The Promotion of Gonadal Cell Divisions by the Caenorhabditis elegans TRPM Cation Channel GON-2 Is Antagonized by GEM-4 Copine

Corresponding author: Eric J. Lambie, Department of Biological Sciences, Dartmouth College, Hanover, NH 03755., eric.j.lambie{at}dartmouth.edu (E-mail)

Communicating editor: P. ANDERSON

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

The initiation of postembryonic cell divisions by the gonadal precursors of C. elegans requires the activity of gon-2. gon-2 encodes a predicted cation channel (GON-2) of the TRPM subfamily of TRP proteins and is likely to mediate the influx of Ca²⁺ and/or Mg²⁺. We report here that mutations in gem-4 (gon-2 extragenic modifier) are capable of suppressing loss-of-function alleles of gon-2. gem-4 encodes a member of the copine family of Ca²⁺-dependent phosphatidylserine binding proteins. Overall, our data indicate that GEM-4 antagonizes GON-2. This antagonism could be mediated by a direct inhibition of GON-2 by GEM-4, since both proteins are predicted to be localized to the plasma membrane. Alternatively, GEM-4 could affect GON-2 activity levels by either promoting endocytosis or inhibiting exocytosis of vesicles that carry GON-2. It is also possible that GEM-4 and GON-2 act in parallel to each other. Mutation of gem-4 does not suppress the gonadal defects produced by inactivation of gon-4, suggesting that gon-4 either acts downstream of gem-4 and gon-2 or acts in a parallel regulatory pathway.

THE gonad of the nematode Caenorhabditis elegans is derived from four postembryonic blast cells that initiate divisions several hours after the larva hatches from the egg (KIMBLE and HIRSH 1979 ). These divisions require the activity of GON-2, a predicted cation channel of the TRPM (M for melastatin) subfamily of TRP proteins (DUNCAN et al. 1998 ; WEST et al. 2001 ; MONTELL et al. 2002B ), the founding member of this subgroup.

TRPM proteins are similar to other TRPs in that they have a cluster of six plasma-membrane-spanning segments; however, unlike other TRP proteins, TRPMs have a relatively large C-terminal cytoplasmic domain and lack ankyrin repeats in the N-terminal cytoplasmic domain (MONTELL et al. 2002A ). The C-terminal portion of TRPM2 has an ADP-ribose pyrophosphatase domain (PERRAUD et al. 2001 ) and the C-terminal cytoplasmic segment of TRPM7 has a protein kinase domain (NADLER et al. 2001 ; RUNNELS et al. 2001 ). Other TRPM channels, e.g., GON-2 and melastatin, have no apparent enzymatic domains. Some TRPM channels function as nonselective cation channels, whereas others are relatively selective for divalent cations (MONTELL et al. 2002A ). In addition to Ca²⁺, certain TRPM channels are also permeable to other physiologically important divalent cations, such as Mg²⁺, Zn²⁺, Mn²⁺, and Co²⁺ (NADLER et al. 2001 ; SCHLINGMANN et al. 2002 ; WALDER et al. 2002 ; MONTEILH-ZOLLER et al. 2003 ). The activity of different TRPM channels may be regulated by diverse factors, including phosphorylation (RUNNELS et al. 2001 ), Mg²⁺-ATP (NADLER et al. 2001 ), Ca²⁺ (MCHUGH et al. 2003 ), cold temperature (PEIER et al. 2002 ), ADP-ribose (PERRAUD et al. 2001 ), and cellular redox state (HEINER et al. 2003 ). In the case of melastatin, the channel is constitutively active and may be regulated at the level of translocation to the plasma membrane (XU et al. 2001 ). TRPM channel activity can affect a range of different cellular functions, depending on channel identity and cell type. Most notably with respect to this study, inactivation of TRPM7 in tissue culture cells leads to growth arrest and cell death (NADLER et al. 2001 ).

It is not known how GON-2 activity is regulated or how its activity regulates the divisions of the gonadal precursor cells. We previously found that gon-2 mRNA is not restricted to the gonad; however, we were not able to determine whether gon-2 is expressed within the somatic gonadal cells (WEST et al. 2001 ). Our working model is that GON-2 is expressed within the gonadal precursors and that it responds to developmental signals by allowing the influx of divalent cations, most likely Ca²⁺ and Mg²⁺ (NADLER et al. 2001 ; SCHLINGMANN et al. 2002 ; WALDER et al. 2002 ), which then promote cell cycle progression (TAKUWA et al. 1995 ; WOLF and CITTADINI 1999 ).

To identify potential regulators of gon-2, we performed a screen for extragenic modifiers of the temperature-sensitive allele, gon-2(q388). One of the genes that we identified in this screen is gem-4 (gon-2 extragenic modifier), which encodes a member of the copine family of cytoplasmic, Ca²⁺-dependent phosphatidylserine binding proteins (CREUTZ et al. 1998 ; NAKAYAMA et al. 1998 ). Little is known about the biological functions of copines. However, loss-of-function mutations have recently been reported for the Arabidopsis copine gene BON1/CPN1 (HUA et al. 2001 ; JAMBUNATHAN et al. 2001 ). Mutant plants exhibit cold-sensitive dwarfism due to a combination of reduced cell number and smaller cell size (HUA et al. 2001 ). The basis for this phenotype is not known, although it could result from a defect in vesicle transport or fusion. BON1/CPN1 mutants also exhibit humidity-sensitive precocious cell death and increased pathogen resistance (JAMBUNATHAN et al. 2001 ); these abnormalities could result from elevated levels of intracellular calcium.

In this article, we present results indicating that the inactivation of gem-4 copine can suppress the effects of a reduction in gon-2 TRPM activity, but cannot suppress the complete inactivation of gon-2 TRPM. These data suggest that gem-4(+) acts as an antagonist of gon-2(+). Such antagonism could be mediated by a direct interaction between the two proteins, or it could be that GON-2 and GEM-4 act in parallel to regulate the divisions of the gonadal precursors.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Worm culture methods:
Nematodes were grown in petri dishes or 12-well microtiter plates using Escherichia coli as a food source, essentially as described by BRENNER 1974 . NGM-lite was used as the growth medium (SUN and LAMBIE 1997 ), and E. coli strain AMA1004 (CASADABAN et al. 1993 ) as the food source.

Microscopy and imaging:
Live nematodes were viewed and photographed as described by SUN and LAMBIE 1997 , except that an MTI RC300 CCCD camera was used to integrate images.

Nematode strains:
The wild-type N2 background was used in all experiments except the single nucleotide polymorphism (SNP) mapping, which also utilized the wild-type strain CB4856 (HODGKIN and DONIACH 1997 ). Strain construction and genetic analyses were done using standard methods (SULSTON and HODGKIN 1988 ).

The following mutations and rearrangements were used (described by HODGKIN 1997 ), unless stated otherwise).

• Mutations: I: gon-2(q388), gon-2(dx58) (WEST et al. 2001 ), unc-29(e1072); IV: unc-24(e138), him-8(e1489), dpy-20(e1282), let-60(s1124), let-92(s504), unc-22(s7), unc-31(e169).

• Chromosomal aberrations: sDf7 IV (MOERMAN and BAILLIE 1981 ), sDf8 IV (ROGALSKI et al. 1982 ), nT1[let-?] IV; nT1[deg-3(u662)] V (referred to here as DnT1) (FERGUSON and HORVITZ 1985 ; TREININ and CHALFIE 1995 ), hT2[bli-4(e937)] I; hT2[dpy-18(e364)] III.

Isolation of mutant alleles of gem-4:
To identify extragenic modifiers of gon-2 (specifically, suppressors), we mutagenized hermaphrodites of genotype gon-2(q388) unc-29(e1072) and plated them in groups to produce F₁ progeny at permissive temperature. Mutagenesis conditions for UV and EMS was as previously described by CHURCH et al. 1995 and BRENNER 1974 , respectively. The F₁ progeny were expected to include animals of genotype gem/+ (gon-2 extragenic modifier) at low frequency. Once the ensuing generation of F₂ progeny began to lay eggs, the plates were shifted to 23.5°. We used 23.5°, because gon-2(q388) retains a low level of residual function at this temperature, allowing the possibility of identifying upstream regulators of gon-2. At this point in the procedure, some of the F₃ progeny should have progressed beyond the temperature-sensitive period for gon-2(q388) (SUN and LAMBIE 1997 ), so even if a suppressor mutation were recessive and maternally rescued, some of the gem/gem F₃ animals would be expected to be fertile. Plates were permitted to overgrow, and then 15% of the total progeny were transferred to a new plate, which was again incubated at 23.5°. This procedure was repeated four or five times and then each plate was inspected for the presence of relatively large numbers of fertile animals. Since q388 is not fully penetrant at 23.5°, even stocks that do not carry suppressor mutations continue to propagate through multiple passages. Therefore, at this point, several fertile individuals were cloned from each plate and tested for their ability to produce a high fraction of non-Gon progeny at 23.5°.

Initial characterization of gem mutations:
All mutations were outcrossed to gon-2(q388); him-8(e1489) males to test for dominance and sex linkage. Subsequent segregation of the gem mutation relative to unc-29(e1072) and him-8(e1489) was used to assess linkage to chromosomes I and IV, respectively. Four mutations exhibited linkage to him-8, and these mutations all fell into the same complementation group, which we designated gem-4. Characterization of the other suppressor mutations will be described elsewhere.

Mapping of gem-4:
We used conventional three-factor mapping to localize gem-4 on chromosome IV (Fig 1). Among the progeny of hermaphrodites of genotype gon-2(q388); unc-24(e138) dpy-20(e1282)/gem-4(dx77), 0/22 Dpy non-Uncs and 29/29 Unc non-Dpys segregated gem-4(dx77). Therefore, gem-4 is probably to the right of dpy-20. Among progeny of hermaphrodites of genotype gon-2(q388); let-60(s1124) unc-22(s7) unc-31(e169)/gem-4(dx77), 4/6 Unc-22 non-Lets segregated gem-4(dx77). Therefore, gem-4 is between let-60 and unc-22.

View larger version (24K): In this window In a new window Download PPT slide   Figure 1. Map location of gem-4. (Top) The portion of chromosome IV near the gem-4 locus. Map positions are from the genetic map of C. elegans (J. HODGKIN and S. MARTINELLI, personal communication). Cosmids are indicated below the genetic map; positions are based on COULSON 1996 and C. ELEGANS SEQUENCING CONSORTIUM (1998). (Bottom) The intron/exon structure of the gem-4 transcript (exons solid). The 5' end of the gem-4 cDNA begins with the SL1 trans-spliced leader sequence, GGTTTAATTACCCAAGTTTGAG, followed by the sequence AAAAAAACACAAAAAATG, where ATG is the initiation codon for gem-4. The 3' end of the gem-4 cDNA ends with AATAAAGTTTGAACGGG, followed by the poly(A) tail, where AATAAA is the probable cleavage and polyadenylation sequence.

We identified an SNP within the predicted gene, F38H4.9, and used this to sublocalize gem-4 within the let-60-unc-22 interval, as described by JAKUBOWSKI and KORNFELD 1999 . This was done by constructing a strain of genotype gon-2(q388); gem-4(dx77) unc-22(s7)/CB4856 and isolating six independent Gem non-Unc progeny. Among the six recombinant chromosomes, two had undergone recombination in the 150-kb interval between let-60 and F38H4.9 and four had undergone recombination in the 130-kb interval between F38H4.9 and unc-22 (Fig 1). This placed gem-4 to the left of F38H4.9 in the vicinity of cosmid T12A7.

Transformation:
Standard methods were used to generate and maintain transgenic nematode stocks by coinjection of sample DNAs with plasmid pRF4, which contains the dominant rol-6(su1006) marker (MELLO et al. 1991 ).

Defecation cycle:
Hermaphrodites were raised at 19.5° on uncrowded plates and scored as young adults. Three consecutive defecation cycles were timed for each of five hermaphrodites and standard deviations for each group of animals were calculated using Microsoft Excel.

Plasmid construction:
Cosmid T28C1 (which overlaps T12A7, Fig 1) was digested with BamHI and shotgun cloned into pGem7Zf(+) (Promega, Madison, WI), which had been cut with BamHI and dephosphorylated with calf intestinal phosphatase (New England Biolabs, Beverly, MA). PCR was used to identify clones that had the correct insert (an 8574-bp BamHI fragment with 2157 bp upstream of the gem-4 ATG and 3054 bp downstream of the gem-4 TAG). There are two NdeI cleavage sites in this plasmid (pG41), one of which is ideally situated for creating a C-terminal translational fusion (2 bp upstream of the gem-4 TAG codon). Therefore, pG41 was partially digested with NdeI and linear molecules were isolated by agarose gel electrophoresis, followed by QIAquick (QIAGEN, Chatsworth, CA) purification. Linearized pG41 was ligated with an excess of annealed oligonucleotides o478 (TATCCCGTACGG CGGCCGC) and o479 (TAGCGGCCGCCGTACGGGA). Restriction digests and DNA sequencing were used to identify a plasmid in which the adapter was ligated into the desired NdeI site. The resulting plasmid (pG42) contains unique BsiWI and NotI sites immediately upstream of the gem-4 TAG codon. Primers o481 (AGATCGACGTACGGAGTAAAGGAGAAGAACTTTTC) and o467 (CCCTGCAGGGCGGCCGCCGTACGATGCA) were used to amplify green fluorescent protein (GFP) by PCR, using plasmid L3929 as the template (kindly supplied by A. Fire, Carnegie Institute of Washington). The PCR product was purified using a QIAquick column and digested with BsiWI and NotI and ligated into plasmid pG42, cut with the same enzymes. In the resulting plasmid (pG43), the coding sequence for the terminal V of gem-4 is replaced by PVR, followed by GFP, and then the gem-4 3' flanking sequences.

cDNA isolation:
RNA was purified from mixed-stage worms using Trizol (GIBCO/Bethesda Research Laboratories). RT-PCR was performed according to the manufacturer's instructions (Invitrogen, San Diego) to determine the 5' end and the intron/exon structure of the gem-4 mRNA. We used PCR to amplify the 3' end of gem-4 from a cDNA library kindly supplied by R. Barstead (BARSTEAD and WATERSTON 1989 ).

DNA sequencing:
PCR was used to amplify 1-kb segments of gem-4 genomic DNA, plasmids, or cDNAs for sequencing. These were processed using the BigDye cycle sequencing kit (Applied Biosystems, Foster City, CA) and analyzed by the Dartmouth Molecular Biology Core Facility. Mutant alleles of gem-4 were sequenced on both strands to confirm their identity.

RNAi experiments:
An 850-bp segment of the gem-4 cDNA was PCR amplified using primers o512 (GCTAATACGACTCACTATAGGGCTGAACGAGGACGAACTGAA) and o513 (GCTAATACGACTCACTATAGGGTGCAAAGATCCAGGTGTTCG). The first 22 nucleotides (nt) of each primer contains the promoter for T7 RNA polymerase. A 749-bp fragment of genomic DNA corresponding to F26D10.4 was amplified using primers o532 (TAATACGACTCACTATAGGATCCGTGCTATCCATTTGCC) and o533 (TAATACGACTCACTATAGGCTTCCAGTCCCATCTAGAATC). This segment contains exons of 343 and 350 bp in size. The first 19 nt of each of these primers corresponds to the T7 promoter. A 1456-bp segment of the gon-2 cDNA was amplified using primers o344 AATACGACTCACTATACGCGTCGAAGATGTGATTG and o149 AATACGACTCACTATAATCTATGGCATGGTGGTCTT. The first 16 bp of each of these primers contains the T7 promoter. An 873-bp fragment of gon-4 coding sequence was amplified from genomic DNA using primers o592 TAATACGACTCACTATAGGCTTAATGGTGGTCTAGAATTG and o591 TAATACGACTCACTATAGGCCCGATGAAGCTCAGTACG. The first 19 nt of each of these primers corresponds to the T7 promoter.

The Megascript kit (Ambion, Austin, TX) was used to generate double-stranded RNA (dsRNA) corresponding to gem-4, gon-2, gon-4, and F26D10.4. In each case, 1 µg of double-strand template DNA was added to the transcription reaction, which was run for 7 hr at 37°. Transcription efficiency was monitored by running an aliquot of the reaction on an agarose gel and staining with ethidium bromide. dsRNAs were heated to 60° for 10 min, cooled to room temperature, and then injected into the intestine and/or pseudocoelomic cavity of adult hermaphrodites at an estimated concentration of 1 µg/µl. Groups of injected animals were incubated on the same plate for at least 8 hr and then transferred to individual plates or multiwells for scoring of offspring.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Identification of gem-4:
To identify genes that interact with gon-2, we screened for revertants of the sterile phenotype of gon-2(q388). These screens resulted in the identification of 25 UV-induced suppressors and 16 EMS-induced suppressors. The total number of genomes screened was 10⁶ for UV and 5.6 x 10⁵ for EMS. However, the efficiency of recovery of suppressor mutations is not likely to be 100%, so the actual frequency of mutations is probably higher than the 2.5 x 10^-5 estimate provided by these data.

Initial outcrosses revealed that four of the mutations (dx63 and dx97, UV; dx74 and dx77, EMS) were recessive and showed linkage to him-8 IV. These four mutations represent a single complementation group, which we designated gem-4.

Characterization of gem-4 alleles:
Each of the mutant alleles of gem-4 exhibits a moderately high level of suppression of gon-2(q388), is fully recessive to wild type, and is not maternally rescued (Table 1). We arbitrarily chose gem-4(dx77) for most of our further characterization.

Suppression is not specific to gon-2(q388), since gem-4(dx77) is also capable of suppressing another missense mutant, gon-2(dx58) (Table 2). The efficiency of suppression of gon-2(dx58) by gem-4(dx77) is similar at 15°, 19.5°, and 23.5°, indicating that gem-4(dx77) is not a temperature-sensitive allele.

gem-4(dx77) is capable of suppressing a reduction of gon-2 activity mediated by RNAi (Table 3). However, the frequency of gonadless (Gon) animals produced by gon-2(RNAi) in a wild-type background is lower than that seen in gon-2(q388) mutant individuals. This indicates that gon-2(RNAi) does not fully eliminate gon-2(+) activity. To reduce gon-2 activity to a negligible level, we performed gon-2(RNAi) in a gon-2(q388) background at the restrictive temperature for gon-2(q388). In these animals, no suppression by gem-4(dx77) was observed. Therefore, suppression by gem-4(dx77) requires that the level of gon-2(+) activity be above a certain threshold.

sDf7 and sDf8 are both predicted to remove the gem-4 locus (MOERMAN and BAILLIE 1981 ; ROGALSKI et al. 1982 ). We found that gem-4(dx77)/sDf7 animals exhibit efficient suppression of gon-2(q388), although it is somewhat less than that seen in gem-4(dx77) homozygotes. Possibly there is a haplo-insufficient locus within the deleted region that accounts for this difference. No suppression was observed in gem-4(dx77)/sDf8 animals. Subsequent PCR analyses using gem-4-specific primers revealed that the gem-4 locus is deleted by sD7, but not by sDf8 (data not shown). Therefore, the gem-4(dx77)/sDf7 results are consistent with the idea that gem-4(dx77) is a loss-of-function allele.

Mapping and cloning gem-4:
We used a combination of conventional three-factor mapping and SNP mapping to narrow the location of gem-4 to a position midway between let-60 and unc-22 (Fig 1). By assaying cosmids within this interval for their ability to rescue suppression by gem-4(dx77), we determined that gem-4 is located on cosmid T28C1 (Table 4). The overlapping cosmid, T12A7, contains a predicted gene (T12A7.1) that has two calcium-binding C2 motifs. Since this was a prime candidate for gem-4, we sequenced the coding regions of T12A7.1 to search for mutations corresponding to mutant alleles of gem-4. In each case, we found a single G A mutation within the coding region for T12A7.1 (Fig 1; see below). Therefore, we conclude that gem-4 corresponds to T12A7.1.

We used RT-PCR to amplify and sequence the 5' end and internal coding region of the gem-4 transcript. Our results match the intron/exon structure of T12A7.1 described in GenBank. We verified the 3' end of gem-4 by PCR amplification and sequencing of cDNA from an oligo(dT)-primed library supplied by R. Barstead (BARSTEAD and WATERSTON 1989 ). It has been suggested that T12A7.1 may be the first gene in an operon consisting of T12A7.1, T12A7.6, and T12A7.7 (BLUMENTHAL et al. 2002 ). T12A7.6 is a novel gene, and T12A7.7 has similarity to G-protein-coupled receptors (WormBase website, http://www.wormbase.org, release WS96, 3/5/03). However, T12A7.6 is trans-spliced to SL1, which is atypical of downstream genes in C. elegans operons (WormBase website, http://www.wormbase.org, release WS96, 3/5/03).

gem-4 encodes a copine:
GEM-4 is highly similar to three human proteins, copine I, copine III, and KIA1599 (>40% identity over 590 residues; Fig 2). Within the C. elegans genome, GEM-4 is most similar to another predicted C. elegans gene, F26D10.4 (73% identity over 637 residues). At least three other copine family members, with lower degrees of similarity, are also present in the C. elegans genome.

View larger version (89K): In this window In a new window Download PPT slide   Figure 2. Predicted amino acid sequence of GEM-4 and other copines. Full-length proteins were compared using the PILEUP program of the UWGCG software package. Shading was done using BOXSHADE, with identical residues shaded in black and similar residues in gray. Conserved transmembrane domains S1–S6 are indicated. Residues affected by mutations in gem-4 are indicated with an asterisk and the nature of the predicted amino acid alteration. dx77 is predicted to result in the insertion of "INLKLFSNFKIYNFQ" after proline 286. COP1, human copine I (AAH01142); COP3, human copine III (O75131); KIAA1599 (Q9HCH3); F26D10.4 is also known as T28F3.1 (Q9XUB9); GEM-4 is T12A7.1 (NP_502225).

All copines have two 130-amino-acid (aa) C2 domains in the N-terminal half of the protein (CREUTZ et al. 1998 ; NAKAYAMA et al. 1998 ). C2 domains are found in many different proteins and typically mediate binding to Ca²⁺ (RIZO and SUDHOF 1998 ). The C-terminal half of copine proteins contains an A domain of 200 aa that has similarity to the Mg²⁺-binding domain of integrins (CREUTZ et al. 1998 ; NAKAYAMA et al. 1998 ).

Mutant alleles of gem-4:
Each of the mutant alleles of gem-4 that we identified alters the predicted protein coding sequence (Fig 1 and Fig 2). dx74 and dx63 alter different glycine residues, each of which is adjacent to a potential serine/threonine phosphorylation site that is conserved among the metazoan relatives of GEM-4 (but absent from Arabidopsis BON1). dx74 is between the two C2 domains, while dx63 is near the end of the second C2 domain (C2B). gem-4(dx77) alters a splice site upstream of intron 5. We used RT-PCR to examine the splicing pattern in gem-4(dx77) animals and found that intron 5 is retained within the resulting mRNA. Since this intron is 45 nt in length and contains no stop codons within the GEM-4 reading frame, dx77 is predicted to result in a 15-amino-acid insertion, beginning after P286. This insertion is likely to disrupt C2B function. dx97 causes a E K substitution in the C-terminal portion of GEM-4, adjacent to the A domain. Although this region is conserved among the various copines, no function has been ascribed to this portion of the protein.

gem-4::GFP expression pattern:
To determine when and where gem-4 is expressed during C. elegans development, we fused the coding sequence of GFP to the 3' end of the coding sequence of GEM-4 and generated transgenic animals carrying this construct. We examined the expression and localization of GEM-4::GFP in three different backgrounds: wild type (N2), gon-2(q388); gem-4(dx77), and gon-2(q388). No obvious differences in expression pattern were observed in these different backgrounds (data not shown).

The gem-4::GFP reporter gene complements gem-4(dx77) just as efficiently as the cosmid T28C1, suggesting that the fusion protein is expressed and functions within the tissues within which GEM-4 normally acts (Table 4). In cells that express GEM-4::GFP, fluorescence is typically brightest at the plasma membrane. In some cases, punctate staining is also evident within the cytoplasm, possibly due to association with vesicular structures (Fig 3). We have not systematically examined the embryonic expression pattern; however, GEM-4::GFP is broadly expressed in embryos that have several hundred cells and continues to be expressed in most cells as the embryo undergoes elongation (Fig 4).

View larger version (86K): In this window In a new window Download PPT slide   Figure 3. Punctate expression of GEM-4::GFP. (A) Differential interference contrast (DIC) image of the head mesodermal cell (nucleus indicated) in an adult animal of genotype gon-2(q388); gem-4(dx77); dxEx15[gem-4::GFP; pRF4]. (B) GFP fluorescence of the same field. GEM-4::GFP outlines the plasma membrane of the head mesodermal cell (hmc) and is also present as multiple discrete puncta (only one is distinct in this focal plane). Bar, 5 µm.

View larger version (124K): In this window In a new window Download PPT slide   Figure 4. Embryonic expression of GEM-4::GFP. (A and B) Midstage embryo, prior to morphogenesis. (C and D) Comma stage embryo. Both embryos have genotype gon-2(q388); gem-4(dx77); dxEx15[gem-4::GFP; pRF4]. DIC is shown in A and C, GFP fluorescence in B and D. Anterior is to the left, dorsal is up (dorsal/ventral not determined in A and B). Bar, 10 µm.

In newly hatched L1s, GEM-4::GFP is expressed in the precursors of the somatic gonad (Z1 and Z4), the pharyngeal/intestinal valve cells, the intestinal cells, and the head mesodermal cell (the sister of Z4; Fig 4 and Fig 5). The germline precursors, Z2 and Z3, also appear to be outlined in some animals (Fig 5); however, it is not clear whether this is due to expression within the germ cells themselves or whether it results from extensions of the plasma membranes of Z1 and Z4.

View larger version (167K): In this window In a new window Download PPT slide   Figure 5. Expression of GEM-4::GFP in L1 larvae. (A and B) DIC and GFP fluorescence images of an early L1 stage animal of genotype gon-2(q388); gem-4(dx77); dxEx15[gem-4::GFP; pRF4] raised at 15° [permissive temperature for gon-2(q388)]. (C and D) DIC and GFP fluorescence images of an early L1 stage animal of genotype gon-2(q388); dxEx15[gem-4::GFP; pRF4] raised at 25° [restrictive temperature for gon-2(q388)]. gem-4::GFP is also localized to the intestinal brush border (bb). The granular/globular fluorescence in B and D is due to autofluorescence of gut granules. Bar, 10 µm.

Localization of GEM-4::GFP to the plasma membrane is not dependent on gon-2 activity, since this is not altered at restrictive temperature in animals of background genotype gon-2(q388); gem-4(dx77) or gon-2(q388) (Fig 5). Expression of GEM-4::GFP within Z1 and Z4 becomes progressively more difficult to detect as the animals progress through L1 and is not detectable within the progeny of Z1 and Z4. GEM-4::GFP expression within somatic gonadal tissues does not resume until early adulthood. At this point, GEM-4::GFP becomes strongly expressed within the distal spermathecal cells, the spermathecal valve cells, and the uterine epithelial cells (Fig 6).

View larger version (146K): In this window In a new window Download PPT slide   Figure 6. Expression of GEM-4::GFP in late L4. (A and B) DIC and GFP images of a late-L4-stage hermaphrodite of genotype gon-2(q388); gem-4(dx77); dxEx15[gem-4::GFP; pRF4]. Expression of GEM-4::GFP is evident within cells of the distal (d) and proximal (p) spermatheca (spth), uterus (ut), intestine (int), and coelomocytes (cc). The punctate fluorescence in the intestine is due to autofluorescent gut granules. Bar, 10 µm.

gem-4(dx77) and gem-4(dx74) have no apparent phenotype in a wild-type background:
We outcrossed gem-4(dx74) and gem-4(dx77) to determine whether these mutations produce any mutant phenotypes in a gon-2(+) background. However, neither strain is obviously different from wild type in terms of growth rate, gonad development, behavior, or dependence of gonadal cell divisions on the availability of food (data not shown). We determined brood sizes among animals raised at either 15° or 23.5°. At 15°, we found that the brood sizes for N2 (mean 265, SD 29, n = 3) and gem-4(dx77) (mean 240, SD 25, n = 4) were similar, whereas that for gem-4(dx74) was somewhat lower (mean 162, SD 58, n = 4). We obtained similar results for brood sizes at 23.5°: N2, mean 233, SD 65, n = 4; gem-4(dx77), mean 253, SD 37, n = 4; gem-4(dx74), mean 173, SD 43, n = 4. The relatively low fecundity of the gem-4(dx74) strain may be due to a mutation in a separate gene that was not removed during outcrossing of the mutagenized stock.

Since gem-4 is implicated in the regulation of calcium-mediated signaling, and calcium levels within the intestinal cells are known to regulate the defecation cycle (DAL SANTO et al. 1999 ), we compared the periodicity of defecation in gem-4(dx74) and gem-4(dx77) animals with N2 individuals grown in parallel. Very similar periodicities were observed in each case: N2, 48.9 sec, SD 3.2; gem-4(dx74), 49.8 sec, SD 3.2; gem-4(dx77), 51.0 sec, SD 3.5. We also examined the defecation cycle of animals of genotype gon-2(q388) and gon-2(q388); gem-4(dx77) and found no apparent difference between these animals and wild-type controls (data not shown).

Inactivation of gem-4 by RNAi:
We used RNAi to determine whether reducing the level of gem-4 activity is sufficient to suppress gon-2(q388). gem-4(RNAi) suppresses gon-2(q388) nearly as efficiently as the mutant alleles of gem-4 (Table 5). To assess the efficacy of the RNAi treatment, we also tested animals carrying an extrachromosomal array that contains gem-4::GFP. In nearly all of these animals GFP fluorescence was either eliminated or greatly reduced. In addition, the rescuing effects of GEM-4::GFP were severely attenuated by gem-4(RNAi) (Table 5).

We also tested whether gem-4(RNAi) would enhance the suppression of gon-2(q388) by gem-4(dx77) or cause a detectable phenotype in animals of genotype gem-4(dx77). gem-4(RNAi) had no discernible effect in either experiment, suggesting that gem-4(dx77) is a strong loss-of-function allele (Table 5).

To investigate the possibility that gem-4 is functionally redundant to F26D10.4, we also examined the effects of F26D10.4(RNAi). F26D10.4(RNAi) weakly suppressed gon-2(q388), but did not alter the penetrance of suppression of gon-2(q388) by gem-4(dx77) or produce any obvious effects in a wild-type background (Table 6). We suspect that the weak suppressive effect of F26D10.4(RNAi) may be due to cross-inactivation of gem-4, because several 30-nt stretches of 90% identity between gem-4 and F26D10.4 are present within the region that was used to generate the double-stranded RNA. HUANG et al. 2002 have reported that this degree of similarity can be sufficient to cause significant RNAi effects.

gem-4(dx77) does not suppress the effects of inactivation of gon-4:
The gon-4 gene encodes a large nuclearly localized protein whose function is important for the initial divisions of the gonadal precursors (FRIEDMAN et al. 2000 ). To investigate the possibility that gem-4(-) might be able to suppress the effect of inactivation of gon-4, we compared the effects of gon-4(RNAi) in gem-4(+) and gem-4(dx77) genetic backgrounds. We found no evidence of suppression. Among the progeny of injected gem-4(dx77) hermaphrodites, 50% (n = 942, from 14 injected animals) exhibited gonadal defects typical of gon-4 inactivation (ranging from vulvaless with little gonadal tissue to Egl), whereas 36% of the progeny of injected gem-4(+) hermaphrodites exhibited such defects (n = 631, from 7 injected animals). The intermediate penetrance of the Gon-4 phenotypes indicates that gon-4 activity was not completely eliminated by the RNAi treatment. Therefore, suppression by gem-4(dx77) should have been detectable, even if gem-4(dx77) cannot suppress gon-4(0). Furthermore, dead eggs and L1 lethal progeny were often observed in the latter part of the broods of injected animals, suggesting that a severe reduction in gon-4 activity can cause more extreme developmental defects. The absence of embryonic lethals and L1 lethals among the progeny of gon-4(0)/+ hermaphrodites (FRIEDMAN et al. 2000 ) is probably due to maternal rescue by gon-4(+).

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

In our screen for genes that interact with gon-2, we identified four mutant alleles of the gem-4 locus. Several lines of evidence suggest that these are strong loss-of-function alleles of gem-4. First, each mutant allele is recessive to wild type. Second, gem-4(dx77) fails to complement the deficiency, sDf7. Third, gem-4(RNAi) suppresses gon-2(q388) nearly as effectively as the mutant alleles of gem-4. Fourth, the degree of suppression of gon-2(q388) by gem-4(dx77) is not altered when combined with gem-4(RNAi).

gem-4 encodes a member of the copine family of Ca²⁺-binding proteins (CREUTZ et al. 1998 ; NAKAYAMA et al. 1998 ). Copines have two C2 domains in the N-terminal portion of the protein that mediate Ca²⁺-dependent binding to phosphatidylserine-containing membranes (CREUTZ et al. 1998 ; TOMSIG and CREUTZ 2000 ). Copines also have an A domain in the C-terminal portion; this region has been proposed to bind Mg²⁺ and may have kinase activity (CAUDELL et al. 2000 ). Three of our mutant alleles affect the portion of GEM-4 that contains the C2 domains, and the fourth allele is adjacent to the A domain. These results are consistent with the expectation that both of these regions are important for normal copine function.

We found that GEM-4::GFP is constitutively localized to the plasma membrane in all cells that express the fusion protein, regardless of the activity state of gon-2 (and therefore possibly not dependent on high levels of intracellular calcium). This could be an artifact due to the GFP fusion or an unusually high level of protein expressed from the extrachromosomal array. However, Ca²⁺ is not essential for copines to bind to lipid membranes composed of phosphatidic acid (TOMSIG and CREUTZ 2000 ) or plasma membranes isolated from Arabidopsis cells (HUA et al. 2001 ). Furthermore, HUA et al. 2001 found that a BON1::GFP fusion protein was constitutively localized to the plasma membrane in transfected leaf protoplasts.

Mutation of the Arabidopsis copine gene, BON1/CPN1, causes a cold-sensitive growth defect, suggesting the possibility that copines are generally required for membrane fusion events at relatively low temperatures (HUA et al. 2001 ). Our data do not provide support for this idea in the case of GEM-4, since we found no difference in the degree of suppression of gon-2(-) by gem-4(-) at different temperatures. Mutations in BON1/CPN1 also cause a hypersensitive stress response that may result from elevated intracellular Ca²⁺ signaling (JAMBUNATHAN et al. 2001 ). This is directly comparable to our findings regarding gon-2 and could conceivably result from an elevation of calcium channel activity in Arabidopsis BON1/CPN1 mutants.

Suppression by gem-4 requires at least a low level of gon-2 function. Therefore, gem-4 does not operate downstream of gon-2 in a simple linear regulatory pathway. Overall, our results are consistent with a model in which GON-2 and GEM-4 are both expressed and localize to the plasma membrane of the somatic gonad precursors at the beginning of the first larval stage. We hypothesize that GON-2 mediates an influx of mitogenic cations in response to developmental signals produced at the onset of postembryonic development. The resulting increase in free intracellular Ca²⁺ and Mg²⁺ could lead to the activation of GEM-4, which could then negatively regulate GON-2, possibly by direct phosphorylation.

Since copines may potentially be involved in vesicle trafficking (CREUTZ et al. 1998 ) and some TRP channels may be regulated by the fusion of channel-containing vesicles with the plasma membrane (KANZAKI et al. 1999 ; XU et al. 2001 ), it is possible that inactivation of gem-4 suppresses gon-2(lf) by increasing the number of GON-2 channels that are present within the plasma membrane. In this scenario, GEM-4 could be either a positive regulator of endocytosis or a negative regulator of the fusion/transport of GON-2-containing vesicles to the plasma membrane.

Our data are also consistent with the possibility that GEM-4 acts in parallel to GON-2 to modulate the level of intracellular Ca²⁺ and/or Mg²⁺ signaling. This could be accomplished by either altering the level of free intracellular cations or affecting the activity of one or more signal transduction components.

gon-4 encodes a novel nuclear protein whose inactivation causes an impairment of gonadal cell divisions similar to that seen in gon-2 mutants (but slightly less severe; FRIEDMAN et al. 2000 ). Given the similarity of their mutant phenotypes, it is possible that a positive regulatory relationship exists between gon-2 and gon-4. In a simple linear pathway, gon-4 could act either upstream or downstream of gon-2. In the first case, inactivation of gon-4 would cause a reduction in gon-2 activity, which would then lead to the mutant phenotype. If this model were correct, then gem-4(lf) should suppress the effects of inactivation of gon-4, since gem-4(lf) potentiates gon-2 activity. We found that gem-4(lf) does not suppress the gonadal defects caused by gon-4(RNAi). Therefore, gon-4 is likely to act either downstream of gon-2 (and gem-4) or as part of a separate regulatory pathway required for the divisions of the gonadal precursors.

We have not observed any obvious defects in the timing or pattern of gonadal divisions when gem-4 mutations are present in a gon-2(+) background. Furthermore, gon-2(q388) is not fully suppressed by inactivation of gem-4. Together, these results suggest the possibility that gem-4 may be redundant to one or more other genes. We investigated this possibility by using RNAi to attempt to inactivate the paralogous gene, F26D10.4; however, this treatment had little or no effect. Perhaps regulation by gem-4 is merely a fine-tuning mechanism whose disruption has no overt consequences when the expression and function of gon-2 is normal. This would be consistent with other reports of extragenic suppressor mutations that have little or no obvious phenotype other than their suppressor activity (MAINE and KIMBLE 1993 ; JONGEWARD et al. 1995 ; GRANT and GREENWALD 1996 ).

	ACKNOWLEDGMENTS

We thank Theresa Stiernagle and the Caenorhabditis Genetics Stock Center [which is supported by the National Institutes of Health (NIH) National Center for Research Resources] for many of the strains used in this study, Andy Fire for the L3929 vector, Bob Barstead for the cDNA library, Alan Coulson and the Sanger Center for providing cosmids, Rachel West for ds gon-2 RNA, Victor Ambros for helpful comments on the manuscript, and reviewers for additional constructive suggestions. This work was supported by NIH grant RO1-GM49785.

Manuscript received January 11, 2003; Accepted for publication February 6, 2003.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

BARSTEAD, R. J. and R. H. WATERSTON, 1989  The basal component of the nematode dense-body is vinculin. J. Biol. Chem. 264:10177-10185.[Abstract/Free Full Text]

BLUMENTHAL, T., D. EVANS, C. D. LINK, A. GUFFANTI, and D. LAWSON et al., 2002  A global analysis of Caenorhabditis elegans operons. Nature 417:851-854.[Medline]

BRENNER, S., 1974  The genetics of Caenorhabditis elegans.. Genetics 77:71-94.[Abstract/Free Full Text]

Genome sequence of the nematode C. elegans: a platform for investigating biology. (1998) Science 282:2012-2018.[Abstract/Free Full Text]

CASADABAN, M. J., A. MARTINEZ-ARIAS, S. K. SHAPIRA, and J. CHAOU, 1993  ß-Galactosidase gene fusions for analyzing gene expression in Escherichia coli and yeast. Methods Enzymol. 100:293-299.

CAUDELL, E. G., J. J. CAUDELL, C. H. TANG, T. K. YU, and M. J. FREDERICK et al., 2000  Characterization of human copine III as a phosphoprotein with associated kinase activity. Biochemistry 39:13034-13043.[Medline]

CHURCH, D. L., K. L. GUAN, and E. J. LAMBIE, 1995  Three genes of the MAP kinase cascade, mek-2, mpk-1/sur-1 and let-60 ras, are required for meiotic cell cycle progression in Caenorhabditis elegans.. Development 121:2525-2535.[Abstract]

COULSON, A., 1996  The Caenorhabditis elegans genome project. C. elegans Genome Consortium. Biochem. Soc. Trans. 24:289-291.[Medline]

CREUTZ, C. E., J. L. TOMSIG, S. L. SNYDER, M. C. GAUTIER, and F. SKOURI et al., 1998  The copines, a novel class of C2 domain-containing, calcium-dependent, phospholipid-binding proteins conserved from Paramecium to humans. J. Biol. Chem. 273:1393-1402.[Abstract/Free Full Text]

DAL SANTO, P., M. A. LOGAN, A. D. CHISHOLM, and E. M. JORGENSEN, 1999  The inositol trisphosphate receptor regulates a 50-second behavioral rhythm in C. elegans.. Cell 98:757-767.[Medline]

DUNCAN, L. M., J. DEEDS, J. HUNTER, J. SHAO, and L. M. HOLMGREN et al., 1998  Down-regulation of the novel gene melastatin correlates with potential for melanoma metastasis. Cancer Res. 58:1515-1520.[Abstract/Free Full Text]

FERGUSON, E. L. and H. R. HORVITZ, 1985  Identification and characterization of 22 genes that affect the vulval cell lineages of the nematode Caenorhabditis elegans.. Genetics 110:17-72.[Abstract/Free Full Text]

FRIEDMAN, L., S. SANTA ANNA-ARRIOLA, J. HODGKIN, and J. KIMBLE, 2000  gon-4, a cell lineage regulator required for gonadogenesis in Caenorhabditis elegans.. Dev. Biol. 228:350-362.[Medline]

GRANT, B. and I. GREENWALD, 1996  The Caenorhabditis elegans sel-1 gene, a negative regulator of lin-12 and glp-1, encodes a predicted extracellular protein. Genetics 143:237-247.[Abstract]

HEINER, I., J. EISFELD, C. R. HALASZOVICH, E. WEHAGE, and E. JUNGLING et al., 2003  Expression profile of the transient receptor potential (TRP) family in neutrophil granulocytes: evidence for currents through LTRPC2 induced by ADP-ribose and NAD. Biochem. J. 4:4.

HODGKIN, J., 1997 Genetics, pp. 881–1047 in C. elegans II, edited by D. RIDDLE, T. BLUMENTHAL, B. MEYER and J. PRIESS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

HODGKIN, J. and T. DONIACH, 1997  Natural variation and copulatory plug formation in Caenorhabditis elegans.. Genetics 146:149-164.[Abstract]

HUA, J., P. GRISAFI, S. H. CHENG, and G. R. FINK, 2001  Plant growth homeostasis is controlled by the Arabidopsis BON1 and BAP1 genes. Genes Dev. 15:2263-2272.[Abstract/Free Full Text]

HUANG, N. N., D. E. MOOTZ, A. J. WALHOUT, M. VIDAL, and C. P. HUNTER, 2002  MEX-3 interacting proteins link cell polarity to asymmetric gene expression in Caenorhabditis elegans.. Development 129:747-759.[Abstract/Free Full Text]

JAKUBOWSKI, J. and K. KORNFELD, 1999  A local, high-density, single-nucleotide polymorphism map used to clone Caenorhabditis elegans cdf-1.. Genetics 153:743-752.[Abstract/Free Full Text]

JAMBUNATHAN, N., J. M. SIANI, and T. W. MCNELLIS, 2001  A humidity-sensitive Arabidopsis copine mutant exhibits precocious cell death and increased disease resistance. Plant Cell 13:2225-2240.[Abstract/Free Full Text]

JONGEWARD, G. D., T. R. CLANDININ, and P. W. STERNBERG, 1995  sli-1, a negative regulator of let-23-mediated signaling in C. elegans.. Genetics 139:1553-1566.[Abstract]

KANZAKI, M., Y. Q. ZHANG, H. MASHIMA, L. LI, and H. SHIBATA et al., 1999  Translocation of a calcium-permeable cation channel induced by insulin-like growth factor-I. Nat. Cell Biol. 1:165-170.[Medline]

KIMBLE, J. and D. HIRSH, 1979  Post-embryonic cell lineages of the hermaphrodite and male gonads in C. elegans.. Dev. Biol. 70:396-417.[Medline]

MAINE, E. M. and J. KIMBLE, 1993  Suppressors of glp-1, a gene required for cell communication during development in Caenorhabditis elegans, define a set of interacting genes. Genetics 135:1011-1022.[Abstract]

MCHUGH, D., R. FLEMMING, S. Z. XU, A. L. PERRAUD, and D. J. BEECH, 2003  Critical intracellular Ca²⁺ dependence of transient receptor potential melastatin 2 (TRPM2) cation channel activation. J. Biol. Chem. 278:11002-11006.[Abstract/Free Full Text]

MELLO, C. C., J. M. KRAMER, D. STINCHCOMB, and V. AMBROS, 1991  Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10:3959-3970.[Medline]

MOERMAN, D. G. and D. L. BAILLIE, 1981  Formaldehyde mutagenesis in the nematode Caenorhabditis elegans.. Mutat. Res. 80:273-279.[Medline]

MONTEILH-ZOLLER, M. K., M. C. HERMOSURA, M. J. NADLER, A. M. SCHARENBERG, and R. PENNER et al., 2003  TRPM7 provides an ion channel mechanism for cellular entry of trace metal ions. J. Gen. Physiol. 121:49-60.[Abstract/Free Full Text]

MONTELL, C., L. BIRNBAUMER, and V. FLOCKERZI, 2002a  The TRP channels, a remarkably functional family. Cell 108:595-598.[Medline]

MONTELL, C., L. BIRNBAUMER, V. FLOCKERZI, R. J. BINDELS, and E. A. BRUFORD et al., 2002b  A unified nomenclature for the superfamily of TRP cation channels. Mol. Cell 9:229-231.[Medline]

NADLER, M. J., M. C. HERMOSURA, K. INABE, A. L. PERRAUD, and Q. ZHU et al., 2001  LTRPC7 is a Mg.ATP-regulated divalent cation channel required for cell viability. Nature 411:590-595.[Medline]

NAKAYAMA, T., T. YAOI, M. YASUI, and G. KUWAJIMA, 1998  N-copine: a novel two C2-domain-containing protein with neuronal activity-regulated expression. FEBS Lett. 428:80-84.[Medline]

PEIER, A. M., A. MOQRICH, A. C. HERGARDEN, A. J. REEVE, and D. A. ANDERSSON et al., 2002  A TRP channel that senses cold stimuli and menthol. Cell 108:705-715.[Medline]

PERRAUD, A. L., A. FLEIG, C. A. DUNN, L. A. BAGLEY, and P. LAUNAY et al., 2001  ADP-ribose gating of the calcium-permeable LTRPC2 channel revealed by Nudix motif homology. Nature 411:595-599.[Medline]

RIZO, J. and T. C. SUDHOF, 1998  C2-domains, structure and function of a universal Ca²⁺-binding domain. J. Biol. Chem. 273:15879-15882.[Free Full Text]

ROGALSKI, T. M., D. G. MOERMAN, and D. L. BAILLIE, 1982  Essential genes and deficiencies in the unc-22 IV region of Caenorhabditis elegans.. Genetics 102:725-736.[Abstract/Free Full Text]

RUNNELS, L. W., L. YUE, and D. E. CLAPHAM, 2001  TRP-PLIK, a bifunctional protein with kinase and ion channel activities. Science 291:1043-1047.[Abstract/Free Full Text]

SCHLINGMANN, K. P., S. WEBER, M. PETERS, L. NIEMANN NEJSUM, and H. VITZTHUM et al., 2002  Hypomagnesemia with secondary hypocalcemia is caused by mutations in TRPM6, a new member of the TRPM gene family. Nat. Genet. 31:166-170.[Medline]

SULSTON, J., and J. HODGKIN, 1988 Methods, pp. 587–606 in The Nematode Caenorhabditis elegans, edited by W. WOOD and the COMMUNITY OF C. ELEGANS RESEARCHERS. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

SUN, A. Y. and E. J. LAMBIE, 1997  gon-2, a gene required for gonadogenesis in Caenorhabditis elegans.. Genetics 147:1077-1089.[Abstract]

TAKUWA, N., W. ZHOU, and Y. TAKUWA, 1995  Calcium, calmodulin and cell cycle progression. Cell. Signal. 7:93-104.[Medline]

TOMSIG, J. L. and C. E. CREUTZ, 2000  Biochemical characterization of copine: a ubiquitous Ca²⁺-dependent, phospholipid-binding protein. Biochemistry 39:16163-16175.[Medline]

TREININ, M. and M. CHALFIE, 1995  A mutated acetylcholine receptor subunit causes neuronal degeneration in C. elegans.. Neuron 14:871-877.[Medline]

WALDER, R. Y., D. LANDAU, P. MEYER, H. SHALEV, and M. TSOLIA et al., 2002  Mutation of TRPM6 causes familial hypomagnesemia with secondary hypocalcemia. Nat. Genet. 31:171-174.[Medline]

WEST, R. J., A. Y. SUN, D. L. CHURCH, and E. J. LAMBIE, 2001  The C. elegans gon-2 gene encodes a putative TRP cation channel protein required for mitotic cell cycle progression. Gene 266:103-110.[Medline]

WOLF, F. I. and A. CITTADINI, 1999  Magnesium in cell proliferation and differentiation. Front. Biosci. 4:D607-D617.[Medline]

XU, X. Z., F. MOEBIUS, D. L. GILL, and C. MONTELL, 2001  Regulation of melastatin, a TRP-related protein, through interaction with a cytoplasmic isoform. Proc. Natl. Acad. Sci. USA 98:10692-10697.[Abstract/Free Full Text]

This article has been cited by other articles:

				J. Xing, X. Yan, A. Estevez, and K. Strange Highly Ca2+-selective TRPM Channels Regulate IP3-dependent Oscillatory Ca2+ Signaling in the C. elegans Intestine J. Gen. Physiol., February 25, 2008; 131(3): 245 - 255. [Abstract] [Full Text] [PDF]

				C. K. Damer, M. Bayeva, P. S. Kim, L. K. Ho, E. S. Eberhardt, C. I. Socec, J. S. Lee, E. A. Bruce, A. E. Goldman-Yassen, and L. C. Naliboff Copine A Is Required for Cytokinesis, Contractile Vacuole Function, and Development in Dictyostelium Eukaryot. Cell, March 1, 2007; 6(3): 430 - 442. [Abstract] [Full Text] [PDF]