not yield severe phenotypes. In conclusion, this strategy produced recessive lethal
3 mutants, thereby demonstrating that
3 is an essential gene in flies.
Importin
3 deletion mutants do not develop past larval stages:
To determine when importin
3 mutant flies die,
3D93 and
3D165 chromosomes were balanced with a TM3 chromosome marked by GFP (TM3{GFP}, Ser1). In this fashion homozygous mutant offspring could be distinguished from heterozygotes by GFP fluorescence. Homozygous
3D93 and
3D165 offspring completed embryogenesis and formed normal-appearing first instar larvae. Most homozygous mutant
3D93 and
3D165 first instar larvae were able to duplicate their mouth hooks in preparation for molting (Fig 2B and Fig C), but most died before completing ecdysis. Of the offspring that did begin ecdysis most died while still attached or immediately adjacent to their first instar cuticles. Rarely first instar cuticles were found that were not associated with dead larvae. These larvae presumably died as very early second instar larvae, since we never observed any crawling homozygous mutant second instar larvae. Offspring carrying
3D93 or
3D165 deletions over Df(3R)by416 or Df(3R)GB104 also died around the first instar molt (not shown). We conclude that
3 serves an essential role in larval development and that the majority of
3 mutant offspring die before or during ecdysis of the first instar larval molt.
importin
3D93 and
3D165 larvae express little if any full-length Importin
3 protein:
Since the phenotypes of importin
3D93 and
3D165 were no more severe over deficiencies than when homozygous, it is likely that both mutations are either null or strongly hypomorphic. This conclusion was supported by Northern blot analysis showing that
3D93/
3D93 and
3D165/
3D165 first instar larvae contained very little or no
3 mRNA (not shown, see MATERIALS AND METHODS). This was expected since the two deletions removed significant portions of the
3 5'UTR (![]()
3D93 and
3D165 mutants are due to the complete or partial absence of
3 protein. Total protein was isolated from first instar larvae and examined by immunoblotting with an antiserum against the C-terminal domain of
3 (![]()
3D93,
3D165, and
3D93/Df(3R)GB104 first instar larvae contained very little or no full-length
3 protein. Curiously, a faster-migrating anti-
3 cross-reactive band appeared in both wild-type and mutant larvae (Fig 3A; see below). The identity of this band is currently unknown.
Rescue of importin
3D93 larval lethality:
If the developmental defects of importin
3D93 and
3D165 mutants are due to the lack of
3 protein, the defects should be rescued by an
3 transgene. A Gal4tubP driver was used to express a UASp
3 transgene in a homozygous
3D93 background. As shown in Table 3, the
3 transgene rescued many
3D93/
3D93 and
3D93/
3D165 offspring to the pigmented pharate adult stage and
3D93/Df(3R)GB104 offspring to pupal stages, but none to full adulthood. Some rescued larvae completed the second and third instar molts to form morphologically normal pupae before dying, and a few became well-developed pigmented pharate adults that never eclosed (Table 3). When expressed with a Gal4Act5c driver the
3 transgene rescued
3D93/
3D93 offspring to wandering third instar larvae. These partially rescued larvae sclerotized their cuticles but did not extend their spiracles and died before becoming puparia. Full rescue may require the expression of the
3 transgene in the correct tissues at the correct time and at appropriate levels. The fact that Gal4tubP and Gal4Act5c drivers rescued to different degrees supports this possibility. Another concern is the likelihood that the
3D93 and
3D165 deletions affected not only the expression of both
3's but also the divergently transcribed cg8273 (Fig 1). The partial rescue by the
3 transgene does, however, demonstrate that the death of
3D93/
3D93 larvae around the first molt is due to defects in
3 and not in cg8273.
An objective of this study is to determine if importin
1's,
2's, and
3's have distinct and/or overlapping functions. Previously, using the Gal4/UAS expression system (![]()
1,
2, and
3 transgenes all rescued the partial male sterility of
2 null flies, but only
2 transgenes rescued the sterility of
2 null females (![]()
2 in gametogenesis appears not to be redundant with
1 and
3 in females but is redundant in males. A similar approach was taken to determine if
1 and
2 transgenes could rescue the death of
3 mutant offspring.
For these rescue experiments to be meaningful it is important that the transgenes be expressed at reasonable levels in mutant first instar larvae. Extracts from homozygous importin
3D93 first instar larvae expressing UASp
1,
2, or
3 transgenes were examined by Western blot using antibodies directed against
2 (![]()
3 (![]()
-tubulin (Fig 3B). As shown in Fig 3B,
2 and
3 were both expressed at high levels in first instar larvae carrying the UASp
2 or
3 transgenes, respectively. A slower-migrating anti-
3 cross-reactive band in mutant first instar larvae expressing UASp
1 (* in Fig 3B) is consistent with results observed when UASp
1 was expressed in
2 mutant ovaries with the Gal4pnos-VP16 driver (![]()
1 is predicted to be
60 kD and
3 is predicted to be
56.6 kD, it is likely that this band represents a cross-reaction of
1 with the anti-
3 antiserum. We conclude that all three transgenes are expressed at high levels in first instar larvae.
The expression of either the importin
1 or
2 transgene delayed the death of homozygous
3D93 offspring. Many offspring expressing UASp
1 with the Gal4tubP or Gal4Act5c drivers completed the first instar molt before dying as late-stage second instar larvae, although some larvae appeared to survive to early third instar stages (not shown). Similarly, many
3D93/
3D93 offspring expressing UASp
2 also survived the first instar larval molt before dying as late second or early third instar larvae. In some trials a few of these animals developed to puparia (not shown). We note that
3D93/
3D93 offspring expressing
1 or
2 were not able to reach pupal stages as efficiently as mutant offspring expressing
3 (Table 3). We conclude that
1 and
2 can, at least partially, replace the function(s) of
3 during larval development.
Nonsense mutation alleles of importin
3:
The results described above suggest that
3 is important for developmental events during or after the first larval molt. There are two caveats to this conclusion. First, the
3D93 and
3D165 deletions may affect the expression of cg8273, a divergently transcribed gene whose possible role in development is not known. Second, it is not certain whether the
3D93 and
3D165 alleles are null or hypomorphic. If hypomorphic, it is possible that
3 is required for even earlier stages of development. To address these issues we used two nonsense alleles,
317-7 containing a stop codon after amino acid (aa) 131 in the second ARM repeat and
3w73 containing a stop codon after aa 158 within the third ARM repeat (kindly provided by T. Herman and L. Zipursky). Since the nonsense mutations were isolated in a screen using heavy mutagenesis they may carry multiple mutations (T. HERMAN and L. ZIPURSKY, personal communications). However, by working with independently derived nonsense mutations over the
3D93 deletion chromosome we can alleviate the possible contribution of recessive mutations in cg8273 or other loci to the phenotype. Both
317-7 and
3w73 were completely lethal over
3D93,
3D165, and Df(3R)GB104 (Table 2; not shown). Importin
3w73/
3D93 offspring died as mid to late second instar larvae, indicating that the
3w73 allele may not be null. In contrast, many
317-7/
3D93 and
317-7/Df(3R)GB104 larvae died at the first/second instar molt with duplicated mouth hooks (Fig 2D; not shown), although some died as early second instar larvae. More
3D93/
317-7, like
3D93/
3D165, offspring appeared to complete ecdysis and died as early second instar larvae compared to
3D93/
3D93 and
3D165/
3D165 mutants. This is possibly due to subtle genetic background differences. Generally, then,
317-7,
3D93, and
3D165 alleles all cause death at or soon after the first larval molt. Therefore, the larval deaths of
3D93 and
3D165 mutant flies reflect defects in
3 expression that are independent of cg8273.
As expected, levels of Importin
3 protein in first instar larvae carrying
317-7 over
3D93 or Df(3R)GB104 were extremely low or undetectable (Fig 3C). The faster-migrating cross-reactive band described above is also apparent in extracts from
317-7/Df(3R)GB104 flies (Fig 3C). This finding rules out the possibility that this band is an N-terminal truncation expressed from the
3D93 chromosome. The band is unlikely to be a degradation product of maternal
3 since the faster-migrating band is also present in extracts from
3D93/
3D93 and
317-7/
3D93 larvae that were rescued to third instar by an
2 transgene (see below). The identity of this faster-migrating band is a mystery, since it appears in extracts from flies (potentially) expressing native, N-terminally truncated (
3D93 and
3D165), and C-terminally truncated (
317-7)
3 proteins, each of which has a different predicted mass. The simplest explanation is that the band is a spurious cross-reactive species that is unrelated to
3.
Importantly, expression of UASp importin
3 with Gal4tubP was able to rescue
317-7/
3D93 and
3w73/
3D93 offspring to fully viable fertile adults (Table 4; not shown). Thus, it is likely that the inability to rescue
3D93/
3D93 flies to adulthood with an
3 transgene is due to disruption of cg8273 expression. In contrast, UASp
1 and
2 transgenes were both unable to rescue
317-7/
3D93 flies to adulthood (Table 4). However, the
2 transgene was able to rescue some offspring to abnormal pharate adults, although most died at earlier stages (Table 4). Dissecting these partially rescued pharate adults from the pupal cases revealed that some adult structures were at least partially formed, including wings, tergites, sternites, thorax, and bristles. Expression of the
1 transgene rescued less well, as these offspring survived at best to late second or early third instar larvae. It is worth noting that heterozygous
3D93 flies expressing UASp
1 have a lower than expected viability (Table 4). Thus, it is possible that the overexpression of
1 causes a partial-dominant lethal phenotype. On the basis of these rescue experiments we conclude that
3 serves a mostly redundant function during larval development. However, since
1 and
2 transgenes do not rescue to adult stages it is likely that the role of
3 in the development of some adult tissues cannot be replaced by
1 or
2.
Analysis of importin
3D93 mutant eyes:
The observation that importin
3 does not appear to play an exclusively paralog-specific role in larval development led us to examine the effects of the loss of
3 on the development of adult tissues. To address this issue we created an FRT82B,
3D93 chromosome that can be used to create clones of homozygous
3D93 cells in an otherwise heterozygous fly using the FLP/FRT recombinase system (![]()
3D93 using a stock that expresses the FLP recombinase in the eye and contains a FRT82B, GMR-hid chromosome (![]()
![]()
3+/FRT82B, GMR-hid flies had well-formed eyes when FLP recombinase was expressed in the eye (![]()
|
|
Eyes homozygous for the importin
3D93 allele were highly defective (Fig 4C). Under the light microscope these eyes appeared "glassy." The
3D93 mutation did not cause a general cell-lethal phenotype in the eye, since ommatidial-like structures were visible (Fig 4C). However, the ommatidia were disorganized and did not fully develop, and interommatidial bristles were often missing (Fig 4C). Examination of tangential sections of homozygous
3D93 eyes demonstrated that the ommatidia were defective, since the photoreceptor cell rhabdomeres were not visible and the ommatidia were severely misshapen (Fig 5B).
To test whether the defective eye phenotype is truly the result of the lack of Importin
3 activity in the eye, UASp
3 was expressed in
3D93 mutant eyes using the Gal4eye driver. The
3 transgene was able to partially rescue the defect in ommatidia formation (Fig 4F), demonstrating that the glassy-eye phenotype is indeed due to the lack of
3. However, expression of the
3 transgene did not completely rescue the phenotype, as most interommatidial bristles were missing (Fig 4F). Tangential sectioning of these rescued eyes revealed that the photoreceptor cell rhabdomeres were visible, demonstrating that their loss was indeed due to a disruption in
3. However, the photoreceptors in the rescued eyes were not wild type in appearance. They appeared disorganized and misshapen and most ommatidia had an incorrect number of photoreceptors (Fig 5E). This partial rescue may be due to problems with the Gal4eye expression pattern or may be the result of the disruption of the neighboring gene as previously discussed.
To examine the specificity of Importin
3 function in the eye, UASp
1 and
2 transgenes were expressed. Eyes mutant for
3, but ectopically expressing
1, appeared to be at least partially rescued (Fig 4D). Eyes rescued with
1 still appeared partially glassy by light microscopy, but when examined by SEM it was clear that they had more well-developed ommatidia than when the transgene was not expressed (Fig 4D). Tangential sections of these eyes revealed that
1-rescued ommatidia were still largely defective, since no photoreceptor cell rhabdomeres were observed (Fig 5C). Expression of UASp
2 did not appear to affect the phenotype, since homozygous
3D93 eyes expressing
2 looked identical to those not expressing the transgene (Fig 4E) and tangential sections demonstrated that photoreceptor cell rhabdomeres were not present in these ommatidia (Fig 5D). These data suggest that
1, but not
2, is able to partially replace
3 in the eye.
We have also observed that a null mutation in importin
2,
2D14 (![]()
![]()
![]()
3D93 eyes. Eyes that were homozygous for the
3D93 mutation and heterozygous for the
2D14 allele lacked almost all ommatidial structures. These eyes appeared to be thin sheets of tissue with very little differentiation (not shown). However, for unknown reasons this enhancement was not rescued by the expression of an
2 transgene. Specifically, flies expressing UASp
2 in eyes that were homozygous for
3D93 and heterozygous for
2D14 appeared identical to those that were not expressing the transgene (not shown).
Finally, we looked at whether a hypomorphic importin
3 condition caused slight defects in eye development. To examine this we looked at tangential sections of eyes from
31(R1)/
3D93 flies. This analysis demonstrated that these ommatidia had the correct number, shape, and patterning of photoreceptor rhabdomeres (Fig 5F). We conclude that a hypomorphic
3 condition does not cause defects in eye development.
Importin
3 does not function in ring canal formation:
![]()
2 is required in the female germline to correctly form ring canals. In homozygous
2D14 ovaries, Kelch (![]()
![]()
2 transgene is able to rescue the Kelch mislocalization phenotype observed in
2 null females (![]()
1 or
3 to function in ring canal formation we examined the localization of the Kelch protein in ovaries from homozygous
2D14 females expressing UASp
1,
2, or
3 transgenes. Consistent with previous observations that
2 mutant females expressing
1 or
3 are sterile (![]()
1 or
3 did not rescue the mislocalization of Kelch (Fig 6C and Fig E). In rare cases some accumulation of weak Kelch fluorescence was observed in mutant ovaries expressing
3 (Fig 6E, arrow). It is not known whether this signal represents poorly formed ring canals or, more likely, is a staining artifact. We conclude that
1 and
3 do not function to properly target Kelch to ring canals in the same manner as
2 does.
|
| DISCUSSION |
|---|
Nuclear transport is facilitated largely by members of the karyopherin gene family. These importins and exportins bind nuclear import or export signal-bearing proteins and ferry them across the nuclear pore complex. Importin
's are adaptors that link many cNLS-containing cargoes to the karyopherin importin ß1 (![]()
![]()
![]()
gene family is composed of three clades,
1's,
2's, and
3's, although fungi and plants contain only
1 genes. With the exception of C. elegans, invertebrate and vertebrate animal genomes encode at least one importin
from each clade (![]()
![]()
![]()
![]()
![]()
1's, one
2, and two
3's. There is ample in vitro evidence that conventional importin
's mediate the import of cNLS-containing cargoes as well as paralog-specific NLS cargoes (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
gene family in metazoan animals is complicated by the individual paralogs' poorly defined NLS-cargo-binding repertoires, their differing cell type- and tissue-specific expression patterns and levels, and the likelihood that some may perform non-transport-related activities (![]()
![]()
![]()
![]()
![]()
![]()
A previous study concluded that a hypomorphic mutation in importin
3 was partially lethal with all surviving females being sterile (![]()
31 allele, which itself caused no phenotypes. Therefore, even though the
31 allele is hypomorphic, the reported phenotypes were most likely due to a second-site mutation(s). To determine whether more severe mutations in
3 cause phenotypes we generated new 5' deletion alleles (
3D93 and
3D165) and studied the effects of nonsense mutation alleles (
317-7 and
3w73) provided by T. Herman and L. Zipursky (UCLA). The fact that homozygous
3D93 and
3D165 flies and flies containing
3D93,
3D165, and
317-7 alleles over
3 deficiencies die at approximately the same stage is consistent with all three alleles being null. However, since we could not rule out by Western blot the possibility that these mutants retained low residual levels of
3 protein, they could be severe hypomorphs rather than nulls.
The analysis of these alleles demonstrates that Drosophila Importin
3 is required for the development of both larval and adult tissues. Importin
3 mutant flies die around the first larval molt, and
3 mutant eyes are severely defective and lack photoreceptor cells. The
3 mutant phenotypes are dramatically different from those of
2 mutant flies. Specifically,
2 is required for gametogenesis and apparently not for somatic development (![]()
![]()
![]()
2 causes sterility, total in females and partial in males. Interestingly,
1,
2, and
3 transgenes all rescued the male sterility defect to the same degree, but only
2 transgenes rescued the female sterility defect. These results are consistent with
2 playing a paralog-specific role in oogenesis that cannot be performed by either
1 or
3 (![]()
2 mRNA is expressed in a number of larval tissues and imaginal discs (![]()
2 null flies develop normally to adulthoodthe germline not withstandingits role in somatic development must be either unimportant or redundant with at least one of the other paralogs.
Transgene rescue studies support the conclusion that Importin
3, like
2, serves both paralog-specific and redundant roles during development. On the basis of our criteria, paralog-specific roles for
3 are those that can be rescued by only
3 transgenes. Redundant functions are those that could be rescued by an
3 and
1 and/or
2 transgenes. The most likely redundant function is the housekeeping transport of cNLS cargoes. This class of phenotype probably arises when only the mutated importin
type, in this case
3, is normally expressed at sufficient levels in the relevant tissue or when a high level of general importin
activity is required.
Drosophila importin
3 mutant offspring complete embryogenesis and hatch to first instar larvae without any apparent defects. The majority of
3 mutant offspring die during the first instar molt. At the end of each larval stage ecdysone pulses signal significant changes in gene expression that are necessary for the generation of second instar larvae (![]()
![]()
![]()
![]()
3 plays a role in facilitating this transition, perhaps by mediating the nuclear transport of signaling proteins or transcription factors that specify the transition. In this regard, homozygous
3D93 mutants containing a Gal4Act5C-expressed
3 transgene successfully completed first and second instar molts only to die near the transition from wandering third instar larvae to puparium. This is consistent with the notion that
3 is required for both the transition from first to second instar larva and the transition from larva to puparium. Thus,
3 may play a general role in developmental transitions.
Importin
3 is likely required during the first molt for a redundant function. First, since some
3 mutant larvae reach the second instar, there may be enough endogenous
1 and
2 present to partially replace the loss of
3 during the first larval molt. Importin
1 in particular is well expressed in larval tissues (![]()
3 during the first molt may be important but nonessential, whether or not
1 or
2 is present. The most convincing argument that a redundant function of
3 is required during this developmental transition is the finding that the expression of
1 and
2 transgenes rescued
3 mutant flies to later stages. In conclusion, it is likely that the cause of this phenotype is due to the preferential expression of redundant
3 activity(s) in one or more larval tissues, rather than of an
3-specific activity. Here, the preferential use of
3 to perform a redundant importin
function during larval development is analogous to the role of
2 in spermatogenesis.
The interpretation of the rescue experiments is complicated by differences in the capacity of the various transgenes to rescue the similar defects of homozygous importin
3D93 vs.
3D93/
317-7 flies. For example, only
3 transgenes rescued
3D93/
3D93 flies to pupal stages, whereas both
2 and
3, but not
1, transgenes rescued
3D93/
317-7 flies to pupal stages. Importin
2-rescued
3D93/
317-7 progeny do not properly complete pupation and, consequently, never eclose. Only
3 transgenes are capable of rescuing the latter stages of development through eclosion. We trust the
3D93/
317-7 results more because these flies would not suffer the effects of deleterious recessive alleles potentially present in homozygous
3D93/
3D93 offspring. Therefore, focusing on
3D93/
317-7 results, we conclude that an activity of
3 that is essential for pupation is at least partially redundant with
2. These functional results are consistent with phylogenetic analyses showing that
3's are more closely related to
2's than to
1's (![]()
![]()
3 transgene is able to rescue
3D93/
317-7 progeny to adults suggests that
3 does serve an
3-specific function in the development of some adult tissues.
Importin
3 has both redundant and paralog-specific roles in eye development. Homozygous
3D93 eyes appear glassy and lack photoreceptor cell rhabdomeres in adult ommatidia. These phenotypes can be mostly rescued by the expression of
3 transgenes. Only an
3 transgene was able to partially rescue the photoreceptor cell defect, indicating that
3 likely serves a paralog-specific function in the differentiation of these cells. A recent study demonstrated that a dominant-negative Importin ß1 protein expressed in the eye caused defects in development of photoreceptor cells (![]()
3 and Importin ß1 may work together to perform a nuclear transport function essential for the development of the eye. We cannot rule out the possibility that
3 is important for eye development only under the EGUF/hid experimental conditions (![]()
Expression of importin
1 improved the overall morphology of
3 mutant eyes, but these eyes still lacked recognizable photoreceptor cell rhabdomeres. Importin
1 may rescue the differentiation of nonphotoreceptor accessory cells, like pigment and cone cells, or may improve photoreceptor development enough to allow more efficient specification of accessory cell lineages. Importin
2 expression has little if any effect on the development of
3 mutant eyes. Curiously, an
2 null mutation enhanced the
3 glassy eye phenotype, suggesting that endogenous
2 and
3 may function together during eye development. However, this enhancement could not be rescued by the expression of an
2 transgene. Flies homozygous for the null
2 allele have morphologically wild-type eyes, so
2 does not appear to be required for eye development when
3 is present (![]()
![]()
![]()
1 was better than
2 at rescuing eye development, but the opposite was true for pupation, where
2 was better than
1. Rather than being contradictory, we believe these results underscore just how complex the physiology of the importin
gene family is likely to be.
We cannot rule out the possibility that the differing capacity of UASp importin
1,
2, or
3 transgenes to rescue
2 and
3 mutant phenotypes is due to differences in transgenic protein expression levels, protein stability, or post-translational modifications. However, we do note that all three transgenes appear by Western blot analyses to be well expressed (![]()
2, but not
3, transgene fully rescued phenotypes associated with the loss of
2 (Fig 6 and not shown), while the same
3 transgene, but not the
2, fully rescued phenotypes caused by the loss of
3 (Table 4). These results strongly suggest that
2 and
3 differ in their ability to perform cellular functions in vivo.
Previously, in vitro studies showed that vertebrate importin
3's specifically transported presumably essential cellular proteins, such as RCC1 and RanBP3 (![]()
![]()
![]()
![]()
3-specific activity was, therefore, surprising. It is possible that
3 protein or mRNA may be stored maternally at a low level and maintained until larval stages. However, ![]()
3 mRNA or protein in 0- to 2-hr embryos, suggesting that
3 is not stored maternally. Small amounts of
3 protein were observed in 0- to 2-hr embryos by ![]()
3 activity may be present in mutant embryos and
1- and
2-rescued mutant larvae to perform all
3 functions necessary for cell survival. Alternatively,
3-specific nuclear transport of RCC1 and RanBP3 observed in vitro may not be specific for
3 in vivo or these
3-specific functions may not be conserved from vertebrates to flies. Finally, the nuclear import of
3-specific essential cellular proteins may also be imported by a redundant nuclear targeting pathway. This appears to be the case for the import of RCC1 in vertebrate cells. RCC1 import is mediated by two distinct pathways, only one of which requires
3 (![]()
The analyses of importin
2 and
3 mutant phenotypes demonstrate that
2 is essential only for gametogenesis, while
3 appears to serve a more widespread developmental role (![]()
![]()
![]()
3 paralogs in C. elegans and porcine embryos (![]()
![]()
2's are the most derived of the three importin
types. In addition, rescue experiments with UASp
1,
2, and
3 transgenes suggest that these differential developmental roles are due, at least partly, to distinct
2 and
3 biochemical activities (![]()
gene family.
| ACKNOWLEDGMENTS |
|---|
We thank T. Herman and L. Zipursky for the importin
317-7 and
3w73 nonsense alleles; I. Kiss for the
2D14 allele; the Bloomington Stock Center for fly stocks; I. Török and B. Mechler for the anti-
2 antibodies; P. Rørth for the Gal4pnos-VP16 stock and the UASp vector; N. Shulga for assistance with confocal microscopy; A. Jonth for assistance isolating viable recombinant
31 chromosomes; H. Jasper for assistance embedding eyes; R. Angerer for the use of the UV dissecting scope; K. Bentley for sectioning embedded eyes; B. McIntyre for SEM; and T. Herman, T. Schwarz, and members of the Goldfarb and Fleming labs for helpful discussions. The monoclonal anti-Kelch antibody developed by L. Cooley was obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the National Institute of Child Health and Human Development and maintained by The University of Iowa, Department of Biological Sciences, Iowa City, IA 52242. This work was supported by grants from the March of Dimes (1-FY01-313) to D. S. Goldfarb, from the National Science Foundation (IBN-0234751) to R. Fleming, and from the National Science Foundation (CTS-6571042) to B. McIntyre.
Manuscript received July 25, 2003; Accepted for publication August 21, 2003.
| LITERATURE CITED |
|---|
ADAMS, M. D., S. E. CELNIKER, R. A. HOLT, C. A. EVANS, and J. D. GOCAYNE et al., 2000 The genome sequence of Drosophila melanogaster. Science 287:2185-2195.
ASKJAER, P., V. GALY, E. HANNAK, and I. W. MATTAJ, 2002 Ran GTPase cycle and Importins
and ß are essential for spindle formation and nuclear envelope assembly in living Caenorhabditis elegans embryos. Mol. Biol. Cell 13:4355-4370.
BEDNENKO, J., G. CINGOLANI, and L. GERACE, 2003 Nucleocytoplasmic transport: navigating the channel. Traffic 4:127-135.[Medline]
BENDER, M., 1995 Metamorphosis in Drosophila: from molecular biology to mutants. Trends Genet. 11:335-336.[Medline]
BRAND, A. H. and N. PERRIMON, 1993 Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118:401-415.[Abstract]
CABOT, R. A. and R. S. PRATHER, 2003 Cleavage stage porcine embryos may have differing developmental requirements for karyopherins
2 and
3. Mol. Reprod. Dev. 64:292-301.[Medline]
CAVENER, D. R., 1987 Comparison of the consensus sequence flanking the translational start sites in Drosophila and vertebrates. Nucleic Acids Res. 15:1353-1361.
CHOMCZYNSKI, P., 1993 A reagent for the single-step simultaneous isolation of RNA, DNA and proteins from cell and tissue samples. Biotechniques 15:532-537.[Medline]
CONTI, E., M. UY, L. LEIGHTON, G. BLOBEL, and J. KURIYAN, 1998 Crystallographic analysis of the recognition of a nuclear localization signal by the nuclear import factor karyopherin alpha. Cell 94:193-204.[Medline]
DOCKENDORFF, T. C., Z. TANG, and T. A. JONGENS, 1999 Cloning of karyopherin-alpha3 from Drosophila through its interaction with the nuclear localization sequence of germ cell-less protein. Biol. Chem. 380:1263-1272.[Medline]
EGGERT, H., K. BERGEMANN, and H. SAUMWEBER, 1998 Molecular screening for P-element insertions in a large genomic region of Drosophila melanogaster using polymerase chain reaction mediated by the vectorette. Genetics 149:1427-1434.
FANG, X. D., T. CHEN, K. TRAN, and C. S. PARKER, 2001 Developmental regulation of the heat shock response by nuclear transport factor karyopherin
3. Development 128:3349-3358.
GELES, K. G. and S. A. ADAM, 2001 Germline and developmental roles of the nuclear transport factor importin alpha3 in C. elegans. Development 128:1817-1830.[Abstract]
GELES, K. G., J. J. JOHNSON, S. JONG, and S. A. ADAM, 2002 A role for Caenorhabditis elegans Importin IMA-2 in germline and embryonic mitosis. Mol. Biol. Cell 13:3138-3147.
GIARRÈ, M., I. TÖRÖK, R. SCHMITT, M. GORJÁNÁCZ, and I. KISS et al., 2002 Patterns of importin-
expression during Drosophila spermatogenesis. J. Struct. Biol. 140:279-290.[Medline]
GORJÁNÁCZ, M., G. ÁDÁM, I. TÖRÖK, B. M. MECHLER, and T. SZLANKA et al., 2002 Importin-
2 is critically required for the assembly of ring canals during Drosophila oogenesis. Dev. Biol. 251:271-282.[Medline]
GÖRLICH, D., P. HENKELIN, R. A. LASKEY, and E. HARTMANN, 1996 A 41 amino acid motif in importin-alpha confers binding to importin-beta and hence transit into the nucleus. EMBO J. 15:1810-1817.[Medline]
GRUSS, O. J., R. E. CARAZO-SALAS, C. A. SCHATZ, G. GUARGUAGLINI, and J. KAST et al., 2001 Ran induces spindle assembly by reversing the inhibitory effect of importin alpha on TPX2 activity. Cell 104:83-93.[Medline]
GUILLEMAIN, G., M. J. MUÑOZ-ALONSO, A. CASSANY, M. LOIZEAU, and A. M. FAUSSAT et al., 2002 Karyopherin
2: a control step of glucose-sensitive gene expression in hepatic cells. Biochem. J. 362:201-209.
JIANG, C. J., K. SHOJI, R. MATSUKI, A. BABA, and N. INAGAKI et al., 2001 Molecular cloning of a novel importin
homologue from rice, by which constitutive photomorphogenic 1 (COP1) is preferentially nuclear imported. J. Biol. Chem. 276:9322-9329.
KAMEI, Y., S. YUBA, T. NAKAYMA, and Y. YONEDA, 1999 Three distinct classes of the alpha-subunit of the nuclear pore-targeting complex (importin-alpha) are differentially expressed in adult mouse tissues. J. Histochem. Cytochem. 47:363-372.
KÖHLER, M., S. ANSIEAU, S. PREHN, A. LEUTZ, and H. HALLER et al., 1997 Cloning of two novel human importin-alpha subunits and analysis of the expression pattern of the importin-alpha protein family. FEBS Lett. 417:104-108.[Medline]
KÖHLER, M., C. SPECK, M. CHRISTIANSEN, F. R. BISCHOFF, and S. PREHN et al., 1999 Evidence for distinct substrate specificities of importin alpha family members in nuclear protein import. Mol. Cell. Biol. 19:7782-7791.
KÖHLER, M., D. GÖRLICH, E. HARTMANN, and J. FRANKE, 2001 Adenoviral E1A protein nuclear import is preferentially mediated by Importin
3 in vitro.. Virology 289:186-191.[Medline]
KÖHLER, M., A. FIEBELER, M. HARTWIG, S. THIEL, and S. PREHN et al., 2002 Differential expression of classical nuclear transport factors during cellular proliferation and differentiation. Cell. Physiol. Biochem. 12:335-344.[Medline]
KOZLOVA, T. and C. S. THUMMEL, 2000 Steroid regulation of post-embryonic development and reproduction in Drosophila. Trends Endocrinol. Metab. 11:276-280.[Medline]
KUMAR, K. P., K. M. MCBRIDE, B. K. WEAVER, C. DINGWALL, and N.C. REICH, 2000 Regulated nuclear-cytoplasmic localization of interferon regulatory factor 3, a subunit of double-stranded RNA-activated factor 1. Mol. Cell. Biol. 20:4159-4168.
KUMAR, J. P., G. S. WILKIE, H. TEKOTTE, K. MOSES, and I. DAVIS, 2001 Perturbing nuclear transport in Drosophila eye imaginal discs causes specific cell adhesion and axon guidance defects. Dev. Biol. 240:315-325.[Medline]
KÜSSEL, P. and M. FRASCH, 1995 Pendulin, a Drosophila protein with cell cycle-dependent nuclear localization, is required for normal cell proliferation. J. Cell Biol. 129:1491-1507.
MACARA, I. G., 2001 Transport into and out of the nucleus. Microbiol. Mol. Biol. Rev. 65:570-594.
MALIK, H. S., T. EICKBUSH, and D. S. GOLDFARB, 1997 Evolutionary specialization of the nuclear targeting apparatus. Proc. Natl. Acad. Sci. USA 94:13738-13742.
MASON, D. A., R. J. FLEMING, and D. S. GOLDFARB, 2002 Drosophila melanogaster Importin
1 and
3 can replace Importin
2 during spermatogenesis but not oogenesis. Genetics 161:157-170.
MÁTHÉ, E., H. BATES, H. HUIKESHOVEN, P. DEÁK, and D. M. GLOVER et al., 2000 Importin-alpha3 is required at multiple stages of Drosophila development and has a role in the completion of oogenesis. Dev. Biol. 223:307-322.[Medline]
MATSUSAKA, T., N. IMAMOTO, Y. YONEDA, and M. YANAGIDA, 1998 Mutations in fission yeast Cut15 an importin
homolog, lead to mitotic progression without chromosome condensation. Curr. Biol. 8:1031-1034.[Medline]
MELÉN, K., R. FAGERLUND, J. FRANKE, M. KÖHLER, and L. KINNUNEN et al., 2003 Importin alpha nuclear localization signal binding sites for STAT1, STAT2, and influenza A virus nucleoprotein. J. Biol. Chem. 278:28193-28200.
MIYAMOTO, Y., N. IMAMOTO, T. SEKIMOTO, T. TACHIBANA, and T. SEKI et al., 1997 Differential modes of nuclear localization signal (NLS) recognition by three distinct classes of NLS receptors. J. Biol. Chem. 272:26375-26381.
NACHURY, M. V., U. RYDER, A. I. LAMOND, and K. WEIS, 1998 Cloning and characterization of hSRP1 gamma, a tissue-specific nuclear transport factor. Proc. Natl. Acad. Sci. USA 95:582-587.
NACHURY, M. V., T. J. MARESCA, W. C. SALMON, C. M. WATERMAN-STORER, and R. HEALD et al., 2001 Importin beta is a mitotic target of the small GTPase Ran in spindle assembly. Cell 104:95-106.[Medline]
NADLER, S. G., D. TRITSCHLER, O. K. HAFFAR, J. BLAKE, and A. G. BRUCE et al., 1997 Differential expression and sequence-specific interaction of karyopherin alpha with nuclear localization sequences. J. Biol. Chem. 272:4310-4315.
NEMERGUT, M. E. and I. G. MACARA, 2000 Nuclear import of the Ran exchange factor, RCC1, is mediated by at least two distinct mechanisms. J. Cell Biol. 149:835-849.
PRIEVE, M. G., K. GUTTRIDGE, J. E. MUNGUIA, and M. L. WATERMAN, 1996 The nuclear localization signal of lymphoid enhancer factor-1 is recognized by two differentially expressed Srp1-nuclear localization sequence receptor proteins. J. Biol. Chem. 13:7654-7658.
PRIEVE, M. G., K. GUTTRIDGE, J. MUNGUIA, and M. L. WATERMAN, 1998 Differential importin-alpha recognition and nuclear transport by nuclear localization signals within the high-mobility-group DNA binding domains of lymphoid enhancer factor 1 and T-cell factor 1. Mol. Cell. Biol. 18:4819-4832.
RIDDIFORD, L. M., 1993 Hormones and Drosophila development, pp. 899939 in The Development of Drosophila melanogaster, Vol. 2, edited by M. BATE and A. MARTINEZ ARIAS. Cold Spring Harbor Laboratory Press, Plainview, NY.
RØRTH, P., 1998 Gal4 in the Drosophila female germline. Mech. Dev. 78:113-118.[Medline]
SEKIMOTO, T., N. IMAMOTO, K. NAKAJIMA, T. HIRANO, and Y. YONEDA, 1997 Extracellular signal-dependent nuclear import of Stat1 is mediated by nuclear pore-targeting complex formation with NPI-1, but not Rch1. EMBO J. 16:7067-7077.[Medline]
SPRADLING, A. C., 1986 P element-mediated transformation, pp. 175197 in Drosophila: A Practical Approach, edited by D. B. ROBERTS. IRL Press, Oxford.
STERN, D. L., and E. A. SUCENA, 2000 Preparation of larval and adult cuticles for light microscopy, pp. 601616 in Drosophila Protocols, edited by W. SULLIVAN, M. ASHBURNER and R. S. HAWLEY. Cold Spring Harbor Laboratory Press, Plainview, NY.
STOWERS, R. S. and T. L. SCHWARZ, 1999 A genetic method for generating Drosophila eyes composed exclusively of mitotic clones of a single genotype. Genetics 152:1631-1639.
TABB, M. M., P. TONGAONKAR, L. VU, and M. NOMURA, 2000 Evidence for separable functions of Srp1p, the yeast homolog of importin alpha (Karyopherin alpha): role for Srp1p and Sts1p in protein degradation. Mol. Cell. Biol. 16:6062-6073.
TALCOTT, B. and M. S. MOORE, 2000 The nuclear import of RCC1 requires a specific nuclear localization sequence receptor, Karyopherin
3/QIP. J. Biol. Chem. 275:10099-10104.
TEKOTTE, H., D. BERDNIK, T. TÖRÖK, M. BUSZCZAK, and L. M. JONES et al., 2002 Dcas is required for importin
3 nuclear export and mechano-sensory organ cell fate specification in Drosophila. Dev. Biol. 244:396-406.[Medline]
THUMMEL, C. S., 1996 Flies on steroidsDrosophila metamorphosis and the mechanisms of steroid hormone action. Trends Genet. 12:306-310.[Medline]
TÖRÖK, I., D. STRAND, R. SCHMITT, G. TICK, and T. TÖRÖK et al., 1995 The overgrown hematopoietic organs-31 tumor suppressor gene of Drosophila encodes an Importin-like protein accumulating in the nucleus at the onset of mitosis. J. Cell Biol. 129:1473-1489.
TSUJI, L., T. TAKUMI, N. IMAMOTO, and Y. YONEDA, 1997 Identification of novel homologues of mouse importin alpha, the alpha subunit of the nuclear pore-targeting complex, and their tissue-specific expression. FEBS Lett. 416:30-34.[Medline]
WEIS, K., 2003 Regulating access to the genome: nucleocytoplasmic transport throughout the cell cycle. Cell 112:441-451.[Medline]
WEIS, K., U. RYDER, and A. I. LAMOND, 1996 The conserved amino-terminal domain of hSRP1 alpha is essential for nuclear protein import. EMBO J. 15:1818-1825.[Medline]
WELCH, K., J. FRANKE, M. KÖHLER, and I. G. MACARA, 1999 RanBP3 contains an unusual nuclear localization signal that is imported preferentially by importin-alpha3. Mol. Cell. Biol. 19:8400-8411.
WIESE, C., A. WILDE, M. S. MOORE, S. A. ADAM, and A. MERDES et al., 2001 Role of importin-beta in coupling Ran to downstream targets in microtubule assembly. Science 291:653-656.
WOLFF, T., 2000 Histological techniques for the Drosophila eye. Part II: adult, pp. 229243 in Drosophila Protocols, edited by W. SULLIVAN, M. ASHBURNER and R. S. HAWLEY. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
XU, T. and S. D. HARRISON, 1994 Mosaic analysis using FLP recombinase. Methods Cell Biol. 44:655-681.[Medline]
XUE, F. and L. COOLEY, 1993 Kelch encodes a component of intercellular bridges in Drosophila egg chambers. Cell 72:681-693.[Medline]
This article has been cited by other articles:
![]() |
L. M. Mikhaylova, K. Nguyen, and D. I. Nurminsky Analysis of the Drosophila melanogaster Testes Transcriptome Reveals Coordinate Regulation of Paralogous Genes Genetics, May 1, 2008; 179(1): 305 - 315. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ratan, D. A. Mason, B. Sinnot, D. S. Goldfarb, and R. J. Fleming Drosophila Importin {alpha}1 Performs Paralog-Specific Functions Essential For Gametogenesis Genetics, February 1, 2008; 178(2): 839 - 850. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Monferrer and R. Artero An Interspecific Functional Complementation Test in Drosophila for Introductory Genetics Laboratory Courses J. Hered., January 1, 2006; 97(1): 67 - 73. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Mason, D. A.
- Articles by Goldfarb, D. S.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Mason, D. A.
- Articles by Goldfarb, D. S.







