The Drosophila melanogaster importin 3 Locus Encodes an Essential Gene Required for the Development of Both Larval and Adult Tissues

Corresponding author: David S. Goldfarb, University of Rochester, Rochester, NY 14627., dasg{at}mail.rochester.edu (E-mail)

Communicating editor: K. ANDERSON

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

The nuclear transport of classical nuclear localization signal (cNLS)-containing proteins is mediated by the cNLS receptor importin . The conventional importin gene family in metazoan animals is composed of three clades that are conserved between flies and mammals and are referred to here as 1, 2, and 3. In contrast, plants and fungi contain only 1 genes. In this study we report that Drosophila importin 3 is required for the development of both larval and adult tissues. Importin 3 mutant flies die around the transition from first to second instar larvae, and homozygous importin 3 mutant eyes are defective. The transition to second instar larvae was rescued with importin 1, 2, or 3 transgenes, indicating that Importin 3 is normally required at this stage for an activity shared by all three importin 's. In contrast, an 3-specific biochemical activity(s) of Importin 3 is probably required for development to adults and photoreceptor cell development, since only an importin 3 transgene rescued these processes. These results are consistent with the view that the importin 's have both overlapping and distinct functions and that their role in animal development involves the spatial and temporal control of their expression.

MOST proteins targeted to the nucleus contain nuclear localization signals (NLSs) that are recognized by soluble receptors called karyopherins (MACARA 2001 ; BEDNENKO et al. 2003 ; WEIS 2003 ). Proteins containing classical NLSs (cNLSs) are imported bound to the importin /ß1 heterodimer. Importin serves as an adapter that links cNLS cargo to the karyopherin importin ß1, which ferries the complex through the nuclear pore complex (MACARA 2001 ; BEDNENKO et al. 2003 ; WEIS 2003 ).

The genomes of metazoan organisms encode multiple importin genes. For example, the human genome encodes six importin 's (KOHLER et al. 2002 ; CABOT and PRATHER 2003 ). Phylogenetic analyses of the importin gene family revealed that most importin 's belong to one of three evolutionarily conserved clades, designated by our nomenclature as conventional 1's, 2's, and 3's (KOHLER et al. 1997 , KOHLER et al. 1999 ; MALIK et al. 1997 ; MATHE et al. 2000 ; MASON et al. 2002 ). Conventional importin 's from plants and fungi are all 1's. In contrast, metazoan animals, with the exception of Caenorhabditis elegans (GELES and ADAM 2001 ), contain representatives from each of the three groups. Parsimony arguments suggest that metazoan 2 and 3 genes arose from 1 progenitors in ancestral single-cell eukaryotic lineages.

Vertebrate importin 's show distinct tissue- and cell-type-specific expression patterns (PRIEVE et al. 1996 ; KOHLER et al. 1997 , KOHLER et al. 2002 ; TSUJI et al. 1997 ; NACHURY et al. 1998 ; KAMEI et al. 1999 ), and human importin paralogs are differentially regulated in quiescent and proliferating cultured cells and tissue differentiation models (KOHLER et al. 2002 ). In vitro binding assays and permeabilized cell transport assays indicate that 1's, 2's, and 3's have both overlapping and distinct sets of transport cargoes (MIYAMOTO et al. 1997 ; NADLER et al. 1997 ; SEKIMOTO et al. 1997 ; PRIEVE et al. 1998 ; KOHLER et al. 1999 , KOHLER et al. 2001 ; WELCH et al. 1999 ; KUMAR et al. 2000 ; NEMERGUT and MACARA 2000 ; TALCOTT and MOORE 2000 ; JIANG et al. 2001 ; GUILLEMAIN et al. 2002 ; MELEN et al. 2003 ). For example, a vertebrate 3 has unique specificity for RCC1 (KOHLER et al. 1999 ; NEMERGUT and MACARA 2000 ; TALCOTT and MOORE 2000 ), Ran BP3 (WELCH et al. 1999 ), interferon regulatory factor 3 (KUMAR et al. 2000 ), and adenoviral E1A (KOHLER et al. 2001 ). An 2 selectively bound the glucose transporter GLUT2 (GUILLEMAIN et al. 2002 ) and an 1 specifically transported STAT1 and STAT2 transcription factors (SEKIMOTO et al. 1997 ; MELEN et al. 2003 ). Importantly, the preference of importin 's for NLS cargo can be altered when two different substrates are presented together in permeabilized cell transport assays (KOHLER et al. 1999 ). This latter finding underscores the complexity of the functional interactions between importin 's and different NLS cargo and indicates that in vivo studies are needed to unravel the physiological roles of individual importin 's.

In vivo studies are consistent with the notion that the different importin 's play distinct roles in animal development. The RNAi-mediated disruption of an 3 paralog, but not an 2, had a severe effect on the development of porcine embryos (CABOT and PRATHER 2003 ). Likewise, RNAi-mediated reductions in the expression of different importin 's caused distinct developmental defects in C. elegans (GELES and ADAM 2001 ; ASKJAER et al. 2002 ; GELES et al. 2002 ). Specifically, the C. elegans 3 paralog ima-3 is required for meiosis in the developing female germline (GELES and ADAM 2001 ), while the nonconventional ima-2 is required for mitosis (GELES et al. 2002 ). Proper spindle formation requires ima-2 but not ima-3 (ASKJAER et al. 2002 ).

The Drosophila genome encodes four importin 's (KUSSEL and FRASCH 1995 ; TOROK et al. 1995 ; DOCKENDORFF et al. 1999 ; ADAMS et al. 2000 ; MATHE et al. 2000 ; GIARRE et al. 2002 ; MASON et al. 2002 ), three of which contain conserved Importin ß1 (GORLICH et al. 1996 ; WEIS et al. 1996 ) and cNLS-binding domains (CONTI et al. 1998 ; DOCKENDORFF et al. 1999 ). The fourth predicted Drosophila importin , cg14708 (ADAMS et al. 2000 ), is extremely divergent, has a weakly conserved IBB domain, and is missing the conserved tryptophan-asparagine array that is crucial for binding to cNLS cargo (CONTI et al. 1998 ).

The three conventional Drosophila importin paralogs have different developmental stage- and cell-type-specific expression patterns (KUSSEL and FRASCH 1995 ; TOROK et al. 1995 ; DOCKENDORFF et al. 1999 ; MATHE et al. 2000 ; FANG et al. 2001 ; GIARRE et al. 2002 ). In addition, 1 and 2, but not 3, accumulate in the nucleus at the onset of mitosis (KUSSEL and FRASCH 1995 ; TOROK et al. 1995 ; MATHE et al. 2000 ; GIARRE et al. 2002 ). Null 2 mutations result in defects in gametogenesis that cause incompletely penetrant male sterility and complete female sterility (GIARRE et al. 2002 ; GORJANACZ et al. 2002 ; MASON et al. 2002 ). The 2 activity essential for female fertility appears to be unique to 2 since it cannot be replaced by the ectopic expression of 1 or 3 transgenes. In contrast, male sterility was rescued to a similar extent by the expression of 1, 2, and 3 (MASON et al. 2002 ).

Drosophila Importin 3 has been identified as a binding partner of germ cell-less (DOCKENDORFF et al. 1999 ), DNA polymerase (MATHE et al. 2000 ), and heat-shock factor (HSF; FANG et al. 2001 ). Importin 3 mRNA and protein were not detected in early embryos, coincident with the restriction of HSF to the cytoplasm (FANG et al. 2001 ). Finally, defects in 3 nuclear export correlate with specific cell fate transformations in mechano-sensory organs observed in hypomorphic mutations in the importin recycling factor Dcas (TEKOTTE et al. 2002 ). In this study we describe the developmental defects associated with severe mutations in 3 and conclude that 3 is required for the development of both larval and adult tissues. Transgene rescue studies demonstrate that the requirement for 3 in larval development can be partially replaced by ectopic expression of 1 or 2. In contrast, only ectopic 3 expression can support development to adults. In the eye, 1, but not 2, can partially replace 3 in at least some cell types, but 3 appears to be uniquely required for the proper differentiation of photoreceptor cells.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Genetic stocks and markers:
Flies were kept on standard cornmeal-dextrose media and grown at 25° unless indicated otherwise. The importin 3¹/TM6C stock is described in MATHE et al. 2000 . The FRT82B, 3^17-7/TM3 {Kr-GFP}, Sb¹ and FRT82B, 3^w73/TM3 {Kr-GFP}, Sb¹ stocks were created and provided by Tory Herman and Larry Zipursky [University of California (UCLA), Los Angeles]. The 2^D14/y⁺ CyO stock was created by Bernard Mechler (Department of Developmental Genetics, DKFZ, Heidelberg, Germany) and provided by István Kiss (Hungarian Academy of Sciences, Szeged, Hungary) (TOROK et al. 1995 ; GIARRE et al. 2002 ; GORJANACZ et al. 2002 ). The Gal4^pnos-VP16 stock (RORTH 1998 ) was provided by Pernille Rørth (EMBL, Heidelberg, Germany). The (1) Gal4^tubP (P{w + mC = tubP-GAL4}LL7)/TM3,Sb¹; (2) Gal4^Act5C (P{w[+mC] = Act5CGAL4} 17bFO1)/TM6B, Tb¹; (3) Gal4^arm (P{w[+m W.hs] = GAL4-armS}4a P{w[+mW.hs] + GAL4-arm.S}4b)/TM3, Sb¹; (4) Sb¹/TM3 P{w + mC = ActGFP}JMR2, Ser¹; (5) Df(3R)GB104/TM3, Sb¹; (6) Df(3R)by416/TM3, Sb¹; (7) Df(3R)by62/TM1; (8) TM3, Sb1, P{ry[+t7.2] = 2-3}99B/Df(3R)C7, ry[506]; and (9) Gal4^eye, UASt FLP/CyO ; FRT82B, GMR-hid, l(3)CL-R¹/TM2 (STOWERS and SCHWARZ 1999 ) stocks were obtained from the Bloomington Drosophila Stock Center at Indiana University.

PCR of importin 3¹:
Genomic DNA was prepped from single flies of the indicated genotypes and used for PCR. PCR conditions were: 2 µM primers; 1.5 mM MgCl₂; 2.5 units Taq DNA polymerase; and 2 mM dATP, dCTP, dGTP, and dTTP (annealing temperature is 62°, 30 cycles). The 5' P-element primer, PF-2 or primer 1 in Fig 1, had the sequence CGACGGGACCACCTTATGTTAT (EGGERT et al. 1998 ), and the 3' primer, 3 3'NsacII or primer 2 in Fig 1, had the sequence CGCACGCCGCGGCCTTTGCCAGCTTCTTCAGG. The resulting band that appears only when importin 3¹ is present was sequenced and shown to correspond to a P-element insertion 780 bp from the ATG of 3 (see also MATHE et al. 2000 ).

View larger version (45K): In this window In a new window Download PPT slide   Figure 1. PCR of importin 31 chromosomes and creation of deletion mutants in importin 3. (A) PCR to detect the P element in importin 31. Importin 3 and cg8273 coding regions are shown in white, the noncoding region is shown in gray, the P-element insertion in 31 is indicated by the black triangle, and primers used for PCR are indicated with arrows. Nucleotide numbers are indicated relative to the start of the 3 coding region (ATG = +1). To verify the presence of the P element in 31, DNA was isolated from single flies of the indicated genotypes and analyzed by PCR using a P-element primer (primer 1) and a primer in 3 (primer 2). Lane 1, 1-kb DNA ladder; lane 2, w1118; lane 3, 31/TM6C; lane 4, Gal4Act5C, 31/TM6B; lane 5, Gal4arm, 31/TM6B; lane 6, Gal4arm, 31/Gal4arm, 31; lane 7, Gal4arm/TM6B; lane 8, 31(R1)/TM6B; lane 9, 31(R1)/31(R1); lane 10, 31(R2)/TM6C. DNA size markers are shown in kilobases. (B) PCR to detect P-element excision-induced deletions in importin 3. DNA isolated from P-element-excised flies was analyzed by PCR using primers that flank the P-element insertion site (primers 2 and 3 in A). Two lines, importin 3D93 and 3D165, carrying small deletions in the 3 locus were identified (lanes containing bands <1.4 kb). DNA size markers are shown in kilobases. (C) Diagram of importin 3 alleles. Importin 3 and cg8273 coding regions are shown in white, the noncoding region is shown in gray, and deleted regions in 3D93 and 3D165 are indicated by black boxes. The 317-7 allele is also used in this study and contains a stop codon in place of amino acid W132 (T. HERMAN and L. ZIPURSKY, personal communication). Nucleotide numbers are indicated relative to the start of the 3 coding region (ATG = +1).

Expression constructs and germline transformations:
UASp Importin transgenes were created by cloning 1 (MASON et al. 2002 ), 2, or 3 PCR fragments containing a 5' Cavener consensus sequence (AAAATG; CAVENER 1987 ) and the 1.5-kb coding region into KpnI and NotI sites in the UASp P-element transformation vector (RORTH 1998 ). In contrast to transgenes used previously (MASON et al. 2002 ), the 2 and 3 transgenes do not contain any 2- or 3-specific 5' or 3' untranslated region (UTR) sequences. The UASp 1 transgene contains 1 nucleotide of 1 3'UTR. Transgenic UASp 1, 2, and 3 lines were created using standard germline transformation procedures (SPRADLING 1986 ). The UASp 1, 2, and 3 inserts used in this study were all located on the second chromosome.

Larval cuticle preps:
Importin 3 alleles were balanced with a green fluorescent protein (GFP)-tagged TM3 chromosome and the appropriate crosses were set up in egg-laying cups. Eggs were laid on apple juice plates overnight. Resulting first instar larvae were examined with a UV dissecting microscope and nonfluorescent larvae were removed to a plate containing standard cornmeal-dextrose media. After 24–48 hr dead larvae were isolated and larval cuticles were prepared as previously described (STERN and SUCENA 2000 ), except that 4% paraformaldehyde was used as the fixative. Cuticles were observed by differential interference contrast (DIC) imaging with a Leica TCS NT microscope equipped with UV, Ar, Kr/Ar, and He/Ne lasers. Digital images were processed using Adobe PhotoShop (Adobe Systems, San Jose, CA).

Northern and Western blots:
Total RNA and protein were isolated from Drosophila tissues with Tri-Reagent LS (Molecular Research Center, Cincinnati; CHOMCZYNSKI 1993 ) following the recommended protocols. Protein isolated from larvae of the indicated stage and genotype was analyzed by Western blot with rabbit anti-Importin 2 (TOROK et al. 1995 ) provided by Istvan Török (DKFZ, Heidelberg, Germany), rabbit anti-3 (MATHE et al. 2000 ), or a mouse anti--tubulin antibody (Amersham Biosciences, Piscataway, NJ). Blots were developed using alkaline phosophatase-tagged goat anti-rabbit secondary antibodies. The Fermentas Prestained Protein Ladder, an 10- to 180-kD size marker (Fermentas, Hanover, MD; Fig 3A and Fig C), or the GIBCO BRL (Gaithersburg, MD) benchmark size marker (Life Technologies, Grand Island, NY; Fig 3B) were used as size markers. RNA isolated from heterozygous and homozygous 3^D93 and 3^D165 mutant first instar larvae was analyzed by Northern blot with an 3 full-length random prime ³²P-labeled probe (not shown).

View larger version (179K): In this window In a new window Download PPT slide   Figure 2. Stage of lethality for importin 3 mutant larvae. Larval cuticles were prepared from (A) first instar larvae of the genotype importin 3D93/TM3 {GFP} or dead larvae of the genotypes (B) 3D93/3D93, (C) 3D165/3D165, and (D) 317-7/3D93. Note the duplicated mouth hooks in B–D.

View larger version (61K): In this window In a new window Download PPT slide   Figure 3. Importin 3 protein levels in importin 3 mutants and Importin transgene expression. (A) Protein isolated from first instar larvae of the indicated genotype was examined by Western blot with anti-Importin 3 or anti--tubulin antibodies. (B) Protein isolated from first instar larvae of the indicated genotype was examined by Western blot with anti-2, anti-3, or anti--tubulin antibodies. (C) Protein isolated from first or third instar larvae of the indicated genotype was examined by Western blot with anti-3 or anti--tubulin antibodies. The estimated sizes of the markers are indicated next to the arrows; the thick arrowhead indicates the size of the full-length 3 protein, and the thin arrowhead represents a smaller anti-3-cross-reactive band (A–C).*, the slower migrating anti-3-cross-reactive band that appears only when 1 transgenes are expressed (B); **, a second slower-migrating anti-3-cross-reactive band that appears only when an 2 transgene is expressed (B and C).

Scanning electron microscopy of adult eyes:
Flies of the indicated genotypes were dehydrated in a graded ethanol series and stored in 100% ethanol. Flies were critical point dried, coated with gold, and examined by scanning electron microscopy with a LEO 982 FESEM microscope. Digital images were processed using Adobe PhotoShop (Adobe Systems).

Eye sectioning:
Fly eyes of the indicated genotypes were embedded in Durcapan resin according to standard procedures (WOLFF 2000 ), sectioned to 1 µm thickness, stained with toluidine blue, and observed by DIC imaging. Digital images were processed using Adobe PhotoShop (Adobe Systems).

Immunofluorescence:
Ovaries were dissected from females of the indicated genotypes, fixed in 1x PBS, 4% paraformaldehyde, and blocked in PBS-saponin (1x PBS, 0.1% saponin, and 1% normal goat serum). Ovaries were incubated with a mouse anti-Kelch antibody (XUE and COOLEY 1993 ) diluted 1:1 (GORJANACZ et al. 2002 ) in PBS-saponin, followed by a goat anti-rabbit FITC-labeled secondary antibody diluted 1:300 in PBS-saponin. DNA was stained with 4',6-diamidino-2-phenylindole (DAPI) in PBS. Samples were examined by confocal microscopy and digital images were processed using Adobe PhotoShop (Adobe Systems). The anti-Kelch antibody was developed by L. Cooley and provided by the Developmental Studies Hybridoma Bank (Iowa City, IA).

Crosses:
Recombination of importin 3¹: Gal4^arm/TM3, Sb¹ or Gal4^Act5C/TM6B, Tb¹ males were crossed to importin 3¹/TM6C, Sb¹, Tb¹ virgin females. Gal4^arm/3¹ or Gal4^Act5C/3¹ virgin female offspring were collected and mated to TM3, Sb¹/TM6B, Tb¹ males. Resulting male offspring were selected for a dark red eye. These males were utilized to make stocks and the presence of the P element in 3¹ was verified by PCR (see above).

To allow importin 3¹ to recombine with a "wild-type" third chromosome, w¹¹¹⁸ males were crossed to 3¹/TM6C, Sb¹, Tb¹ females. Importin 3¹/+ virgin female offspring were collected and mated to TM3, Sb¹/TM6B, Tb¹ males. Recombinant 3¹/TM6B, Tb¹ males were mated individually to virgin females from the original 3¹/TM6C, Sb¹, Tb¹ stock. Crosses were incubated at room temperature and each vial was examined for the presence of non-Tb¹ pupal offspring. If non-Tb¹ pupae were observed the adult offspring from this cross were analyzed. Four recombinant 3¹ chromosomes were viable over the original 3¹ chromosome [designated 3^1(R1), 3^1(R2), 3^1(R3), and 3^1(R4)]. Stocks were made for the 3^1(R1) and 3^1(R2) chromosomes, and the presence of the P element was verified by PCR (Fig 1).

Analysis of importin 3¹ viability: Importin 3¹/TM6C, Sb¹, Tb¹ females were crossed to: (a) 3¹/TM6C, Sb¹, Tb¹; (b) 3^1(R1)/TM3, Sb¹; (c) 3^1(R2)/TM6C, Sb¹, Tb¹; (d) Df(3R)by416/TM3, Sb¹; (e) Df(3R)GB104/TM3, Sb¹; (f) Df(3R)by62/TM1; or (g) Gal4^arm, 3¹/TM6B, Tb¹ males. Likewise, 3^1(R1)/TM3, Sb¹ flies were crossed to (a) 3^1(R1)/TM3, Sb¹; (b) Df(3R)by416/TM3, Sb¹; (c) Df(3R)GB104/TM3, Sb¹; or (d) Df(3R)by62/TM1 flies. Finally, 3^1(R2)/TM6C, Sb¹, Tb¹ flies were crossed to (a) 3^1(R2)/TM6C, Sb¹, Tb¹ or (b) Df(3R)GB104/TM3, Sb¹. For all crosses offspring were analyzed for the presence of the appropriate markers on balancers and viability indices were calculated by dividing the number of observed offspring by the number of expected offspring if all nonhomozygous balancer genotypes were equally viable (Table 1). Offspring inheriting two copies of the same balancer (e.g., TM3, Sb¹/TM3, Sb¹) were assumed to be completely lethal. Offspring inheriting two different balancers (e.g., TM3, Sb¹/TM6C, Sb¹, Tb¹) were often lethal. However, in crosses in which these offspring were observed the viability was calculated assuming them to be fully viable.

View this table: In this window In a new window   Table 1. Viability of importin 31 chromosomes

Creating deletions in importin 3: Importin 3^1(R1)/TM3, Sb1 virgin females were crossed to TM3, Sb1, P{ry[+t7.2] = 2-3}99B/Df(3R)C7, ry[506]. "Jump start" male offspring of the genotype 3^1(R1)/TM3, Sb¹, P{ry[+t7.2] = 2-3}99B were collected and mated to TM3, Sb¹/TM6B, Tb¹ virgin females. Resulting white-eyed, non-ebony, TM3, Sb¹ or TM6B, Tb¹ male offspring were selected and mated individually to TM3, Sb¹/TM6B, Tb¹ virgin females. After 5 days of mating 10–20 males were pooled together for a genomic DNA extraction. Approximately 3 µl of this genomic DNA was then used in a PCR reaction (60° annealing temperature, 1.5 mM MgCl₂) with the 3 3'NSacII primer, primer 2 in Fig 1 (sequence above), and the 3 5' prom 2 primer, primer 3 in Fig 1 (3 5' prom 2 sequence, CCAGTTCATTGCTGTTGCTCC). Small deletions in 3 were detected by the presence of a smaller PCR product. If a pool of DNA was shown to contain an 3 deletion, DNA was extracted separately from offspring of each of the 10–20 males. This DNA was utilized in the PCR reaction as described above, enabling the identification of the specific line that contained the deletion. The shortened PCR products were gel purified with QiaQuick columns (QIAGEN, Valencia, CA) and sequenced.

Analysis of importin 3 mutant alleles: Importin 3^D93/TM3, Sb¹ flies were crossed to: (a) 3^D93/TM3, Sb¹; (b) FRT82B, 3^17-7/TM3 {GFP}, Sb¹; (c) FRT82B, 3^w73/TM3 {GFP}, Sb¹; (d) Df(3R)by416/TM3, Sb¹; (e) Df(3R)GB104/TM3, Sb¹; (f) Df(3R)by62/TM1; or (g) 3¹/TM6C, Sb¹, Tb¹ flies. Likewise, 3^D165/TM3, Sb¹ or TM6B, Tb¹ or TM3 {GFP}, Ser¹ flies were crossed to: (a) 3^D165/TM3, Sb¹; (b) FRT82B, 3^17-7/TM3 {GFP}, Sb¹; (c) FRT82B, 3^w73/TM3 {GFP}, Sb¹; (d) Df(3R)by416/TM3, Sb¹; (e) Df(3R)GB104/TM3, Sb¹; (f) Df(3R)by62/TM1; or (g) 3^D93/TM6B, Tb¹. Finally, Df(3R)GB104/TM3, Sb¹ flies were crossed to (a) FRT82B, 3^17-7/TM3 {GFP}, Sb¹ or (b) FRT82B, 3^w73/TM3 {GFP}, Sb¹ flies. For all crosses offspring were analyzed for the presence of the appropriate markers on balancers and viability indices were calculated as described above (Table 2).

View this table: In this window In a new window   Table 2. Viability of importin 3 mutants

To determine the approximate stage of lethality the importin 3 mutant alleles and deficiency chromosomes were balanced with TM3 {GFP} chromosomes and the appropriate crosses were repeated in egg-laying cups. Embryos were allowed to hatch and early first instar larvae were sorted by fluorescence. Nonfluorescent first instar larvae were collected on a cornmeal agar plate and their development was observed at 25°.

Rescue of importin 3^D93/3^D93 lethality: Male flies of the genotype UASp importin 1, 2 or 3/UASp 1, 2, or 3; FRT82B, 3^D93/TM3 {GFP}, Ser¹ (males carrying UASp 1 had the original 3^D93 chromosome instead of FRT82B, 3^D93) were crossed to virgin females of the genotype Gal4^tubP, 3^D93/TM3 {GFP}, Ser¹. Progeny were scored at the onset of pupariation for fluorescence when observed through the side of the vial with a UV dissecting microscope. The resulting adult progeny were scored for the presence of the Ser¹ marker on the TM3{GFP}, Ser¹ chromosome. Viability indices were calculated by dividing the number of observed offspring by the number of expected offspring if all nonhomozygous balancer genotypes were viable to the indicated stage (Table 3). Due to the partial penetrance of Ser¹, all non-Ser¹ flies were assayed for fluorescence with a UV dissecting microscope to conclusively determine their genotype. As a negative control, 3^D93/TM3{GFP}, Ser¹ males were mated to Gal4^tubP, 3^D93/TM3{GFP}, Ser¹ females.

View this table: In this window In a new window   Table 3. Rescue of importin 3D93/3D93 lethality

The approximate stage of lethality for UASp importin 1, 2, or 3;3^D93/Gal4^tubP, 3^D93 offspring was determined as previously described. FRT82B, 3^D93/Gal4^tubP, 3^D93 and 3^D93/Gal4^tubP, 3^D93 offspring served as negative controls.

Rescue of importin 3^D93/3^17-7 lethality: Male flies of the genotype UASp importin 1, 2, or 3/CyO; Gal4^tubP, 3^D93/TM3 {GFP}, Ser¹ were crossed to females of the genotype FRT82B, 3^17-7/TM3 {GFP}, Sb¹. Progeny were scored at the onset of pupariation as previously described. It was assumed that all nonfluorescent pupae had inherited the UASp importin transgene and not CyO. Adult offspring were scored for the presence of the CyO, TM3 {GFP}, Ser¹, and TM3 {GFP}, Sb¹ balancers using the appropriate markers. Viability indices were calculated as previously described, except we assumed that all CyO; Gal4^tubP, 3^D93/ FRT82B, 3^17-7 offspring died as first/second instar larvae and, therefore, zero offspring of this genotype were expected at later stages. The viability of adult progeny was calculated for (a) UASp 1, 2 or 3 ; Gal4^tubP, 3^D93/ FRT82B, 3^17-7 experimental flies and (b) UASp 1, 2, or 3; Gal4^tubP, 3^D93/TM3 {GFP}, Sb¹ positive control flies (Table 4). As a negative control Gal4^tubP, 3^D93/TM3 {GFP}, Ser¹ males were crossed to FRT82B, 3^17-7/TM3{GFP}, Sb¹ females and the viability of Gal4^tubP, 3^D93/FRT82B, 3^17-7 offspring was calculated at puparium, pharate adult, and adult stages (Table 4). Due to the partial penetrance of Ser¹, all non-Ser¹ flies were assayed for fluorescence with a UV dissecting microscope to conclusively determine their genotype. The approximate stage of lethality for UASp 1, 2, or 3;FRT82B, 3^17-7/Gal4^tubP, 3^D93 off-spring was determined as previously described. FRT82B, 3^17-7/Gal4^tubP, 3^D93 and FRT82B, 3^17-7/3^D93 offspring served as negative controls.

View this table: In this window In a new window   Table 4. Rescue of importin 3D93/317-7 lethality

Generating homozygous importin 3^D93 eyes using EGUF/hid: UASt FLP, Gal4^eye/CyO; FRT82B, GMR-hid, l(3)CL-R¹/TM6B females were crossed to: (a) FRT82B, 3⁺, 87E P-lacW [w⁺]/FRT82B, importin 3⁺, 87E P-lacW [w⁺] or (b) FRT82B, 3^D93/TM6B flies. Adult offspring of the genotype (a) UASt FLP, Gal4^eye/+; FRT82B, GMR-hid, l(3)CL-R¹/FRT82B, 3⁺, 87E P-lacW [w⁺] or (b)UASt FLP, Gal4^eye/+; FRT82B, GMR-hid, l(3)CL-R¹/FRT82B, 3^D93 were selected for and their eyes were analyzed by scanning electron microscopy (SEM) and tangential sectioning.

Rescue of homozygous importin 3^D93 eyes: UASt FLP, Gal4^eye/CyO; FRT82B, GMR-hid, l(3)CL-R¹/TM6B females were crossed to UASp importin 1, 2, or 3/CyO; FRT82B, 3^D93/TM6B males. Adult offspring of the genotype UASt FLP, Gal4^eye/UASp 1, 2, or 3 ; FRT82B, GMR-hid, l(3)CL-R¹/FRT82B, 3^D93 were selected for and their eyes were analyzed by SEM and tangential sectioning.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Phenotypes associated with importin 3¹ can be removed by recombination:
A Drosophila importin 3 hypomorphic mutation, 3¹, was reported to greatly reduce viability, and all surviving females were sterile (MATHE et al. 2000 ). The 3¹ allele is associated with a P-element insertion (P-lacW [w⁺]) located 780 bp upstream of the start codon (MATHE et al. 2000 ). To determine if UASp 1, 2, or 3 transgenes could rescue the homozygous 3¹ phenotypes a Gal4^arm driver was recombined onto the same chromosome as 3¹. Unexpectedly, the Gal4^arm, 3¹ chromosome was homozygous viable (Table 1) and homozygous females were fertile (not shown). The presence and correct position of the 3¹ P element was confirmed by PCR (Fig 1). Therefore, the low viability and female sterility of 3¹ flies is likely not due to the hypomorphic 3 mutation. Alternatively, it is possible that the chromosome containing the Gal4^arm driver carries a suppressor of the 3¹ mutation.

To distinguish between these possibilities we repeated the recombination experiment using an independent third chromosome from a "normal" w¹¹¹⁸ stock. This analysis showed that 4 out of 74 recombinant P-lacW [w⁺]-containing chromosomes [importin 3^1(R1), 3^1(R2), 3^1(R3), and 3^1(R4)] supported good viability over the original 3¹ chromosome (Table 1; not shown). The presence and position of the P-element insert was confirmed by PCR for two of the recombinant chromosomes [3^1(R1) and 3^1(R2); Fig 1]. Flies homozygous for 3^1(R1) were viable (Table 1) and the females were fertile (not shown). These results confirm that the original P-lacW[w⁺] insertion could not have been solely responsible for the reported phenotypes. For unknown reasons flies homozygous for 3^1(R2) were homozygous lethal despite the fact that they were viable over the original 3¹ allele (Table 1).

We also examined the viability of the original and recombinant importin 3¹ alleles over various deficiencies. Flies carrying the original 3¹ allele or the recombinant 3^1(R1) were viable and female progeny were fertile over Df(3R)by416, breakpoints 085D10–12;085E01–03; Df(3R)GB104, breakpoints 085D12;085E10; and Df(3R)by62, breakpoints 085D11–14; 085F06 (Table 1; MATHE et al. 2000 ; not shown). Further experiments demonstrated that all three of these deficiencies uncover 3 (Table 2; Fig 3; not shown). Taken together, these results indicate that a second site mutation(s) on the original 3¹ chromosome either caused or contributed strongly to the published phenotypes (MATHE et al. 2000 ). The discovery that the 3¹ allele is viable and female fertile over deficiencies and loss-of-function 3 alleles (see below) suggests that the second-site mutation is the major contributor to these phenotypes. Although 3¹ flies were demonstrably hypomorphic for 3 protein expression (MATHE et al. 2000 ), the reduced 3 levels are apparently not deleterious to the organism.

P-element excision-induced alleles of importin 3:
In search of more severe importin 3 mutations, a P-element excision mutagenesis was used to create small deletions in the 3 coding sequence. The P element in the clean 3^1(R1) stock was mobilized and offspring were selected for the loss of the P element (loss of white⁺). A PCR assay using primers flanking the P-element insertion site was used to screen for imprecise P-element excision events (Fig 1). Two small deletions in the 3 gene (3^D93 and 3^D165) were identified (Fig 1). Sequencing of the shortened PCR products revealed that the 3^D93 deletion removes 897 bp from the 5' region of 3, including the coding sequence for the first 20 amino acids. The 3^D165 deletion removes 619 bp but no coding sequence (Fig 1). Because the original 3¹ P element was inserted in the 5' region between 3 and the convergently transcribed predicted open reading frame cg8273 (ADAMS et al. 2000 ), only 125 nucleotides remain upstream of one of the predicted start sites of cg8273 in 3^D93 and 3^D165 (Fig 1). Thus, it is possible that the expression of cg8273 will be affected by 3^D93 and 3^D165 deletions.

The importin 3^D93 and 3^D165 mutations were both homozygous lethal and lethal over each other (Table 2). In addition, 3^D93 was lethal over Df(3R)by416, Df(3R)GB104, and Df(3R)by62 (Table 2). Importin 3^D93/3¹ flies were completely viable (Table 2) and the females were fertile (not shown), confirming our conclusion that the 3¹ allele does not yield severe phenotypes. In conclusion, this strategy produced recessive lethal 3 mutants, thereby demonstrating that 3 is an essential gene in flies.

Importin 3 deletion mutants do not develop past larval stages:
To determine when importin 3 mutant flies die, 3^D93 and 3^D165 chromosomes were balanced with a TM3 chromosome marked by GFP (TM3{GFP}, Ser¹). In this fashion homozygous mutant offspring could be distinguished from heterozygotes by GFP fluorescence. Homozygous 3^D93 and 3^D165 offspring completed embryogenesis and formed normal-appearing first instar larvae. Most homozygous mutant 3^D93 and 3^D165 first instar larvae were able to duplicate their mouth hooks in preparation for molting (Fig 2B and Fig C), but most died before completing ecdysis. Of the offspring that did begin ecdysis most died while still attached or immediately adjacent to their first instar cuticles. Rarely first instar cuticles were found that were not associated with dead larvae. These larvae presumably died as very early second instar larvae, since we never observed any crawling homozygous mutant second instar larvae. Offspring carrying 3^D93 or 3^D165 deletions over Df(3R)by416 or Df(3R)GB104 also died around the first instar molt (not shown). We conclude that 3 serves an essential role in larval development and that the majority of 3 mutant offspring die before or during ecdysis of the first instar larval molt.

importin 3^D93 and 3^D165 larvae express little if any full-length Importin 3 protein:
Since the phenotypes of importin 3^D93 and 3^D165 were no more severe over deficiencies than when homozygous, it is likely that both mutations are either null or strongly hypomorphic. This conclusion was supported by Northern blot analysis showing that 3^D93/3^D93 and 3^D165/3^D165 first instar larvae contained very little or no 3 mRNA (not shown, see MATERIALS AND METHODS). This was expected since the two deletions removed significant portions of the 3 5'UTR (MATHE et al. 2000 ; Fig 1C). Immunoblot analysis was used to investigate whether the first-second instar arrest phenotypes of homozygous 3^D93 and 3^D165 mutants are due to the complete or partial absence of 3 protein. Total protein was isolated from first instar larvae and examined by immunoblotting with an antiserum against the C-terminal domain of 3 (MATHE et al. 2000 ). As shown in Fig 3, homozygous 3^D93, 3^D165, and 3^D93/Df(3R)GB104 first instar larvae contained very little or no full-length 3 protein. Curiously, a faster-migrating anti-3 cross-reactive band appeared in both wild-type and mutant larvae (Fig 3A; see below). The identity of this band is currently unknown.

Rescue of importin 3^D93 larval lethality:
If the developmental defects of importin 3^D93 and 3^D165 mutants are due to the lack of 3 protein, the defects should be rescued by an 3 transgene. A Gal4^tubP driver was used to express a UASp 3 transgene in a homozygous 3^D93 background. As shown in Table 3, the 3 transgene rescued many 3^D93/3^D93 and 3^D93/3^D165 offspring to the pigmented pharate adult stage and 3^D93/Df(3R)GB104 offspring to pupal stages, but none to full adulthood. Some rescued larvae completed the second and third instar molts to form morphologically normal pupae before dying, and a few became well-developed pigmented pharate adults that never eclosed (Table 3). When expressed with a Gal4^Act5c driver the 3 transgene rescued 3^D93/3^D93 offspring to wandering third instar larvae. These partially rescued larvae sclerotized their cuticles but did not extend their spiracles and died before becoming puparia. Full rescue may require the expression of the 3 transgene in the correct tissues at the correct time and at appropriate levels. The fact that Gal4^tubP and Gal4^Act5c drivers rescued to different degrees supports this possibility. Another concern is the likelihood that the 3^D93 and 3^D165 deletions affected not only the expression of both 3's but also the divergently transcribed cg8273 (Fig 1). The partial rescue by the 3 transgene does, however, demonstrate that the death of 3^D93/3^D93 larvae around the first molt is due to defects in 3 and not in cg8273.

An objective of this study is to determine if importin 1's, 2's, and 3's have distinct and/or overlapping functions. Previously, using the Gal4/UAS expression system (BRAND and PERRIMON 1993 ), we showed that 1, 2, and 3 transgenes all rescued the partial male sterility of 2 null flies, but only 2 transgenes rescued the sterility of 2 null females (MASON et al. 2002 ). Thus the role of 2 in gametogenesis appears not to be redundant with 1 and 3 in females but is redundant in males. A similar approach was taken to determine if 1 and 2 transgenes could rescue the death of 3 mutant offspring.

For these rescue experiments to be meaningful it is important that the transgenes be expressed at reasonable levels in mutant first instar larvae. Extracts from homozygous importin 3^D93 first instar larvae expressing UASp 1, 2, or 3 transgenes were examined by Western blot using antibodies directed against 2 (TOROK et al. 1995 ), 3 (MATHE et al. 2000 ), or -tubulin (Fig 3B). As shown in Fig 3B, 2 and 3 were both expressed at high levels in first instar larvae carrying the UASp 2 or 3 transgenes, respectively. A slower-migrating anti-3 cross-reactive band in mutant first instar larvae expressing UASp 1 (* in Fig 3B) is consistent with results observed when UASp 1 was expressed in 2 mutant ovaries with the Gal4^pnos-VP16 driver (MASON et al. 2002 ). Since 1 is predicted to be 60 kD and 3 is predicted to be 56.6 kD, it is likely that this band represents a cross-reaction of 1 with the anti-3 antiserum. We conclude that all three transgenes are expressed at high levels in first instar larvae.

The expression of either the importin 1 or 2 transgene delayed the death of homozygous 3^D93 offspring. Many offspring expressing UASp 1 with the Gal4^tubP or Gal4^Act5c drivers completed the first instar molt before dying as late-stage second instar larvae, although some larvae appeared to survive to early third instar stages (not shown). Similarly, many 3^D93/3^D93 offspring expressing UASp 2 also survived the first instar larval molt before dying as late second or early third instar larvae. In some trials a few of these animals developed to puparia (not shown). We note that 3^D93/3^D93 offspring expressing 1 or 2 were not able to reach pupal stages as efficiently as mutant offspring expressing 3 (Table 3). We conclude that 1 and 2 can, at least partially, replace the function(s) of 3 during larval development.

Nonsense mutation alleles of importin 3:
The results described above suggest that 3 is important for developmental events during or after the first larval molt. There are two caveats to this conclusion. First, the 3^D93 and 3^D165 deletions may affect the expression of cg8273, a divergently transcribed gene whose possible role in development is not known. Second, it is not certain whether the 3^D93 and 3^D165 alleles are null or hypomorphic. If hypomorphic, it is possible that 3 is required for even earlier stages of development. To address these issues we used two nonsense alleles, 3^17-7 containing a stop codon after amino acid (aa) 131 in the second ARM repeat and 3^w73 containing a stop codon after aa 158 within the third ARM repeat (kindly provided by T. Herman and L. Zipursky). Since the nonsense mutations were isolated in a screen using heavy mutagenesis they may carry multiple mutations (T. HERMAN and L. ZIPURSKY, personal communications). However, by working with independently derived nonsense mutations over the 3^D93 deletion chromosome we can alleviate the possible contribution of recessive mutations in cg8273 or other loci to the phenotype. Both 3^17-7 and 3^w73 were completely lethal over 3^D93, 3^D165, and Df(3R)GB104 (Table 2; not shown). Importin 3^w73/3^D93 offspring died as mid to late second instar larvae, indicating that the 3^w73 allele may not be null. In contrast, many 3^17-7/3^D93 and 3^17-7/Df(3R)GB104 larvae died at the first/second instar molt with duplicated mouth hooks (Fig 2D; not shown), although some died as early second instar larvae. More 3^D93/3^17-7, like 3^D93/3^D165, offspring appeared to complete ecdysis and died as early second instar larvae compared to 3^D93/3^D93 and 3^D165/3^D165 mutants. This is possibly due to subtle genetic background differences. Generally, then, 3^17-7, 3^D93, and 3^D165 alleles all cause death at or soon after the first larval molt. Therefore, the larval deaths of 3^D93 and 3^D165 mutant flies reflect defects in 3 expression that are independent of cg8273.

As expected, levels of Importin 3 protein in first instar larvae carrying 3^17-7 over 3^D93 or Df(3R)GB104 were extremely low or undetectable (Fig 3C). The faster-migrating cross-reactive band described above is also apparent in extracts from 3^17-7/Df(3R)GB104 flies (Fig 3C). This finding rules out the possibility that this band is an N-terminal truncation expressed from the 3^D93 chromosome. The band is unlikely to be a degradation product of maternal 3 since the faster-migrating band is also present in extracts from 3^D93/3^D93 and 3^17-7/3^D93 larvae that were rescued to third instar by an 2 transgene (see below). The identity of this faster-migrating band is a mystery, since it appears in extracts from flies (potentially) expressing native, N-terminally truncated (3^D93 and 3^D165), and C-terminally truncated (3^17-7) 3 proteins, each of which has a different predicted mass. The simplest explanation is that the band is a spurious cross-reactive species that is unrelated to 3.

Importantly, expression of UASp importin 3 with Gal4^tubP was able to rescue 3^17-7/3^D93 and 3^w73/3^D93 offspring to fully viable fertile adults (Table 4; not shown). Thus, it is likely that the inability to rescue 3^D93/3^D93 flies to adulthood with an 3 transgene is due to disruption of cg8273 expression. In contrast, UASp 1 and 2 transgenes were both unable to rescue 3^17-7/3^D93 flies to adulthood (Table 4). However, the 2 transgene was able to rescue some offspring to abnormal pharate adults, although most died at earlier stages (Table 4). Dissecting these partially rescued pharate adults from the pupal cases revealed that some adult structures were at least partially formed, including wings, tergites, sternites, thorax, and bristles. Expression of the 1 transgene rescued less well, as these offspring survived at best to late second or early third instar larvae. It is worth noting that heterozygous 3^D93 flies expressing UASp 1 have a lower than expected viability (Table 4). Thus, it is possible that the overexpression of 1 causes a partial-dominant lethal phenotype. On the basis of these rescue experiments we conclude that 3 serves a mostly redundant function during larval development. However, since 1 and 2 transgenes do not rescue to adult stages it is likely that the role of 3 in the development of some adult tissues cannot be replaced by 1 or 2.

Analysis of importin 3^D93 mutant eyes:
The observation that importin 3 does not appear to play an exclusively paralog-specific role in larval development led us to examine the effects of the loss of 3 on the development of adult tissues. To address this issue we created an FRT82B, 3^D93 chromosome that can be used to create clones of homozygous 3^D93 cells in an otherwise heterozygous fly using the FLP/FRT recombinase system (XU and HARRISON 1994 ). We subsequently generated eyes that were homozygous for 3^D93 using a stock that expresses the FLP recombinase in the eye and contains a FRT82B, GMR-hid chromosome (STOWERS and SCHWARZ 1999 ). The GMR-hid element drives the expression of the apoptosis-inducing gene hid under the control of the eye-specific GMR enhancer. Consequently, any eye cell that contains one or two copies of GMR-hid undergoes apoptosis during early pupal stages. Therefore, only cells that have lost this chromosome through mitotic recombination survive to form adult eyes (STOWERS and SCHWARZ 1999 ; Fig 4A). Consistent with previous results, we observed that FRT82B, 3⁺/FRT82B, GMR-hid flies had well-formed eyes when FLP recombinase was expressed in the eye (STOWERS and SCHWARZ 1999 ; Fig 4B), although the photoreceptor patterning observed in eye sections appears to be slightly defective (Fig 5A).

View larger version (120K): In this window In a new window Download PPT slide   Figure 4. SEM of importin 3 mutant and rescued eyes. Flies of the genotypes (A) Gal4eye, UASt FLP; FRT82B, GMR-hid/TM6B; (B) Gal4eye, UASt FLP; FRT82B, GMR-hid/FRT82B, importin 3+; (C) Gal4eye, UASt FLP; FRT82B, GMR-hid/FRT82B, 3D93; (D) Gal4eye, UASt FLP/UASp 1; FRT82B, GMR-hid/FRT82B, 3D93; (E) Gal4eye, UASt FLP/UASp 2; FRT82B, GMR-hid/FRT82B, 3D93; and (F) Gal4eye, UASt FLP/UASp 3; FRT82B, GMR-hid/FRT82B, 3D93 were critical-point dried and examined by scanning electron microscopy.

View larger version (146K): In this window In a new window Download PPT slide   Figure 5. Tangential sections through importin 3 mutant and rescued eyes. Eyes dissected from flies of the genotypes (A) Gal4eye, UASt FLP ; FRT82B, GMR-hid/FRT82B, 3+; (B) Gal4eye, UASt FLP; FRT82B, GMR-hid/FRT82B, importin 3D93; (C) Gal4eye, UASt FLP/UASp 1 ; FRT82B, GMR-hid/FRT82B, 3D93; (D) Gal4eye, UASt FLP/UASp 2;FRT82B, GMR-hid/FRT82B, 3D93; (E) Gal4eye, UASt FLP/UASp 3;FRT82B, GMR-hid/FRT82B, 3D93; and (F) 31(R1)/3D93 were embedded in resin, sectioned, and toluidine blue stained. Note the absence of photoreceptor rhabdomeres in B–D.

Eyes homozygous for the importin 3^D93 allele were highly defective (Fig 4C). Under the light microscope these eyes appeared "glassy." The 3^D93 mutation did not cause a general cell-lethal phenotype in the eye, since ommatidial-like structures were visible (Fig 4C). However, the ommatidia were disorganized and did not fully develop, and interommatidial bristles were often missing (Fig 4C). Examination of tangential sections of homozygous 3^D93 eyes demonstrated that the ommatidia were defective, since the photoreceptor cell rhabdomeres were not visible and the ommatidia were severely misshapen (Fig 5B).

To test whether the defective eye phenotype is truly the result of the lack of Importin 3 activity in the eye, UASp 3 was expressed in 3^D93 mutant eyes using the Gal4^eye driver. The 3 transgene was able to partially rescue the defect in ommatidia formation (Fig 4F), demonstrating that the glassy-eye phenotype is indeed due to the lack of 3. However, expression of the 3 transgene did not completely rescue the phenotype, as most interommatidial bristles were missing (Fig 4F). Tangential sectioning of these rescued eyes revealed that the photoreceptor cell rhabdomeres were visible, demonstrating that their loss was indeed due to a disruption in 3. However, the photoreceptors in the rescued eyes were not wild type in appearance. They appeared disorganized and misshapen and most ommatidia had an incorrect number of photoreceptors (Fig 5E). This partial rescue may be due to problems with the Gal4^eye expression pattern or may be the result of the disruption of the neighboring gene as previously discussed.

To examine the specificity of Importin 3 function in the eye, UASp 1 and 2 transgenes were expressed. Eyes mutant for 3, but ectopically expressing 1, appeared to be at least partially rescued (Fig 4D). Eyes rescued with 1 still appeared partially glassy by light microscopy, but when examined by SEM it was clear that they had more well-developed ommatidia than when the transgene was not expressed (Fig 4D). Tangential sections of these eyes revealed that 1-rescued ommatidia were still largely defective, since no photoreceptor cell rhabdomeres were observed (Fig 5C). Expression of UASp 2 did not appear to affect the phenotype, since homozygous 3^D93 eyes expressing 2 looked identical to those not expressing the transgene (Fig 4E) and tangential sections demonstrated that photoreceptor cell rhabdomeres were not present in these ommatidia (Fig 5D). These data suggest that 1, but not 2, is able to partially replace 3 in the eye.

We have also observed that a null mutation in importin 2, 2^D14 (TOROK et al. 1995 ; GIARRE et al. 2002 ; GORJANACZ et al. 2002 ), was able to enhance the eye defect observed in homozygous 3^D93 eyes. Eyes that were homozygous for the 3^D93 mutation and heterozygous for the 2^D14 allele lacked almost all ommatidial structures. These eyes appeared to be thin sheets of tissue with very little differentiation (not shown). However, for unknown reasons this enhancement was not rescued by the expression of an 2 transgene. Specifically, flies expressing UASp 2 in eyes that were homozygous for 3^D93 and heterozygous for 2^D14 appeared identical to those that were not expressing the transgene (not shown).

Finally, we looked at whether a hypomorphic importin 3 condition caused slight defects in eye development. To examine this we looked at tangential sections of eyes from 3^1(R1)/3^D93 flies. This analysis demonstrated that these ommatidia had the correct number, shape, and patterning of photoreceptor rhabdomeres (Fig 5F). We conclude that a hypomorphic 3 condition does not cause defects in eye development.

Importin 3 does not function in ring canal formation:
GORJANACZ et al. 2002 have recently demonstrated that Importin 2 is required in the female germline to correctly form ring canals. In homozygous 2^D14 ovaries, Kelch (XUE and COOLEY 1993 ) is not targeted to the ring canal correctly, correlating with a defect in transfer of maternal material from the nurse cells to the developing oocyte (GORJANACZ et al. 2002 ). Expression of a UASp 2 transgene is able to rescue the Kelch mislocalization phenotype observed in 2 null females (GORJANACZ et al. 2002 ; Fig 6D). To examine the ability of 1 or 3 to function in ring canal formation we examined the localization of the Kelch protein in ovaries from homozygous 2^D14 females expressing UASp 1, 2, or 3 transgenes. Consistent with previous observations that 2 mutant females expressing 1 or 3 are sterile (MASON et al. 2002 ), we found that expression of 1 or 3 did not rescue the mislocalization of Kelch (Fig 6C and Fig E). In rare cases some accumulation of weak Kelch fluorescence was observed in mutant ovaries expressing 3 (Fig 6E, arrow). It is not known whether this signal represents poorly formed ring canals or, more likely, is a staining artifact. We conclude that 1 and 3 do not function to properly target Kelch to ring canals in the same manner as 2 does.

View larger version (84K): In this window In a new window Download PPT slide   Figure 6. Kelch staining of ovaries from importin 2 null females rescued with importin transgenes. Ovaries dissected from females of the genotypes (A) w1118; (B) importin 2D14/2D14 ; Gal4pnos-VP16/TM6B; (C) 2D14, UASp 1/2D14 ; Gal4pnos-VP16; (D) 2D14, UASp 2/2D14 ; Gal4pnos-VP16; and (E) 2D14, UASp 3/2D14 ; Gal4pnos-VP16 were stained with an anti-Kelch antibody (green) and DAPI (blue). Note the Kelch-stained ring canals (arrowheads) in A and D and their absence in B, C, and E. Rarely, some very faint fluorescent anti-Kelch-stained structures are observed in 2D14, UASp 3/2D14 ; Gal4pnos-VP16 ovaries (arrows in E).

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Nuclear transport is facilitated largely by members of the karyopherin gene family. These importins and exportins bind nuclear import or export signal-bearing proteins and ferry them across the nuclear pore complex. Importin 's are adaptors that link many cNLS-containing cargoes to the karyopherin importin ß1 (MACARA 2001 ; BEDNENKO et al. 2003 ; WEIS 2003 ). The conventional importin gene family is composed of three clades, 1's, 2's, and 3's, although fungi and plants contain only 1 genes. With the exception of C. elegans, invertebrate and vertebrate animal genomes encode at least one importin from each clade (KOHLER et al. 1997 , KOHLER et al. 1999 ; MALIK et al. 1997 ; MATHE et al. 2000 ; MASON et al. 2002 ). For example, humans contain three 1's, one 2, and two 3's. There is ample in vitro evidence that conventional importin 's mediate the import of cNLS-containing cargoes as well as paralog-specific NLS cargoes (MIYAMOTO et al. 1997 ; NADLER et al. 1997 ; SEKIMOTO et al. 1997 ; PRIEVE et al. 1998 ; KOHLER et al. 1999 , KOHLER et al. 2001 ; WELCH et al. 1999 ; KUMAR et al. 2000 ; NEMERGUT and MACARA 2000 ; TALCOTT and MOORE 2000 ; JIANG et al. 2001 ; GUILLEMAIN et al. 2002 ; MELEN et al. 2003 ). The in vivo analysis of the importin gene family in metazoan animals is complicated by the individual paralogs' poorly defined NLS-cargo-binding repertoires, their differing cell type- and tissue-specific expression patterns and levels, and the likelihood that some may perform non-transport-related activities (MATSUSAKA et al. 1998 ; TABB et al. 2000 ; GRUSS et al. 2001 ; NACHURY et al. 2001 ; WIESE et al. 2001 ; ASKJAER et al. 2002 ).

A previous study concluded that a hypomorphic mutation in importin 3 was partially lethal with all surviving females being sterile (MATHE et al. 2000 ). However, these phenotypes did not cosegregate with the P element in the 3¹ allele, which itself caused no phenotypes. Therefore, even though the 3¹ allele is hypomorphic, the reported phenotypes were most likely due to a second-site mutation(s). To determine whether more severe mutations in 3 cause phenotypes we generated new 5' deletion alleles (3^D93 and 3^D165) and studied the effects of nonsense mutation alleles (3^17-7 and 3^w73) provided by T. Herman and L. Zipursky (UCLA). The fact that homozygous 3^D93 and 3^D165 flies and flies containing 3^D93, 3^D165, and 3^17-7 alleles over 3 deficiencies die at approximately the same stage is consistent with all three alleles being null. However, since we could not rule out by Western blot the possibility that these mutants retained low residual levels of 3 protein, they could be severe hypomorphs rather than nulls.

The analysis of these alleles demonstrates that Drosophila Importin 3 is required for the development of both larval and adult tissues. Importin 3 mutant flies die around the first larval molt, and 3 mutant eyes are severely defective and lack photoreceptor cells. The 3 mutant phenotypes are dramatically different from those of 2 mutant flies. Specifically, 2 is required for gametogenesis and apparently not for somatic development (GIARRE et al. 2002 ; GORJANACZ et al. 2002 ; MASON et al. 2002 ). The loss of 2 causes sterility, total in females and partial in males. Interestingly, 1, 2, and 3 transgenes all rescued the male sterility defect to the same degree, but only 2 transgenes rescued the female sterility defect. These results are consistent with 2 playing a paralog-specific role in oogenesis that cannot be performed by either 1 or 3 (MASON et al. 2002 ). Normally, 2 mRNA is expressed in a number of larval tissues and imaginal discs (TOROK et al. 1995 ), but, since 2 null flies develop normally to adulthood—the germline not withstanding—its role in somatic development must be either unimportant or redundant with at least one of the other paralogs.

Transgene rescue studies support the conclusion that Importin 3, like 2, serves both paralog-specific and redundant roles during development. On the basis of our criteria, paralog-specific roles for 3 are those that can be rescued by only 3 transgenes. Redundant functions are those that could be rescued by an 3 and 1 and/or 2 transgenes. The most likely redundant function is the housekeeping transport of cNLS cargoes. This class of phenotype probably arises when only the mutated importin type, in this case 3, is normally expressed at sufficient levels in the relevant tissue or when a high level of general importin activity is required.

Drosophila importin 3 mutant offspring complete embryogenesis and hatch to first instar larvae without any apparent defects. The majority of 3 mutant offspring die during the first instar molt. At the end of each larval stage ecdysone pulses signal significant changes in gene expression that are necessary for the generation of second instar larvae (RIDDIFORD 1993 ; BENDER 1995 ; THUMMEL 1996 ; KOZLOVA and THUMMEL 2000 ). It is possible that 3 plays a role in facilitating this transition, perhaps by mediating the nuclear transport of signaling proteins or transcription factors that specify the transition. In this regard, homozygous 3^D93 mutants containing a Gal4^Act5C-expressed 3 transgene successfully completed first and second instar molts only to die near the transition from wandering third instar larvae to puparium. This is consistent with the notion that 3 is required for both the transition from first to second instar larva and the transition from larva to puparium. Thus, 3 may play a general role in developmental transitions.

Importin 3 is likely required during the first molt for a redundant function. First, since some 3 mutant larvae reach the second instar, there may be enough endogenous 1 and 2 present to partially replace the loss of 3 during the first larval molt. Importin 1 in particular is well expressed in larval tissues (GIARRE et al. 2002 ). Alternatively, the requirement for 3 during the first molt may be important but nonessential, whether or not 1 or 2 is present. The most convincing argument that a redundant function of 3 is required during this developmental transition is the finding that the expression of 1 and 2 transgenes rescued 3 mutant flies to later stages. In conclusion, it is likely that the cause of this phenotype is due to the preferential expression of redundant 3 activity(s) in one or more larval tissues, rather than of an 3-specific activity. Here, the preferential use of 3 to perform a redundant importin function during larval development is analogous to the role of 2 in spermatogenesis.

The interpretation of the rescue experiments is complicated by differences in the capacity of the various transgenes to rescue the similar defects of homozygous importin 3^D93 vs. 3^D93/3^17-7 flies. For example, only 3 transgenes rescued 3^D93/3^D93 flies to pupal stages, whereas both 2 and 3, but not 1, transgenes rescued 3^D93/3^17-7 flies to pupal stages. Importin 2-rescued 3^D93/3^17-7 progeny do not properly complete pupation and, consequently, never eclose. Only 3 transgenes are capable of rescuing the latter stages of development through eclosion. We trust the 3^D93/3^17-7 results more because these flies would not suffer the effects of deleterious recessive alleles potentially present in homozygous 3^D93/3^D93 offspring. Therefore, focusing on 3^D93/3^17-7 results, we conclude that an activity of 3 that is essential for pupation is at least partially redundant with 2. These functional results are consistent with phylogenetic analyses showing that 3's are more closely related to 2's than to 1's (KOHLER et al. 1999 ; MASON et al. 2002 ; not shown). However, the fact that only an 3 transgene is able to rescue 3^D93/3^17-7 progeny to adults suggests that 3 does serve an 3-specific function in the development of some adult tissues.

Importin 3 has both redundant and paralog-specific roles in eye development. Homozygous 3^D93 eyes appear glassy and lack photoreceptor cell rhabdomeres in adult ommatidia. These phenotypes can be mostly rescued by the expression of 3 transgenes. Only an 3 transgene was able to partially rescue the photoreceptor cell defect, indicating that 3 likely serves a paralog-specific function in the differentiation of these cells. A recent study demonstrated that a dominant-negative Importin ß1 protein expressed in the eye caused defects in development of photoreceptor cells (KUMAR et al. 2001 ), suggesting that 3 and Importin ß1 may work together to perform a nuclear transport function essential for the development of the eye. We cannot rule out the possibility that 3 is important for eye development only under the EGUF/hid experimental conditions (STOWERS and SCHWARZ 1999 ).

Expression of importin 1 improved the overall morphology of 3 mutant eyes, but these eyes still lacked recognizable photoreceptor cell rhabdomeres. Importin 1 may rescue the differentiation of nonphotoreceptor accessory cells, like pigment and cone cells, or may improve photoreceptor development enough to allow more efficient specification of accessory cell lineages. Importin 2 expression has little if any effect on the development of 3 mutant eyes. Curiously, an 2 null mutation enhanced the 3 glassy eye phenotype, suggesting that endogenous 2 and 3 may function together during eye development. However, this enhancement could not be rescued by the expression of an 2 transgene. Flies homozygous for the null 2 allele have morphologically wild-type eyes, so 2 does not appear to be required for eye development when 3 is present (GIARRE et al. 2002 ; GORJANACZ et al. 2002 ; MASON et al. 2002 ). Interestingly, 1 was better than 2 at rescuing eye development, but the opposite was true for pupation, where 2 was better than 1. Rather than being contradictory, we believe these results underscore just how complex the physiology of the importin gene family is likely to be.

We cannot rule out the possibility that the differing capacity of UASp importin 1, 2, or 3 transgenes to rescue 2 and 3 mutant phenotypes is due to differences in transgenic protein expression levels, protein stability, or post-translational modifications. However, we do note that all three transgenes appear by Western blot analyses to be well expressed (MASON et al. 2002 ; Fig 3). In addition, a UASp 2, but not 3, transgene fully rescued phenotypes associated with the loss of 2 (Fig 6 and not shown), while the same 3 transgene, but not the 2, fully rescued phenotypes caused by the loss of 3 (Table 4). These results strongly suggest that 2 and 3 differ in their ability to perform cellular functions in vivo.

Previously, in vitro studies showed that vertebrate importin 3's specifically transported presumably essential cellular proteins, such as RCC1 and RanBP3 (KOHLER et al. 1999 ; WELCH et al. 1999 ; NEMERGUT and MACARA 2000 ; TALCOTT and MOORE 2000 ). Our finding that embryos and larvae do not appear to require an 3-specific activity was, therefore, surprising. It is possible that 3 protein or mRNA may be stored maternally at a low level and maintained until larval stages. However, FANG et al. 2001 did not observe any 3 mRNA or protein in 0- to 2-hr embryos, suggesting that 3 is not stored maternally. Small amounts of 3 protein were observed in 0- to 2-hr embryos by MATHE et al. 2000 and the source of this discrepancy is currently unclear. Therefore, residual 3 activity may be present in mutant embryos and 1- and 2-rescued mutant larvae to perform all 3 functions necessary for cell survival. Alternatively, 3-specific nuclear transport of RCC1 and RanBP3 observed in vitro may not be specific for 3 in vivo or these 3-specific functions may not be conserved from vertebrates to flies. Finally, the nuclear import of 3-specific essential cellular proteins may also be imported by a redundant nuclear targeting pathway. This appears to be the case for the import of RCC1 in vertebrate cells. RCC1 import is mediated by two distinct pathways, only one of which requires 3 (NEMERGUT and MACARA 2000 ).

The analyses of importin 2 and 3 mutant phenotypes demonstrate that 2 is essential only for gametogenesis, while 3 appears to serve a more widespread developmental role (GIARRE et al. 2002 ; GORJANACZ et al. 2002 ; MASON et al. 2002 ; this study). These observations are consistent with the defects in somatic tissues associated with RNAi-mediated disruption of 3 paralogs in C. elegans and porcine embryos (GELES et al. 2002 ; CABOT and PRATHER 2003 ) and suggest that the 2's are the most derived of the three importin types. In addition, rescue experiments with UASp 1, 2, and 3 transgenes suggest that these differential developmental roles are due, at least partly, to distinct 2 and 3 biochemical activities (MASON et al. 2002 ; this study). Much work remains to be done to determine the precise cellular processes and molecular mechanisms that yield the observed mutant phenotypes. In conclusion, these studies lay the groundwork for future in vivo and in vitro studies of the importin gene family.

	ACKNOWLEDGMENTS

We thank T. Herman and L. Zipursky for the importin 3^17-7 and 3^w73 nonsense alleles; I. Kiss for the 2^D14 allele; the Bloomington Stock Center for fly stocks; I. Török and B. Mechler for the anti-2 antibodies; P. Rørth for the Gal4^pnos-VP16 stock and the UASp vector; N. Shulga for assistance with confocal microscopy; A. Jonth for assistance isolating viable recombinant 3¹ chromosomes; H. Jasper for assistance embedding eyes; R. Angerer for the use of the UV dissecting scope; K. Bentley for sectioning embedded eyes; B. McIntyre for SEM; and T. Herman, T. Schwarz, and members of the Goldfarb and Fleming labs for helpful discussions. The monoclonal anti-Kelch antibody developed by L. Cooley was obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the National Institute of Child Health and Human Development and maintained by The University of Iowa, Department of Biological Sciences, Iowa City, IA 52242. This work was supported by grants from the March of Dimes (1-FY01-313) to D. S. Goldfarb, from the National Science Foundation (IBN-0234751) to R. Fleming, and from the National Science Foundation (CTS-6571042) to B. McIntyre.

Manuscript received July 25, 2003; Accepted for publication August 21, 2003.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ADAMS, M. D., S. E. CELNIKER, R. A. HOLT, C. A. EVANS, and J. D. GOCAYNE et al., 2000  The genome sequence of Drosophila melanogaster. Science 287:2185-2195.[Abstract/Free Full Text]

ASKJAER, P., V. GALY, E. HANNAK, and I. W. MATTAJ, 2002  Ran GTPase cycle and Importins and ß are essential for spindle formation and nuclear envelope assembly in living Caenorhabditis elegans embryos. Mol. Biol. Cell 13:4355-4370.[Abstract/Free Full Text]

BEDNENKO, J., G. CINGOLANI, and L. GERACE, 2003  Nucleocytoplasmic transport: navigating the channel. Traffic 4:127-135.[Medline]

BENDER, M., 1995  Metamorphosis in Drosophila: from molecular biology to mutants. Trends Genet. 11:335-336.[Medline]

BRAND, A. H. and N. PERRIMON, 1993  Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118:401-415.[Abstract]

CABOT, R. A. and R. S. PRATHER, 2003  Cleavage stage porcine embryos may have differing developmental requirements for karyopherins 2 and 3. Mol. Reprod. Dev. 64:292-301.[Medline]

CAVENER, D. R., 1987  Comparison of the consensus sequence flanking the translational start sites in Drosophila and vertebrates. Nucleic Acids Res. 15:1353-1361.[Abstract/Free Full Text]

CHOMCZYNSKI, P., 1993  A reagent for the single-step simultaneous isolation of RNA, DNA and proteins from cell and tissue samples. Biotechniques 15:532-537.[Medline]

CONTI, E., M. UY, L. LEIGHTON, G. BLOBEL, and J. KURIYAN, 1998  Crystallographic analysis of the recognition of a nuclear localization signal by the nuclear import factor karyopherin alpha. Cell 94:193-204.[Medline]

DOCKENDORFF, T. C., Z. TANG, and T. A. JONGENS, 1999  Cloning of karyopherin-alpha3 from Drosophila through its interaction with the nuclear localization sequence of germ cell-less protein. Biol. Chem. 380:1263-1272.[Medline]

EGGERT, H., K. BERGEMANN, and H. SAUMWEBER, 1998  Molecular screening for P-element insertions in a large genomic region of Drosophila melanogaster using polymerase chain reaction mediated by the vectorette. Genetics 149:1427-1434.[Abstract/Free Full Text]

FANG, X. D., T. CHEN, K. TRAN, and C. S. PARKER, 2001  Developmental regulation of the heat shock response by nuclear transport factor karyopherin 3. Development 128:3349-3358.[Abstract/Free Full Text]

GELES, K. G. and S. A. ADAM, 2001  Germline and developmental roles of the nuclear transport factor importin alpha3 in C. elegans. Development 128:1817-1830.[Abstract]

GELES, K. G., J. J. JOHNSON, S. JONG, and S. A. ADAM, 2002  A role for Caenorhabditis elegans Importin IMA-2 in germline and embryonic mitosis. Mol. Biol. Cell 13:3138-3147.[Abstract/Free Full Text]

GIARRÈ, M., I. TÖRÖK, R. SCHMITT, M. GORJÁNÁCZ, and I. KISS et al., 2002  Patterns of importin- expression during Drosophila spermatogenesis. J. Struct. Biol. 140:279-290.[Medline]

GORJÁNÁCZ, M., G. ÁDÁM, I. TÖRÖK, B. M. MECHLER, and T. SZLANKA et al., 2002  Importin-2 is critically required for the assembly of ring canals during Drosophila oogenesis. Dev. Biol. 251:271-282.[Medline]

GÖRLICH, D., P. HENKELIN, R. A. LASKEY, and E. HARTMANN, 1996  A 41 amino acid motif in importin-alpha confers binding to importin-beta and hence transit into the nucleus. EMBO J. 15:1810-1817.[Medline]

GRUSS, O. J., R. E. CARAZO-SALAS, C. A. SCHATZ, G. GUARGUAGLINI, and J. KAST et al., 2001  Ran induces spindle assembly by reversing the inhibitory effect of importin alpha on TPX2 activity. Cell 104:83-93.[Medline]

GUILLEMAIN, G., M. J. MUÑOZ-ALONSO, A. CASSANY, M. LOIZEAU, and A. M. FAUSSAT et al., 2002  Karyopherin 2: a control step of glucose-sensitive gene expression in hepatic cells. Biochem. J. 362:201-209.

JIANG, C. J., K. SHOJI, R. MATSUKI, A. BABA, and N. INAGAKI et al., 2001  Molecular cloning of a novel importin homologue from rice, by which constitutive photomorphogenic 1 (COP1) is preferentially nuclear imported. J. Biol. Chem. 276:9322-9329.[Abstract/Free Full Text]

KAMEI, Y., S. YUBA, T. NAKAYMA, and Y. YONEDA, 1999  Three distinct classes of the alpha-subunit of the nuclear pore-targeting complex (importin-alpha) are differentially expressed in adult mouse tissues. J. Histochem. Cytochem. 47:363-372.[Abstract/Free Full Text]

KÖHLER, M., S. ANSIEAU, S. PREHN, A. LEUTZ, and H. HALLER et al., 1997  Cloning of two novel human importin-alpha subunits and analysis of the expression pattern of the importin-alpha protein family. FEBS Lett. 417:104-108.[Medline]

KÖHLER, M., C. SPECK, M. CHRISTIANSEN, F. R. BISCHOFF, and S. PREHN et al., 1999  Evidence for distinct substrate specificities of importin alpha family members in nuclear protein import. Mol. Cell. Biol. 19:7782-7791.[Abstract/Free Full Text]

KÖHLER, M., D. GÖRLICH, E. HARTMANN, and J. FRANKE, 2001  Adenoviral E1A protein nuclear import is preferentially mediated by Importin 3 in vitro.. Virology 289:186-191.[Medline]

KÖHLER, M., A. FIEBELER, M. HARTWIG, S. THIEL, and S. PREHN et al., 2002  Differential expression of classical nuclear transport factors during cellular proliferation and differentiation. Cell. Physiol. Biochem. 12:335-344.[Medline]

KOZLOVA, T. and C. S. THUMMEL, 2000  Steroid regulation of post-embryonic development and reproduction in Drosophila. Trends Endocrinol. Metab. 11:276-280.[Medline]

KUMAR, K. P., K. M. MCBRIDE, B. K. WEAVER, C. DINGWALL, and N.C. REICH, 2000  Regulated nuclear-cytoplasmic localization of interferon regulatory factor 3, a subunit of double-stranded RNA-activated factor 1. Mol. Cell. Biol. 20:4159-4168.[Abstract/Free Full Text]

KUMAR, J. P., G. S. WILKIE, H. TEKOTTE, K. MOSES, and I. DAVIS, 2001  Perturbing nuclear transport in Drosophila eye imaginal discs causes specific cell adhesion and axon guidance defects. Dev. Biol. 240:315-325.[Medline]

KÜSSEL, P. and M. FRASCH, 1995  Pendulin, a Drosophila protein with cell cycle-dependent nuclear localization, is required for normal cell proliferation. J. Cell Biol. 129:1491-1507.[Abstract/Free Full Text]

MACARA, I. G., 2001  Transport into and out of the nucleus. Microbiol. Mol. Biol. Rev. 65:570-594.[Abstract/Free Full Text]

MALIK, H. S., T. EICKBUSH, and D. S. GOLDFARB, 1997  Evolutionary specialization of the nuclear targeting apparatus. Proc. Natl. Acad. Sci. USA 94:13738-13742.[Abstract/Free Full Text]

MASON, D. A., R. J. FLEMING, and D. S. GOLDFARB, 2002  Drosophila melanogaster Importin 1 and 3 can replace Importin 2 during spermatogenesis but not oogenesis. Genetics 161:157-170.[Abstract/Free Full Text]

MÁTHÉ, E., H. BATES, H. HUIKESHOVEN, P. DEÁK, and D. M. GLOVER et al., 2000  Importin-alpha3 is required at multiple stages of Drosophila development and has a role in the completion of oogenesis. Dev. Biol. 223:307-322.[Medline]

MATSUSAKA, T., N. IMAMOTO, Y. YONEDA, and M. YANAGIDA, 1998  Mutations in fission yeast Cut15 an importin homolog, lead to mitotic progression without chromosome condensation. Curr. Biol. 8:1031-1034.[Medline]

MELÉN, K., R. FAGERLUND, J. FRANKE, M. KÖHLER, and L. KINNUNEN et al., 2003  Importin alpha nuclear localization signal binding sites for STAT1, STAT2, and influenza A virus nucleoprotein. J. Biol. Chem. 278:28193-28200.[Abstract/Free Full Text]

MIYAMOTO, Y., N. IMAMOTO, T. SEKIMOTO, T. TACHIBANA, and T. SEKI et al., 1997  Differential modes of nuclear localization signal (NLS) recognition by three distinct classes of NLS receptors. J. Biol. Chem. 272:26375-26381.[Abstract/Free Full Text]

NACHURY, M. V., U. RYDER, A. I. LAMOND, and K. WEIS, 1998  Cloning and characterization of hSRP1 gamma, a tissue-specific nuclear transport factor. Proc. Natl. Acad. Sci. USA 95:582-587.[Abstract/Free Full Text]

NACHURY, M. V., T. J. MARESCA, W. C. SALMON, C. M. WATERMAN-STORER, and R. HEALD et al., 2001  Importin beta is a mitotic target of the small GTPase Ran in spindle assembly. Cell 104:95-106.[Medline]

NADLER, S. G., D. TRITSCHLER, O. K. HAFFAR, J. BLAKE, and A. G. BRUCE et al., 1997  Differential expression and sequence-specific interaction of karyopherin alpha with nuclear localization sequences. J. Biol. Chem. 272:4310-4315.[Abstract/Free Full Text]

NEMERGUT, M. E. and I. G. MACARA, 2000  Nuclear import of the Ran exchange factor, RCC1, is mediated by at least two distinct mechanisms. J. Cell Biol. 149:835-849.[Abstract/Free Full Text]

PRIEVE, M. G., K. GUTTRIDGE, J. E. MUNGUIA, and M. L. WATERMAN, 1996  The nuclear localization signal of lymphoid enhancer factor-1 is recognized by two differentially expressed Srp1-nuclear localization sequence receptor proteins. J. Biol. Chem. 13:7654-7658.

PRIEVE, M. G., K. GUTTRIDGE, J. MUNGUIA, and M. L. WATERMAN, 1998  Differential importin-alpha recognition and nuclear transport by nuclear localization signals within the high-mobility-group DNA binding domains of lymphoid enhancer factor 1 and T-cell factor 1. Mol. Cell. Biol. 18:4819-4832.[Abstract/Free Full Text]

RIDDIFORD, L. M., 1993 Hormones and Drosophila development, pp. 899–939 in The Development of Drosophila melanogaster, Vol. 2, edited by M. BATE and A. MARTINEZ ARIAS. Cold Spring Harbor Laboratory Press, Plainview, NY.

RØRTH, P., 1998  Gal4 in the Drosophila female germline. Mech. Dev. 78:113-118.[Medline]

SEKIMOTO, T., N. IMAMOTO, K. NAKAJIMA, T. HIRANO, and Y. YONEDA, 1997  Extracellular signal-dependent nuclear import of Stat1 is mediated by nuclear pore-targeting complex formation with NPI-1, but not Rch1. EMBO J. 16:7067-7077.[Medline]

SPRADLING, A. C., 1986 P element-mediated transformation, pp. 175–197 in Drosophila: A Practical Approach, edited by D. B. ROBERTS. IRL Press, Oxford.

STERN, D. L., and E. A. SUCENA, 2000 Preparation of larval and adult cuticles for light microscopy, pp. 601–616 in Drosophila Protocols, edited by W. SULLIVAN, M. ASHBURNER and R. S. HAWLEY. Cold Spring Harbor Laboratory Press, Plainview, NY.

STOWERS, R. S. and T. L. SCHWARZ, 1999  A genetic method for generating Drosophila eyes composed exclusively of mitotic clones of a single genotype. Genetics 152:1631-1639.[Abstract/Free Full Text]

TABB, M. M., P. TONGAONKAR, L. VU, and M. NOMURA, 2000  Evidence for separable functions of Srp1p, the yeast homolog of importin alpha (Karyopherin alpha): role for Srp1p and Sts1p in protein degradation. Mol. Cell. Biol. 16:6062-6073.

TALCOTT, B. and M. S. MOORE, 2000  The nuclear import of RCC1 requires a specific nuclear localization sequence receptor, Karyopherin 3/QIP. J. Biol. Chem. 275:10099-10104.[Abstract/Free Full Text]

TEKOTTE, H., D. BERDNIK, T. TÖRÖK, M. BUSZCZAK, and L. M. JONES et al., 2002  Dcas is required for importin 3 nuclear export and mechano-sensory organ cell fate specification in Drosophila. Dev. Biol. 244:396-406.[Medline]

THUMMEL, C. S., 1996  Flies on steroids—Drosophila metamorphosis and the mechanisms of steroid hormone action. Trends Genet. 12:306-310.[Medline]

TÖRÖK, I., D. STRAND, R. SCHMITT, G. TICK, and T. TÖRÖK et al., 1995  The overgrown hematopoietic organs-31 tumor suppressor gene of Drosophila encodes an Importin-like protein accumulating in the nucleus at the onset of mitosis. J. Cell Biol. 129:1473-1489.[Abstract/Free Full Text]

TSUJI, L., T. TAKUMI, N. IMAMOTO, and Y. YONEDA, 1997  Identification of novel homologues of mouse importin alpha, the alpha subunit of the nuclear pore-targeting complex, and their tissue-specific expression. FEBS Lett. 416:30-34.[Medline]

WEIS, K., 2003  Regulating access to the genome: nucleocytoplasmic transport throughout the cell cycle. Cell 112:441-451.[Medline]

WEIS, K., U. RYDER, and A. I. LAMOND, 1996  The conserved amino-terminal domain of hSRP1 alpha is essential for nuclear protein import. EMBO J. 15:1818-1825.[Medline]

WELCH, K., J. FRANKE, M. KÖHLER, and I. G. MACARA, 1999  RanBP3 contains an unusual nuclear localization signal that is imported preferentially by importin-alpha3. Mol. Cell. Biol. 19:8400-8411.[Abstract/Free Full Text]

WIESE, C., A. WILDE, M. S. MOORE, S. A. ADAM, and A. MERDES et al., 2001  Role of importin-beta in coupling Ran to downstream targets in microtubule assembly. Science 291:653-656.[Abstract/Free Full Text]

WOLFF, T., 2000 Histological techniques for the Drosophila eye. Part II: adult, pp. 229–243 in Drosophila Protocols, edited by W. SULLIVAN, M. ASHBURNER and R. S. HAWLEY. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

XU, T. and S. D. HARRISON, 1994  Mosaic analysis using FLP recombinase. Methods Cell Biol. 44:655-681.[Medline]

XUE, F. and L. COOLEY, 1993  Kelch encodes a component of intercellular bridges in Drosophila egg chambers. Cell 72:681-693.[Medline]

This article has been cited by other articles:

				L. M. Mikhaylova, K. Nguyen, and D. I. Nurminsky Analysis of the Drosophila melanogaster Testes Transcriptome Reveals Coordinate Regulation of Paralogous Genes Genetics, May 1, 2008; 179(1): 305 - 315. [Abstract] [Full Text] [PDF]

				R. Ratan, D. A. Mason, B. Sinnot, D. S. Goldfarb, and R. J. Fleming Drosophila Importin {alpha}1 Performs Paralog-Specific Functions Essential For Gametogenesis Genetics, February 1, 2008; 178(2): 839 - 850. [Abstract] [Full Text] [PDF]

				L. Monferrer and R. Artero An Interspecific Functional Complementation Test in Drosophila for Introductory Genetics Laboratory Courses J. Hered., January 1, 2006; 97(1): 67 - 73. [Abstract] [Full Text] [PDF]