- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Blanc, V. M.
- Articles by Adams, J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Blanc, V. M.
- Articles by Adams, J.
Evolution in Saccharomyces cerevisiae: Identification of Mutations Increasing Fitness in Laboratory Populations
Victoria M. Blanc1,a and Julian Adamsaa Department of Biology, University of Michigan, Ann Arbor, Michigan 48109-1048
Corresponding author: Julian Adams, Cellular, and Developmental Biology and Ecology and Evolutionary Biology, 830 N. University, University of Michigan, Ann Arbor, MI 48109-1048., julian{at}umich.edu (E-mail)
Communicating editor: H. OCHMAN
| ABSTRACT |
|---|
Since the publication of the complete sequence of the genome of Saccharomyces cerevisiae, a number of comprehensive investigations have been initiated to gain insight into cellular function. The focus of these studies has been to identify genes essential for survival in specific environments or those that when mutated cause gross phenotypic defects in growth. Here we describe Ty1-based mutational approaches designed to identify genes, which when mutated generate evolutionarily significant phenotypes causing small but positive increments on fitness. As expected, Ty1 mutations with a positive fitness effect were in the minority. However, mutations in two loci, one inactivating FAR3 and one upstream of CYR1, identified in evolving populations, were shown to have small but significantly positive fitness effects.
THE number of complete genome sequences that has been published is now large and includes a diverse array of organisms. The genome of Saccharomyces cerevisiae,
12 Mb in size and containing
6000 protein-coding genes (![]()
Recently, a number of experimental approaches have been utilized to gain insight into cellular function in S. cerevisiae. One strategy that has been utilized has been to analyze the phenotypes resulting from a series of systematically constructed deletions (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
As informative as these studies have been, they were designed to identify mutations with a neutral or deleterious effect on fitness; and they will not necessarily identify evolutionarily significant mutations with small but positive effects on fitness. In this article, we describe and utilize two alternative experimental approaches to identify mutations enhancing fitness. Both approaches use Ty1 transposon tagging to identify adaptive mutations. The first approach relies on spontaneous Ty1 transpositions occurring in an initially genetically homogeneous population during long-term culture (
1000 generations), whereas the second approach relies on the generation of large amounts of genetic variation due to Ty1 transposition, followed by short-term culture (
100 generations) to allow the most fit clone to predominate. These two approaches may be considered to be complementary and possess their own advantages and disadvantages. Non-Ty1-associated adaptive mutations may complicate the analysis of the populations obtained from the first rather than the second approach. However, multiple Ty1 insertions, some with a nonzero fitness effect, will complicate the analysis of the populations obtained from the second approach, but will rarely be a factor in the first.
Using both approaches mutations were identified, one inactivating the FAR3 locus and one upstream of CYR1, which encodes adenylate cyclase. Reconstruction experiments confirmed the adaptive advantage of both mutations.
| MATERIALS AND METHODS |
|---|
Media, growth, and sampling:
Batch cultures were grown in 10 ml 1% yeast extract, 2% peptone, and 2% glucose (YPD), at 30°, in a gyratory shaker at 150200 gyrations/min. Solid YPD medium contained 1.4% agar. When indicated, G418 (200 µg/ml) was added after autoclaving. Synthetic complete medium lacking uracil (SC - ura) or leucine (SC - leu) was made as described (![]()
Strains:
Strains used in this study are listed in Table 1. Clones derived from CMW101 and isolated during the experiment are listed in Table 2. Disruptions of the LEU2 and FAR3 loci were generated by transformation with purified amplification products containing the KanMX cassette (![]()
![]()
|
|
Population construction:
Strain 337, containing no Ty1 elements, was transformed using the lithium acetate procedure (![]()
![]()
5 x 105 transformed cells. Cells were incubated for 23 days before sampling every 612 hr. A portion of each sample was plated to YPD, and the remainder was stored in 40% glycerol at -70°. Analysis of the samples taken at each time point indicated that the sample from the fifth time point contained cells with a small range in the number of Ty1 insertions (08). To generate populations used in selection experiments, cells from the frozen stock of time point number five were added directly to 10 ml YPD medium.
Serial dilution cultures and sampling:
Competition experiments between FAR3+ and far3 strains were initiated with frequencies of far3 of
0.1 or
0.5. The far3 strain was isolated from generation 546 of the long-term population described by ![]()
1 x 108 cells/ml, and transferred to fresh YPD at
1 x 103 cells/ml. far3::Ty1 allele frequency was monitored by PCR amplification of the disrupted FAR3 locus, using primers to the 3' ends of Ty1 and the FAR3 ORF, and/or by Southern blotting, using the FAR3 ORF as a probe. In experiments where FAR3 was disrupted by KanMX, changes in the frequency of G418 resistance were estimated by plating samples of appropriate dilutions onto YPD plates and then picking colonies onto YPD plus G418. Relative fitnesses were calculated as described previously (![]()
![]()
DNA manipulations:
Yeast nuclear DNA was isolated using methods previously described (![]()
PCR:
For inverse PCR (![]()
For flank PCR (![]()
![]()
Amplification was carried out under the following conditions: 100 ng digested and ligated genomic DNA, 50 pmol of primer "VB1" 5'-GATCGTTGATCTACTATCAGTAAG-3' and 50 pmol primer "VB2" 5'-GAGACTTAGAGATGAAGTATC-3', 200 µM dNTPs, 1x Taq Polymerase buffer, 2.5 mM MgCl2, and 1 unit Taq Polymerase (Promega) in a 100-µl reaction. Samples were heated in an MJ Research (Waltham, MA) thermal cycler at 94° for 3 min and then cycled 30 times through the following temperature profile: 1 min 94°, 45 sec 42°, 2 min 72°, followed by a final 5-min extension at 72°. PCR products were separated on a 1.5% low-melting-point agarose gel, and bands >630 bp in size were cut out of the gel. Two volumes of water were added to the gel slice, which was then melted at 65° for 20 min, and 510 µl was used for a nested PCR. Nested PCR was performed under the same conditions as above, using VB1 and nested primer VB3 5'-AGAACTTCTAGTATATTCTG-3', which anneals to the Ty1 template 402 bp downstream of VB2. Nested products were gel extracted using either Schleicher and Schuell (Keene, NH) NA45 DEAE cellulose paper or the QIAquick gel extraction kit (QIAGEN). These DNA fragments were subsequently sequenced (see below). The FAR3 and ACT1 ORF sequences were amplified from strain 337 using "GenePairs" primers for YMR052W and YFL039C, respectively, available from Research Genetics (Huntsville, AL). PCR was performed under the conditions recommended by the company. YMR052W-reverse primer and primer VB4 5'-GATCTATTACATTATGGGTG-3', which anneals to a region in the 3' end of Ty1, were used in experiments to monitor the frequency of the Ty1::FAR3 allele in reconstruction experiments. Cycling conditions were as described for inverse PCR.
To generate deletion cassettes for FAR3 and LEU2, oligonucleotides were synthesized such that their 5' ends would generate 60 bp of DNA homologous to the gene being replaced, and the 3' ends were complementary to the KanMX gene, located on the plasmid pFA6-KanMX4, and used as the template for PCR. The 5' ends were designed such that the entire genomic ORF would be replaced with KanMX. The primer used for homologous recombination at the 5' end of FAR3 has the sequence 5'-CCGGCTAGCATTCGGCGATTAATGAAGAAAGTAAAACCGTGATTTATTACTTCTTGCTCGCAGCTGAAGCTTCGTACGC-3' and the primer for 3' end recombination is 5'-AATGCATTCAAGGTTTGCTATTTCACGTCTGCTTACACTTTTGTTCGATCCATCGTAGGGCATAGGCCACTAGTGGATCTG-3'. To replace LEU2, the following primer pair was used: 5'-TTCTAACTTTTCTTACCTTTTACATTTCAGCAATATATATATATATATTTCAAGGATATACAGCTGAAGCTTCGTACGC-3' and 5'-ACCCTATGAACATATT CCATTTTGTAATTTCGTGTCGTTTCTATTATGAATTTCATTTAGCATAGGCCACTAGTGGATCTG-3', which recombined with the 5' and 3' ends of the gene, respectively. The underlined sequences anneal to KanMX. PCR conditions were as described (![]()
Cycle sequencing:
We used the Perkin Elmer (Norwalk, CT) fluorescent-dye termination kit, following manufacturer's instructions, except that all reactions using 2.5 pmol VB3 were halved. Cycling conditions were: 2 min at 96°, followed by 25 cycles of 96° for 30 sec, 42° for 20 sec, and 60° for 4 min. Products were sequenced using an ABI prism 310 or 377 automated sequencer. Sequenced products were compared to GenBank (http://www.ncbi.nlm.nih.gov/) and/or the Saccharomyces cerevisiae Genome Database (SGD; http://genome-www.stanford.edu/Saccharomyces/) using the BLAST algorithm (![]()
Southern blotting and hybridization conditions:
Genomic yeast DNA was isolated as described (![]()
![]()
![]()
-32P]dATP, by random priming, using a kit by Promega.
Northern analysis:
Yeast cells were grown to midlog phase and total RNA was isolated as previously described (![]()
![]()
| RESULTS |
|---|
Two different approaches were used to search for mutations that increased fitness under our conditions.
Analysis of a population maintained for
1000 generations:
In work described by ![]()
1000 generations. Samples were taken for analysis every 200 generations, and the changes in Ty1 number were monitored by hybridization of a Ty1-specific probe to yeast genomic DNA, and the differences were compared between the clones. Over the course of the experiment a small but significant increase in Ty1 number/genome was observed. The loci of insertions of the Ty1 elements were determined by Ty1-specific inverse PCR (![]()
![]()
,
, or
elements (![]()
To determine if this clone possessed a selective advantage relative to other clones coexisting in the population at the time it was identified, competition experiments were initiated to reconstruct the changes occurring in the population. Clone F was inoculated in 10 ml YPD at frequencies of either 0.10 or 0.50. The remainder of the population was composed of 19 other clones in equal frequencies, isolated from the population at generation 546, the generation sample at which clone F was first identified. In all replicates, the frequency of clone F increased significantly. The average fitness of clone F was 1.0149 ± 0.0074 (relative to 1 for the other 19 clones) and was independent of the initial frequency of clone F (Table 3). Thus, clone F possesses a small, but significant growth advantage over other clones isolated from the sample taken at generation 546. Furthermore, there is no evidence that this selective advantage is dependent on the frequency of clone F in the population.
|
Clone F possessed three Ty1 elements whose order of insertion can be traced from the population history. The first insertion was identified near tRNA-Lys, and the second is located within a cluster of LTRs, while the third is found upstream of the FAR3 locus, in the 5' noncoding region of FAR3, at -35 relative to the translation start site and in the same transcriptional orientation (Fig 1). Upstream from FAR3 is a tRNA-Trp gene and several solo
elements indicative of past Ty insertions. Considering the location of the three insertions, and that clones containing only the tRNA-Lys and composite LTR insertions were lost from the population, the results suggest that the most likely cause of the selective advantage observed is the third insertionupstream of FAR3.
|
FAR3 is expressed constitutively in a- and
-haploid and diploid cells and is required for pheromone-mediated cell cycle arrest (![]()
Production of genetic variation for Ty1 transposition events:
Strain 337, transformed with pGTyH3 (see MATERIALS AND METHODS), was grown in liquid SC - ura media with galactose as the carbon source, to induce transposition. After
2.5 generations of growth, the average number of Ty1 insertions was 2.0 ± 2.3 including clones containing zero Ty elements (
25%) and those containing up to eight insertions. The short duration of growth in galactose medium ensured that the overwhelming majority of the genetic variation was generated by Ty1 insertion.
Each clone possessing one or more Ty elements exhibited a different Ty banding pattern, indicative of a high level of variability for Ty1 insertion sites. Three populations were then inoculated with
140 cells in 10 ml YPD and grown overnight. The following day, each population was split evenly into two flasks and allowed to reach stationary phase, when the cells were diluted to fresh medium at
1000 cells/ml in 10 ml. This process of serial dilution was repeated until 120130 generations of growth had elapsed. Colonies were then sampled and assayed for Ty1 pattern by Southern blotting. In all three populations, the same clone type predominated in both replicates, indicating the presence of an adaptively favored clone at the start of the experiment.
To confirm that these clones possessed an increased fitness compared to the progenitor strain 337, reconstruction competition experiments were initiated with 337 and clones containing the same Ty1 insertions (as determined by hybridization profiles) isolated from the earliest samples available. The use of such clones minimized the confounding of any Ty1-associated selective effect with that of any potential spontaneous non-Ty1-associated adaptive mutations, which may have occurred during the 120-130 generations of growth. As expected, in every replicate, the frequency of the clone containing the Ty1 insertions increased over time. Thus, the data indicate that the clones predominating in the populations were selectively favored compared to their progenitor 337. In the case of population II, the predominating clone possessed only one Ty1 insertion.
Table 4 shows the loci of insertions of the Ty1 elements in the three populations. The predominant clone in population I possessed seven Ty1 elements. Of these, five were sequenced, and three were located near tRNA genes. One insertion matched nothing in the database. The last insertion identified was located at +180 bp from the ATG codon of the FAR3 gene (Fig 2). The fitness of this clone (relative to a fitness of 1 for strain 337) was estimated, from reconstruction experiments, to be 1.0123 ± 0.0019.
|
|
The predominant clone in population II possessed only one element located 512 bp upstream of CYR1, which encodes adenylate cyclase (![]()
![]()
The predominant clone in population III possessed three Ty1 elements, of which one was also located upstream of the CYR1 locus. However, Southern analysis indicated that the location of the insertion in population II upstream of CYR1 was different from that seen in population III and was located closer to the CYR1 start codon. The fitness of this clone (relative to a fitness of 1 for strain 337) was estimated, from reconstruction experiments, to be 1.0355 ± 0.0173.
Molecular analysis of FAR3 and CYR1:
Given that the FAR3 locus in population I is disrupted by a Ty1 insertion, it seemed probable that its expression was lost. Analysis of the expression of FAR3-specific mRNA in population I by Northern blotting showed the expression of a shorter mRNA, as compared to that in 337 (data not shown). This lower molecular weight mRNA can be attributed to expression from the intact FAR3 promoter through to the Ty1. Translation of this mRNA would produce a protein consisting of the first 60 amino acids of Far3p, followed by 11 amino acids encoded fortuitously by the LTR of Ty, until a stop codon is reached. Truncations of Far3p after codon 122 have been shown to be inactive (![]()
Since loss of CYR1 function has been shown to be lethal (e.g., ![]()
Selective effect of loss of FAR3 expression:
To confirm that the observed increase in fitness was due to the loss of FAR3 expression, rather than to a different spontaneous mutation, competition experiments were performed with a pair of strains isogenic except for a deletion of the FAR3 locus. A deletion of FAR3 was constructed in the standard laboratory strain X2180 using the KanMX deletion cassette (![]()
As before, competition experiments were initiated with two initial frequencies of the FAR3 deletion strain, 0.10 and 0.50. In all replicates, an increase in the relative frequency of cells resistant to G418 was observed. The relative fitness of the far3
strain was 1.0204 ± 0.0021 (Table 3). The increment in fitness observed was not significantly different from that observed for clone F (Table 3).
To confirm that that the selective difference observed was due to the loss of FAR3 and not to the presence of the KanMX cassette, similar competition experiments were performed using a strain in which the LEU2 gene had been replaced with the KanMX cassette. Previous experiments had indicated that leu2 auxotrophs had no selective advantage in rich medium. Deletion of the LEU2 locus was confirmed by Southern blotting of genomic DNA digests using a LEU2-specific probe. No hybridization was observed in G418-resistant transformants. In addition, these cells were unable to grow on medium lacking leucine, but were capable of growth when leucine was supplied. As expected, the fitness of the leu2
::KanMX strain was not significantly different from that of the LEU2+ parent strain (X2180; Table 3).
| DISCUSSION |
|---|
Ty1 is the most abundant of the yeast transposable elements, present in >30 full-length copies in laboratory strains. The effects of Ty1 transposition can be deleterious, neutral, or beneficial. Arguments for the neutrality of Ty1 elements come from the observation of their abundance in yeast; laboratory strains show no apparent harmful effects of having such high numbers, although in wild strains the average Ty1 number is somewhat lower (![]()
![]()
![]()
A number of studies have systematically analyzed the genome of S. cerevisiae to identify genes that when mutated or deleted have a deleterious or lethal effect. The focus of this communication was to identify genes that when mutated enhance fitness. Our results show that the experimental design allows us to identify mutations that have a quite small, but significant beneficial effecton the order of 2%. It is also clear from the results that such mutations constitute a small proportion of the total mutational spectrum, as the selective effects of a large number of Ty1 insertions were assayed as the populations evolved. Ty1 transpositions occur at a rate of 10-510-7/element/cell division (![]()
1000 generations ranged in cell number from 104 immediately after transfer to fresh medium to 109 at stationary phase. Therefore, at a minimum, there was less than one new transposition event per generation, and at a maximum, there were 10,000 for each element. Consequently, between 1000 and 1 x 107 Ty1-induced mutations occurred during this time. Nevertheless, beneficial mutations were seen at only two loci. Moreover, mutations at the same two loci were seen in independent populations, providing further evidence that there are a limited number of loci at which beneficial Ty1-induced mutations may occur.
Our study does not permit us to identify Ty1 mutations that have a deleterious or lethal effect on fitness. However, our results indicate that the majority of the Ty1-induced mutations identified in this work (![]()
![]()
![]()
![]()
One insertion was identified in the 5' region of the FAR3 gene. This is consistent with the observation that Ty1 target site preference is not exclusive to tRNAs and LTRs. In fact, when Ty1 is observed in or near protein-encoding genes, it shows another level of targeting to the 5' regions (![]()
![]()
![]()
Mutations in FAR3 enhance fitness:
Our results show unambiguously that mutations inactivating FAR3 are selected in laboratory culture. FAR3 was previously identified as a gene required for pheromone-mediated G1 arrest (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Our results show that FAR3 may operate in a more general cell arrest pathway, particularly since it is expressed constitutively through the cell cycle in both a and
cells (![]()
Mutations 5' to CYR1 enhance fitness:
Three lines of evidence point to a selective advantage of mutations upstream of CYR1.
- Clones containing two different mutations upstream of CYR1 were selected in two independent populations constructed so that the overwhelming majority of variation was due to Ty1 insertion.
- One clone possessed only one Ty1 insertionupstream of CYR1. Consequently, the only alternative explanation for the predominance of this clone would be a non-Ty1-based adaptive mutationwhich can be considered to be unlikely given the experimental design.
- The fitness increments associated with the two clones possessing Ty1 insertions upstream of CYR1 possessed the same fitnesses, relative to the parent strain 337: 0.040 (population II) and 0.055 (population III). The clone selected in population III contained, in addition to a Ty1 insertion upstream of CYR1, two other insertions, one near a tRNA locus and one within a
element. However, the results from independent experiments have shown that such insertions have no significant selective effect and thus can be considered neutral (BLANC 2000 ).
Our results provide no indication that the Ty1 insertions upstream of CYR1 alter the expression of this locus. Indeed, the distance between the locus of one of the insertions and the CYR1 start codon, 512 bp, renders this possibility quite unlikely. Nevertheless, it is tantalizing to speculate that such insertions have effects on CYR1 expression that are too subtle to be detected by our assays, as previous work by ![]()
![]()
130 bp upstream of the CYR1 start codon indicate the existence of a previously unidentified ORF in this region (A. KUMAR, personal communication).
In conclusion, the work presented here demonstrates how Ty1 transposon tagging may be used to identify fitness-enhancing mutations. Two such mutations have been identified: in one case, identifying a novel phenotype associated with a previously characterized mutation; and in the second, a possible new ORF, which has not been previously characterized. In this article we employed populations maintained in large volumes (10150 ml). However, the same experimental procedures could conceivably be carried out using much smaller volumes, in microtiter plates, thus allowing for a much larger-scale screening for adaptive mutations.
| FOOTNOTES |
|---|
1 Present address: Asterand Inc., Detroit, MI 48201. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank M. Blot, J. Maddock, L. Olsen, M. Savageau, and C. Wilke for helpful discussion. This work was supported in part by National Institutes of Health (NIH) grant AI55756. V.M.B. acknowledges support of NIH training grants NIH 5 T32 GM07544 and NIH 5-T32 HG00040.
Manuscript received June 16, 2003; Accepted for publication June 25, 2003.
| LITERATURE CITED |
|---|
ALTSCHUL, S. F., T. L. MADDEN, A. A. SCHAFFER, J. ZHANG, and Z. ZHANG et al., 1997 Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.
BLANC, V. M., 2000 Effects of retrotransposon Ty1 on fitness in Saccharomyces cerevisiae. Ph.D. Thesis, University of Michigan, Ann Arbor, MI.
BLANC, V. M. and J. ADAMS, 2003 Ty1 insertions in intergenic regions of the genome of Saccharomyces cerevisiae transcribed by RNA polymerase III have no detectable selective effect. FEMS Yeast Res. in press.
BOEKE, J. D., D. J. GARFINKEL, C. A. STYLES, and G. R. FINK, 1985 Ty elements transpose through an RNA intermediate. Cell 40:491-500.[Medline]
BOEKE, J. D., D. J. EICHINGER, and G. NATSOULIS, 1991 Doubling Ty1 element copy number in Saccharomyces cerevisiae: host genome stability and phenotypic effects. Genetics 129:1043-1052.[Abstract]
CASPERSON, G. F., N. WALKER, and H. R. BOURNE, 1985 Isolation of the gene encoding adenylate cyclase in Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 82:5060-5063.
CHERKASOVA, V., D. M. LYONS, and E. A. ELION, 1999 Fus3p and Kss1p control G1 arrest in Saccharomyces cerevisiae through a balance of distinct arrest and proliferative functions that operate in parallel with Far1p. Genetics 151:989-1004.
CHURCH, G. M. and W. GILBERT, 1984 Genomic sequencing. Proc. Natl. Acad. Sci. USA 81:1991-1995.
CURCIO, M. J. and D. J. GARFINKEL, 1991 Single-step selection for Ty1 element retrotransposition. Proc. Natl. Acad. Sci. USA 88:936-940.
EIBEL, H. and P. PHILIPPSEN, 1984 Preferential integration of yeast transposable element Ty into a promoter region. Nature 307:386-388.[Medline]
ELION, E. A., J. A. BRILL, and G. R. FINK, 1991 FUS3 represses CLN1 and CLN2 and in concert with KSS1 promotes signal transduction. Proc. Natl. Acad. Sci. USA 88:9392-9396.
FARLEY, F. W., B. SATTERBERG, E. J. GOLDSMITH, and E. A. ELION, 1999 Relative dependence of different outputs of the Saccharomyces cerevisiae pheromone response pathway on the MAP kinase Fus3p. Genetics 151:1425-1444.
GARTNER, A., A. JOVANOVIC, D. I. JEOUNG, S. BOURLAT, and F. R. CROSS et al., 1998 Pheromone-dependent G1 cell cycle arrest requires Far1 phosphorylation, but may not involve inhibition of Cdc28-Cln2 kinase, in vivo.. Mol. Cell. Biol. 18:3681-3691.
GAVIN, A.-C., M. BÖSCHE, R. KRAUSE, P. GRANDI, and M. MARZIOCH et al., 2002 Functional organization of the yeast proteome by systematic analysis of protein complexes. Nature 415:141-147.[Medline]
GEITZ, R. D., R. H. SCHIESTL, A. R. WILLEMS, and R. A. WOODS, 1995 Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 11:355-360.[Medline]
GOEBL, M. G. and T. D. PETES, 1986 Most of the yeast genomic sequences are not essential for cell growth and division. Cell 46:983-992.[Medline]
GOFFEAU, A., B. G. BARRELL, H. BUSSEY, R. W. DAVIS, and B. DUJON et al., 1996 Life with 6000 genes. Science 274:546-563. 567.
HORECKA, J. and G. F. SPRAGUE, JR., 1996 Identification and characterization of FAR3, a gene required for pheromone-mediated G1 arrest in Saccharomyces cerevisiae.. Genetics 144:905-921.[Abstract]
IIDA, H., 1988 Multistress resistance of Saccharomyces cerevisiae is generated by insertion of retrotransposon Ty into the 5' coding region of the adenylate cyclase gene. Mol. Cell. Biol. 8:5555-5560.
JI, H., D. P. MOORE, M. A. BLOMBERG, L. T. BRAITERMAN, and D. F. VOYTAS et al., 1993 Hotspots for unselected Ty1 transposition events on yeast chromosome III are near tRNA genes and LTR sequences. Cell 73:1007-1018.[Medline]
KATAOKA, T., D. BROEK, and M. WIGLER, 1985 DNA sequence and characterization of the S. cerevisiae gene encoding adenylate cyclase. Cell 43:493-505.[Medline]
KIM, J. M., S. VANGURI, J. D. BOEKE, A. GABRIEL, and D. F. VOYTAS, 1998 Transposable elements and genome organization: a comprehensive survey of retrotransposons revealed by the complete Saccharomyces cerevisiae genome sequence. Genome Res. 8:464-478.
KUMAR, A., K. H. CHEUNG, P. ROSS-MACDONALD, P. S. COELHO, and P. MILLER et al., 2000 TRIPLES: a database of gene function in Saccharomyces cerevisiae.. Nucleic Acids Res. 28:81-84.
MA, D., J. G. COOK, and J. THORNER, 1995 Phosphorylation and localization of Kss1, a MAP kinase of the Saccharomyces cerevisiae pheromone response pathway. Mol. Biol. Cell 6:889-909.[Abstract]
MADDOCK, J. R., J. ROY, and J. L. WOOLFORD, JR., 1996 Six novel genes necessary for pre-mRNA splicing in Saccharomyces cerevisiae.. Nucleic Acids Res. 24:1037-1044.
MODI, R. I. and J. ADAMS, 1991 Coevolution in bacterial-plasmid populations. Evolution 45:656-667.
MORISHITA, T., A. MATSUURA, and I. UNO, 1993 Characterization of the cyr12 UGA mutation in Saccharomyces cerevisiae.. Mol. Gen. Genet. 237:463-466.[Medline]
NATSOULIS, G., W. THOMAS, M. C. ROGHMANN, F. WINSTON, and J. D. BOEKE, 1989 Ty1 transposition in Saccharomyces cerevisiae is nonrandom. Genetics 123:269-279.
OCHMAN, H., A. S. GERBER, and D. L. HARTL, 1988 Genetic applications of an inverse polymerase chain reaction. Genetics 120:621-623.
OLIVER, S., 1996 A network approach to the systematic analysis of yeast gene function. Trends Genet. 12:241-242.[Medline]
ROSS-MACDONALD, P., A. SHEEHAN, G. S. ROEDER, and M. SNYDER, 1997 A multipurpose transposon system for analyzing protein production, localization, and function in Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 94:190-195.
ROSS-MACDONALD, P., P. S. R. COELHO, T. ROEMER, S. AGRAWAL, and A. KUMAR et al., 1999 Large-scale analysis of the yeast genome by transposon tagging and gene disruption. Nature 402:413-418.[Medline]
SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SHERMAN, F., G. R. FINK and J. B. HICKS, 1986 Laboratory Course Manual for Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SIEBERT, P. D., A. CHENCHIK, D. E. KELLOGG, K. A. LUKYANOV, and S. A. LUKYANOV, 1995 An improved PCR method for walking in uncloned genomic DNA. Nucleic Acids Res. 23:1087-1088.
SMITH, V., D. BOTSTEIN, and P. BROWN, 1995 Genetic footprinting: a genomic strategy for determining a gene's function given its sequence. Proc. Natl. Acad. Sci. USA 92:6479-6483.
SMITH, V., K. CHOU, D. LASHKARI, D. BOTSTEIN, and P. BROWN, 1996 Functional analysis of the genes of yeast chromosome V by genetic footprinting. Science 274:2069-2074.
SPRAGUE, JR., G. F., and J. W. THORNER, 1993 Pheromone response and signal transduction during the mating process of Saccharomyces cerevisiae, pp. 657744 in The Molecular and Cellular Biology of the Yeast Saccharomyces, edited by E. JONES, J. PRINGLE and J. BROACH. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
THATCHER, J. W., J. M. SHAW, and W. J. DICKINSON, 1998 Marginal fitness contributions of nonessential genes in yeast. Proc. Natl. Acad. Sci. USA 95:253-257.
THEVELEIN, J. M. and J. H. DE WINDE, 1999 Novel sensing mechanisms and targets for the cAMP-protein kinase A pathway in the yeast Saccharomyces cerevisiae.. Mol. Microbiol. 33:904-918.[Medline]
UETZ, P., L. GIOT, G. CAGNEY, T. A. MANSFIELD, and R. S. JUDSON et al., 2000 A comprehensive analysis of protein-protein interactions in Saccharomyces cerevisiae.. Nature 403:623-627.[Medline]
WACH, A., A. BRACHAT, R. POHLMANN, and P. PHILIPPSEN, 1994 New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae.. Yeast 10:1793-1808.[Medline]
WILKE, C. M. and J. ADAMS, 1992 Fitness effects of Ty transpositions in Saccharomyces cerevisiae.. Genetics 131:31-42.[Abstract]
WILKE, C. M., S. H. HEIDLER, N. BROWN, and S. W. LIEBMAN, 1989 Analysis of yeast retrotransposon Ty insertions at the CAN1 locus. Genetics 123:655-665.
WILKE, C. M., E. MAIMER, and J. ADAMS, 1992 The population biology and evolutionary significance of Ty elements in Saccharomyces cerevisiae.. Genetica 86:155-173.[Medline]
WINZELER, E. A., D. D. SHOEMAKER, A. ASTROMOFF, H. LIANG, and K. ANDERSON et al., 1999 Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis. Science 285:901-906.
This article has been cited by other articles:
![]() |
P. Sliwa and R. Korona Loss of dispensable genes is not adaptive in yeast PNAS, December 6, 2005; 102(49): 17670 - 17674. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Blanc, V. M.
- Articles by Adams, J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Blanc, V. M.
- Articles by Adams, J.


