Genetics, Vol. 165, 1507-1519, November 2003, Copyright © 2003

The extended auricle1 (eta1) Gene Is Essential for the Genetic Network Controlling Postinitiation Maize Leaf Development

Karen S. Osmonta, Lynne A. Jesaitis1,a, and Michael Freelinga
a Department of Plant and Microbial Biology, University of California, Berkeley, California 94720

Corresponding author: Michael Freeling, University of California, 111 Koshland Hall, Berkeley, CA 94720., freeling{at}nature.berkeley.edu (E-mail)

Communicating editor: J. BIRCHLER


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The maize leaf is composed of distinct regions with clear morphological boundaries. The ligule and auricle mark the boundary between distal blade and proximal sheath and are amenable to genetic study due to the array of mutants that affect their formation without severely affecting viability. Herein, we describe the novel maize gene extended auricle1 (eta1), which is essential for proper formation of the blade/sheath boundary. Homozygous eta1 individuals have a wavy overgrowth of auricle tissue and the blade/sheath boundary is diffuse. Double-mutant combinations of eta1 with genes in the knox and liguleless pathways result in synergistic and, in some cases, dosage-dependent interactions. While the phenotype of eta1 mutant individuals resembles that of dominant knox overexpression phenotypes, eta1 mutant leaves do not ectopically express knox genes. In addition, eta1 interacts synergistically with lg1 and lg2, but does not directly affect the transcription of either gene in leaf primordia. We present evidence based on genetic and molecular analyses that eta1 provides a downstream link between the knox and liguleless pathways.


IN plants, lateral organs such as leaves are born on the flanks of meristems (STEEVES and SUSSEX 1989 Down). This is a reiterative process, which originates with recruitment of segment initial cells to form a phytomer composed of leaf, node, internode, and axillary bud (SCANLON et al. 1996 Down). A subset of these cells initiates the leaf and is termed the leaf founder cells (POETHIG 1984 Down). These founder cells divide, giving rise to leaf primordia, which undergo longitudinal differentiation that occurs basipetally (from tip to base such that blade differentiates prior to sheath) as well as laterally from the midrib to the margin (HARPER and FREELING 1996B Down). The maize leaf provides a simple model for examining the genetic cues involved in organ regional identity and cell fate determination.

The ligule, a morphological feature of the grasses, is an epidermal fringe of tissue derived from the adaxial leaf surface. The ligule bisects the longitudinal, or proximodistal, axis of the leaf into proximal sheath and distal blade (Fig 1). Along with the ligule, a pair of triangular-shaped auricles forms the blade/sheath boundary. Differentiation of auricle is first visible as a thin line of cells that separates the blade and sheath, which can be seen only after initiation of the ligule (BECRAFT et al. 1990 Down). The auricle cells enlarge concomitantly with ligule outgrowth and then divide as the blade and sheath expand. After the leaf emerges, the auricle cells expand further, allowing the leaf blade to bend out horizontally from the main axis.



View larger version (123K):
In this window
In a new window
Download PPT slide
 
Figure 1. A typical maize leaf can be divided along three axes, the proximodistal, mediolateral, and dorsiventral or ad/abaxial. Auricle (aur) and ligule (lg) mark the proximodistal boundary between proximal sheath (sh) and distal blade (bl).

Our understanding of ligule and auricle development stems from analysis of leaf structures in wild-type plants as well as in mutant plants that show disruptions at the blade/sheath boundary. Aberrations in the auricle are often associated with a disrupted ligule, implying that their development is closely linked. Mutants that affect the auricle and/or the blade/sheath boundary include lg1, lg2, rs2, Rs1, Lg3, Kn1, and Gn1 (see below and Table 1). These mutants can be divided into two distinct groups. The first group is defined by recessive mutants that show altered ligule and auricle development resulting from absence of essential proteins during leaf primordial development. The second group is defined by mutants that affect proximodistal identity and ectopically express KNOX proteins in the leaf.


 
View this table:
In this window
In a new window

 
Table 1. Alleles used in this study

The first group of genes consists of liguleless (lg1) and liguleless2 (lg2). Recessive mutants of lg1 remove both the ligule and auricle, but a rudimentary ligule is formed in the upper leaves (BECRAFT et al. 1990 Down; SYLVESTER et al. 1990 Down). Recessive mutants of lg2 remove the ligule and auricle in the first one to three leaves. The ligule and auricle recover in later leaves but the blade/sheath boundary remains displaced. Double-mutant analysis of lg1 and lg2 revealed that these two genes interact in a dosage-dependent manner (HARPER and FREELING 1996A Down). Double-mutant lg1 lg2 plants fail to form a ligule or auricle and the blade/sheath boundary is diffuse (HARPER and FREELING 1996A Down). Reverse transcriptase (RT)-PCR analysis showed that LG2 expression precedes that of LG1 (WALSH et al. 1998 Down). These genetic and molecular analyses have shown that lg1 and lg2 act in the same genetic network late in leaf development to induce ligule and auricle formation (HARPER and FREELING 1996A Down; WALSH et al. 1998 Down). Both lg1 and lg2 have been cloned and encode nuclear-localized proteins with homology to squamosa promoter binding proteins and bZIP transcription factors, respectively (MORENO et al. 1997 Down; WALSH et al. 1998 Down).

The second group of genes affecting the blade/sheath boundary includes mutants that ectopically express KNOX proteins in the leaf, resulting in alteration of regional identity and formation of proximal tissues more distally (i.e., the sheath forms or extends into the leaf blade; FREELING 1992 Down; MUEHLBAUER et al. 1997 Down). The knotted1 (kn1) gene was first defined by dominant alleles that cause formation of knots over lateral veins and ectopic ligule in the blade (FREELING and HAKE 1985 Down), and the mutant phenotype was found to be caused by ectopic expression of kn1, a homeobox gene, in the leaves (HAKE et al. 1989 Down; VOLLBRECHT et al. 1991 Down). The class 1 knotted1-like homeobox (knox) genes rough sheath1 (rs1), gnarley1 (gn1), and liguleless3 (lg3) have also been defined by dominant mutants (BECRAFT and FREELING 1994 Down; FOWLER and FREELING 1996 Down; KERSTETTER et al. 1997 Down; FOSTER et al. 1999 Down). On the basis of loss-of-function phenotypes, the knox genes are thought to be required for meristem maintenance and to repress differentiation, although the precise function of these genes has not been determined (KERSTETTER et al. 1997 Down; VOLLBRECHT et al. 2000 Down). In Arabidopsis, the knox genes SHOOT MERISTEMLESS (STM) and KNAT1 (KNOTTED1-LIKE IN ARABIDOPSIS THALIANA) may act redundantly to confer meristematic identity (LONG et al. 1996 Down; BYRNE et al. 2002 Down).

Another member of the second group has been defined by recessive mutants in rough sheath 2 (rs2). Mutants of rs2 have several phenotypic effects, including dwarfing, disruption of the blade sheath boundary, twisting of the leaves, loss of blade tissue, and disorganization of cell division resulting in leaf proximalization (SCHNEEBERGER et al. 1998 Down). RS2 encodes a MYB-domain-containing factor with homology to the PHANTASICA (PHAN) gene from Antirrhinum and the ASYMMETRIC LEAVES1 (AS1) gene from Arabidopsis (TIMMERMANS et al. 1999 Down; TSIANTIS et al. 1999 Down; BYRNE et al. 2000 Down; ORI et al. 2000 Down). AS1 is required for suppression of the Arabidopsis KNOX genes KNAT1, KNAT2, and KNAT6 in the leaf (ORI et al. 2000 Down). Genetic evidence suggests that STM acts to suppress AS1 and AS2 in the meristem to prevent initiation of the leaf developmental program (BYRNE et al. 2000 Down, BYRNE et al. 2002 Down). In addition, the PICKLE (PKL) gene, which encodes a chromatin-remodeling factor of the CHD class, enhances as1 and as2 mutants, indicating that PKL may have a general role in repression of KNOX genes in the leaf via changes in chromatin structure (ORI et al. 2000 Down). Expression studies of rs2 mutants revealed the knox genes lg3, kn1, and rs1 are ectopically expressed in the leaf (SCHNEEBERGER et al. 1998 Down). The rs2 gene is normally expressed in leaves whereas knox genes are expressed in the shoot apical meristem (TIMMERMANS et al. 1999 Down; TSIANTIS et al. 1999 Down). These molecular and genetic data suggest that the RS2/AS1/PHAN protein family functions to repress knox genes in the leaf.

Other components of the knox gene pathway include the maize mutant semaphore1 (sem1). sem1 acts to repress a subset of the knox genes in the maize leaf, mainly the genomic duplicates gn1 and rs1 (SCANLON et al. 2002 Down). KNOX proteins appear to function through interactions with the BEL1 class of homeodomain proteins in both monocots and dicots (BELLAOUI et al. 2001 Down; MUELLER et al. 2001 Down; SMITH et al. 2002 Down). Plant growth hormones are also regulated by knox gene action. KNOX proteins inhibit the expression of GA 20-oxidase in tobacco, tomato, and Arabidopsis, presumably inhibiting GA biosynthesis, while overexpression of knotted1 causes increased levels of cytokinin in tobacco (LI et al. 1992 Down; ORI et al. 1999 Down; SAKAMOTO et al. 2001 Down; HAY et al. 2002 Down).

We have identified a novel maize gene called extended auricle1 (eta1) on the basis of the behavior of a recessive mutant allele. Homozygous eta1 individuals have a wavy overgrowth of auricle tissue and the blade/sheath boundary is diffuse. However, one or two doses of eta1 mutant alleles result in synergism and enhancement of liguleless and knox phenotypes. We provide evidence based on genetic and molecular analyses with eta1 that the knox and liguleless pathways are linked in the genetic network controlling maize leaf development. These data also suggest that eta1 may function downstream of these pathways and show it is a key player in maize leaf development.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Origin of the eta1-R allele:
The eta1 reference allele, eta1-R, originated from an EMS screen of M2 segregating families performed by the Hollick lab (UC-Berkeley).

Mapping and introgression:
The eta1-R mutation was introgressed five to seven times into the inbred lines Mo17, B73, W22, W23, and A188 via backcrossing and self-pollination. Individuals homozygous for eta1-R were pollinated by B-A translocation stocks for mapping (BECKETT 1994A Down). Resultant F1 individuals were planted, scored, and compared to segregating eta1-R families derived from the same parental eta1-R plants. Families segregating eta1-R were outcrossed to the inbred lines Mo17, B73, and W22 and then self-pollinated. The subsequent F2 families were used for fine mapping with simple sequence repeats (SSRs) and restriction fragment length polymorphisms (RFLPs).

Double-mutant stocks:
Sarah Hake kindly provided Kn1-N and Gn1-R in the W22 background. Heterozygous Kn1-N and Gn1-R individuals were crossed to homozygous eta1-R individuals in the W22 background. F1 individuals displaying the Kn1-N or Gn1-R phenotypes were backcrossed to eta1-R homozygotes in the case of Kn1-N or self-pollinated in the case of Gn1-R. The spontaneous lg1-R mutation was originally obtained from the Maize Genetics Stock Center (Urbana, IL) and backcrossed six generations into the Mo17 background. The lg1-R mutation was crossed to eta1-R in the Mo17 background. The lg2-219 allele was isolated in a directed Mutator-tagging experiment (WALSH et al. 1998 Down) and was backcrossed into the inbred line W23 for three generations. Homozygous lg2-219 individuals were crossed to eta1-R homozygotes in the W22 and Mo17 backgrounds. The dominant dosage effect of eta1-R heterozygotes with lg2-219 was seen in all double-mutant families independent of background. The genotypes of individuals displaying the eta1-R/+ lg2-219/lg2-219 dosage phenotype were determined with the SSR marker linked to eta1-R. They were also test crossed to the eta1-R single mutant to confirm the dosage effect. The rs2-R allele was obtained from the Maize Genetics Stock Center and backcrossed into the inbred line Mo17 for five generations. Homozygous eta1-R individuals in the Mo17 background were crossed to lg1-R and rs2-R homozygotes in the Mo17 background. The resultant F1 individuals were self-pollinated and scored in the F2 generation. The Lg3-O and Rs1-O alleles were obtained from the Maize Genetics Stock Center and backcrossed for seven generations into the Mo17 background. Individuals heterozygous for either Lg3-O or Rs1-O were crossed to eta1-R homozygous individuals in the Mo17 background. The resultant F1 individuals were either self-pollinated in the case of Rs1-0 or outcrossed to eta1-R homozygotes in the case of Lg3-O (see Table 2).


 
View this table:
In this window
In a new window

 
Table 2. Double-mutant analysis

PCR:
DNA was isolated for PCR using the method described previously (EDWARDS et al. 1991 Down). The primers umc1221 forward and reverse were used to amplify the SSR linked to eta1-R (umc1221 forward, GCAACAGCAACTGGCAACAG; umc1221 reverse, AAACAGGCACAAAGCATGGATAG). Additional SSR primers used in mapping included umc1171 forward and reverse, mmc0081 forward and reverse, and umc1060 forward and reverse (for primer sequences and amplification conditions refer to http://www.agron.missouri.edu). The RFLP csu308 was also used in fine mapping the eta1-R mutation.

Environmental scanning electron microscope analysis:
Seedlings were harvested at 4 weeks from an eta1-R segregating family in the W23 background. Fresh leaves were dissected and mounted on metal stubs for imaging with an Electroscan E3 environmental scanning electron microscope (ESEM) located at the Electron Microscope Laboratory (UC-Berkeley).

Reverse transcriptase-PCR gel blot analysis:
RNA was isolated from 3-week-old seedlings in eta1-R segregating families in the Mo17 and W22 backgrounds. The meristems and p1–5 leaves from three individuals were pooled as were the p6–8 leaves at the ligule ridge stage. RNA isolation was performed using TRIzol (Invitrogen, San Diego). RNA was treated with DNaseI and then reverse transcribed using Superscript II reverse transcriptase (RT) and an oligo(dT) primer (Invitrogen). Gene-specific primers for the liguleless1, ubiquitin (MORENO et al. 1997 Down), liguleless2 (WALSH et al. 1998 Down), knotted1, gnarley1, roughsheath1, liguleless3, liguleless4a, and liguleless4b genes were used to PCR amplify the corresponding genes from the resulting cDNAs. The PCR reactions were run for 20 cycles. The gene products were detected via Southern blot hybridization with gene-specific probes. RT-PCR was performed on independent RNA pools at least three times for each gene. RT-PCR reactions were repeated with the knox gene primers and amplified for 30 cycles to confirm expression patterns in the eta1-R segregating families. Primers for the knox genes were as follows: kn1-5', AGCTCGCTCAAGCAAGAACTGTC; kn1-B2, CATAGGCGCATATAGATAGAGTAGCAAC; gn1-B1, TACGCAGAAACACTCCGACACGGTCG; gn1-F2, GGAAGACGACGACATGGATCCGAG; rs1-11464, TTCTGAAGATGACATGGACCCGAATGGTC; rs1-pbo7, GAGAACTACAAGCCATGCATAGACGCTAC; lg3/4-1, GTGGAACACGCACTACCGCTG; lg3-D2, TGAGCTGGCCAGTTGTCATCCC; lg4a-B1, CCAGTATGCTGAGTGTACCTACCGACAC; and lg4b-B1, CGACAATACACGTTGTCGCCCATGC.

Northern blot analysis:
RNA was isolated from 3- to 4-week-old seedlings in an eta1-R Kn1-N-segregating family in the W22 background. RNA was isolated using the TRIzol method (Invitrogen). Poly(A)+ RNA was then isolated using the oligotex mRNA miniprep kit from QIAGEN (Valencia, CA). Approximately 2 µg poly(A)+ RNA was loaded on a formaldehyde-containing 1% agarose gel and subjected to gel electrophoresis at 72 V for 2.5 hr. The RNA was transferred for 4 hr to nylon membrane (Hybond-NX). Membranes were hybridized in 1 M sodium phosphate buffer, pH 7.2, 7% SDS, and 1 mM EDTA. A kn1 cDNA probe obtained from the Hake lab was used for hybridization (SMITH et al. 1992 Down). An ubiqitin probe was used as a loading control.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Phenotypic analysis and effect of genetic background on eta1:
The eta1-R mutation was originally isolated from an EMS mutagenesis screen. The eta1 phenotype segregates as a single recessive locus in F2 families. The most notable phenotype of eta1 is an overgrowth or extension of auricle tissue. The eta1 mutant is pleiotropic and displays a range of phenotypes, including displacement of the blade/sheath boundary, disruption of the ligule, reduction in internode spacing and overall plant height, and the production of smaller, more compact ear shoots (Fig 2, A–D).



View larger version (92K):
In this window
In a new window
Download PPT slide
 
Figure 2. Pleiotropic effects of the eta1-R mutation. (A) Mo17 siblings in an eta1-R-segregating family, wild type on the left and eta1 on the right. Note the compaction of internodes and auricle extension. (B) W22 siblings in an eta1-R-segregating family, wild-type leaf on the left and eta1 on the right. Note the displacement of the blade/sheath boundary and the interrupted ligule line. Extension of auricle can be seen as lighter tissue extending up into the darker green blade. Arrows mark the auricle tissue in wild type and eta1. (C) A188 siblings in an eta1-R-segregating family, wild type on the left and eta1 on the right. Plant height is reduced to approximately one-half of wild type. (D) Ear shoots of an eta1-R-segregating family in the Mo17 background, wild-type ear on the left and eta1 mutant ear on the right. The eta1 ear is more compact and husk leaves fail to form completely around the developing ear shoot. (E–H) ESEM images of the adaxial leaf surface of wild-type and eta1 individuals in a W23 background. The leaves imaged here are just extruding from the whorl, are the sixth leaf produced, and are approximately plastochron 10. (E) Wild-type leaf at the blade/sheath boundary. (F) eta1 leaf at the blade/sheath boundary. (G) Wild-type auricle cells. (H) eta1 auricle cells. Lg, ligule; sh, sheath; aur, auricle; bl, blade. Bar, 50 µm.

To determine the developmental basis of the eta1 phenotype, ESEM analysis was used to compare wild-type and eta1 siblings (Fig 2, E–H). The blade/sheath boundary of eta1 mutants is severely displaced relative to wild type (Fig 2E vs. F). The blade/sheath boundary normally runs perpendicular to the proximodistal axis of the leaf, thus forming a boundary between blade and sheath. However, the blade/sheath boundary of eta1 individuals runs nearly parallel to the proximodistal leaf axis (Fig 2F). In addition, the ligule fails to form completely in eta1 mutants. Although somewhat disorganized, morphologically recognizable blade, sheath, ligule, and auricle cells are visible in eta1 individuals. Examination of the auricle cells in eta1 mutants reveals some aberrant, disorganized divisions, but the auricle cell shape and size are comparable to those of wild type (Fig 2G and Fig H).

Given the pleiotropic nature of the eta1-R allele, it was introgressed into five different maize inbred lines to determine the most expressive phenotypes and to help elucidate a precise eta1 function. As with many maize developmental mutants, eta1 displays background effects, but is fully penetrant in all inbred lines tested. Background effects have been previously documented with maize heterochronic mutants as well as with dominant knox mutants (POETHIG 1988 Down; FOWLER and FREELING 1996 Down). The auricle phenotype is most severe in Mo17 and W23, in which the auricles become highly elaborated, sometimes even forming a collar-like structure similar to the morphology of the blade/sheath boundary of rice (Fig 3A). The auricle phenotype is least severe in B73 with auricle extension only along the margin in adult leaves and little to no auricle extension in juvenile leaves (Fig 3B). In all of the genetic backgrounds tested, eta1 mutant plant height compared to wild-type siblings was similarly reduced (see Table 3). The most penetrant eta1 phenotypes were the reduction in plant height and the displacement of the blade sheath boundary, which enabled consistent scoring even in weakly expressing backgrounds.



View larger version (122K):
In this window
In a new window
Download PPT slide
 
Figure 3. The eta1-R mutant displays background effects. (A) Leaf 10 in an eta1-R-segregating family in the W23 background, wild type on the left and eta1 on the right. Note displacement of the blade/sheath boundary and auricle extension (arrows). (B) Leaf 10 in an eta1-R-segregating family in the B73 background, wild type on the left and eta1 on the right. Note reduction of auricle extension (arrows) but blade/sheath boundary remains displaced.


 
View this table:
In this window
In a new window

 
Table 3. Effect of genetic background on eta1 plant height

Mapping and dosage:
The eta1 mutation was initially mapped using B-A translocation stocks, using standard procedures (BECKETT 1994B Down). The translocation 5Ld uncovered the eta1 phenotype, indicating that the eta1 locus is distal to this chromosome breakpoint on the long arm of chromosome 5. The phenotype of eta1-R hemizygotes is equivalent to eta1-R homozygotes, suggesting that the eta1-R allele is an amorph or has complete loss of function. SSR markers (SMITH et al. 1997 Down) were then used to fine map eta1. Linkage was first found to the marker mmc0081, which maps to bin 5.05 (bin number is a positional designation along maize chromosomes; for example, chromosome 5 is divided into nine bins). SSRs in bins 5.04 and 5.05 were then tested for linkage. The SSR umc1221 located at position 329.5 in bin 5.04 was found to be closely linked to eta1 at a recombination distance of 1 cM. This marker was subsequently used for determination of eta1 genotype.

Double-mutant analysis
eta1 interacts synergistically with the liguleless1/liguleless2 pathway: Both the lg1 and lg2 genes function in formation of the blade/sheath boundary and elaboration of ligule and auricle. Mutants of lg1 and lg2 show a dosage-dependent genetic interaction, suggesting that they function in the same developmental network. To test whether eta1 may be involved in this network, we generated double mutants with eta1-R and lg1-R or lg2-219.

A synergistic interaction was seen between lg1-R and eta1-R (Fig 4). The lg1-R eta1-R homozygotes show a marked displacement of the blade/sheath boundary, which is more severe than the displacement seen with either of the single mutants (Fig 4D). In addition, eta1-R homozygotes form ligule tissue and lg1-R homozygotes form a rudimentary ligule, but the double mutant fails to form ligule or auricle. Unusual protrusions of undifferentiated tissue were observed on the abaxial leaf surface of double-mutant individuals (Fig 4E, arrows), which are not seen in either lg1-R or eta1-R single mutants. These protrusions did not coincide with venation and were localized to the proximal blade region in the presumptive auricle domain. The novel phenotype of lg1-R eta1-R double mutants suggests that these two genes interact synergistically and not additively.



View larger version (125K):
In this window
In a new window
Download PPT slide
 
Figure 4. Synergistic interaction of lg1-R and eta1-R in the Mo17 background. Adaxial views of leaf 10: (A) wild type, (B) eta1-R/eta1-R, (C) lg1-R/lg1-R, and (D) eta1-R/eta1-R lg1-R/lg1-R. Note the increased displacement of the ligule/auricle line in the double mutant vs. that in either of the single mutants (solid arrows). (E) lg1-R/lg1-R eta1-R/ eta1-R individual. Open arrows point to ectopic protrusions on the adaxial leaf surface just distal to the blade/sheath boundary.

A synergistic interaction was also observed with lg2-219 and eta1-R, but surprisingly, our double-mutant analysis uncovered a dominant dosage effect of the eta1-R allele (Fig 5). In the upper adult leaves of the lg2-219 mutants, ligule and auricle recover. However, lg2-219 homozygotes that were heterozygous for eta1-R displayed extension of auricle in the upper adult leaves (Fig 5C). This dominant dosage effect was confirmed both genetically and molecularly. No notable phenotypic dosage effect was seen with eta1-R homozygotes carrying a single copy of the lg2-219 allele (data not shown). Plants homozygous for both lg2-219 and eta1-R were extremely short, twisted, and often infertile (Fig 5F). The blade/sheath boundary of double-mutant individuals was extremely displaced toward the distal portion of the leaf compared to either of the single mutants, but ligule outgrowth was still apparent. Taken together, the synergistic interaction of lg1-R and eta1-R and the synergistic dominant dosage effect of eta1-R with lg2-219 place eta1 in the liguleless1/2 network of function.



View larger version (78K):
In this window
In a new window
Download PPT slide
 
Figure 5. Dosage effect of lg2-219 and eta1-R. Adaxial view of leaf 12 in a lg2-219 eta1-R-segregating family in the Mo17/W23 background. (A) Wild type; (B) lg2-219/lg2-219; (C) lg2-219/lg2-219 eta1-R/+; (D) eta1-R/eta1-R; (E) lg2-219/lg2-219 eta1-R/eta1-R; (F) whole-plant view of the lg2-219/lg2-219 eta1-R/eta1-R double mutant. Arrows mark the auricle extension.

eta1 enhances regional identity phenotypes: The eta1 mutant phenotype is remarkably similar to that of proximodistal regional identity mutants, which cause disruption of the blade/sheath boundary and formation of proximal structures more distally. Of the regional identity mutants, we tested the interaction of eta1-R with two of the semidominant class 1 knox mutants, Kn1-N and Lg3-O. To simplify the analysis, only one dose of Kn1-N and Lg3-O was used. The eta1-R mutant enhanced the Kn1-N phenotype (Fig 6). Individuals homozygous for eta1-R and heterozygous for Kn1-N displayed an increase in the number and size of knots, an increase in prominent venation, and an increase in ectopic patches of ligule compared to heterozygous Kn1-N siblings (compare Fig 6B with 6D). There is no increase in auricle extension or in displacement of the blade/sheath boundary in the Kn1-N/+ eta1-R mutant individuals, suggesting that eta1-R is enhancing the Kn1-N phenotype.



View larger version (108K):
In this window
In a new window
Download PPT slide
 
Figure 6. eta1-R enhances Kn1-N. Adaxial view of leaf 12 from a Kn1-N/+ eta1-R-segregating family in the W22 background is shown. This family resulted from an outcross of a plant heterozygous for both Kn1-N and eta1-R to an individual homozygous for eta1-R. (A) Wild type; (B) Kn1-N/+; (C) eta1-R/eta1-R; (D) Kn1-N/+ eta1-R/eta1-R.

Similarly, eta1-R enhances the Lg3-O mutant phenotype (Fig 7). Individuals homozygous for eta1-R and heterozygous for Lg3-O phenocopied Lg3-O homozygotes. Again, there was no significant increase in the amount of auricle tissue in double-mutant individuals, but the leaves were severely proximalized. Double-mutant phenotypes included severe displacement of the blade/sheath boundary, ectopic ligule along the midrib, twisting of the midrib, and alteration in leaf attitude (Fig 7D and Fig E).



View larger version (123K):
In this window
In a new window
Download PPT slide
 
Figure 7. eta1-R enhances Lg3-O. Adaxial view of leaf 12 from a family segregating Lg3-O/+ eta1-R in the Mo17 background is shown. This family resulted from the outcross of a plant heterozygous for both Lg3-O and eta1-R to a plant homozygous for eta1-R. (A) Wild type; (B) eta1-R/eta1-R; (C) Lg3-O/+; (D) Lg3-O/+ eta1-R/eta1-R; (E) mature Lg3-O/+ eta1-R/eta1-R plant. Note the severe twisting of the midrib and the change in leaf attitude.

We also tested the interaction of eta1 with a fully dominant class I knox gene, Gnarley1 (FOSTER et al. 1999 Down). eta1-R shows a dosage effect with Gn1-R as seen in Fig 8. Plants homozygous for eta1-R with one copy of Gn1-R display an increase in leaf width, an increase in extension of auricle tissue into blade along the margin, and an increase in auricle proliferation at the blade/sheath boundary (compare Fig 8C with 8D). In families segregating Gn1-R alone, Gn1-R homozygotes are indistinguishable from heterozygotes (FOSTER et al. 1999 Down). However, when a second dose of Gn1-R is added in families segregating for eta1-R, the phenotype is severely enhanced (Fig 8E and Fig F). The blade/sheath boundary is severely distorted and the width of blade and sheath is increased. In addition, the leaf is increasingly proximalized with increasing dosage of Gn1-R, as sheath and auricle are displaced distally into blade, especially in the region flanking the midrib (Fig 8F). In other words, the eta1-R background permits a Gn1-R dosage effect that is not evident in a wild-type background.



View larger version (187K):
In this window
In a new window
Download PPT slide
 
Figure 8. The eta1-R mutation shows a dosage effect with Gn1-R. Adaxial view of adult leaves from a family segregating eta1-R Gn1-R in the W22 background is shown. This family resulted from self-pollination of a plant heterozygous for both Gn1-R and eta1-R. (A) Wild type; (B) eta1-R/eta1-R; (C) Gn1-R/+; (D) Gn1-R/+ eta1-R/eta1-R; (E) Gn1-R/Gn1-R eta1-R/eta1-R; (F) whole-plant view of a Gn1-R/Gn1-R eta1-R/eta1-R individual.

Both rs2-R and Rs1-O show a strong synergistic interaction with eta1-R (Fig 9). RS2 has homology to MYB-like transcription factors and RS1 is a class 1 knox transcription factor. One of the functions of RS2 is to downregulate RS1 in the leaves (SCHNEEBERGER et al. 1998 Down). When combined with eta1-R, rs2-R shows a synergistic interaction such that the eta1-R phenotype is exacerbated as well as the rs2-R phenotype (Fig 9). The double-mutant individuals show a reduction in height, excessively rough sheath, reduction in sheath length, increased auricle extension, and an overall increase in the proximalization of the leaf compared to eta1-R and rs2-R single-mutant siblings (compare Fig 9B and Fig 9C with 9D). However, the synergistic interaction of Rs1-O and eta1-R is subtly different. The overall plant height of Rs1-O eta1-R double-mutant individuals is greatly reduced and the sheath length is reduced as is seen with the rs2-R eta1-R double mutants. The focus of the ectopic knox gene action is shifted distally so that the phenotype is most severe at the auricle region, and the sheath is not particularly rough compared to the Rs1-O single mutant. In addition, Rs1-O eta1-R double-mutant individuals do not show any ligule outgrowth, are increasingly proximalized with auricle extension flanking the margin, and have very prominent venation in the extended blade/sheath boundary region.



View larger version (124K):
In this window
In a new window
Download PPT slide
 
Figure 9. The eta1-R mutation interacts synergistically with rs2-R and Rs1-O. (A–D) Abaxial view of leaf 12 from a family segregating rs2-R eta1-R in the Mo17 background. This family resulted from a self-pollination of an individual heterozygous for both rs2-R and eta1-R. (A) Wild type; (B) eta1-R/eta1-R; (C) rs2-R/rs2-R; (D) rs2-R/rs2-R eta1-R/eta1-R. (E–H) Abaxial view of leaf 12 from a family segregating Rs1-O and eta1-R in the Mo17 background. (E) Wild type; (F) eta1-R/eta1-R; (G) Rs1-O/Rs1-O; (H) Rs1-O/Rs1-O eta1-R/eta1-R.

Molecular analyses
eta1 does not affect lg1 or lg2 expression: To test whether or not eta1 functions to regulate lg1 or lg2 gene expression, we used RT-PCR to analyze expression of LG1- and LG2-mRNA in a family segregating for eta1-R. Previous studies have shown that LG2-mRNA expression precedes LG1-mRNA and can be detected in p1–5 leaves (WALSH et al. 1998 Down), whereas LG1 is not expressed in early p1–5 leaf primordia but can be seen only in p6–8 leaves (WALSH et al. 1998 Down). We isolated mRNA from either meristem and p1–5 or p6–8 leaf primordia and then subjected it to RT-PCR with lg1- and lg2-specific primers. No difference in mRNA expression of either LG2 or LG1 was found in leaves of eta1-R mutants vs. their wild-type siblings (Fig 10A). On the basis of these data, eta1 is not likely to function upstream of lg1 or lg2.



View larger version (65K):
In this window
In a new window
Download PPT slide
 
Figure 10. (A) RT-PCR gel blot analysis of LG1 and LG2 expression in an eta1-R-segregating family. Lane 1, wild-type meristems and p1–5 leaves; lane 2, wild-type p6–8 leaves; lane 3, eta1-R meristems and p1–5 leaves; lane 4, eta1-R p6–8 leaves. Ubiquitin was used as a loading control. (B) RT-PCR gel blot analysis of kn1 and lg3 in an eta1-R-segregating family. Lane 1, wild-type meristems and p1–5 leaves; lane 2, wild-type p6–8 leaves; lane 3, eta1-R meristems and p1–5 leaves; lane 4, eta1-R p6–8 leaves. Ubiquitin was used as a loading control. (C) Northern blot analysis of a Kn1-N/+ eta1/eta1-segregating family. Lane 1, wild-type meristems and p1–5 leaves; lane 2, wild-type p6–8 leaves; lane 3, Kn1 meristems and p1–5 leaves; lane 4, Kn1 p6–8 leaves; lane 5, eta1 meristems and p1–5 leaves; lane 6, eta1 p6–8 leaves; lane 7, eta1 Kn1 meristems and p1–5 leaves; lane 8, eta1 Kn1 p6–8 leaves. Lanes 1 and 2 are from a different Northern blot than lanes 3–8; however, they represent RNA from the same Kn1-N eta1-R-segregating family.

Leaves of eta1 mutant plants do not ectopically express knox genes: The phenotype of eta1 mutants resembles a number of maize mutants where the molecular cause of the mutant phenotype is ectopic expression of knox genes. Because of this, KNOX-mRNA expression was assayed via RT-PCR with primers specific for lg3, lg4a, lg4b, rs1, gn1, or kn1. No notable differences were seen in eta1 individuals vs. their wild-type siblings with any of these probes. For example, KN1-mRNA expression was detected in meristems of both wild-type and eta1 mutant individuals, but not in developing leaves (Fig 10B). The same expression pattern was seen with RS1 and GN1 (data not shown). Even after 30 cycles of PCR, we detected no ectopic KN1, GN1, or RS1 expression in eta1 or wild-type developing leaves (data not shown). LG3-mRNA expression was detected at high levels in meristems and at low levels in developing leaves of wild-type and eta1 mutant individuals (Fig 10B). Both LG4A and LG4B were expressed in the same pattern as LG3 (data not shown). These results suggest that eta1 may act downstream of the ectopic knox pathway since it does not cause ectopic knox gene expression.

Northern blot analysis: The severity of the Kn1 phenotype has been correlated with increased KN1-mRNA expression in the leaves (SMITH et al. 1992 Down). We wanted to determine if the severe Kn1-N eta1-R double-mutant phenotype could be attributed to increased KN1-mRNA levels or if mRNA levels were unchanged. KN1-mRNA is abundant and is easily visualized using Northern blot analysis, which is optimal for direct comparison of RNA concentrations. Fig 10C shows the results of a Northern blot analysis with a Kn1-N eta1-R-segregating family in the W22 background. No KN1-mRNA can be detected in eta1-R mutant leaves, which is consistent with our RT-PCR findings. Levels of KN1-mRNA did not differ significantly between Kn1-N/+ and Kn1-N/+ eta1-R/eta1-R leaves (lane 4 vs. 8). These results further suggest that eta1 functions downstream of the ectopic knox pathway.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Much effort in recent years has focused on identifying novel loci in the developmental genetic network controlling proximodistal patterning in the maize leaf. We describe a recessive mutation of the eta1 gene, eta1-R, which affects proximodistal patterning in the maize leaf. To date there are only two published recessive mutations in maize, rs2 and sem1, that are implicated in proximodistal patterning in the leaf and both act to repress knox genes (TIMMERMANS et al. 1999 Down; TSIANTIS et al. 1999 Down; SCANLON et al. 2002 Down). While eta1 is involved in proximodistal patterning in the leaf, eta1 is unique in that it is not involved in regulating knox gene expression. In addition, eta1 enhances the phenotypes of all known mutants affecting proximodistal patterning in the maize leaf. Thus, our findings implicate eta1 as a novel and essential component of the developmental genetic network controlling maize leaf development.

The nature of the eta1-R mutation and background effects:
Genetic evidence from B-A translocations reported here suggests that the eta1-R allele is a complete loss-of-function mutation. This amorphy is essential when inferring a functional role for eta1. The effect of background on the eta1 phenotype is not surprising given that background effects are well documented in maize. However, it is intriguing that eta1-R displays background expressivities similar to Lg3-O (POETHIG 1988 Down; FOWLER and FREELING 1996 Down), being most severe in Mo17 and least severe in B73. This could indicate that similar modifiers are involved in either enhancing or suppressing the aspects of proximodistal patterning in leaf development controlled by eta1 and disrupted by Lg3.

Interaction with the liguleless pathway:
Previous work with lg1 and lg2 suggests that this phenotype is saturated. For example, 18 independent lg1 alleles and 9 independent lg2 alleles have been identified, some in genetic screens to identify other genes in the liguleless pathway, but no novel genes have been discovered (D. BRAUN and J. WALSH, personal communication). It was proposed that other factors in the liguleless pathway would be either pleiotropic or lethal (HARPER and FREELING 1996A Down). On the basis of genetic interactions of eta1 with lg1 and lg2 and the eta1 phenotype, eta1 can be considered a pleiotropic factor in the liguleless network of function. However, given the pleiotropic nature of eta1, it is unlikely eta1 is exclusively functioning in this pathway. RT-PCR gel blot analyses show eta1 does not affect lg1 or lg2 expression. However, eta1 may act on lg1 and/or lg2 at the protein level or perhaps could affect the spatial distribution of LG-mRNAs, which is difficult to test given that the expression patterns of lg1 and lg2 have not been precisely discerned. It is likely that eta1 function is necessary along with lg1 and lg2 during early leaf development for correct formation and differentiation of the blade/sheath boundary. lg1 function seems to be specific to ligule and auricle induction while lg2 function is specific to regional organ transitions (WALSH and FREELING 1999 Down). lg2 is involved in early establishment of the blade/sheath boundary during early vegetative stages and in the transition from vegetative to floral branching in the apical tassel meristem (WALSH and FREELING 1999 Down).

Consequently, the synergistic interaction of eta1 with lg1 indicates that eta1 plays a role in the formation of the blade/sheath boundary and in the elaboration of the ligule. Notably, the lg1 single mutant fails to develop ligule and auricle in the lower leaves but a rudimentary ligule is formed in upper leaves. In contrast, the eta1 lg1 double mutants do not form rudimentary ligule and the blade/sheath boundary is displaced over the midrib (Fig 4D). This double-mutant phenotype indicates eta1 is involved in formation of the rudimentary ligule in the absence of lg1. This is similar to the dosage-dependent synergistic interaction seen between lg1 and lg2. Double mutants of dominant Lg3 and Lg4 alleles with lg1 and lg2 also fail to form a rudimentary ligule, but do not enhance the ectopic knox phenotypes (FOWLER and FREELING 1996 Down). Plants homozygous for lg1-R and heterozygous and/or homozygous for lg2-R failed to form the rudimentary ligule and had a displaced blade/sheath boundary (HARPER and FREELING 1996A Down). These data indicate eta1 functions in the same genetic network as lg1.

In addition to lg1 interactions, eta1 has a directional dosage-dependent interaction with lg2. The eta1-R allele behaves dominantly to extend auricle tissue in the upper leaves of lg2-219 homozygous plants. The lg2 eta1 double mutants also showed extreme displacement of the blade/sheath boundary relative to eta1 and lg2 homozygotes. The observation that the double-mutant plants were able to produce ligule suggests that neither of these genes is specifically involved in ligule induction, but may be involved prior to that in establishment of the blade/sheath boundary. These data indicate that lg2 and eta1 have partially overlapping functions in properly delineating the blade/sheath boundary.

Interaction with proximodistal axis regional identity mutants:
While the mutant eta1 phenotype resembles that of rs2 and the dominant knox mutants, we found that the eta1 mutation does not ectopically express any of the class 1 knox genes (Fig 10). However, proximodistal regional identity mutants including class 1 knox genes interact genetically with eta1. Interactions between the dominant knox mutants have been previously documented (FOWLER and FREELING 1996 Down). Interestingly, eta1 can phenocopy dominant knox mutations in double-mutant combination. For example, the double-mutant phenotype of Lg3-O eta1-R (Fig 7) is nearly identical to the double-mutant phenotype of Lg3-O Lg4-O (FOWLER and FREELING 1996 Down). This is also true of the Kn1-N eta1-R (Fig 6) double-mutant phenotype, which mimics that of Kn1-O Rs1-O (FOWLER and FREELING 1996 Down). Since the severity of Kn1-N eta1-R double-mutant individuals is not a direct result of increased KN1-mRNA levels and eta1-R in double-mutant combination with knox genes results in severe phenotypes, eta1-R likely functions either downstream of the pathway perturbed by knox neomorphs or in a parallel but convergent pathway that promotes differentiation.

In the Rs1-O mutant, the area of ectopic RS1-mRNA expression is greater than one would expect given the phenotypic consequences of that expression (SCHNEEBERGER et al. 1995 Down). Specifically, ectopic RS1-mRNA expression can be detected in most cell types but only the sheath and the ligular region display developmental defects. The authors propose that this could be due to competency of cells to respond to ectopic RS1 expression. Perhaps eta1 is essential in competency and without its normal function cells are increasingly sensitive or responsive to ectopic knox gene expression. This could be one explanation for the change in focus of ectopic RS1 action in the Rs1-O eta1-R double mutants.

Interestingly, the phenotype of rs2-R eta1-R double mutants is slightly different from that of the Rs1-O eta1-R double mutants. Both double-mutant analyses were carried out in the same genetic background, which cannot account for the differences observed. It is possible that the difference in the synergistic interaction of rs2-R eta1-R compared to Rs1-O eta1-R can be attributed to as yet unidentified downstream rs2 targets, which are likely to be misexpressed. In addition, the spatial and temporal expression of knox genes is likely to differ in Rs1-O and rs2-R. For example, in Arabidopsis, the rounded-leaf phenotype of as1 mutants differs from that of the lobed-leaf phenotype of 35S:KNAT1 plants (ORI et al. 2000 Down; THEODORIS et al. 2003 Down).

More surprising is the eta1 Gn1 dosage effect. Gn1-R acts as a true dominant and therefore Gn1 heterozygotes cannot be distinguished from homozygotes. rs1 and gn1 are duplicate genes (FOSTER et al. 1999 Down); therefore, it is interesting that we see a dosage effect only with Gn1-R and eta1-R and not with Rs1-O and eta1-R. There are multiple explanations for this. One possibility is that the dosage interaction with eta1-R and Gn1-R is due to allelic differences between Gn1-R and Rs1-O. Another possibility is that there is a modifier in W22 that confers dosage sensitivity with Gn1-R eta1-R and this modifier is not present in Mo17, the background in which the Rs1-O eta1-R double-mutant analysis was performed. A third possibility is that although Rs1 and Gn1 are thought to be duplicate genes, over evolutionary time they have evolved slightly disparate functions and thus we found proximodistal identity to be more sensitive to dosage of Gn1 when Eta1+ function is lost. These data uncover a threshold of responsiveness to ectopic GN1 that is seen when Eta1+ function is lost, which is consistent with eta1 playing a role in competency.

Alternative modes of eta1 action:
Our current understanding of genetic control of patterning in simple leaves comes primarily from work with maize, Antirrhinum, and Arabidopsis. Although there is no precedent in maize for the breadth of interaction seen between eta1 and the lg and knox pathways, there is a clue from Arabidopsis on how eta1 may be functioning. The pickle (pkl) mutant, which encodes a chromatin-remodeling factor, enhances the as1 mutant phenotype, but does not ectopically express knox genes on its own (ORI et al. 2000 Down). These authors propose that PKL functions to limit accessibility of KNOX genes to their gene targets, while as1 confers specificity for repression of the KNOX genes (ORI et al. 2000 Down). Interestingly, the phenotype of pkl as1 double mutants mimics that of 35S:KNAT1 overexpression lines (ORI et al. 2000 Down), much like eta1 in double-mutant combination with knox genes mimics dominant knox double mutants. ORI et al. 2000 Down propose that PKL may play a role in restricting competency of cells to respond to morphogenetic factors. Given the pleiotropic phenotype of eta1 and its many genetic interactors, it is possible eta1 may have a general function in altering chromatin states and therefore competency similar to pkl.

An alternative possibility is that eta1 functions simply in restricting cell proliferation at the blade/sheath boundary. This seems unlikely given the effects of eta1 in double-mutant combination with the knox genes and liguleless genes. Since lg2 and Gn1 share only a defect in proper initiation of the blade/sheath boundary, it is more likely that eta1 functions in establishment of the blade/sheath boundary given its dosage interactions with both lg2 and Gn1 (Fig 5 and Fig 8). We have shown that the increase in auricle tissue at the blade/sheath boundary is not solely due to an increase in cell expansion because the auricle cells in eta1 leaves are similar in size to auricle cells of wild-type siblings (Fig 2G and Fig H). Another possibility is that eta1 acts as a receptor or in the reception end of the pathway that establishes the blade/sheath boundary. Further research is focused on the cloning of newly derived eta1 alleles in hopes of shedding some light on its complex series of genetic interactions. Regardless, eta1 proves to be an essential component in the genetic circuitry involved with proximodistal patterning in the maize leaf.


*  FOOTNOTES

1 Present address: Pointilliste, 2541 Leghorn St., Suite 4, Mountain View, CA 94043. Back


*  ACKNOWLEDGMENTS

Many thanks go to Sarah Hake for alleles, probes, and helpful comments; to Frank Baker for providing the marked B-A translocation stocks; to Randall Tyers for design of the knox primers; and to George Theodoris, Randall Tyers, Frank Baker, Noriko Inada, and Nick Kaplinsky for critical reading of the manuscript. Many thanks also go to all of the Freeling lab members past and present who have provided support and guidance in this research, which was supported by National Institutes of Health grant 5R01 GM42610 to M.F.

Manuscript received April 8, 2003; Accepted for publication July 11, 2003.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

BECKETT, J. B., 1994a Comprehensive list of B-A translocations in maize, pp. 336–341 in The Maize Handbook, edited by M. FREELING and V. WALBOT. Springer-Verlag, New York/Berlin.

BECKETT, J. B., 1994b Locating recessive genes to chromosome arm with B-A translocations, pp. 315–327 in The Maize Handbook, edited by M. FREELING and V. WALBOT. Springer-Verlag, New York/Berlin.

BECRAFT, P. W. and M. FREELING, 1994  Genetic analysis of rough sheath1 developmental mutants of maize. Genetics 136:295-311.[Abstract]

BECRAFT, P. W., D. K. BONGARD-PIERCE, A. W. SYLVESTER, R. S. POETHIG, and M. FREELING, 1990  The liguleless-1 gene acts tissue specifically in maize leaf development. Dev. Biol. 141:220-232.[Medline]

BELLAOUI, M., M. S. PIDKOWICH, A. SAMACH, K. KUSHALAPPA, and S. E. KOHALMI et al., 2001  The Arabidopsis BELL1 and KNOX TALE homeodomain proteins interact through a domain conserved between plants and animals. Plant Cell 13:2455-2470.[Abstract/Free Full Text]

BYRNE, M. E., R. BARLEY, M. CURTIS, J. M. ARROYO, and M. DUNHAM et al., 2000  Asymmetric leaves1 mediates leaf patterning and stem cell function in Arabidopsis. Nature 408:967-971.[Medline]

BYRNE, M. E., J. SIMOROWSKI, and R. A. MARTIENSSEN, 2002  ASYMMETRIC LEAVES1 reveals knox gene redundancy in Arabidopsis. Development 129:1957-1965.

EDWARDS, K., C. JOHNSTONE, and C. THOMPSON, 1991  A simple and rapid method for the preparation of plant genomic DNA for Pcr analysis. Nucleic Acids Res. 19:1349.[Free Full Text]

FOSTER, T., J. YAMAGUCHI, B. C. WONG, B. VEIT, and S. HAKE, 1999  Gnarley1 is a dominant mutation in the knox4 homeobox gene affecting cell shape and identity. Plant Cell 11:1239-1252.[Abstract/Free Full Text]

FOWLER, J. E. and M. FREELING, 1996  Genetic analysis of mutations that alter cell fates in maize leaves: dominant liguleless mutations. Dev. Genet. 18:198-222.[Medline]

FREELING, M., 1992  A conceptual framework for maize leaf development. Dev. Biol. 153:44-58.[Medline]

FREELING, M. and S. HAKE, 1985  Developmental genetics of mutants that specify knotted leaves in maize. Genetics 111:617-634.[Abstract/Free Full Text]

HAKE, S., E. VOLLBRECHT, and M. FREELING, 1989  Cloning knotted the dominant morphological mutant in maize using Ds2 as a transposon tag. EMBO J. 8:15-22.[Medline]

HARPER, L. and M. FREELING, 1996a  Interactions of liguleless1 and liguleless2 function during ligule induction in maize. Genetics 144:1871-1882.[Abstract]

HARPER, L. and M. FREELING, 1996b  Studies on early leaf development. Curr. Opin. Biotechnol. 7:139-144.

HAY, A., H. KAUR, A. PHILLIPS, P. HEDDEN, and S. HAKE et al., 2002  The gibberellin pathway mediates KNOTTED1-type homeobox function in plants with different body plans. Curr. Biol. 12:1557-1565.[Medline]

KERSTETTER, R. A., D. LAUDENCIA-CHINGCUANCO, L. G. SMITH, and S. HAKE, 1997  Loss-of-function mutations in the maize homeobox gene, knotted1, are defective in shoot meristem maintenance. Development 124:3045-3054.[Abstract]

LI, Y., G. HAGEN, and T. J. GUILFOYLE, 1992  Altered morphology in transgenic tobacco plants that overproduce cytokinins in specific tissues and organs. Dev. Biol. 153:386-395.[Medline]

LONG, J. A., E. I. MOAN, J. I. MEDFORD, and M. K. BARTON, 1996  A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature 379:66-69.[Medline]

MORENO, M. A., L. C. HARPER, R. W. KRUEGER, S. L. DELLAPORTA, and M. FREELING, 1997  Liguleless1 encodes a nuclear-localized protein required for induction of ligules and auricles during maize leaf organogenesis. Genes Dev. 11:616-628.[Abstract/Free Full Text]

MUEHLBAUER, G. J., J. E. FOWLER, and M. FREELING, 1997  Sectors expressing the homeobox gene liguleless3 implicate a time-dependent mechanism for cell fate acquisition along the proximal-distal axis of the maize leaf. Development 124:5097-5106.[Abstract]

MUELLER, J., Y. WANG, R. FRANZEN, L. SANTI, and F. SALAMINI et al., 2001  In vitro interactions between barley TALE homeodomain proteins suggest a role for protein-protein associations in the regulation of Knox gene function. Plant J. 27:13-23.[Medline]

ORI, N., M. T. JUAREZ, D. JACKSON, J. YAMAGUCHI, and G. M. BANOWETZ et al., 1999  Leaf senescence is delayed in tobacco plants expressing the maize homeobox gene knotted1 under the control of a senescence-activated promoter. Plant Cell 11:1073-1080.[Abstract/Free Full Text]

ORI, N., Y. ESHED, G. CHUCK, J. L. BOWMAN, and S. HAKE, 2000  Mechanisms that control knox gene expression in the Arabidopsis shoot. Development 127:5523-5532.[Abstract]

POETHIG, R. S., 1988  Heterochronic mutations affecting shoot development in maize. Genetics 119:959-974.[Abstract/Free Full Text]

POETHIG, S., 1984 Cellular parameters of leaf morphogenesis in maize Zea-mays and tobacco Nicotiana-tabacum, pp. 235–260 in Contemporary Problems in Plant Anatomy; Symposium, Chapel Hill, North Carolina, edited by R. A. WHITE and W. C. DICKISON. Academic Press, Orlando, FL/London.

SAKAMOTO, T., N. KAMIYA, M. UEGUCHI-TANAKA, S. IWAHORI, and M. MATSUOKA, 2001  KNOX homeodomain protein directly suppresses the expression of a gibberellin biosynthetic gene in the tobacco shoot apical meristem. Genes Dev. 15:581-590.[Abstract/Free Full Text]

SCANLON, M. J., R. G. SCHNEEBERGER, and M. FREELING, 1996  The maize mutant narrow sheath fails to establish leaf margin identity in a meristematic domain. Development 122:1683-1691.[Abstract]

SCANLON, M. J., D. C. HENDERSON, and B. BERNSTEIN, 2002  SEMAPHORE1 functions during the regulation of ancestrally duplicated knox genes and polar auxin transport in maize. Development 129:2663-2673.[Abstract/Free Full Text]

SCHNEEBERGER, R. G., P. W. BECRAFT, S. HAKE, and M. FREELING, 1995  Ectopic expression of the knox homeo box gene rough sheath1 alters cell fate in the maize leaf. Genes Dev. 9:2292-2304.[Abstract/Free Full Text]

SCHNEEBERGER, R., M. TSIANTIS, M. FREELING, and J. A. LANGDALE, 1998  The rough sheath2 gene negatively regulates homeobox gene expression during maize leaf development. Development 125:2857-2865.[Abstract]

SMITH, L. G., B. GREENE, B. VEIT, and S. HAKE, 1992  A dominant mutation in the maize homeobox gene, Knotted-1, causes its ectopic expression in leaf cells with altered fates. Development 116:21-30.[Abstract]

SMITH, J. S. C., E. C. L. CHIN, H. SHU, O. S. SMITH, and S. J. WALL et al., 1997  An evaluation of the utility of SSR loci as molecular markers in maize (Zea may L.): comparisons with data from RFLPS and pedigree. Theor. Appl. Genet. 95:163-173.

SMITH, H. M. S., I. BOSCHKE, and S. HAKE, 2002  Selective interaction of plant homeodomain proteins mediates high DNA-binding affinity. Proc. Natl. Acad. Sci. USA 99:9579-9584.[Abstract/Free Full Text]

STEEVES, T. A., and I. M. SUSSEX, 1989 Patterns in Plant Development, Ed. 2. Cambridge University Press, New York/Cambridge, UK.

SYLVESTER, A. W., W. Z. CANDE, and M. FREELING, 1990  Division and differentiation during normal and liguleless-1 maize leaf development. Development 110:985-1000.[Abstract/Free Full Text]

THEODORIS, G., N. INADA, and M. FREELING, 2003  Conservation and molecular dissection of ROUGH SHEATH2 and ASYMMETRIC LEAVES1 function in leaf development. Proc. Natl. Acad. Sci. USA 100:6837-6842.[Abstract/Free Full Text]

TIMMERMANS, M. C. P., A. HUDSON, P. W. BECRAFT, and T. NELSON, 1999  Rough sheath2: a Myb protein that represses knox homeobox genes in maize lateral organ primordia. Science 284:151-153.[Abstract/Free Full Text]

TSIANTIS, M., R. SCHNEEBERGER, J. F. GOLZ, M. FREELING, and J. A. LANGDALE, 1999  The maize rough sheath2 gene and leaf development programs in monocot and dicot plants. Science 284:154-156.[Abstract/Free Full Text]

VOLLBRECHT, E., B. VEIT, N. SINHA, and S. HAKE, 1991  The developmental gene knotted-1 is a member of a maize homeobox gene family. Nature 350:241-243.[Medline]

VOLLBRECHT, E., L. REISER, and S. HAKE, 2000  Shoot meristem size is dependent on inbred background and presence of the maize homeobox gene, knotted1. Development 127:3161-3172.[Abstract]

WALSH, J. and M. FREELING, 1999  The liguleless2 gene of maize functions during the transition from the vegetative to the reproductive shoot apex. Plant J. 19:489-495.[Medline]

WALSH, J., C. A. WATERS, and M. FREELING, 1998  The maize gene liguleless 2 encodes a basic leucine zipper protein involved in the establishment of the leaf blade-sheath boundary. Genes Dev. 12:208-218.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Plant Physiol.Home page
D. L. Alexander, E. A. Mellor, and J. A. Langdale
CORKSCREW1 Defines a Novel Mechanism of Domain Specification in the Maize Shoot
Plant Physiology, July 1, 2005; 138(3): 1396 - 1408.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
A. Hay and S. Hake
The Dominant Mutant Wavy auricle in blade1 Disrupts Patterning in a Lateral Domain of the Maize Leaf
Plant Physiology, May 1, 2004; 135(1): 300 - 308.
[Abstract] [Full Text] [PDF]