Genetics, Vol. 165, 1943-1958, December 2003, Copyright © 2003

The Drosophila melanogaster importin {alpha}3 Locus Encodes an Essential Gene Required for the Development of Both Larval and Adult Tissues

D. Adam Masona, Endre Máthéb, Robert J. Flemingc, and David S. Goldfarba
a Department of Biology, University of Rochester, Rochester, New York 14627,
b CRC Cell Cycle Research Group, Department of Genetics, University of Cambridge, Cambridge CB2 3EH, United Kingdom
c Biology Department, Trinity College, Hartford, Connecticut 06106

Corresponding author: David S. Goldfarb, University of Rochester, Rochester, NY 14627., dasg{at}mail.rochester.edu (E-mail)

Communicating editor: K. ANDERSON


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The nuclear transport of classical nuclear localization signal (cNLS)-containing proteins is mediated by the cNLS receptor importin {alpha}. The conventional importin {alpha} gene family in metazoan animals is composed of three clades that are conserved between flies and mammals and are referred to here as {alpha}1, {alpha}2, and {alpha}3. In contrast, plants and fungi contain only {alpha}1 genes. In this study we report that Drosophila importin {alpha}3 is required for the development of both larval and adult tissues. Importin {alpha}3 mutant flies die around the transition from first to second instar larvae, and homozygous importin {alpha}3 mutant eyes are defective. The transition to second instar larvae was rescued with importin {alpha}1, {alpha}2, or {alpha}3 transgenes, indicating that Importin {alpha}3 is normally required at this stage for an activity shared by all three importin {alpha}'s. In contrast, an {alpha}3-specific biochemical activity(s) of Importin {alpha}3 is probably required for development to adults and photoreceptor cell development, since only an importin {alpha}3 transgene rescued these processes. These results are consistent with the view that the importin {alpha}'s have both overlapping and distinct functions and that their role in animal development involves the spatial and temporal control of their expression.


MOST proteins targeted to the nucleus contain nuclear localization signals (NLSs) that are recognized by soluble receptors called karyopherins (MACARA 2001 Down; BEDNENKO et al. 2003 Down; WEIS 2003 Down). Proteins containing classical NLSs (cNLSs) are imported bound to the importin {alpha}/ß1 heterodimer. Importin {alpha} serves as an adapter that links cNLS cargo to the karyopherin importin ß1, which ferries the complex through the nuclear pore complex (MACARA 2001 Down; BEDNENKO et al. 2003 Down; WEIS 2003 Down).

The genomes of metazoan organisms encode multiple importin {alpha} genes. For example, the human genome encodes six importin {alpha}'s (KOHLER et al. 2002 Down; CABOT and PRATHER 2003 Down). Phylogenetic analyses of the importin {alpha} gene family revealed that most importin {alpha}'s belong to one of three evolutionarily conserved clades, designated by our nomenclature as conventional {alpha}1's, {alpha}2's, and {alpha}3's (KOHLER et al. 1997 Down, KOHLER et al. 1999 Down; MALIK et al. 1997 Down; MATHE et al. 2000 Down; MASON et al. 2002 Down). Conventional importin {alpha}'s from plants and fungi are all {alpha}1's. In contrast, metazoan animals, with the exception of Caenorhabditis elegans (GELES and ADAM 2001 Down), contain representatives from each of the three groups. Parsimony arguments suggest that metazoan {alpha}2 and {alpha}3 genes arose from {alpha}1 progenitors in ancestral single-cell eukaryotic lineages.

Vertebrate importin {alpha}'s show distinct tissue- and cell-type-specific expression patterns (PRIEVE et al. 1996 Down; KOHLER et al. 1997 Down, KOHLER et al. 2002 Down; TSUJI et al. 1997 Down; NACHURY et al. 1998 Down; KAMEI et al. 1999 Down), and human importin {alpha} paralogs are differentially regulated in quiescent and proliferating cultured cells and tissue differentiation models (KOHLER et al. 2002 Down). In vitro binding assays and permeabilized cell transport assays indicate that {alpha}1's, {alpha}2's, and {alpha}3's have both overlapping and distinct sets of transport cargoes (MIYAMOTO et al. 1997 Down; NADLER et al. 1997 Down; SEKIMOTO et al. 1997 Down; PRIEVE et al. 1998 Down; KOHLER et al. 1999 Down, KOHLER et al. 2001 Down; WELCH et al. 1999 Down; KUMAR et al. 2000 Down; NEMERGUT and MACARA 2000 Down; TALCOTT and MOORE 2000 Down; JIANG et al. 2001 Down; GUILLEMAIN et al. 2002 Down; MELEN et al. 2003 Down). For example, a vertebrate {alpha}3 has unique specificity for RCC1 (KOHLER et al. 1999 Down; NEMERGUT and MACARA 2000 Down; TALCOTT and MOORE 2000 Down), Ran BP3 (WELCH et al. 1999 Down), interferon regulatory factor 3 (KUMAR et al. 2000 Down), and adenoviral E1A (KOHLER et al. 2001 Down). An {alpha}2 selectively bound the glucose transporter GLUT2 (GUILLEMAIN et al. 2002 Down) and an {alpha}1 specifically transported STAT1 and STAT2 transcription factors (SEKIMOTO et al. 1997 Down; MELEN et al. 2003 Down). Importantly, the preference of importin {alpha}'s for NLS cargo can be altered when two different substrates are presented together in permeabilized cell transport assays (KOHLER et al. 1999 Down). This latter finding underscores the complexity of the functional interactions between importin {alpha}'s and different NLS cargo and indicates that in vivo studies are needed to unravel the physiological roles of individual importin {alpha}'s.

In vivo studies are consistent with the notion that the different importin {alpha}'s play distinct roles in animal development. The RNAi-mediated disruption of an {alpha}3 paralog, but not an {alpha}2, had a severe effect on the development of porcine embryos (CABOT and PRATHER 2003 Down). Likewise, RNAi-mediated reductions in the expression of different importin {alpha}'s caused distinct developmental defects in C. elegans (GELES and ADAM 2001 Down; ASKJAER et al. 2002 Down; GELES et al. 2002 Down). Specifically, the C. elegans {alpha}3 paralog ima-3 is required for meiosis in the developing female germline (GELES and ADAM 2001 Down), while the nonconventional ima-2 is required for mitosis (GELES et al. 2002 Down). Proper spindle formation requires ima-2 but not ima-3 (ASKJAER et al. 2002 Down).

The Drosophila genome encodes four importin {alpha}'s (KUSSEL and FRASCH 1995 Down; TOROK et al. 1995 Down; DOCKENDORFF et al. 1999 Down; ADAMS et al. 2000 Down; MATHE et al. 2000 Down; GIARRE et al. 2002 Down; MASON et al. 2002 Down), three of which contain conserved Importin ß1 (GORLICH et al. 1996 Down; WEIS et al. 1996 Down) and cNLS-binding domains (CONTI et al. 1998 Down; DOCKENDORFF et al. 1999 Down). The fourth predicted Drosophila importin {alpha}, cg14708 (ADAMS et al. 2000 Down), is extremely divergent, has a weakly conserved IBB domain, and is missing the conserved tryptophan-asparagine array that is crucial for binding to cNLS cargo (CONTI et al. 1998 Down).

The three conventional Drosophila importin {alpha} paralogs have different developmental stage- and cell-type-specific expression patterns (KUSSEL and FRASCH 1995 Down; TOROK et al. 1995 Down; DOCKENDORFF et al. 1999 Down; MATHE et al. 2000 Down; FANG et al. 2001 Down; GIARRE et al. 2002 Down). In addition, {alpha}1 and {alpha}2, but not {alpha}3, accumulate in the nucleus at the onset of mitosis (KUSSEL and FRASCH 1995 Down; TOROK et al. 1995 Down; MATHE et al. 2000 Down; GIARRE et al. 2002 Down). Null {alpha}2 mutations result in defects in gametogenesis that cause incompletely penetrant male sterility and complete female sterility (GIARRE et al. 2002 Down; GORJANACZ et al. 2002 Down; MASON et al. 2002 Down). The {alpha}2 activity essential for female fertility appears to be unique to {alpha}2 since it cannot be replaced by the ectopic expression of {alpha}1 or {alpha}3 transgenes. In contrast, male sterility was rescued to a similar extent by the expression of {alpha}1, {alpha}2, and {alpha}3 (MASON et al. 2002 Down).

Drosophila Importin {alpha}3 has been identified as a binding partner of germ cell-less (DOCKENDORFF et al. 1999 Down), DNA polymerase {alpha} (MATHE et al. 2000 Down), and heat-shock factor (HSF; FANG et al. 2001 Down). Importin {alpha}3 mRNA and protein were not detected in early embryos, coincident with the restriction of HSF to the cytoplasm (FANG et al. 2001 Down). Finally, defects in {alpha}3 nuclear export correlate with specific cell fate transformations in mechano-sensory organs observed in hypomorphic mutations in the importin {alpha} recycling factor Dcas (TEKOTTE et al. 2002 Down). In this study we describe the developmental defects associated with severe mutations in {alpha}3 and conclude that {alpha}3 is required for the development of both larval and adult tissues. Transgene rescue studies demonstrate that the requirement for {alpha}3 in larval development can be partially replaced by ectopic expression of {alpha}1 or {alpha}2. In contrast, only ectopic {alpha}3 expression can support development to adults. In the eye, {alpha}1, but not {alpha}2, can partially replace {alpha}3 in at least some cell types, but {alpha}3 appears to be uniquely required for the proper differentiation of photoreceptor cells.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Genetic stocks and markers:
Flies were kept on standard cornmeal-dextrose media and grown at 25° unless indicated otherwise. The importin {alpha}31/TM6C stock is described in MATHE et al. 2000 Down. The FRT82B, {alpha}317-7/TM3 {Kr-GFP}, Sb1 and FRT82B, {alpha}3w73/TM3 {Kr-GFP}, Sb1 stocks were created and provided by Tory Herman and Larry Zipursky [University of California (UCLA), Los Angeles]. The {alpha}2D14/y+ CyO stock was created by Bernard Mechler (Department of Developmental Genetics, DKFZ, Heidelberg, Germany) and provided by István Kiss (Hungarian Academy of Sciences, Szeged, Hungary) (TOROK et al. 1995 Down; GIARRE et al. 2002 Down; GORJANACZ et al. 2002 Down). The Gal4pnos-VP16 stock (RORTH 1998 Down) was provided by Pernille Rørth (EMBL, Heidelberg, Germany). The (1) Gal4tubP (P{w + mC = tubP-GAL4}LL7)/TM3,Sb1; (2) Gal4Act5C (P{w[+mC] = Act5CGAL4} 17bFO1)/TM6B, Tb1; (3) Gal4arm (P{w[+m W.hs] = GAL4-armS}4a P{w[+mW.hs] + GAL4-arm.S}4b)/TM3, Sb1; (4) Sb1/TM3 P{w + mC = ActGFP}JMR2, Ser1; (5) Df(3R)GB104/TM3, Sb1; (6) Df(3R)by416/TM3, Sb1; (7) Df(3R)by62/TM1; (8) TM3, Sb1, P{ry[+t7.2] = {Delta}2-3}99B/Df(3R)C7, ry[506]; and (9) Gal4eye, UASt FLP/CyO ; FRT82B, GMR-hid, l(3)CL-R1/TM2 (STOWERS and SCHWARZ 1999 Down) stocks were obtained from the Bloomington Drosophila Stock Center at Indiana University.

PCR of importin {alpha}31:
Genomic DNA was prepped from single flies of the indicated genotypes and used for PCR. PCR conditions were: 2 µM primers; 1.5 mM MgCl2; 2.5 units Taq DNA polymerase; and 2 mM dATP, dCTP, dGTP, and dTTP (annealing temperature is 62°, 30 cycles). The 5' P-element primer, PF-2 or primer 1 in Fig 1, had the sequence CGACGGGACCACCTTATGTTAT (EGGERT et al. 1998 Down), and the 3' primer, {alpha}3 3'NsacII or primer 2 in Fig 1, had the sequence CGCACGCCGCGGCCTTTGCCAGCTTCTTCAGG. The resulting band that appears only when importin {alpha}31 is present was sequenced and shown to correspond to a P-element insertion ~780 bp from the ATG of {alpha}3 (see also MATHE et al. 2000 Down).



View larger version (45K):
In this window
In a new window
Download PPT slide
 
Figure 1. PCR of importin {alpha}31 chromosomes and creation of deletion mutants in importin {alpha}3. (A) PCR to detect the P element in importin {alpha}31. Importin {alpha}3 and cg8273 coding regions are shown in white, the noncoding region is shown in gray, the P-element insertion in {alpha}31 is indicated by the black triangle, and primers used for PCR are indicated with arrows. Nucleotide numbers are indicated relative to the start of the {alpha}3 coding region (ATG = +1). To verify the presence of the P element in {alpha}31, DNA was isolated from single flies of the indicated genotypes and analyzed by PCR using a P-element primer (primer 1) and a primer in {alpha}3 (primer 2). Lane 1, 1-kb DNA ladder; lane 2, w1118; lane 3, {alpha}31/TM6C; lane 4, Gal4Act5C, {alpha}31/TM6B; lane 5, Gal4arm, {alpha}31/TM6B; lane 6, Gal4arm, {alpha}31/Gal4arm, {alpha}31; lane 7, Gal4arm/TM6B; lane 8, {alpha}31(R1)/TM6B; lane 9, {alpha}31(R1)/{alpha}31(R1); lane 10, {alpha}31(R2)/TM6C. DNA size markers are shown in kilobases. (B) PCR to detect P-element excision-induced deletions in importin {alpha}3. DNA isolated from P-element-excised flies was analyzed by PCR using primers that flank the P-element insertion site (primers 2 and 3 in A). Two lines, importin {alpha}3D93 and {alpha}3D165, carrying small deletions in the {alpha}3 locus were identified (lanes containing bands <1.4 kb). DNA size markers are shown in kilobases. (C) Diagram of importin {alpha}3 alleles. Importin {alpha}3 and cg8273 coding regions are shown in white, the noncoding region is shown in gray, and deleted regions in {alpha}3D93 and {alpha}3D165 are indicated by black boxes. The {alpha}317-7 allele is also used in this study and contains a stop codon in place of amino acid W132 (T. HERMAN and L. ZIPURSKY, personal communication). Nucleotide numbers are indicated relative to the start of the {alpha}3 coding region (ATG = +1).

Expression constructs and germline transformations:
UASp Importin {alpha} transgenes were created by cloning {alpha}1 (MASON et al. 2002 Down), {alpha}2, or {alpha}3 PCR fragments containing a 5' Cavener consensus sequence (AAAATG; CAVENER 1987 Down) and the ~1.5-kb coding region into KpnI and NotI sites in the UASp P-element transformation vector (RORTH 1998 Down). In contrast to transgenes used previously (MASON et al. 2002 Down), the {alpha}2 and {alpha}3 transgenes do not contain any {alpha}2- or {alpha}3-specific 5' or 3' untranslated region (UTR) sequences. The UASp {alpha}1 transgene contains 1 nucleotide of {alpha}1 3'UTR. Transgenic UASp {alpha}1, {alpha}2, and {alpha}3 lines were created using standard germline transformation procedures (SPRADLING 1986 Down). The UASp {alpha}1, {alpha}2, and {alpha}3 inserts used in this study were all located on the second chromosome.

Larval cuticle preps:
Importin {alpha}3 alleles were balanced with a green fluorescent protein (GFP)-tagged TM3 chromosome and the appropriate crosses were set up in egg-laying cups. Eggs were laid on apple juice plates overnight. Resulting first instar larvae were examined with a UV dissecting microscope and nonfluorescent larvae were removed to a plate containing standard cornmeal-dextrose media. After ~24–48 hr dead larvae were isolated and larval cuticles were prepared as previously described (STERN and SUCENA 2000 Down), except that 4% paraformaldehyde was used as the fixative. Cuticles were observed by differential interference contrast (DIC) imaging with a Leica TCS NT microscope equipped with UV, Ar, Kr/Ar, and He/Ne lasers. Digital images were processed using Adobe PhotoShop (Adobe Systems, San Jose, CA).

Northern and Western blots:
Total RNA and protein were isolated from Drosophila tissues with Tri-Reagent LS (Molecular Research Center, Cincinnati; CHOMCZYNSKI 1993 Down) following the recommended protocols. Protein isolated from larvae of the indicated stage and genotype was analyzed by Western blot with rabbit anti-Importin {alpha}2 (TOROK et al. 1995 Down) provided by Istvan Török (DKFZ, Heidelberg, Germany), rabbit anti-{alpha}3 (MATHE et al. 2000 Down), or a mouse anti-{alpha}-tubulin antibody (Amersham Biosciences, Piscataway, NJ). Blots were developed using alkaline phosophatase-tagged goat anti-rabbit secondary antibodies. The Fermentas Prestained Protein Ladder, an ~10- to 180-kD size marker (Fermentas, Hanover, MD; Fig 3A and Fig C), or the GIBCO BRL (Gaithersburg, MD) benchmark size marker (Life Technologies, Grand Island, NY; Fig 3B) were used as size markers. RNA isolated from heterozygous and homozygous {alpha}3D93 and {alpha}3D165 mutant first instar larvae was analyzed by Northern blot with an {alpha}3 full-length random prime 32P-labeled probe (not shown).



View larger version (179K):
In this window
In a new window
Download PPT slide
 
Figure 2. Stage of lethality for importin {alpha}3 mutant larvae. Larval cuticles were prepared from (A) first instar larvae of the genotype importin {alpha}3D93/TM3 {GFP} or dead larvae of the genotypes (B) {alpha}3D93/{alpha}3D93, (C) {alpha}3D165/{alpha}3D165, and (D) {alpha}317-7/{alpha}3D93. Note the duplicated mouth hooks in B–D.



View larger version (61K):
In this window
In a new window
Download PPT slide
 
Figure 3. Importin {alpha}3 protein levels in importin {alpha}3 mutants and Importin {alpha} transgene expression. (A) Protein isolated from first instar larvae of the indicated genotype was examined by Western blot with anti-Importin {alpha}3 or anti-{alpha}-tubulin antibodies. (B) Protein isolated from first instar larvae of the indicated genotype was examined by Western blot with anti-{alpha}2, anti-{alpha}3, or anti-{alpha}-tubulin antibodies. (C) Protein isolated from first or third instar larvae of the indicated genotype was examined by Western blot with anti-{alpha}3 or anti-{alpha}-tubulin antibodies. The estimated sizes of the markers are indicated next to the arrows; the thick arrowhead indicates the size of the full-length {alpha}3 protein, and the thin arrowhead represents a smaller anti-{alpha}3-cross-reactive band (A–C).*, the slower migrating anti-{alpha}3-cross-reactive band that appears only when {alpha}1 transgenes are expressed (B); **, a second slower-migrating anti-{alpha}3-cross-reactive band that appears only when an {alpha}2 transgene is expressed (B and C).

Scanning electron microscopy of adult eyes:
Flies of the indicated genotypes were dehydrated in a graded ethanol series and stored in 100% ethanol. Flies were critical point dried, coated with gold, and examined by scanning electron microscopy with a LEO 982 FESEM microscope. Digital images were processed using Adobe PhotoShop (Adobe Systems).

Eye sectioning:
Fly eyes of the indicated genotypes were embedded in Durcapan resin according to standard procedures (WOLFF 2000 Down), sectioned to 1 µm thickness, stained with toluidine blue, and observed by DIC imaging. Digital images were processed using Adobe PhotoShop (Adobe Systems).

Immunofluorescence:
Ovaries were dissected from females of the indicated genotypes, fixed in 1x PBS, 4% paraformaldehyde, and blocked in PBS-saponin (1x PBS, 0.1% saponin, and 1% normal goat serum). Ovaries were incubated with a mouse anti-Kelch antibody (XUE and COOLEY 1993 Down) diluted 1:1 (GORJANACZ et al. 2002 Down) in PBS-saponin, followed by a goat anti-rabbit FITC-labeled secondary antibody diluted 1:300 in PBS-saponin. DNA was stained with 4',6-diamidino-2-phenylindole (DAPI) in PBS. Samples were examined by confocal microscopy and digital images were processed using Adobe PhotoShop (Adobe Systems). The anti-Kelch antibody was developed by L. Cooley and provided by the Developmental Studies Hybridoma Bank (Iowa City, IA).

Crosses:
Recombination of importin {alpha}31: Gal4arm/TM3, Sb1 or Gal4Act5C/TM6B, Tb1 males were crossed to importin {alpha}31/TM6C, Sb1, Tb1 virgin females. Gal4arm/{alpha}31 or Gal4Act5C/{alpha}31 virgin female offspring were collected and mated to TM3, Sb1/TM6B, Tb1 males. Resulting male offspring were selected for a dark red eye. These males were utilized to make stocks and the presence of the P element in {alpha}31 was verified by PCR (see above).

To allow importin {alpha}31 to recombine with a "wild-type" third chromosome, w1118 males were crossed to {alpha}31/TM6C, Sb1, Tb1 females. Importin {alpha}31/+ virgin female offspring were collected and mated to TM3, Sb1/TM6B, Tb1 males. Recombinant {alpha}31/TM6B, Tb1 males were mated individually to virgin females from the original {alpha}31/TM6C, Sb1, Tb1 stock. Crosses were incubated at room temperature and each vial was examined for the presence of non-Tb1 pupal offspring. If non-Tb1 pupae were observed the adult offspring from this cross were analyzed. Four recombinant {alpha}31 chromosomes were viable over the original {alpha}31 chromosome [designated {alpha}31(R1), {alpha}31(R2), {alpha}31(R3), and {alpha}31(R4)]. Stocks were made for the {alpha}31(R1) and {alpha}31(R2) chromosomes, and the presence of the P element was verified by PCR (Fig 1).

Analysis of importin {alpha}31 viability: Importin {alpha}31/TM6C, Sb1, Tb1 females were crossed to: (a) {alpha}31/TM6C, Sb1, Tb1; (b) {alpha}31(R1)/TM3, Sb1; (c) {alpha}31(R2)/TM6C, Sb1, Tb1; (d) Df(3R)by416/TM3, Sb1; (e) Df(3R)GB104/TM3, Sb1; (f) Df(3R)by62/TM1; or (g) Gal4arm, {alpha} 31/TM6B, Tb1 males. Likewise, {alpha}31(R1)/TM3, Sb1 flies were crossed to (a) {alpha}31(R1)/TM3, Sb1; (b) Df(3R)by416/TM3, Sb1; (c) Df(3R)GB104/TM3, Sb1; or (d) Df(3R)by62/TM1 flies. Finally, {alpha}31(R2)/TM6C, Sb1, Tb1 flies were crossed to (a) {alpha}31(R2)/TM6C, Sb1, Tb1 or (b) Df(3R)GB104/TM3, Sb1. For all crosses offspring were analyzed for the presence of the appropriate markers on balancers and viability indices were calculated by dividing the number of observed offspring by the number of expected offspring if all nonhomozygous balancer genotypes were equally viable (Table 1). Offspring inheriting two copies of the same balancer (e.g., TM3, Sb1/TM3, Sb1) were assumed to be completely lethal. Offspring inheriting two different balancers (e.g., TM3, Sb1/TM6C, Sb1, Tb1) were often lethal. However, in crosses in which these offspring were observed the viability was calculated assuming them to be fully viable.


 
View this table:
In this window
In a new window

 
Table 1. Viability of importin {alpha}31 chromosomes

Creating deletions in importin {alpha}3: Importin {alpha}31(R1)/TM3, Sb1 virgin females were crossed to TM3, Sb1, P{ry[+t7.2] = {Delta}2-3}99B/Df(3R)C7, ry[506]. "Jump start" male offspring of the genotype {alpha}31(R1)/TM3, Sb1, P{ry[+t7.2] = {Delta}2-3}99B were collected and mated to TM3, Sb1/TM6B, Tb1 virgin females. Resulting white-eyed, non-ebony, TM3, Sb1 or TM6B, Tb1 male offspring were selected and mated individually to TM3, Sb1/TM6B, Tb1 virgin females. After ~5 days of mating 10–20 males were pooled together for a genomic DNA extraction. Approximately 3 µl of this genomic DNA was then used in a PCR reaction (60° annealing temperature, 1.5 mM MgCl2) with the {alpha}3 3'NSacII primer, primer 2 in Fig 1 (sequence above), and the {alpha}3 5' prom 2 primer, primer 3 in Fig 1 ({alpha}3 5' prom 2 sequence, CCAGTTCATTGCTGTTGCTCC). Small deletions in {alpha}3 were detected by the presence of a smaller PCR product. If a pool of DNA was shown to contain an {alpha}3 deletion, DNA was extracted separately from offspring of each of the 10–20 males. This DNA was utilized in the PCR reaction as described above, enabling the identification of the specific line that contained the deletion. The shortened PCR products were gel purified with QiaQuick columns (QIAGEN, Valencia, CA) and sequenced.

Analysis of importin {alpha}3 mutant alleles: Importin {alpha}3D93/TM3, Sb1 flies were crossed to: (a) {alpha}3D93/TM3, Sb1; (b) FRT82B, {alpha}317-7/TM3 {GFP}, Sb1; (c) FRT82B, {alpha}3w73/TM3 {GFP}, Sb1; (d) Df(3R)by416/TM3, Sb1; (e) Df(3R)GB104/TM3, Sb1; (f) Df(3R)by62/TM1; or (g) {alpha}31/TM6C, Sb1, Tb1 flies. Likewise, {alpha}3D165/TM3, Sb1 or TM6B, Tb1 or TM3 {GFP}, Ser1 flies were crossed to: (a) {alpha}3D165/TM3, Sb1; (b) FRT82B, {alpha}317-7/TM3 {GFP}, Sb1; (c) FRT82B, {alpha}3w73/TM3 {GFP}, Sb1; (d) Df(3R)by416/TM3, Sb1; (e) Df(3R)GB104/TM3, Sb1; (f) Df(3R)by62/TM1; or (g) {alpha}3D93/TM6B, Tb1. Finally, Df(3R)GB104/TM3, Sb1 flies were crossed to (a) FRT82B, {alpha}317-7/TM3 {GFP}, Sb1 or (b) FRT82B, {alpha}3w73/TM3 {GFP}, Sb1 flies. For all crosses offspring were analyzed for the presence of the appropriate markers on balancers and viability indices were calculated as described above (Table 2).


 
View this table:
In this window
In a new window

 
Table 2. Viability of importin {alpha}3 mutants

To determine the approximate stage of lethality the importin {alpha}3 mutant alleles and deficiency chromosomes were balanced with TM3 {GFP} chromosomes and the appropriate crosses were repeated in egg-laying cups. Embryos were allowed to hatch and early first instar larvae were sorted by fluorescence. Nonfluorescent first instar larvae were collected on a cornmeal agar plate and their development was observed at 25°.

Rescue of importin {alpha}3D93/{alpha}3D93 lethality: Male flies of the genotype UASp importin {alpha}1, {alpha}2 or {alpha}3/UASp {alpha}1, {alpha}2, or {alpha}3; FRT82B, {alpha}3D93/TM3 {GFP}, Ser1 (males carrying UASp {alpha}1 had the original {alpha}3D93 chromosome instead of FRT82B, {alpha}3D93) were crossed to virgin females of the genotype Gal4tubP, {alpha}3D93/TM3 {GFP}, Ser1. Progeny were scored at the onset of pupariation for fluorescence when observed through the side of the vial with a UV dissecting microscope. The resulting adult progeny were scored for the presence of the Ser1 marker on the TM3{GFP}, Ser1 chromosome. Viability indices were calculated by dividing the number of observed offspring by the number of expected offspring if all nonhomozygous balancer genotypes were viable to the indicated stage (Table 3). Due to the partial penetrance of Ser1, all non-Ser1 flies were assayed for fluorescence with a UV dissecting microscope to conclusively determine their genotype. As a negative control, {alpha}3D93/TM3{GFP}, Ser1 males were mated to Gal4tubP, {alpha}3D93/TM3{GFP}, Ser1 females.


 
View this table:
In this window
In a new window

 
Table 3. Rescue of importin {alpha}3D93/{alpha}3D93 lethality

The approximate stage of lethality for UASp importin {alpha}1, {alpha}2, or {alpha}3;{alpha}3D93/Gal4tubP, {alpha}3D93 offspring was determined as previously described. FRT82B, {alpha}3D93/Gal4tubP, {alpha}3D93 and {alpha}3D93/Gal4tubP, {alpha}3D93 offspring served as negative controls.

Rescue of importin {alpha}3D93/{alpha}317-7 lethality: Male flies of the genotype UASp importin {alpha}1, {alpha}2, or {alpha}3/CyO; Gal4tubP, {alpha}3D93/TM3 {GFP}, Ser1 were crossed to females of the genotype FRT82B, {alpha}317-7/TM3 {GFP}, Sb1. Progeny were scored at the onset of pupariation as previously described. It was assumed that all nonfluorescent pupae had inherited the UASp importin {alpha} transgene and not CyO. Adult offspring were scored for the presence of the CyO, TM3 {GFP}, Ser1, and TM3 {GFP}, Sb1 balancers using the appropriate markers. Viability indices were calculated as previously described, except we assumed that all CyO; Gal4tubP, {alpha}3D93/ FRT82B, {alpha}317-7 offspring died as first/second instar larvae and, therefore, zero offspring of this genotype were expected at later stages. The viability of adult progeny was calculated for (a) UASp {alpha}1, {alpha}2 or {alpha}3 ; Gal4tubP, {alpha}3D93/ FRT82B, {alpha}317-7 experimental flies and (b) UASp {alpha}1, {alpha}2, or {alpha}3; Gal4tubP, {alpha}3D93/TM3 {GFP}, Sb1 positive control flies (Table 4). As a negative control Gal4tubP, {alpha}3D93/TM3 {GFP}, Ser1 males were crossed to FRT82B, {alpha}317-7/TM3{GFP}, Sb1 females and the viability of Gal4tubP, {alpha}3D93/FRT82B, {alpha}317-7 offspring was calculated at puparium, pharate adult, and adult stages (Table 4). Due to the partial penetrance of Ser1, all non-Ser1 flies were assayed for fluorescence with a UV dissecting microscope to conclusively determine their genotype. The approximate stage of lethality for UASp {alpha}1, {alpha}2, or {alpha}3;FRT82B, {alpha}317-7/Gal4tubP, {alpha}3D93 off-spring was determined as previously described. FRT82B, {alpha}317-7/Gal4tubP, {alpha}3D93 and FRT82B, {alpha}317-7/{alpha}3D93 offspring served as negative controls.


 
View this table:
In this window
In a new window

 
Table 4. Rescue of importin {alpha}3D93/{alpha}317-7 lethality

Generating homozygous importin {alpha}3D93 eyes using EGUF/hid: UASt FLP, Gal4eye/CyO; FRT82B, GMR-hid, l(3)CL-R1/TM6B females were crossed to: (a) FRT82B, {alpha}3+, 87E P-lacW [w+]/FRT82B, importin {alpha}3+, 87E P-lacW [w+] or (b) FRT82B, {alpha}3D93/TM6B flies. Adult offspring of the genotype (a) UASt FLP, Gal4eye/+; FRT82B, GMR-hid, l(3)CL-R1/FRT82B, {alpha}3+, 87E P-lacW [w+] or (b)UASt FLP, Gal4eye/+; FRT82B, GMR-hid, l(3)CL-R1/FRT82B, {alpha}3D93 were selected for and their eyes were analyzed by scanning electron microscopy (SEM) and tangential sectioning.

Rescue of homozygous importin {alpha}3D93 eyes: UASt FLP, Gal4eye/CyO; FRT82B, GMR-hid, l(3)CL-R1/TM6B females were crossed to UASp importin {alpha}1, {alpha}2, or {alpha}3/CyO; FRT82B, {alpha}3D93/TM6B males. Adult offspring of the genotype UASt FLP, Gal4eye/UASp {alpha}1, {alpha}2, or {alpha}3 ; FRT82B, GMR-hid, l(3)CL-R1/FRT82B, {alpha}3D93 were selected for and their eyes were analyzed by SEM and tangential sectioning.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Phenotypes associated with importin {alpha}31 can be removed by recombination:
A Drosophila importin {alpha}3 hypomorphic mutation, {alpha}31, was reported to greatly reduce viability, and all surviving females were sterile (MATHE et al. 2000 Down). The {alpha}31 allele is associated with a P-element insertion (P-lacW [w+]) located ~780 bp upstream of the start codon (MATHE et al. 2000 Down). To determine if UASp {alpha}1, {alpha}2, or {alpha}3 transgenes could rescue the homozygous {alpha}31 phenotypes a Gal4arm driver was recombined onto the same chromosome as {alpha}31. Unexpectedly, the Gal4arm, {alpha}31 chromosome was homozygous viable (Table 1) and homozygous females were fertile (not shown). The presence and correct position of the {alpha}31 P element was confirmed by PCR (Fig 1). Therefore, the low viability and female sterility of {alpha}31 flies is likely not due to the hypomorphic {alpha}3 mutation. Alternatively, it is possible that the chromosome containing the Gal4arm driver carries a suppressor of the {alpha}31 mutation.

To distinguish between these possibilities we repeated the recombination experiment using an independent third chromosome from a "normal" w1118 stock. This analysis showed that 4 out of 74 recombinant P-lacW [w+]-containing chromosomes [importin {alpha}31(R1), {alpha}31(R2), {alpha}31(R3), and {alpha}31(R4)] supported good viability over the original {alpha}31 chromosome (Table 1; not shown). The presence and position of the P-element insert was confirmed by PCR for two of the recombinant chromosomes [{alpha}31(R1) and {alpha}31(R2); Fig 1]. Flies homozygous for {alpha}31(R1) were viable (Table 1) and the females were fertile (not shown). These results confirm that the original P-lacW[w+] insertion could not have been solely responsible for the reported phenotypes. For unknown reasons flies homozygous for {alpha}31(R2) were homozygous lethal despite the fact that they were viable over the original {alpha}31 allele (Table 1).

We also examined the viability of the original and recombinant importin {alpha}31 alleles over various deficiencies. Flies carrying the original {alpha}31 allele or the recombinant {alpha}31(R1) were viable and female progeny were fertile over Df(3R)by416, breakpoints 085D10–12;085E01–03; Df(3R)GB104, breakpoints 085D12;085E10; and Df(3R)by62, breakpoints 085D11–14; 085F06 (Table 1; MATHE et al. 2000 Down; not shown). Further experiments demonstrated that all three of these deficiencies uncover {alpha}3 (Table 2; Fig 3; not shown). Taken together, these results indicate that a second site mutation(s) on the original {alpha}31 chromosome either caused or contributed strongly to the published phenotypes (MATHE et al. 2000 Down). The discovery that the {alpha}31 allele is viable and female fertile over deficiencies and loss-of-function {alpha}3 alleles (see below) suggests that the second-site mutation is the major contributor to these phenotypes. Although {alpha}31 flies were demonstrably hypomorphic for {alpha}3 protein expression (MATHE et al. 2000 Down), the reduced {alpha}3 levels are apparently not deleterious to the organism.

P-element excision-induced alleles of importin {alpha}3:
In search of more severe importin {alpha}3 mutations, a P-element excision mutagenesis was used to create small deletions in the {alpha}3 coding sequence. The P element in the clean {alpha}31(R1) stock was mobilized and offspring were selected for the loss of the P element (loss of white+). A PCR assay using primers flanking the P-element insertion site was used to screen for imprecise P-element excision events (Fig 1). Two small deletions in the {alpha}3 gene ({alpha}3D93 and {alpha}3D165) were identified (Fig 1). Sequencing of the shortened PCR products revealed that the {alpha}3D93 deletion removes 897 bp from the 5' region of {alpha}3, including the coding sequence for the first 20 amino acids. The {alpha}3D165 deletion removes 619 bp but no coding sequence (Fig 1). Because the original {alpha}31 P element was inserted in the 5' region between {alpha}3 and the convergently transcribed predicted open reading frame cg8273 (ADAMS et al. 2000 Down), only ~125 nucleotides remain upstream of one of the predicted start sites of cg8273 in {alpha}3D93 and {alpha}3D165 (Fig 1). Thus, it is possible that the expression of cg8273 will be affected by {alpha}3D93 and {alpha}3D165 deletions.

The importin {alpha}3D93 and {alpha}3D165 mutations were both homozygous lethal and lethal over each other (Table 2). In addition, {alpha}3D93 was lethal over Df(3R)by416, Df(3R)GB104, and Df(3R)by62 (Table 2). Importin {alpha}3D93/{alpha}31 flies were completely viable (Table 2) and the females were fertile (not shown), confirming our conclusion that the {alpha}31 allele does not yield severe phenotypes. In conclusion, this strategy produced recessive lethal {alpha}3 mutants, thereby demonstrating that {alpha}3 is an essential gene in flies.

Importin {alpha}3 deletion mutants do not develop past larval stages:
To determine when importin {alpha}3 mutant flies die, {alpha}3D93 and {alpha}3D165 chromosomes were balanced with a TM3 chromosome marked by GFP (TM3{GFP}, Ser1). In this fashion homozygous mutant offspring could be distinguished from heterozygotes by GFP fluorescence. Homozygous {alpha}3D93 and {alpha}3D165 offspring completed embryogenesis and formed normal-appearing first instar larvae. Most homozygous mutant {alpha}3D93 and {alpha}3D165 first instar larvae were able to duplicate their mouth hooks in preparation for molting (Fig 2B and Fig C), but most died before completing ecdysis. Of the offspring that did begin ecdysis most died while still attached or immediately adjacent to their first instar cuticles. Rarely first instar cuticles were found that were not associated with dead larvae. These larvae presumably died as very early second instar larvae, since we never observed any crawling homozygous mutant second instar larvae. Offspring carrying {alpha}3D93 or {alpha}3D165 deletions over Df(3R)by416 or Df(3R)GB104 also died around the first instar molt (not shown). We conclude that {alpha}3 serves an essential role in larval development and that the majority of {alpha}3 mutant offspring die before or during ecdysis of the first instar larval molt.

importin {alpha}3D93 and {alpha}3D165 larvae express little if any full-length Importin {alpha}3 protein:
Since the phenotypes of importin {alpha}3D93 and {alpha}3D165 were no more severe over deficiencies than when homozygous, it is likely that both mutations are either null or strongly hypomorphic. This conclusion was supported by Northern blot analysis showing that {alpha}3D93/{alpha}3D93 and {alpha}3D165/{alpha}3D165 first instar larvae contained very little or no {alpha}3 mRNA (not shown, see MATERIALS AND METHODS). This was expected since the two deletions removed significant portions of the {alpha}3 5'UTR (MATHE et al. 2000 Down; Fig 1C). Immunoblot analysis was used to investigate whether the first-second instar arrest phenotypes of homozygous {alpha}3D93 and {alpha}3D165 mutants are due to the complete or partial absence of {alpha}3 protein. Total protein was isolated from first instar larvae and examined by immunoblotting with an antiserum against the C-terminal domain of {alpha}3 (MATHE et al. 2000 Down). As shown in Fig 3, homozygous {alpha}3D93, {alpha}3D165, and {alpha}3D93/Df(3R)GB104 first instar larvae contained very little or no full-length {alpha}3 protein. Curiously, a faster-migrating anti-{alpha}3 cross-reactive band appeared in both wild-type and mutant larvae (Fig 3A; see below). The identity of this band is currently unknown.

Rescue of importin {alpha}3D93 larval lethality:
If the developmental defects of importin {alpha}3D93 and {alpha}3D165 mutants are due to the lack of {alpha}3 protein, the defects should be rescued by an {alpha}3 transgene. A Gal4tubP driver was used to express a UASp {alpha}3 transgene in a homozygous {alpha}3D93 background. As shown in Table 3, the {alpha}3 transgene rescued many {alpha}3D93/{alpha}3D93 and {alpha}3D93/{alpha}3D165 offspring to the pigmented pharate adult stage and {alpha}3D93/Df(3R)GB104 offspring to pupal stages, but none to full adulthood. Some rescued larvae completed the second and third instar molts to form morphologically normal pupae before dying, and a few became well-developed pigmented pharate adults that never eclosed (Table 3). When expressed with a Gal4Act5c driver the {alpha}3 transgene rescued {alpha}3D93/{alpha}3D93 offspring to wandering third instar larvae. These partially rescued larvae sclerotized their cuticles but did not extend their spiracles and died before becoming puparia. Full rescue may require the expression of the {alpha}3 transgene in the correct tissues at the correct time and at appropriate levels. The fact that Gal4tubP and Gal4Act5c drivers rescued to different degrees supports this possibility. Another concern is the likelihood that the {alpha}3D93 and {alpha}3D165 deletions affected not only the expression of both {alpha}3's but also the divergently transcribed cg8273 (Fig 1). The partial rescue by the {alpha}3 transgene does, however, demonstrate that the death of {alpha}3D93/{alpha}3D93 larvae around the first molt is due to defects in {alpha}3 and not in cg8273.

An objective of this study is to determine if importin {alpha}1's, {alpha}2's, and {alpha}3's have distinct and/or overlapping functions. Previously, using the Gal4/UAS expression system (BRAND and PERRIMON 1993 Down), we showed that {alpha}1, {alpha}2, and {alpha}3 transgenes all rescued the partial male sterility of {alpha}2 null flies, but only {alpha}2 transgenes rescued the sterility of {alpha}2 null females (MASON et al. 2002 Down). Thus the role of {alpha}2 in gametogenesis appears not to be redundant with {alpha}1 and {alpha}3 in females but is redundant in males. A similar approach was taken to determine if {alpha}1 and {alpha}2 transgenes could rescue the death of {alpha}3 mutant offspring.

For these rescue experiments to be meaningful it is important that the transgenes be expressed at reasonable levels in mutant first instar larvae. Extracts from homozygous importin {alpha}3D93 first instar larvae expressing UASp {alpha}1, {alpha}2, or {alpha}3 transgenes were examined by Western blot using antibodies directed against {alpha}2 (TOROK et al. 1995 Down), {alpha}3 (MATHE et al. 2000 Down), or {alpha}-tubulin (Fig 3B). As shown in Fig 3B, {alpha}2 and {alpha}3 were both expressed at high levels in first instar larvae carrying the UASp {alpha}2 or {alpha}3 transgenes, respectively. A slower-migrating anti-{alpha}3 cross-reactive band in mutant first instar larvae expressing UASp {alpha}1 (* in Fig 3B) is consistent with results observed when UASp {alpha}1 was expressed in {alpha}2 mutant ovaries with the Gal4pnos-VP16 driver (MASON et al. 2002 Down). Since {alpha}1 is predicted to be ~60 kD and {alpha}3 is predicted to be ~56.6 kD, it is likely that this band represents a cross-reaction of {alpha}1 with the anti-{alpha}3 antiserum. We conclude that all three transgenes are expressed at high levels in first instar larvae.

The expression of either the importin {alpha}1 or {alpha}2 transgene delayed the death of homozygous {alpha}3D93 offspring. Many offspring expressing UASp {alpha}1 with the Gal4tubP or Gal4Act5c drivers completed the first instar molt before dying as late-stage second instar larvae, although some larvae appeared to survive to early third instar stages (not shown). Similarly, many {alpha}3D93/{alpha}3D93 offspring expressing UASp {alpha}2 also survived the first instar larval molt before dying as late second or early third instar larvae. In some trials a few of these animals developed to puparia (not shown). We note that {alpha}3D93/{alpha}3D93 offspring expressing {alpha}1 or {alpha}2 were not able to reach pupal stages as efficiently as mutant offspring expressing {alpha}3 (Table 3). We conclude that {alpha}1 and {alpha}2 can, at least partially, replace the function(s) of {alpha}3 during larval development.

Nonsense mutation alleles of importin {alpha}3:
The results described above suggest that {alpha}3 is important for developmental events during or after the first larval molt. There are two caveats to this conclusion. First, the {alpha}3D93 and {alpha}3D165 deletions may affect the expression of cg8273, a divergently transcribed gene whose possible role in development is not known. Second, it is not certain whether the {alpha}3D93 and {alpha}3D165 alleles are null or hypomorphic. If hypomorphic, it is possible that {alpha}3 is required for even earlier stages of development. To address these issues we used two nonsense alleles, {alpha}317-7 containing a stop codon after amino acid (aa) 131 in the second ARM repeat and {alpha}3w73 containing a stop codon after aa 158 within the third ARM repeat (kindly provided by T. Herman and L. Zipursky). Since the nonsense mutations were isolated in a screen using heavy mutagenesis they may carry multiple mutations (T. HERMAN and L. ZIPURSKY, personal communications). However, by working with independently derived nonsense mutations over the {alpha}3D93 deletion chromosome we can alleviate the possible contribution of recessive mutations in cg8273 or other loci to the phenotype. Both {alpha}317-7 and {alpha}3w73 were completely lethal over {alpha}3D93, {alpha}3D165, and Df(3R)GB104 (Table 2; not shown). Importin {alpha}3w73/{alpha}3D93 offspring died as mid to late second instar larvae, indicating that the {alpha}3w73 allele may not be null. In contrast, many {alpha}317-7/{alpha}3D93 and {alpha}317-7/Df(3R)GB104 larvae died at the first/second instar molt with duplicated mouth hooks (Fig 2D; not shown), although some died as early second instar larvae. More {alpha}3D93/{alpha}317-7, like {alpha}3D93/{alpha}3D165, offspring appeared to complete ecdysis and died as early second instar larvae compared to {alpha}3D93/{alpha}3D93 and {alpha}3D165/{alpha}3D165 mutants. This is possibly due to subtle genetic background differences. Generally, then, {alpha}317-7, {alpha}3D93, and {alpha}3D165 alleles all cause death at or soon after the first larval molt. Therefore, the larval deaths of {alpha}3D93 and {alpha}3D165 mutant flies reflect defects in {alpha}3 expression that are independent of cg8273.

As expected, levels of Importin {alpha}3 protein in first instar larvae carrying {alpha}317-7 over {alpha}3D93 or Df(3R)GB104 were extremely low or undetectable (Fig 3C). The faster-migrating cross-reactive band described above is also apparent in extracts from {alpha}317-7/Df(3R)GB104 flies (Fig 3C). This finding rules out the possibility that this band is an N-terminal truncation expressed from the {alpha}3D93 chromosome. The band is unlikely to be a degradation product of maternal {alpha}3 since the faster-migrating band is also present in extracts from {alpha}3D93/{alpha}3D93 and {alpha}317-7/{alpha}3D93 larvae that were rescued to third instar by an {alpha}2 transgene (see below). The identity of this faster-migrating band is a mystery, since it appears in extracts from flies (potentially) expressing native, N-terminally truncated ({alpha}3D93 and {alpha}3D165), and C-terminally truncated ({alpha}317-7) {alpha}3 proteins, each of which has a different predicted mass. The simplest explanation is that the band is a spurious cross-reactive species that is unrelated to {alpha}3.

Importantly, expression of UASp importin {alpha}3 with Gal4tubP was able to rescue {alpha}317-7/{alpha}3D93 and {alpha}3w73/{alpha}3D93 offspring to fully viable fertile adults (Table 4; not shown). Thus, it is likely that the inability to rescue {alpha}3D93/{alpha}3D93 flies to adulthood with an {alpha}3 transgene is due to disruption of cg8273 expression. In contrast, UASp {alpha}1 and {alpha}2 transgenes were both unable to rescue {alpha}317-7/{alpha}3D93 flies to adulthood (Table 4). However, the {alpha}2 transgene was able to rescue some offspring to abnormal pharate adults, although most died at earlier stages (Table 4). Dissecting these partially rescued pharate adults from the pupal cases revealed that some adult structures were at least partially formed, including wings, tergites, sternites, thorax, and bristles. Expression of the {alpha}1 transgene rescued less well, as these offspring survived at best to late second or early third instar larvae. It is worth noting that heterozygous {alpha}3D93 flies expressing UASp {alpha}1 have a lower than expected viability (Table 4). Thus, it is possible that the overexpression of {alpha}1 causes a partial-dominant lethal phenotype. On the basis of these rescue experiments we conclude that {alpha}3 serves a mostly redundant function during larval development. However, since {alpha}1 and {alpha}2 transgenes do not rescue to adult stages it is likely that the role of {alpha}3 in the development of some adult tissues cannot be replaced by {alpha}1 or {alpha}2.

Analysis of importin {alpha}3D93 mutant eyes:
The observation that importin {alpha}3 does not appear to play an exclusively paralog-specific role in larval development led us to examine the effects of the loss of {alpha}3 on the development of adult tissues. To address this issue we created an FRT82B, {alpha}3D93 chromosome that can be used to create clones of homozygous {alpha}3D93 cells in an otherwise heterozygous fly using the FLP/FRT recombinase system (XU and HARRISON 1994 Down). We subsequently generated eyes that were homozygous for {alpha}3D93 using a stock that expresses the FLP recombinase in the eye and contains a FRT82B, GMR-hid chromosome (STOWERS and SCHWARZ 1999 Down). The GMR-hid element drives the expression of the apoptosis-inducing gene hid under the control of the eye-specific GMR enhancer. Consequently, any eye cell that contains one or two copies of GMR-hid undergoes apoptosis during early pupal stages. Therefore, only cells that have lost this chromosome through mitotic recombination survive to form adult eyes (STOWERS and SCHWARZ 1999 Down; Fig 4A). Consistent with previous results, we observed that FRT82B, {alpha}3+/FRT82B, GMR-hid flies had well-formed eyes when FLP recombinase was expressed in the eye (STOWERS and SCHWARZ 1999 Down; Fig 4B), although the photoreceptor patterning observed in eye sections appears to be slightly defective (Fig 5A).



View larger version (120K):
In this window
In a new window
Download PPT slide
 
Figure 4. SEM of importin {alpha}3 mutant and rescued eyes. Flies of the genotypes (A) Gal4eye, UASt FLP; FRT82B, GMR-hid/TM6B; (B) Gal4eye, UASt FLP; FRT82B, GMR-hid/FRT82B, importin {alpha}3+; (C) Gal4eye, UASt FLP; FRT82B, GMR-hid/FRT82B, {alpha}3D93; (D) Gal4eye, UASt FLP/UASp {alpha}1; FRT82B, GMR-hid/FRT82B, {alpha}3D93; (E) Gal4eye, UASt FLP/UASp {alpha}2; FRT82B, GMR-hid/FRT82B, {alpha}3D93; and (F) Gal4eye, UASt FLP/UASp {alpha}3; FRT82B, GMR-hid/FRT82B, {alpha}3D93 were critical-point dried and examined by scanning electron microscopy.



View larger version (146K):
In this window
In a new window
Download PPT slide
 
Figure 5. Tangential sections through importin {alpha}3 mutant and rescued eyes. Eyes dissected from flies of the genotypes (A) Gal4eye, UASt FLP ; FRT82B, GMR-hid/FRT82B,