- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Church, D. L.
- Articles by Lambie, E. J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Church, D. L.
- Articles by Lambie, E. J.
The Promotion of Gonadal Cell Divisions by the Caenorhabditis elegans TRPM Cation Channel GON-2 Is Antagonized by GEM-4 Copine
Diane L. Churcha and Eric J. Lambieaa Department of Biological Sciences, Dartmouth College, Hanover, New Hampshire 03755
Corresponding author: Eric J. Lambie, Department of Biological Sciences, Dartmouth College, Hanover, NH 03755., eric.j.lambie{at}dartmouth.edu (E-mail)
Communicating editor: P. ANDERSON
| ABSTRACT |
|---|
The initiation of postembryonic cell divisions by the gonadal precursors of C. elegans requires the activity of gon-2. gon-2 encodes a predicted cation channel (GON-2) of the TRPM subfamily of TRP proteins and is likely to mediate the influx of Ca2+ and/or Mg2+. We report here that mutations in gem-4 (gon-2 extragenic modifier) are capable of suppressing loss-of-function alleles of gon-2. gem-4 encodes a member of the copine family of Ca2+-dependent phosphatidylserine binding proteins. Overall, our data indicate that GEM-4 antagonizes GON-2. This antagonism could be mediated by a direct inhibition of GON-2 by GEM-4, since both proteins are predicted to be localized to the plasma membrane. Alternatively, GEM-4 could affect GON-2 activity levels by either promoting endocytosis or inhibiting exocytosis of vesicles that carry GON-2. It is also possible that GEM-4 and GON-2 act in parallel to each other. Mutation of gem-4 does not suppress the gonadal defects produced by inactivation of gon-4, suggesting that gon-4 either acts downstream of gem-4 and gon-2 or acts in a parallel regulatory pathway.
THE gonad of the nematode Caenorhabditis elegans is derived from four postembryonic blast cells that initiate divisions several hours after the larva hatches from the egg (![]()
![]()
![]()
![]()
TRPM proteins are similar to other TRPs in that they have a cluster of six plasma-membrane-spanning segments; however, unlike other TRP proteins, TRPMs have a relatively large C-terminal cytoplasmic domain and lack ankyrin repeats in the N-terminal cytoplasmic domain (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
It is not known how GON-2 activity is regulated or how its activity regulates the divisions of the gonadal precursor cells. We previously found that gon-2 mRNA is not restricted to the gonad; however, we were not able to determine whether gon-2 is expressed within the somatic gonadal cells (![]()
![]()
![]()
![]()
![]()
![]()
To identify potential regulators of gon-2, we performed a screen for extragenic modifiers of the temperature-sensitive allele, gon-2(q388). One of the genes that we identified in this screen is gem-4 (gon-2 extragenic modifier), which encodes a member of the copine family of cytoplasmic, Ca2+-dependent phosphatidylserine binding proteins (![]()
![]()
![]()
![]()
![]()
![]()
In this article, we present results indicating that the inactivation of gem-4 copine can suppress the effects of a reduction in gon-2 TRPM activity, but cannot suppress the complete inactivation of gon-2 TRPM. These data suggest that gem-4(+) acts as an antagonist of gon-2(+). Such antagonism could be mediated by a direct interaction between the two proteins, or it could be that GON-2 and GEM-4 act in parallel to regulate the divisions of the gonadal precursors.
| MATERIALS AND METHODS |
|---|
Worm culture methods:
Nematodes were grown in petri dishes or 12-well microtiter plates using Escherichia coli as a food source, essentially as described by ![]()
![]()
![]()
Microscopy and imaging:
Live nematodes were viewed and photographed as described by ![]()
Nematode strains:
The wild-type N2 background was used in all experiments except the single nucleotide polymorphism (SNP) mapping, which also utilized the wild-type strain CB4856 (![]()
![]()
The following mutations and rearrangements were used (described by ![]()
- Mutations: I: gon-2(q388), gon-2(dx58) (
WEST et al. 2001 ), unc-29(e1072); IV: unc-24(e138), him-8(e1489), dpy-20(e1282), let-60(s1124), let-92(s504), unc-22(s7), unc-31(e169).
- Chromosomal aberrations: sDf7 IV (
MOERMAN and BAILLIE 1981 ), sDf8 IV (
ROGALSKI et al. 1982 ), nT1[let-?] IV; nT1[deg-3(u662)] V (referred to here as DnT1) (
FERGUSON and HORVITZ 1985 ;
TREININ and CHALFIE 1995 ), hT2[bli-4(e937)] I; hT2[dpy-18(e364)] III.
Isolation of mutant alleles of gem-4:
To identify extragenic modifiers of gon-2 (specifically, suppressors), we mutagenized hermaphrodites of genotype gon-2(q388) unc-29(e1072) and plated them in groups to produce F1 progeny at permissive temperature. Mutagenesis conditions for UV and EMS was as previously described by ![]()
![]()
![]()
15% of the total progeny were transferred to a new plate, which was again incubated at 23.5°. This procedure was repeated four or five times and then each plate was inspected for the presence of relatively large numbers of fertile animals. Since q388 is not fully penetrant at 23.5°, even stocks that do not carry suppressor mutations continue to propagate through multiple passages. Therefore, at this point, several fertile individuals were cloned from each plate and tested for their ability to produce a high fraction of non-Gon progeny at 23.5°.
Initial characterization of gem mutations:
All mutations were outcrossed to gon-2(q388); him-8(e1489) males to test for dominance and sex linkage. Subsequent segregation of the gem mutation relative to unc-29(e1072) and him-8(e1489) was used to assess linkage to chromosomes I and IV, respectively. Four mutations exhibited linkage to him-8, and these mutations all fell into the same complementation group, which we designated gem-4. Characterization of the other suppressor mutations will be described elsewhere.
Mapping of gem-4:
We used conventional three-factor mapping to localize gem-4 on chromosome IV (Fig 1). Among the progeny of hermaphrodites of genotype gon-2(q388); unc-24(e138) dpy-20(e1282)/gem-4(dx77), 0/22 Dpy non-Uncs and 29/29 Unc non-Dpys segregated gem-4(dx77). Therefore, gem-4 is probably to the right of dpy-20. Among progeny of hermaphrodites of genotype gon-2(q388); let-60(s1124) unc-22(s7) unc-31(e169)/gem-4(dx77), 4/6 Unc-22 non-Lets segregated gem-4(dx77). Therefore, gem-4 is between let-60 and unc-22.
|
We identified an SNP within the predicted gene, F38H4.9, and used this to sublocalize gem-4 within the let-60-unc-22 interval, as described by ![]()
Transformation:
Standard methods were used to generate and maintain transgenic nematode stocks by coinjection of sample DNAs with plasmid pRF4, which contains the dominant rol-6(su1006) marker (![]()
Defecation cycle:
Hermaphrodites were raised at 19.5° on uncrowded plates and scored as young adults. Three consecutive defecation cycles were timed for each of five hermaphrodites and standard deviations for each group of animals were calculated using Microsoft Excel.
Plasmid construction:
Cosmid T28C1 (which overlaps T12A7, Fig 1) was digested with BamHI and shotgun cloned into pGem7Zf(+) (Promega, Madison, WI), which had been cut with BamHI and dephosphorylated with calf intestinal phosphatase (New England Biolabs, Beverly, MA). PCR was used to identify clones that had the correct insert (an 8574-bp BamHI fragment with 2157 bp upstream of the gem-4 ATG and 3054 bp downstream of the gem-4 TAG). There are two NdeI cleavage sites in this plasmid (pG41), one of which is ideally situated for creating a C-terminal translational fusion (2 bp upstream of the gem-4 TAG codon). Therefore, pG41 was partially digested with NdeI and linear molecules were isolated by agarose gel electrophoresis, followed by QIAquick (QIAGEN, Chatsworth, CA) purification. Linearized pG41 was ligated with an excess of annealed oligonucleotides o478 (TATCCCGTACGG CGGCCGC) and o479 (TAGCGGCCGCCGTACGGGA). Restriction digests and DNA sequencing were used to identify a plasmid in which the adapter was ligated into the desired NdeI site. The resulting plasmid (pG42) contains unique BsiWI and NotI sites immediately upstream of the gem-4 TAG codon. Primers o481 (AGATCGACGTACGGAGTAAAGGAGAAGAACTTTTC) and o467 (CCCTGCAGGGCGGCCGCCGTACGATGCA) were used to amplify green fluorescent protein (GFP) by PCR, using plasmid L3929 as the template (kindly supplied by A. Fire, Carnegie Institute of Washington). The PCR product was purified using a QIAquick column and digested with BsiWI and NotI and ligated into plasmid pG42, cut with the same enzymes. In the resulting plasmid (pG43), the coding sequence for the terminal V of gem-4 is replaced by PVR, followed by GFP, and then the gem-4 3' flanking sequences.
cDNA isolation:
RNA was purified from mixed-stage worms using Trizol (GIBCO/Bethesda Research Laboratories). RT-PCR was performed according to the manufacturer's instructions (Invitrogen, San Diego) to determine the 5' end and the intron/exon structure of the gem-4 mRNA. We used PCR to amplify the 3' end of gem-4 from a cDNA library kindly supplied by R. Barstead (![]()
DNA sequencing:
PCR was used to amplify
1-kb segments of gem-4 genomic DNA, plasmids, or cDNAs for sequencing. These were processed using the BigDye cycle sequencing kit (Applied Biosystems, Foster City, CA) and analyzed by the Dartmouth Molecular Biology Core Facility. Mutant alleles of gem-4 were sequenced on both strands to confirm their identity.
RNAi experiments:
An 850-bp segment of the gem-4 cDNA was PCR amplified using primers o512 (GCTAATACGACTCACTATAGGGCTGAACGAGGACGAACTGAA) and o513 (GCTAATACGACTCACTATAGGGTGCAAAGATCCAGGTGTTCG). The first 22 nucleotides (nt) of each primer contains the promoter for T7 RNA polymerase. A 749-bp fragment of genomic DNA corresponding to F26D10.4 was amplified using primers o532 (TAATACGACTCACTATAGGATCCGTGCTATCCATTTGCC) and o533 (TAATACGACTCACTATAGGCTTCCAGTCCCATCTAGAATC). This segment contains exons of 343 and 350 bp in size. The first 19 nt of each of these primers corresponds to the T7 promoter. A 1456-bp segment of the gon-2 cDNA was amplified using primers o344 AATACGACTCACTATACGCGTCGAAGATGTGATTG and o149 AATACGACTCACTATAATCTATGGCATGGTGGTCTT. The first 16 bp of each of these primers contains the T7 promoter. An 873-bp fragment of gon-4 coding sequence was amplified from genomic DNA using primers o592 TAATACGACTCACTATAGGCTTAATGGTGGTCTAGAATTG and o591 TAATACGACTCACTATAGGCCCGATGAAGCTCAGTACG. The first 19 nt of each of these primers corresponds to the T7 promoter.
The Megascript kit (Ambion, Austin, TX) was used to generate double-stranded RNA (dsRNA) corresponding to gem-4, gon-2, gon-4, and F26D10.4. In each case,
1 µg of double-strand template DNA was added to the transcription reaction, which was run for
7 hr at 37°. Transcription efficiency was monitored by running an aliquot of the reaction on an agarose gel and staining with ethidium bromide. dsRNAs were heated to 60° for
10 min, cooled to room temperature, and then injected into the intestine and/or pseudocoelomic cavity of adult hermaphrodites at an estimated concentration of
1 µg/µl. Groups of injected animals were incubated on the same plate for at least 8 hr and then transferred to individual plates or multiwells for scoring of offspring.
| RESULTS |
|---|
Identification of gem-4:
To identify genes that interact with gon-2, we screened for revertants of the sterile phenotype of gon-2(q388). These screens resulted in the identification of 25 UV-induced suppressors and 16 EMS-induced suppressors. The total number of genomes screened was
106 for UV and 5.6 x 105 for EMS. However, the efficiency of recovery of suppressor mutations is not likely to be 100%, so the actual frequency of mutations is probably higher than the
2.5 x 10-5 estimate provided by these data.
Initial outcrosses revealed that four of the mutations (dx63 and dx97, UV; dx74 and dx77, EMS) were recessive and showed linkage to him-8 IV. These four mutations represent a single complementation group, which we designated gem-4.
Characterization of gem-4 alleles:
Each of the mutant alleles of gem-4 exhibits a moderately high level of suppression of gon-2(q388), is fully recessive to wild type, and is not maternally rescued (Table 1). We arbitrarily chose gem-4(dx77) for most of our further characterization.
|
Suppression is not specific to gon-2(q388), since gem-4(dx77) is also capable of suppressing another missense mutant, gon-2(dx58) (Table 2). The efficiency of suppression of gon-2(dx58) by gem-4(dx77) is similar at 15°, 19.5°, and 23.5°, indicating that gem-4(dx77) is not a temperature-sensitive allele.
|
gem-4(dx77) is capable of suppressing a reduction of gon-2 activity mediated by RNAi (Table 3). However, the frequency of gonadless (Gon) animals produced by gon-2(RNAi) in a wild-type background is lower than that seen in gon-2(q388) mutant individuals. This indicates that gon-2(RNAi) does not fully eliminate gon-2(+) activity. To reduce gon-2 activity to a negligible level, we performed gon-2(RNAi) in a gon-2(q388) background at the restrictive temperature for gon-2(q388). In these animals, no suppression by gem-4(dx77) was observed. Therefore, suppression by gem-4(dx77) requires that the level of gon-2(+) activity be above a certain threshold.
|
sDf7 and sDf8 are both predicted to remove the gem-4 locus (![]()
![]()
Mapping and cloning gem-4:
We used a combination of conventional three-factor mapping and SNP mapping to narrow the location of gem-4 to a position midway between let-60 and unc-22 (Fig 1). By assaying cosmids within this interval for their ability to rescue suppression by gem-4(dx77), we determined that gem-4 is located on cosmid T28C1 (Table 4). The overlapping cosmid, T12A7, contains a predicted gene (T12A7.1) that has two calcium-binding C2 motifs. Since this was a prime candidate for gem-4, we sequenced the coding regions of T12A7.1 to search for mutations corresponding to mutant alleles of gem-4. In each case, we found a single G
A mutation within the coding region for T12A7.1 (Fig 1; see below). Therefore, we conclude that gem-4 corresponds to T12A7.1.
|
We used RT-PCR to amplify and sequence the 5' end and internal coding region of the gem-4 transcript. Our results match the intron/exon structure of T12A7.1 described in GenBank. We verified the 3' end of gem-4 by PCR amplification and sequencing of cDNA from an oligo(dT)-primed library supplied by R. Barstead (![]()
![]()
gem-4 encodes a copine:
GEM-4 is highly similar to three human proteins, copine I, copine III, and KIA1599 (>40% identity over
590 residues; Fig 2). Within the C. elegans genome, GEM-4 is most similar to another predicted C. elegans gene, F26D10.4 (73% identity over 637 residues). At least three other copine family members, with lower degrees of similarity, are also present in the C. elegans genome.
|
All copines have two
130-amino-acid (aa) C2 domains in the N-terminal half of the protein (![]()
![]()
![]()
200 aa that has similarity to the Mg2+-binding domain of integrins (![]()
![]()
Mutant alleles of gem-4:
Each of the mutant alleles of gem-4 that we identified alters the predicted protein coding sequence (Fig 1 and Fig 2). dx74 and dx63 alter different glycine residues, each of which is adjacent to a potential serine/threonine phosphorylation site that is conserved among the metazoan relatives of GEM-4 (but absent from Arabidopsis BON1). dx74 is between the two C2 domains, while dx63 is near the end of the second C2 domain (C2B). gem-4(dx77) alters a splice site upstream of intron 5. We used RT-PCR to examine the splicing pattern in gem-4(dx77) animals and found that intron 5 is retained within the resulting mRNA. Since this intron is 45 nt in length and contains no stop codons within the GEM-4 reading frame, dx77 is predicted to result in a 15-amino-acid insertion, beginning after P286. This insertion is likely to disrupt C2B function. dx97 causes a E
K substitution in the C-terminal portion of GEM-4, adjacent to the A domain. Although this region is conserved among the various copines, no function has been ascribed to this portion of the protein.
gem-4::GFP expression pattern:
To determine when and where gem-4 is expressed during C. elegans development, we fused the coding sequence of GFP to the 3' end of the coding sequence of GEM-4 and generated transgenic animals carrying this construct. We examined the expression and localization of GEM-4::GFP in three different backgrounds: wild type (N2), gon-2(q388); gem-4(dx77), and gon-2(q388). No obvious differences in expression pattern were observed in these different backgrounds (data not shown).
The gem-4::GFP reporter gene complements gem-4(dx77) just as efficiently as the cosmid T28C1, suggesting that the fusion protein is expressed and functions within the tissues within which GEM-4 normally acts (Table 4). In cells that express GEM-4::GFP, fluorescence is typically brightest at the plasma membrane. In some cases, punctate staining is also evident within the cytoplasm, possibly due to association with vesicular structures (Fig 3). We have not systematically examined the embryonic expression pattern; however, GEM-4::GFP is broadly expressed in embryos that have several hundred cells and continues to be expressed in most cells as the embryo undergoes elongation (Fig 4).
|
|
In newly hatched L1s, GEM-4::GFP is expressed in the precursors of the somatic gonad (Z1 and Z4), the pharyngeal/intestinal valve cells, the intestinal cells, and the head mesodermal cell (the sister of Z4; Fig 4 and Fig 5). The germline precursors, Z2 and Z3, also appear to be outlined in some animals (Fig 5); however, it is not clear whether this is due to expression within the germ cells themselves or whether it results from extensions of the plasma membranes of Z1 and Z4.
|
Localization of GEM-4::GFP to the plasma membrane is not dependent on gon-2 activity, since this is not altered at restrictive temperature in animals of background genotype gon-2(q388); gem-4(dx77) or gon-2(q388) (Fig 5). Expression of GEM-4::GFP within Z1 and Z4 becomes progressively more difficult to detect as the animals progress through L1 and is not detectable within the progeny of Z1 and Z4. GEM-4::GFP expression within somatic gonadal tissues does not resume until early adulthood. At this point, GEM-4::GFP becomes strongly expressed within the distal spermathecal cells, the spermathecal valve cells, and the uterine epithelial cells (Fig 6).
|
gem-4(dx77) and gem-4(dx74) have no apparent phenotype in a wild-type background:
We outcrossed gem-4(dx74) and gem-4(dx77) to determine whether these mutations produce any mutant phenotypes in a gon-2(+) background. However, neither strain is obviously different from wild type in terms of growth rate, gonad development, behavior, or dependence of gonadal cell divisions on the availability of food (data not shown). We determined brood sizes among animals raised at either 15° or 23.5°. At 15°, we found that the brood sizes for N2 (mean 265, SD 29, n = 3) and gem-4(dx77) (mean 240, SD 25, n = 4) were similar, whereas that for gem-4(dx74) was somewhat lower (mean 162, SD 58, n = 4). We obtained similar results for brood sizes at 23.5°: N2, mean 233, SD 65, n = 4; gem-4(dx77), mean 253, SD 37, n = 4; gem-4(dx74), mean 173, SD 43, n = 4. The relatively low fecundity of the gem-4(dx74) strain may be due to a mutation in a separate gene that was not removed during outcrossing of the mutagenized stock.
Since gem-4 is implicated in the regulation of calcium-mediated signaling, and calcium levels within the intestinal cells are known to regulate the defecation cycle (![]()
Inactivation of gem-4 by RNAi:
We used RNAi to determine whether reducing the level of gem-4 activity is sufficient to suppress gon-2(q388). gem-4(RNAi) suppresses gon-2(q388) nearly as efficiently as the mutant alleles of gem-4 (Table 5). To assess the efficacy of the RNAi treatment, we also tested animals carrying an extrachromosomal array that contains gem-4::GFP. In nearly all of these animals GFP fluorescence was either eliminated or greatly reduced. In addition, the rescuing effects of GEM-4::GFP were severely attenuated by gem-4(RNAi) (Table 5).
|
We also tested whether gem-4(RNAi) would enhance the suppression of gon-2(q388) by gem-4(dx77) or cause a detectable phenotype in animals of genotype gem-4(dx77). gem-4(RNAi) had no discernible effect in either experiment, suggesting that gem-4(dx77) is a strong loss-of-function allele (Table 5).
To investigate the possibility that gem-4 is functionally redundant to F26D10.4, we also examined the effects of F26D10.4(RNAi). F26D10.4(RNAi) weakly suppressed gon-2(q388), but did not alter the penetrance of suppression of gon-2(q388) by gem-4(dx77) or produce any obvious effects in a wild-type background (Table 6). We suspect that the weak suppressive effect of F26D10.4(RNAi) may be due to cross-inactivation of gem-4, because several
30-nt stretches of
90% identity between gem-4 and F26D10.4 are present within the region that was used to generate the double-stranded RNA. ![]()
|
gem-4(dx77) does not suppress the effects of inactivation of gon-4:
The gon-4 gene encodes a large nuclearly localized protein whose function is important for the initial divisions of the gonadal precursors (![]()
![]()
| DISCUSSION |
|---|
In our screen for genes that interact with gon-2, we identified four mutant alleles of the gem-4 locus. Several lines of evidence suggest that these are strong loss-of-function alleles of gem-4. First, each mutant allele is recessive to wild type. Second, gem-4(dx77) fails to complement the deficiency, sDf7. Third, gem-4(RNAi) suppresses gon-2(q388) nearly as effectively as the mutant alleles of gem-4. Fourth, the degree of suppression of gon-2(q388) by gem-4(dx77) is not altered when combined with gem-4(RNAi).
gem-4 encodes a member of the copine family of Ca2+-binding proteins (![]()
![]()
![]()
![]()
![]()
We found that GEM-4::GFP is constitutively localized to the plasma membrane in all cells that express the fusion protein, regardless of the activity state of gon-2 (and therefore possibly not dependent on high levels of intracellular calcium). This could be an artifact due to the GFP fusion or an unusually high level of protein expressed from the extrachromosomal array. However, Ca2+ is not essential for copines to bind to lipid membranes composed of phosphatidic acid (![]()
![]()
![]()
Mutation of the Arabidopsis copine gene, BON1/CPN1, causes a cold-sensitive growth defect, suggesting the possibility that copines are generally required for membrane fusion events at relatively low temperatures (![]()
![]()
Suppression by gem-4 requires at least a low level of gon-2 function. Therefore, gem-4 does not operate downstream of gon-2 in a simple linear regulatory pathway. Overall, our results are consistent with a model in which GON-2 and GEM-4 are both expressed and localize to the plasma membrane of the somatic gonad precursors at the beginning of the first larval stage. We hypothesize that GON-2 mediates an influx of mitogenic cations in response to developmental signals produced at the onset of postembryonic development. The resulting increase in free intracellular Ca2+ and Mg2+ could lead to the activation of GEM-4, which could then negatively regulate GON-2, possibly by direct phosphorylation.
Since copines may potentially be involved in vesicle trafficking (![]()
![]()
![]()
Our data are also consistent with the possibility that GEM-4 acts in parallel to GON-2 to modulate the level of intracellular Ca2+ and/or Mg2+ signaling. This could be accomplished by either altering the level of free intracellular cations or affecting the activity of one or more signal transduction components.
gon-4 encodes a novel nuclear protein whose inactivation causes an impairment of gonadal cell divisions similar to that seen in gon-2 mutants (but slightly less severe; ![]()
We have not observed any obvious defects in the timing or pattern of gonadal divisions when gem-4 mutations are present in a gon-2(+) background. Furthermore, gon-2(q388) is not fully suppressed by inactivation of gem-4. Together, these results suggest the possibility that gem-4 may be redundant to one or more other genes. We investigated this possibility by using RNAi to attempt to inactivate the paralogous gene, F26D10.4; however, this treatment had little or no effect. Perhaps regulation by gem-4 is merely a fine-tuning mechanism whose disruption has no overt consequences when the expression and function of gon-2 is normal. This would be consistent with other reports of extragenic suppressor mutations that have little or no obvious phenotype other than their suppressor activity (![]()
![]()
![]()
| ACKNOWLEDGMENTS |
|---|
We thank Theresa Stiernagle and the Caenorhabditis Genetics Stock Center [which is supported by the National Institutes of Health (NIH) National Center for Research Resources] for many of the strains used in this study, Andy Fire for the L3929 vector, Bob Barstead for the cDNA library, Alan Coulson and the Sanger Center for providing cosmids, Rachel West for ds gon-2 RNA, Victor Ambros for helpful comments on the manuscript, and reviewers for additional constructive suggestions. This work was supported by NIH grant RO1-GM49785.
Manuscript received January 11, 2003; Accepted for publication February 6, 2003.
| LITERATURE CITED |
|---|
BARSTEAD, R. J. and R. H. WATERSTON, 1989 The basal component of the nematode dense-body is vinculin. J. Biol. Chem. 264:10177-10185.
BLUMENTHAL, T., D. EVANS, C. D. LINK, A. GUFFANTI, and D. LAWSON et al., 2002 A global analysis of Caenorhabditis elegans operons. Nature 417:851-854.[Medline]
BRENNER, S., 1974 The genetics of Caenorhabditis elegans.. Genetics 77:71-94.
Genome sequence of the nematode C. elegans: a platform for investigating biology. (1998) Science 282:2012-2018.
CASADABAN, M. J., A. MARTINEZ-ARIAS, S. K. SHAPIRA, and J. CHAOU, 1993 ß-Galactosidase gene fusions for analyzing gene expression in Escherichia coli and yeast. Methods Enzymol. 100:293-299.
CAUDELL, E. G., J. J. CAUDELL, C. H. TANG, T. K. YU, and M. J. FREDERICK et al., 2000 Characterization of human copine III as a phosphoprotein with associated kinase activity. Biochemistry 39:13034-13043.[Medline]
CHURCH, D. L., K. L. GUAN, and E. J. LAMBIE, 1995 Three genes of the MAP kinase cascade, mek-2, mpk-1/sur-1 and let-60 ras, are required for meiotic cell cycle progression in Caenorhabditis elegans.. Development 121:2525-2535.[Abstract]
COULSON, A., 1996 The Caenorhabditis elegans genome project. C. elegans Genome Consortium. Biochem. Soc. Trans. 24:289-291.[Medline]
CREUTZ, C. E., J. L. TOMSIG, S. L. SNYDER, M. C. GAUTIER, and F. SKOURI et al., 1998 The copines, a novel class of C2 domain-containing, calcium-dependent, phospholipid-binding proteins conserved from Paramecium to humans. J. Biol. Chem. 273:1393-1402.
DAL SANTO, P., M. A. LOGAN, A. D. CHISHOLM, and E. M. JORGENSEN, 1999 The inositol trisphosphate receptor regulates a 50-second behavioral rhythm in C. elegans.. Cell 98:757-767.[Medline]
DUNCAN, L. M., J. DEEDS, J. HUNTER, J. SHAO, and L. M. HOLMGREN et al., 1998 Down-regulation of the novel gene melastatin correlates with potential for melanoma metastasis. Cancer Res. 58:1515-1520.
FERGUSON, E. L. and H. R. HORVITZ, 1985 Identification and characterization of 22 genes that affect the vulval cell lineages of the nematode Caenorhabditis elegans.. Genetics 110:17-72.
FRIEDMAN, L., S. SANTA ANNA-ARRIOLA, J. HODGKIN, and J. KIMBLE, 2000 gon-4, a cell lineage regulator required for gonadogenesis in Caenorhabditis elegans.. Dev. Biol. 228:350-362.[Medline]
GRANT, B. and I. GREENWALD, 1996 The Caenorhabditis elegans sel-1 gene, a negative regulator of lin-12 and glp-1, encodes a predicted extracellular protein. Genetics 143:237-247.[Abstract]
HEINER, I., J. EISFELD, C. R. HALASZOVICH, E. WEHAGE, and E. JUNGLING et al., 2003 Expression profile of the transient receptor potential (TRP) family in neutrophil granulocytes: evidence for currents through LTRPC2 induced by ADP-ribose and NAD. Biochem. J. 4:4.
HODGKIN, J., 1997 Genetics, pp. 8811047 in C. elegans II, edited by D. RIDDLE, T. BLUMENTHAL, B. MEYER and J. PRIESS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
HODGKIN, J. and T. DONIACH, 1997 Natural variation and copulatory plug formation in Caenorhabditis elegans.. Genetics 146:149-164.[Abstract]
HUA, J., P. GRISAFI, S. H. CHENG, and G. R. FINK, 2001 Plant growth homeostasis is controlled by the Arabidopsis BON1 and BAP1 genes. Genes Dev. 15:2263-2272.
HUANG, N. N., D. E. MOOTZ, A. J. WALHOUT, M. VIDAL, and C. P. HUNTER, 2002 MEX-3 interacting proteins link cell polarity to asymmetric gene expression in Caenorhabditis elegans.. Development 129:747-759.
JAKUBOWSKI, J. and K. KORNFELD, 1999 A local, high-density, single-nucleotide polymorphism map used to clone Caenorhabditis elegans cdf-1.. Genetics 153:743-752.
JAMBUNATHAN, N., J. M. SIANI, and T. W. MCNELLIS, 2001 A humidity-sensitive Arabidopsis copine mutant exhibits precocious cell death and increased disease resistance. Plant Cell 13:2225-2240.
JONGEWARD, G. D., T. R. CLANDININ, and P. W. STERNBERG, 1995 sli-1, a negative regulator of let-23-mediated signaling in C. elegans.. Genetics 139:1553-1566.[Abstract]
KANZAKI, M., Y. Q. ZHANG, H. MASHIMA, L. LI, and H. SHIBATA et al., 1999 Translocation of a calcium-permeable cation channel induced by insulin-like growth factor-I. Nat. Cell Biol. 1:165-170.[Medline]
KIMBLE, J. and D. HIRSH, 1979 Post-embryonic cell lineages of the hermaphrodite and male gonads in C. elegans.. Dev. Biol. 70:396-417.[Medline]
MAINE, E. M. and J. KIMBLE, 1993 Suppressors of glp-1, a gene required for cell communication during development in Caenorhabditis elegans, define a set of interacting genes. Genetics 135:1011-1022.[Abstract]
MCHUGH, D., R. FLEMMING, S. Z. XU, A. L. PERRAUD, and D. J. BEECH, 2003 Critical intracellular Ca2+ dependence of transient receptor potential melastatin 2 (TRPM2) cation channel activation. J. Biol. Chem. 278:11002-11006.
MELLO, C. C., J. M. KRAMER, D. STINCHCOMB, and V. AMBROS, 1991 Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10:3959-3970.[Medline]
MOERMAN, D. G. and D. L. BAILLIE, 1981 Formaldehyde mutagenesis in the nematode Caenorhabditis elegans.. Mutat. Res. 80:273-279.[Medline]
MONTEILH-ZOLLER, M. K., M. C. HERMOSURA, M. J. NADLER, A. M. SCHARENBERG, and R. PENNER et al., 2003 TRPM7 provides an ion channel mechanism for cellular entry of trace metal ions. J. Gen. Physiol. 121:49-60.
MONTELL, C., L. BIRNBAUMER, and V. FLOCKERZI, 2002a The TRP channels, a remarkably functional family. Cell 108:595-598.[Medline]
MONTELL, C., L. BIRNBAUMER, V. FLOCKERZI, R. J. BINDELS, and E. A. BRUFORD et al., 2002b A unified nomenclature for the superfamily of TRP cation channels. Mol. Cell 9:229-231.[Medline]
NADLER, M. J., M. C. HERMOSURA, K. INABE, A. L. PERRAUD, and Q. ZHU et al., 2001 LTRPC7 is a Mg.ATP-regulated divalent cation channel required for cell viability. Nature 411:590-595.[Medline]
NAKAYAMA, T., T. YAOI, M. YASUI, and G. KUWAJIMA, 1998 N-copine: a novel two C2-domain-containing protein with neuronal activity-regulated expression. FEBS Lett. 428:80-84.[Medline]
PEIER, A. M., A. MOQRICH, A. C. HERGARDEN, A. J. REEVE, and D. A. ANDERSSON et al., 2002 A TRP channel that senses cold stimuli and menthol. Cell 108:705-715.[Medline]
PERRAUD, A. L., A. FLEIG, C. A. DUNN, L. A. BAGLEY, and P. LAUNAY et al., 2001 ADP-ribose gating of the calcium-permeable LTRPC2 channel revealed by Nudix motif homology. Nature 411:595-599.[Medline]
RIZO, J. and T. C. SUDHOF, 1998 C2-domains, structure and function of a universal Ca2+-binding domain. J. Biol. Chem. 273:15879-15882.
ROGALSKI, T. M., D. G. MOERMAN, and D. L. BAILLIE, 1982 Essential genes and deficiencies in the unc-22 IV region of Caenorhabditis elegans.. Genetics 102:725-736.
RUNNELS, L. W., L. YUE, and D. E. CLAPHAM, 2001 TRP-PLIK, a bifunctional protein with kinase and ion channel activities. Science 291:1043-1047.
SCHLINGMANN, K. P., S. WEBER, M. PETERS, L. NIEMANN NEJSUM, and H. VITZTHUM et al., 2002 Hypomagnesemia with secondary hypocalcemia is caused by mutations in TRPM6, a new member of the TRPM gene family. Nat. Genet. 31:166-170.[Medline]
SULSTON, J., and J. HODGKIN, 1988 Methods, pp. 587606 in The Nematode Caenorhabditis elegans, edited by W. WOOD and the COMMUNITY OF C. ELEGANS RESEARCHERS. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
SUN, A. Y. and E. J. LAMBIE, 1997 gon-2, a gene required for gonadogenesis in Caenorhabditis elegans.. Genetics 147:1077-1089.[Abstract]
TAKUWA, N., W. ZHOU, and Y. TAKUWA, 1995 Calcium, calmodulin and cell cycle progression. Cell. Signal. 7:93-104.[Medline]
TOMSIG, J. L. and C. E. CREUTZ, 2000 Biochemical characterization of copine: a ubiquitous Ca2+-dependent, phospholipid-binding protein. Biochemistry 39:16163-16175.[Medline]
TREININ, M. and M. CHALFIE, 1995 A mutated acetylcholine receptor subunit causes neuronal degeneration in C. elegans.. Neuron 14:871-877.[Medline]
WALDER, R. Y., D. LANDAU, P. MEYER, H. SHALEV, and M. TSOLIA et al., 2002 Mutation of TRPM6 causes familial hypomagnesemia with secondary hypocalcemia. Nat. Genet. 31:171-174.[Medline]
WEST, R. J., A. Y. SUN, D. L. CHURCH, and E. J. LAMBIE, 2001 The C. elegans gon-2 gene encodes a putative TRP cation channel protein required for mitotic cell cycle progression. Gene 266:103-110.[Medline]
WOLF, F. I. and A. CITTADINI, 1999 Magnesium in cell proliferation and differentiation. Front. Biosci. 4:D607-D617.[Medline]
XU, X. Z., F. MOEBIUS, D. L. GILL, and C. MONTELL, 2001 Regulation of melastatin, a TRP-related protein, through interaction with a cytoplasmic isoform. Proc. Natl. Acad. Sci. USA 98:10692-10697.
This article has been cited by other articles:
![]() |
B. J. Kemp, D. L. Church, J. Hatzold, B. Conradt, and E. J. Lambie gem-1 Encodes an SLC16 Monocarboxylate Transporter-Related Protein That Functions in Parallel to the gon-2 TRPM Channel During Gonad Development in Caenorhabditis elegans Genetics, February 1, 2009; 181(2): 581 - 591. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Xing, X. Yan, A. Estevez, and K. Strange Highly Ca2+-selective TRPM Channels Regulate IP3-dependent Oscillatory Ca2+ Signaling in the C. elegans Intestine J. Gen. Physiol., February 25, 2008; 131(3): 245 - 255. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. K. Damer, M. Bayeva, P. S. Kim, L. K. Ho, E. S. Eberhardt, C. I. Socec, J. S. Lee, E. A. Bruce, A. E. Goldman-Yassen, and L. C. Naliboff Copine A Is Required for Cytokinesis, Contractile Vacuole Function, and Development in Dictyostelium Eukaryot. Cell, March 1, 2007; 6(3): 430 - 442. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Church, D. L.
- Articles by Lambie, E. J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Church, D. L.
- Articles by Lambie, E. J.








