| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Corresponding author: Michelle Momany, 2502 Plant Sciences, University of Georgia, Athens, GA 30605., momany{at}plantbio.uga.edu (E-mail)
Communicating editor: M. SACHS
 | ABSTRACT |
|---|
 TOP ABSTRACT MATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Previous work identified swoC1 as a single-gene mutant with defects in polarity establishment. In this study swoC1 was shown to have defects in endocytosis, compartmentation, nuclear distribution, and conidiation. Temperature-shift experiments showed that the swoC1 mutant establishes multiple random sites of germ tube emergence. Surprisingly, these experiments also showed that even a slight delay in polarity establishment causes defects in later vegetative growth and asexual reproduction. The swoC gene was mapped to the centromere of chromosome III and cloned by complementation of the temperature-sensitive phenotype. The predicted SwoCp is homologous to rRNA pseudouridine synthases of yeast (Cbf5p) and humans (Dkc1p). However, neither rRNA pseudouridine synthesis nor rRNA processing appears to be affected in the swoC1 mutant. The swoC1 mutation occurs in the putative RNA-binding domain upstream of the C terminus, leaving the N-terminal TRUB catalytic domain intact. Interestingly, while deletion of the swoC gene was lethal in A. nidulans, the C terminus, including NLS, microtubule-binding, and coiled-coil domains, was dispensable for growth. SwoCp likely plays an important role in polar growth and nuclear distribution in A. nidulans, functions not yet described for its homologs.
IN filamentous fungi, spores break dormancy and expand isotropically before switching to polar tip growth. Further growth occurs exclusively at the hyphal tip (
Polarity genes in filamentous fungi are proposed to fall into two categories (
Surprisingly, we found that the swoC polarity establishment gene encodes a homolog of Saccharomyces cerevisiae Cbf5p. Originally discovered by its affinity to the yeast centromere, Cbf5p is the pseudouridine synthase responsible for isomerization of uridine to pseudouridine in rRNA (
The biological role of pseudouridine is not yet clear. Recent evidence suggests that pseudouridine is not essential for ribosomal functions. Yeast depleted of virtually all pseudouridine residues in rRNA are viable (
| MATERIALS AND METHODS |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Strains and media:
Strains used in this study were: A104 (yA2; adE20; AcrA1; phenA2; pyroA4; lysB5; sB3; nicB8; coA1), A457 (proA1; biA1; galE9; sC12; diA1; phenA2; choA1), A773 (pyrG89; wA3; pyroA4), A852 (biA1;
argB::trpCB;methG1;veA1; trpC801\\\\pabaA1 yA2; argB::trpCB;veA1; trpC801), AGA22 (swoC1; pabaA), and AXL8 (swoC1; pyroG89, wA3; pyroA4). All strains were obtained from the Fungal Genetics Stock Center (Department of Microbiology, University of Kansas Medical Center) except AGA22 and AXL8, which were constructed for this study. Identification of the temperature-sensitive swoC1 mutant and verification that it is a single-gene mutation have been previously described (
Growth conditions and microscopic observation:
Vegetative growth:
Conditions for vegetative growth and preparation of cells were as previously reported (
Conidiation: Conidia were inoculated on the edges of a small square of agar medium placed on top of a coverslip, which was placed in a petri dish containing solidified agar to keep it moist. Another coverslip was placed on top of the agar square after inoculation. Plates were sealed with parafilm, incubated inverted at 42° for 9 hr, and then shifted to 30° for 2 days. For observation of conidiophore structure, coverslips with aerial hyphae and conidiophores attached were dipped into 100% ethanol, mounted on slides, and observed microscopically. Otherwise, cells attached to coverslips were fixed and stained as described for vegetative growth.
FM4-64 staining:
Complete liquid medium with proper supplements was inoculated with 1–5 x 104 conidia/ml, poured into a petri dish containing a glass coverslip, and incubated as indicated. Coverslips with adhering cells were labeled with 20 µM FM4-64 (Molecular Probes, Eugene, OR) solution for 30 min at the indicated temperature. NaZ3 (10 mM) was added to stop the labeling. A 20 µM FM4-64 solution with 10 mM NaZ3 was used as control.
DNA and RNA isolation:
DNA was isolated from A. nidulans using previously described methods (
Cloning by complementation and plasmid rescue:
A random genomic plasmid library carrying a pryG marker provided by Greg May (University of Texas, M. D. Anderson Cancer Center, Houston;
Confirmation of complementation by map-based cloning:
Mitotic mapping:
The swoC1 mutant strain AGA22 (swoC1; pabaA) was fused with mitotic mapping strain A104 (yA2; adE20; AcrA1; phenA2; pyroA4; lysB5; sB3; nicB8; coA1) by standard methods (
Meiotic mapping: The swoC1 mutant strain AGA22 (swoC1; pabaA) was crossed with meiotic mapping strain A457 (proA1; biA1; galE9; sC12; diA1; phenA2; choA1). Ascospores (n = 350) released from individual cleistothecia were plated on selective media to test genotypes, and map units between swoC1 and other markers were calculated on the basis of recombination frequency of ts- strains. Only 59 of the progeny were ts-, which may be caused by reduced viability of the ts- strain. Map units between swoC1 and choA1, galE9, sC12, and phenA2 were 50, 30.5, 25.4, and 0, respectively.
Cloning of swoC:
The swoC gene is tightly linked to the phenA marker, which is located near the centromere of chromosome III. On the basis of the physical map of A. nidulans (http://gene.genetics.uga.edu/), 20 cosmids near the centromere from the chromosome-specific genomic library (Fungal Genetics Stock Center, http://www.fgsc.net/) were chosen to transform into the swoC1 mutant. Only cosmid W21H06 restored the swoC1 mutant to wild-type growth at restrictive temperature. Southern blotting experiments (
Identification and sequencing of the swoC gene by transposon tag:
Transposons (GPS-1 system; New England Biolabs, Beverly, MA) were randomly inserted into the complementing plasmid p8c1. Each of the resulting plasmids contains one copy of the transposon at random sites. Forty-eight plasmids were sequenced using primers unique for the transposon ends on an ABI 3700 DNA Analyzer (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions.
The sequences were assembled and analyzed using the Phred (version 0.000925c), Phrap (version 0.990319), and Consed (version 11.0) computer programs (http://depts.washington.edu/ventures/collabtr/direct/ppccombo.htm). All sequences have at least fourfold redundancy with a quality rating of at least 20. The assembled contig was used to search the National Center for Biotechnology Information (NCBI) databases (www.ncbi.nlm.nih.gov), using the Blast program to identify open reading frames (ORFs). Only one ORF was found. Plasmids with transposons inserted within the ORF were transformed into the swoC1 mutant. Plasmids that failed to rescue the swoC1 mutant at restrictive temperature were assumed to have transposon insertions disrupting the complementing gene. The genomic sequence of the swoC gene, its intron locations, and the predicted protein sequence were deposited in GenBank (accession no. AY057454).
Sequencing of the swoC1 mutant allele:
The swoC1 mutant allele was amplified by three independent PCR reactions using the Expand high-fidelity PCR system (Roche Diagnostics, Indianapolis) and cloned into the pGEM-T vector system (Promega, Madison, WI). Genomic DNA from swoC1 mutant strain AXL8 was used as the template. Primers used for PCR amplifications were 5' GAATGTTTACGCAGGTGG and 5' GTGGCTTGTGATGATGCGG. Three clones from each reaction (nine in total) were sequenced using the transposon strategy described above. All sequences showed an identical change in base 1220 (G to T) of swoC1. The sequences obtained were compared with the wild-type allele using GeneDoc (version 2.6.001) (www.psc.edu/biomed/genedoc) with default parameters.
Protein alignment:
Sequences of SwoCp homologs were obtained from GenBank (http://www.ncbi.nlm.nih.gov/). Intron locations in swoC were based on alignments with homologs and presence of consensus splice sites (
Pseudouridine analysis by HPLC-MS:
Enzymatic digestion of 100 µg total RNA by nuclease P1 (Sigma), phosphodiesterase I (Sigma), and alkaline phosphatase (Sigma) was conducted as previously described (
Northern hybridization:
Total RNA was isolated from wild-type A773 and swoC1 mutant AXL8 cultured in complete medium at 42°. RNA was separated on a 1.2% formaldehyde agarose gel and transferred to a nylon membrane by standard methods (
Construction of swoC knock out:
Flanking sequences from upstream and downstream of the swoC gene (1.1 kb each) were amplified by high-fidelity PCR. Primers used to amplify the 5' flanking sequence of swoC were 5' CCGCTCGAGGGTGAATGTTTACGCAGGTGGTTTTGG (with the addition of the XhoI restriction site) and 5' GGAATTCCGGCCATTGCGACTGTTATTGAG (with the addition of the EcoRI restriction site). Primers used to amplify the 3' flanking sequence of swoC with the addition of SacII restriction sites were 5' TCCCCGCGGCGACCAAATGGAAGTCCGAATAC and 5' CCCCGCGGGGACTAACGTCAAGTGTGGCGAGTG. After double digestion with EcoRI and XhoI, the 5' flanking sequence was inserted into pargBC-1 (
The linear fragment containing 5F-argB-3F was transformed into A. nidulans diploid strain A852. Transformants were selected for growth on minimal medium lacking arginine. Genomic DNA of 72 transformants was isolated and digested with KpnI. Southern blot was performed with random-labeled 3' flanking sequence as the probe. Putative homologous integrants were confirmed by Southern blot with BamHI and KpnI double digestion. A single heterozygous diploid transformant with argB replacing swoC on one chromosome and a wild-type swoC on the other was treated with benomyl to induce haploidization as described for mitotic mapping. In total, 206 haploid sectors were scored for genotype. None of the haploid colonies grew on minimal medium without arginine supplement.
Construction of the swoC C-terminal deletion allele:
The construction of the C-terminal deletion allele was essentially the same as the null allele except that the truncated swoC gene lacking the final 294 bases was inserted into pargBC-1 (
| RESULTS |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Phenotypic characterization of the swoC1 mutant
Nuclear division is uncoupled from polarity establishment in the swoC1 mutant:
Previous work has shown that uninucleate spores switch from isotropic to polar growth after the first round of mitosis in wild-type A. nidulans (
|
Previous work has shown that the swoC1 mutant grows isotropically at restrictive temperature (42°) for 13 hr and accumulates six nuclei on average (
|
The swoC1 mutant sends out multiple germ tubes simultaneously at random sites:
Previous work concluded that the swoC1 mutant does not establish polarity at restrictive temperature on the basis of failure to send out germ tubes within 2 hr (just over one cell cycle) after shift from restrictive to permissive temperature (
|
The swoC1 mutant is defective in endocytosis:
One possible explanation for a connection between increased membrane volume and increased germ tube emergence in the swoC1 mutant would be a failure to remove accumulated polarity establishment markers from the plasma membrane during isotropic expansion. Indeed in S. cerevisiae, an endocytic block causes isotropic cell growth, similar to the swoC1 mutant swollen phenotype (reviewed by
|
Early delay in polarity establishment causes a nuclear distribution defect during vegetative growth and conidiation in the swoC1 mutant:
To determine whether an early delay in polarity establishment affects later vegetative growth, we incubated wild type and swoC1 at restrictive temperature for 9 hr (the swoC1 mutant averaged four nuclei) and shifted to permissive temperature for 15 hr. We measured the length and nuclear number of subapical compartments (n = 120). Subapical compartment length and nuclear number were relatively uniform in the wild type and in the swoC1 mutant grown at permissive temperature for the duration of the experiment (Fig 5 and data not shown). However, subapical compartment length and nuclear number varied greatly in the swoC1 mutant after temperature downshift (Fig 5). Occasionally, we observed compartments without nuclei in the mutant (Fig 5A, Fig C). Empty compartments were never observed in wild type. In wild type, the majority of compartments were between 10 and 60 µm with 60% falling between 30 and 40 µm and 23% falling between 40 and 50 µm (Fig 5B). In the swoC1 mutant after temperature downshift, subapical compartment length ranged from <10 µm to >110 µm with only 26% falling between 30 and 40 µm, and 20% falling between 40 and 50 µm. In wild type, nuclear number per compartment was between 1 and 7, with 87% of compartments containing two to four nuclei (Fig 5C). In swoC1, however, nuclear number per compartment ranged from 1 to 20, with only 47% of compartments containing two to four nuclei. The compartment length variation in the swoC1 mutant probably reflects nuclear position variation since in this filamentous fungus, the site of septation is determined by nuclear position (
|
In wild-type A. nidulans, asexual reproduction produces uniform uninucleate conidia on a reproductive structure called the conidiophore (
|
The swoC gene encodes rRNA pseudouridine synthase
The swoC gene maps near the centromere of chromosome III:
To identify the chromosome on which the swoC gene lies, we took advantage of the parasexual cycle in A. nidulans (
To define the position of the swoC gene on chromosome III, the swoC1 mutant strain AGA22 was crossed with the meiotic mapping strain A457. The distance between the swoC1 allele and other markers on chromosome III was determined by recombination frequency. The swoC1 allele was tightly linked to the phenA2 marker near the centromere of chromosome III.
The swoC gene encodes a homolog of rRNA pseudouridine synthase: On the basis of the physical map of A. nidulans (http://gene.genetics.uga.edu/), 20 cosmids near the centromere of chromosome III were chosen from the chromosome-specific library and transformed into the swoC1 mutant. Only cosmid W21H06 complemented the swoC1 ts- phenotype.
In a separate experiment, three autonomously replicating plasmids from a random plasmid library were also found to restore the swoC1 mutant to wild-type growth at restrictive temperature. Restriction mapping showed that these three plasmids contained overlapping genomic DNA inserts (data not shown).
Southern blotting indicated that the three high-copy plasmids shared a common fragment with the W21H06 cosmid (data not shown), showing that the plasmids contain the authentic swoC gene, rather than a suppressor of the swoC1 mutation. The smallest plasmid, p8c1, was chosen for sequencing using a transposon-tagging strategy. Only one ORF was identified in the 8-kb A. nidulans genomic DNA insert in plasmid p8c1. This is not surprising since the swoC gene localizes to the gene-poor centromere-proximal region. Using the NCBI Blast program, the predicted SwoCp was found to be 70% identical with S. cerevisiae Cbf5p, 71% identical with Kluyveromyces lactis Cbf5p, and 63% identical with Homo sapiens Dkc1p (Fig 7). All are members of a highly conserved family of eukaryotic rRNA pseudouridine synthases. Like other members of this family, SwoCp contains serveral predicted domains: a pseudouridylate synthase domain (TruB), an RNA-binding domain (PUA), a microtubule (MT)-binding domain, a nuclear localization signal (NLS), and a coiled-coil protein-protein interaction domain (Fig 7).
|
Sequencing of the swoC1 mutant allele amplified from strain AXL8 by PCR showed a G-to-T mutation at base 1220, which results in a valine-to-phenylalanine substitution at amino acid 338 in the predicted PUA domain.
Deletion of the swoC gene is lethal in A. nidulans:
Even though elimination of all detectable pseudouridine residues in rRNA from S. cerevisiae has no phenotype (
|
The C terminus of SwoCp is dispensable:
To determine which portion of the swoC gene is required to complement the swoC1 mutation, we took advantage of the transposon inserts in plasmid p8c1 created for sequencing swoC. Two p8c1 plasmids with transposons in the first exon and the third exon (p8c1-A11) of the gene were not able to restore the swoC1 mutant to wild-type growth at restrictive temperature (Fig 9C and data not shown). The p8c1 plasmid with a transposon in the first intron (p8c1-H07) also did not complement the swoC1 phenotype (Fig 9B), likely because A. nidulans, which usually has 40- to 100-bp introns, could not properly process the 5-kb intron resulting from transposon insertion. Most interestingly, the plasmid p8c1 with a transposon in the C terminus (p8c1-E10) complemented the swoC1 phenotype (Fig 9A). The E10 insertion is predicted to remove 98 amino acids from the C terminus of the encoded protein including the MT-binding domain, NLS, and coiled-coil domain. Distribution of nuclei and compartment length were similar in swoC1 mutant strains transformed with either the intact p8c1 or p8c1-E10 (data not shown). Two explanations are possible: either the C terminus is not essential for SwoCp or the truncated swoC gene product can function together with the swoC1 mutated gene product to restore the wild-type phenotype. To distinguish between these explanations, we constructed a heterozygous diploid wherein the C terminus of one copy of the swoC gene was replaced with the argB marker by homologous integration (Fig 8). We induced haploidization of the heterozygous diploid and scored haploid sectors (
|
The swoC1 mutant shows no detectable defect in pseudouridine synthesis or rRNA processing:
Pseudouridination is one of the two most abundant nucleic acid modifications and occurs predominantly in rRNA (
1% of rRNA nucleic acids are pseudouridines (reviewed by
Since >90% of total RNA is rRNA, we expected to see a gross decrease of pseudouridine in total RNA if the swoC1 phenotype is due to loss of pseudouridine synthesis activity. Total RNA isolated from overnight cultures of wild type and the swoC1 mutant grown at restrictive and permissive temperatures was enzymatically digested. We used HPLC coupled with MS to separate and identify pseudouridine. HPLC has long been used to detect modified nucleic acids (
|
In S. cerevisiae, certain mutations in CBF5 cause defects in pre-rRNA processing and steady-state levels of mature cytoplasmic ribosomes (
| DISCUSSION |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Polarity establishment cues persist or are reinitiated in swoC1:
In S. cerevisiae, budding occurs once in each cell cycle. Sites for bud emergence are tagged by cortical markers laid down during the previous round of budding. Cdc42p is recruited to these sites, where it drives polar growth through interactions with the cytoskeleton and polarity maintenance apparatus (
In the swoC1 mutant, an extreme delay in polarity establishment did not cause loss of competence for polar growth, suggesting that the underlying polarity markers either persist or can be formed despite a delay. While polar growth could still occur when swoC1 was shifted from restrictive to permissive temperature, the normal bipolar pattern of germ tube emergence was disrupted. We were especially surprised by the increase in the number of germ tubes with increased incubation time at restrictive temperature (Fig 3). Given the endocytosis defect of the swoC1 mutant, it is possible that new polarity markers are synthesized during incubation at restrictive temperature and that failure to remove these markers leads to the emergence of multiple germ tubes in random positions after release of the temperature block. It is also possible that the increased number of nuclei that accumulate in the swoC1 mutant at restrictive temperature triggers the synthesis of additional polarity markers. A. nidulans nud mutants also accumulate nuclei and send out multiple germ tubes when they polarize, though the mechanism is not clear (
Delayed polarity establishment perturbs nuclear distribution and development in swoC1:
In wild-type A. nidulans the isotropic-to-polar switch normally occurs just after the first mitosis, when spores have two nuclei. Polar growth and nuclear division continue, nuclei become distributed evenly along the germ tube, and the hypha is partitioned by evenly spaced septa (
The swoC1 phenotype is likely related to cryptic function in the PUA domain:
Surprisingly, the gene that complemented the swoC1 ts- phenotype was >60% identical with rRNA pseudouridine synthases from other eukaryotes. On the basis of our inability to detect any change in multiple activities associated with rRNA pseudouridine synthases, it is reasonable to propose that we cloned a suppressor rather than the authentic swoC gene. However, we genetically mapped the swoC1 mutation to the centromere of chromosome III. Only cosmid W21H06 from the chromosome III centromere region complemented the swoC1 ts- phenotype. The rRNA pseudouridine synthase gene from complementing plasmids hybridized to the W21H06 cosmid. In addition, sequencing revealed a point mutation in the PUA domain in the swoC1 mutant allele. Thus the rRNA pseudouridine synthase gene is the authentic swoC gene and not a suppressor.
If swoC encodes a pseudouridine synthase, why do we fail to detect any changes in pseudouridine levels or rRNA processing in the swoC1 mutant? The most obvious explanation is that the mutation affects some function of SwoCp other than pseudouridine synthesis. Mutations in the TruB catalytic sites of CBF5 inhibit pseudouridine synthesis and rRNA processing. Indeed, the TruB domain is intact in the swoC1 mutant allele. This is consistent with work on yeast Cbf5p and the E. coli pseudouridine synthase RluD, implying that the pseudouridine synthesis function of the enzyme is not critical for cell growth while the protein itself is essential (
Our results suggest that the unknown essential function of SwoCp may require the PUA domain. The swoC1 mutation occurs in the PUA domain, a conserved RNA-binding domain found in both archaea and eukaryotes (
It is possible that an RNA substrate of SwoCp other than box H/ACA snoRNA might be affected by the swoC1 mutation. Indeed, asymmetric distribution of RNA is critical for development in many organisms (
We cannot rule out the possibility that the swoC1 mutation does not directly cause the nonpolar phenotype. Many different mutations have been reported to result in a nonpolar phenotype. In yeast, defects in a 60S ribosomal subunit protein QSR1 (
-subunit of mitochondrial phenylalanyl-tRNA synthase and transcription factor IIF interacting component of the CTD phosphatase, respectively (
| FOOTNOTES |
|---|
Sequence data from this article have been deposited with the GenBank Data Libraries under accession no.
AY057454. 
| ACKNOWLEDGMENTS |
|---|
We thank Brian Shaw for assistance in sequencing and identification of complementing plasmid and for valuable suggestions, Gretel Guest for AGA22 construction, and Greg May for providing the plasmid library used in this work. This work was sponsored by Department of Energy biosciences grant DE-FG02-97ER20275 to M.M.
Manuscript received April 11, 2003; Accepted for publication May 16, 2003.
| LITERATURE CITED |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
ADAMS, T. H., J. K. WIESER, and J. H. YU, 1998 Asexual sporulation in Aspergillus nidulans.. Microbiol. Mol. Biol. Rev. 62:35-54.
AMURO, Y., H. NAKAOKA, S. SHIMOMURA, S. TAMURA, and T. HADA et al., 1988 Rapid high-performance liquid chromatography for pseudouridine assay in serum and urine. Clin. Chim. Acta 172:117-122.[Medline]
ARAVIND, L. and E. V. KOONIN, 1999 Novel predicted RNA-binding domains associated with the translation machinery. J. Mol. Evol. 48:291-302.[Medline]
BACHEWICH, C. and I. B. HEATH, 1998 Radial F-actin arrays precede new hypha formation in Saprolegnia: implications for establishing polar growth and regulating tip morphogenesis. J. Cell Sci. 111(Pt. 14):2005-2016.
BALLANCE, D. J., 1986 Sequences important for gene expression in filamentous fungi. Yeast 2:229-236.[Medline]
BECKER, H. F., Y. MOTORIN, R. J. PLANTA, and H. GROSJEAN, 1997 The yeast gene YNL292w encodes a pseudouridine synthase (Pus4) catalyzing the formation of psi55 in both mitochondrial and cytoplasmic tRNAs. Nucleic Acids Res. 25:4493-4499.
BOUSQUET-ANTONELLI, C., Y. HENRY, P. G'ELUGNE, J. M. CAIZERGUES-FERRER, and T. KISS, 1997 A small nucleolar RNP protein is required for pseudouridylation of eukaryotic ribosomal RNAs. EMBO J. 16:4770-4776.[Medline]
CADWELL, C., H. J. YOON, Y. ZEBARJADIAN, and J. CARBON, 1997 The yeast nucleolar protein Cbf5p is involved in rRNA biosynthesis and interacts genetically with the RNA polymerase I transcription factor RRN3. Mol. Cell. Biol. 17:6175-6183.[Abstract]
CHANT, J., 1999 Cell polarity in yeast. Annu. Rev. Cell Dev. Biol. 15:365-391.[Medline]
CHANT, J., M. MISCHKE, E. MITCHELL, I. HERSKOWITZ, and J. R. PRINGLE, 1995 Role of Bud3p in producing the axial budding pattern of yeast. J. Cell Biol. 129:767-778.
CHARETTE, M. and M. W. GRAY, 2000 Pseudouridine in RNA: what, where, how, and why. IUBMB Life 49:341-351.[Medline]
DEZ, C., A. HENRAS, B. FAUCON, D. LAFONTAINE, and M. CAIZERGUES-FERRER et al., 2001 Stable expression in yeast of the mature form of human telomerase RNA depends on its association with the box H/ACA small nucleolar RNP proteins Cbf5p, Nhp2p and Nop10p. Nucleic Acids Res. 29:598-603.
EISINGER, D. P., F. A. DICK, and B. L. TRUMPOWER, 1997 Qsr1p, a 60S ribosomal subunit protein, is required for joining of 40S and 60S subunits. Mol. Cell. Biol. 17:5136-5145.[Abstract]
FIDDY, C. and A. P. TRINCI, 1976 Mitosis, septation, branching and the duplication cycle in Aspergillus nidulans.. J. Gen. Microbiol. 97:169-184.[Medline]
FISCHER-PARTON, S., R. M. PARTON, P. C. HICKEY, J. DIJKSTERHUIS, and H. A. ATKINSON et al., 2000 Confocal microscopy of FM4–64 as a tool for analysing endocytosis and vesicle trafficking in living fungal hyphae. J. Microsc. 198:246-259.[Medline]
GANOT, P., M. L. BORTOLIN, and T. KISS, 1997 Site-specific pseudouridine formation in preribosomal RNA is guided by small nucleolar RNAs. Cell 89:799-809.[Medline]
GOODSON, H. V., B. L. ANDERSON, H. M. WARRICK, L. A. PON, and J. A. SPUDICH, 1996 Synthetic lethality screen identifies a novel yeast myosin I gene (MYO5): myosin I proteins are required for polarization of the actin cytoskeleton. J. Cell Biol. 133:1277-1291.
GUTGSELL, N. S., M. D. DEL CAMPO, S. RAYCHAUDHURI, and J. OFENGAND, 2001 A second function for pseudouridine synthases: a point mutant of RluD unable to form pseudouridines 1911, 1915, and 1917 in Escherichia coli 23S ribosomal RNA restores normal growth to an RluD-minus strain. RNA 7:990-998.[Abstract]
HARRIS, S. D., J. L. MORRELL, and J. E. HAMER, 1994 Identification and characterization of Aspergillus nidulans mutants defective in cytokinesis. Genetics 136:517-532.[Abstract]
HARRIS, S. D., A. F. HOFMANN, H. W. TEDFORD, and M. P. LEE, 1999 Identification and characterization of genes required for hyphal morphogenesis in the filamentous fungus Aspergillus nidulans.. Genetics 151:1015-1025.
HEISS, N. S., S. W. KNIGHT, T. J. VULLIAMY, S. M. KLAUCK, and S. WIEMANN et al., 1998 X-linked dyskeratosis congenita is caused by mutations in a highly conserved gene with putative nucleolar functions. Nat. Genet. 19:32-38.[Medline]
HERMAN, P. K. and J. RINE, 1997 Yeast spore germination: a requirement for Ras protein activity during re-entry into the cell cycle. EMBO J. 16:6171-6181.[Medline]
JIANG, W., K. MIDDLETON, H. J. YOON, C. FOUQUET, and J. CARBON, 1993 An essential yeast protein, CBF5p, binds in vitro to centromeres and microtubules. Mol. Cell. Biol. 13:4884-4893.
KAFER, E., 1977 Meiotic and mitotic recombination in Aspergillus and its chromosomal aberrations. Adv. Genet. 19:33-131.[Medline]
KNIGHT, S. W., N. S. HEISS, T. J. VULLIAMY, S. GRESCHNER, and G. STAVRIDES et al., 1999 X-linked dyskeratosis congenita is predominantly caused by missense mutations in the DKC1 gene. Am. J. Hum. Genet. 65:50-58.[Medline]
KRON, S. J., C. A. STYLES, and G. R. FINK, 1994 Symmetric cell division in pseudohyphae of the yeast Saccharomyces cerevisiae.. Mol. Biol. Cell 5:1003-1022.[Abstract]
LAFONTAINE, D. L., C. BOUSQUET-ANTONELLI, Y. HENRY, M. CAIZERGUES-FERRER, and D. TOLLERVEY, 1998 The box H + ACA snoRNAs carry Cbf5p, the putative rRNA pseudouridine synthase. Genes Dev. 12:527-537.
MA, G. C. and E. KAFER, 1974 Genetic analysis of the reciprocal translocation T2(I;8) of Aspergillus using the technique of mitotic mapping in homozygous translocation diploids. Genetics 77:11-23.
MADDEN, K. and M. SNYDER, 1992 Specification of sites for polarized growth in Saccharomyces cerevisiae and the influence of external factors on site selection. Mol. Biol. Cell 3:1025-1035.[Abstract]
MADDEN, K. and M. SNYDER, 1998 Cell polarity and morphogenesis in budding yeast. Annu. Rev. Microbiol. 52:687-744.[Medline]
MADEN, B. E. and J. M. HUGHES, 1997 Eukaryotic ribosomal RNA: the recent excitement in the nucleotide modification problem. Chromosoma 105:391-400.[Medline]
MANN, C., J. Y. MICOUIN, N. CHIANNILKULCHAI, I. TREICH, and J. M. BUHLER et al., 1992 RPC53 encodes a subunit of Saccharomyces cerevisiae RNA polymerase C (III) whose inactivation leads to a predominantly G1 arrest. Mol. Cell. Biol. 12:4314-4326.
MARCINIAK, R. A., F. B. JOHNSON, and L. GUARENTE, 2000 Dyskeratosis congenita, telomeres and human ageing. Trends Genet. 16:193-195.[Medline]
MICKLEM, D. R., 1995 mRNA localisation during development. Dev. Biol. 172:377-395.[Medline]
MITCHELL, J. R., J. CHENG, and K. COLLINS, 1999 A box H/ACA small nucleolar RNA-like domain at the human telomerase RNA 3' end. Mol. Cell. Biol. 19:567-576.
MOMANY, M., 2002 Polarity in filamentous fungi: establishment, maintenance and new axes. Curr. Opin. Microbiol. 5:580-585.[Medline]
MOMANY, M. and J. E. HAMER, 1997 The Aspergillus nidulans septin encoding gene, aspB, is essential for growth. Fungal Genet. Biol. 21:92-100.[Medline]
MOMANY, M. and I. TAYLOR, 2000 Landmarks in the early duplication cycles of Aspergillus fumigatus and Aspergillus nidulans: polarity, germ tube emergence and septation. Microbiology 146:3279-3284.
MOMANY, M., P. J. WESTFALL, and G. ABRAMOWSKY, 1999 Aspergillus nidulans swo mutants show defects in polarity establishment, polarity maintenance and hyphal morphogenesis. Genetics 151:557-567.
OFENGAND, J., 2002 Ribosomal RNA pseudouridines and pseudouridine synthases. FEBS Lett. 514:17-25.[Medline]
OSHEROV, N. and G. MAY, 2000 Conidial germination in Aspergillus nidulans requires RAS signaling and protein synthesis. Genetics 155:647-656.
