The Aspergillus nidulans swoC1 Mutant Shows Defects in Growth and Development

Corresponding author: Michelle Momany, 2502 Plant Sciences, University of Georgia, Athens, GA 30605., momany{at}plantbio.uga.edu (E-mail)

Communicating editor: M. SACHS

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Previous work identified swoC1 as a single-gene mutant with defects in polarity establishment. In this study swoC1 was shown to have defects in endocytosis, compartmentation, nuclear distribution, and conidiation. Temperature-shift experiments showed that the swoC1 mutant establishes multiple random sites of germ tube emergence. Surprisingly, these experiments also showed that even a slight delay in polarity establishment causes defects in later vegetative growth and asexual reproduction. The swoC gene was mapped to the centromere of chromosome III and cloned by complementation of the temperature-sensitive phenotype. The predicted SwoCp is homologous to rRNA pseudouridine synthases of yeast (Cbf5p) and humans (Dkc1p). However, neither rRNA pseudouridine synthesis nor rRNA processing appears to be affected in the swoC1 mutant. The swoC1 mutation occurs in the putative RNA-binding domain upstream of the C terminus, leaving the N-terminal TRUB catalytic domain intact. Interestingly, while deletion of the swoC gene was lethal in A. nidulans, the C terminus, including NLS, microtubule-binding, and coiled-coil domains, was dispensable for growth. SwoCp likely plays an important role in polar growth and nuclear distribution in A. nidulans, functions not yet described for its homologs.

IN filamentous fungi, spores break dormancy and expand isotropically before switching to polar tip growth. Further growth occurs exclusively at the hyphal tip (MOMANY and TAYLOR 2000 ). Germ tube emergence in wild-type Aspergillus nidulans is sequential and usually occurs in a bipolar pattern (HARRIS et al. 1999 ; MOMANY and TAYLOR 2000 ). Along the hyphae, septa are laid down at regular intervals and nuclei are evenly distributed (FIDDY and TRINCI 1976 ; TRINCI and MORRIS 1979 ). The temperature-sensitive swoC1 mutant of A. nidulans was isolated on the basis of its isotropic (swollen) phenotype in a screen to identify genes involved in polar growth (MOMANY et al. 1999 ).

Polarity genes in filamentous fungi are proposed to fall into two categories (MOMANY et al. 1999 ; MOMANY 2002 ): those responsible for establishing a location where a germ tube will emerge (polarity establishment genes) and those responsible for maintaining this directed polar growth (polarity maintenance genes). Previous work showed that the swoC1 mutant is not able to establish polarity, but is able to maintain polarity at restrictive temperature and thus is a polarity establishment mutant (MOMANY et al. 1999 ). The genetic analysis of polarity in yeast and filamentous fungi has shown that the cytoskeleton, Bud proteins, and members of G protein and mitogen-activated protein kinase signaling pathways play major roles in polarity generation (RASMUSSEN et al. 1992 ; ROBERTS and FINK 1994 ; BACHEWICH and HEATH 1998 ; CHANT 1999 ; ROZE et al. 1999 ; PRUYNE and BRETSCHER 2000 ; WENDLAND and PHILIPPSEN 2001 ; MOMANY 2002 ).

Surprisingly, we found that the swoC polarity establishment gene encodes a homolog of Saccharomyces cerevisiae Cbf5p. Originally discovered by its affinity to the yeast centromere, Cbf5p is the pseudouridine synthase responsible for isomerization of uridine to pseudouridine in rRNA (LAFONTAINE et al. 1998 ; WATKINS et al. 1998 ; ZEBARJADIAN et al. 1999 ; WATANABE and GRAY 2000 ). In eukaryotes, rRNA is transcribed by RNA polymerase I and undergoes a series of modifications and cleavages to produce 18S, 5.8S, and 28S mature rRNAs. Isomerization of uridine to pseudouridine is one of the most abundant post-transcriptional modifications and mostly occurs in the large subunit of ribosomal RNA (reviewed by CHARETTE and GRAY 2000 ).

The biological role of pseudouridine is not yet clear. Recent evidence suggests that pseudouridine is not essential for ribosomal functions. Yeast depleted of virtually all pseudouridine residues in rRNA are viable (BOUSQUET-ANTONELLI et al. 1997 ). Nonetheless, deletion of CBF5 is lethal (GANOT et al. 1997 ), suggesting that Cbf5p must have functions other than pseudouridine synthesis. Indeed, yeast Cbf5p has been shown to associate with microtubules (JIANG et al. 1993 ), Pol I transcription factor (CADWELL et al. 1997 ), and snR30, which is involved in pre-RNA endonucleolytic processing (LAFONTAINE et al. 1998 ). The human homolog Dkc1p binds hTR (the RNA component of human telomerase complex) and plays an important role in telomere maintenance (MARCINIAK et al. 2000 ; DEZ et al. 2001 ). Mutations of DKC1 cause the X-linked recessive diseases dyskeratosis congenita (HEISS et al. 1998 ) and Hoyeraal-Hreidarsson syndrome (YAGHMAI et al. 2000 ). Patients with these diseases have a rare bone-marrow failure disorder and early mortality.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Strains and media:
Strains used in this study were: A104 (yA2; adE20; AcrA1; phenA2; pyroA4; lysB5; sB3; nicB8; coA1), A457 (proA1; biA1; galE9; sC12; diA1; phenA2; choA1), A773 (pyrG89; wA3; pyroA4), A852 (biA1;argB::trpCB;methG1;veA1; trpC801\\\\pabaA1 yA2; argB::trpCB;veA1; trpC801), AGA22 (swoC1; pabaA), and AXL8 (swoC1; pyroG89, wA3; pyroA4). All strains were obtained from the Fungal Genetics Stock Center (Department of Microbiology, University of Kansas Medical Center) except AGA22 and AXL8, which were constructed for this study. Identification of the temperature-sensitive swoC1 mutant and verification that it is a single-gene mutation have been previously described (MOMANY et al. 1999 ). Media used were as previously reported (HARRIS et al. 1994 ). Strain construction and genetic analysis were by standard A. nidulans techniques (KAFER 1977 ; HARRIS et al. 1994 ).

Growth conditions and microscopic observation:
Vegetative growth: Conditions for vegetative growth and preparation of cells were as previously reported (MOMANY et al. 1999 ). Briefly, conidia were inoculated on coverslips in liquid medium and incubated in a petri dish. Cells were fixed, nuclei were stained with Hoechst 33258 (Sigma, St. Louis), and septa were stained with calcofluor (American Cyanamid, Wayne, NJ). Microscopic observations were made using a Zeiss (Thornwood, NY) Axioplan microscope and digital images were acquired using an Optronics (Goleta, CA) digital imaging system. Images were prepared using Photoshop 5.5 (Adobe, Mountain View, CA).

Conidiation: Conidia were inoculated on the edges of a small square of agar medium placed on top of a coverslip, which was placed in a petri dish containing solidified agar to keep it moist. Another coverslip was placed on top of the agar square after inoculation. Plates were sealed with parafilm, incubated inverted at 42° for 9 hr, and then shifted to 30° for 2 days. For observation of conidiophore structure, coverslips with aerial hyphae and conidiophores attached were dipped into 100% ethanol, mounted on slides, and observed microscopically. Otherwise, cells attached to coverslips were fixed and stained as described for vegetative growth.

FM4-64 staining:
Complete liquid medium with proper supplements was inoculated with 1–5 x 10⁴ conidia/ml, poured into a petri dish containing a glass coverslip, and incubated as indicated. Coverslips with adhering cells were labeled with 20 µM FM4-64 (Molecular Probes, Eugene, OR) solution for 30 min at the indicated temperature. NaZ₃ (10 mM) was added to stop the labeling. A 20 µM FM4-64 solution with 10 mM NaZ₃ was used as control.

DNA and RNA isolation:
DNA was isolated from A. nidulans using previously described methods (HARRIS et al. 1994 ). Total RNA from A. nidulans was extracted using Trizol reagent according to the manufacturer's instructions (GIBCO BRL, Grand Island, NY).

Cloning by complementation and plasmid rescue:
A random genomic plasmid library carrying a pryG marker provided by Greg May (University of Texas, M. D. Anderson Cancer Center, Houston; OSHEROV and MAY 2000 ) was transformed into protoplasts of the swoC1 mutant AXL8 by standard A. nidulans protocols (YELTON et al. 1984 ). Transformants with pyrG prototrophy restored to wild-type growth at restrictive temperature (42°) were selected. The complementing plasmids were rescued by transformation of Escherichia coli XL1-blue with total DNA purified from the A. nidulans transformants. Restriction mapping showed that all the complementing plasmids contained the same fragment with overlapping genomic DNA inserts (data not shown). The smallest complementing plasmid, p8c1, was chosen for further study.

Confirmation of complementation by map-based cloning:
Mitotic mapping: The swoC1 mutant strain AGA22 (swoC1; pabaA) was fused with mitotic mapping strain A104 (yA2; adE20; AcrA1; phenA2; pyroA4; lysB5; sB3; nicB8; coA1) by standard methods (MA and KAFER 1974 ; KAFER 1977 ). Diploid conidia were incubated on solid complete medium containing 60 µg/ml benomyl for 2 days and transferred to complete medium without benomyl for 2 weeks. Genotypes of the resulting haploid sectors were scored. Of 300 haploid sectors, only 28 showed swoC1 ts- phenotype, which may be caused by reduced viability of the ts- strain. The percentages of haploid sectors with the swoC1 ts- phenotype segregated in repulsion to markers adE20^- (chromosome I), acrA^r (chromosome II), phenA2^- (chromosome III), pyroA4^- (chromosome IV), lysB5^- (chromosome V), sB3^- (chromosome VI), and nicB8^- (chromosome VII) were 57, 43, 100, 54, 78, 75, and 54%, respectively. The chromosome VIII marker in the mitotic mapping strain A104 has a ts- phenotype (compact morphology), which makes it impossible to score at the same time as swoC1 (ts-).

Meiotic mapping: The swoC1 mutant strain AGA22 (swoC1; pabaA) was crossed with meiotic mapping strain A457 (proA1; biA1; galE9; sC12; diA1; phenA2; choA1). Ascospores (n = 350) released from individual cleistothecia were plated on selective media to test genotypes, and map units between swoC1 and other markers were calculated on the basis of recombination frequency of ts- strains. Only 59 of the progeny were ts-, which may be caused by reduced viability of the ts- strain. Map units between swoC1 and choA1, galE9, sC12, and phenA2 were 50, 30.5, 25.4, and 0, respectively.

Cloning of swoC: The swoC gene is tightly linked to the phenA marker, which is located near the centromere of chromosome III. On the basis of the physical map of A. nidulans (http://gene.genetics.uga.edu/), 20 cosmids near the centromere from the chromosome-specific genomic library (Fungal Genetics Stock Center, http://www.fgsc.net/) were chosen to transform into the swoC1 mutant. Only cosmid W21H06 restored the swoC1 mutant to wild-type growth at restrictive temperature. Southern blotting experiments (SAMBROOK et al. 1989 ) showed that cosmid W21H06 contains the same fragment as p8c1 and the two other complementing plasmids (data not shown).

Identification and sequencing of the swoC gene by transposon tag:
Transposons (GPS-1 system; New England Biolabs, Beverly, MA) were randomly inserted into the complementing plasmid p8c1. Each of the resulting plasmids contains one copy of the transposon at random sites. Forty-eight plasmids were sequenced using primers unique for the transposon ends on an ABI 3700 DNA Analyzer (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions.

The sequences were assembled and analyzed using the Phred (version 0.000925c), Phrap (version 0.990319), and Consed (version 11.0) computer programs (http://depts.washington.edu/ventures/collabtr/direct/ppccombo.htm). All sequences have at least fourfold redundancy with a quality rating of at least 20. The assembled contig was used to search the National Center for Biotechnology Information (NCBI) databases (www.ncbi.nlm.nih.gov), using the Blast program to identify open reading frames (ORFs). Only one ORF was found. Plasmids with transposons inserted within the ORF were transformed into the swoC1 mutant. Plasmids that failed to rescue the swoC1 mutant at restrictive temperature were assumed to have transposon insertions disrupting the complementing gene. The genomic sequence of the swoC gene, its intron locations, and the predicted protein sequence were deposited in GenBank (accession no. AY057454).

Sequencing of the swoC1 mutant allele:
The swoC1 mutant allele was amplified by three independent PCR reactions using the Expand high-fidelity PCR system (Roche Diagnostics, Indianapolis) and cloned into the pGEM-T vector system (Promega, Madison, WI). Genomic DNA from swoC1 mutant strain AXL8 was used as the template. Primers used for PCR amplifications were 5' GAATGTTTACGCAGGTGG and 5' GTGGCTTGTGATGATGCGG. Three clones from each reaction (nine in total) were sequenced using the transposon strategy described above. All sequences showed an identical change in base 1220 (G to T) of swoC1. The sequences obtained were compared with the wild-type allele using GeneDoc (version 2.6.001) (www.psc.edu/biomed/genedoc) with default parameters.

Protein alignment:
Sequences of SwoCp homologs were obtained from GenBank (http://www.ncbi.nlm.nih.gov/). Intron locations in swoC were based on alignments with homologs and presence of consensus splice sites (BALLANCE 1986 ). Protein sequences were aligned using GeneDoc (version 2.6.001) with default parameters.

Pseudouridine analysis by HPLC-MS:
Enzymatic digestion of 100 µg total RNA by nuclease P1 (Sigma), phosphodiesterase I (Sigma), and alkaline phosphatase (Sigma) was conducted as previously described (POMERANTZ and MCCLOSKEY 1990 ). The pseudouridine level of the hydrolates was analyzed by HPLC-mass spectrometry (MS) basically as previously described (POMERANTZ and MCCLOSKEY 1990 ) by the Chemical and Biological Sciences Mass Spectrometry Facility, University of Georgia (http://www.uga.edu/mass-spec/). Standards (adenosine, cytidine, guanosine, pseudouridine, and uridine) were used to determine the optimal gradient conditions for separation. Peaks were identified by their retention time and mass spectrum. The experiment was repeated three times with the same results.

Northern hybridization:
Total RNA was isolated from wild-type A773 and swoC1 mutant AXL8 cultured in complete medium at 42°. RNA was separated on a 1.2% formaldehyde agarose gel and transferred to a nylon membrane by standard methods (SAMBROOK et al. 1989 ). The following probes were generated on the basis of A. nidulans 18S, ITS1, ITS2, and 25S rRNA sequences, respectively: probe 1, CTCCCCGCCGAAGCAACAGTG; probe 2, GAGCCATTCGCAGTTTCACAG; probe 3, GACGACGACCCAACACACAAGC; and probe 4, CACTCTACTTGTGCGCTATCGGTC. Probes were labeled at the 5' end by T4 polynucleotide kinase (Roche) according to the manufacturer's instructions.

Construction of swoC knock out:
Flanking sequences from upstream and downstream of the swoC gene (1.1 kb each) were amplified by high-fidelity PCR. Primers used to amplify the 5' flanking sequence of swoC were 5' CCGCTCGAGGGTGAATGTTTACGCAGGTGGTTTTGG (with the addition of the XhoI restriction site) and 5' GGAATTCCGGCCATTGCGACTGTTATTGAG (with the addition of the EcoRI restriction site). Primers used to amplify the 3' flanking sequence of swoC with the addition of SacII restriction sites were 5' TCCCCGCGGCGACCAAATGGAAGTCCGAATAC and 5' CCCCGCGGGGACTAACGTCAAGTGTGGCGAGTG. After double digestion with EcoRI and XhoI, the 5' flanking sequence was inserted into pargBC-1 (MOMANY and HAMER 1997 ) bearing the argB gene as the selectable marker. The resulting plasmid pargBC-5F was then ligated with the 3' flanking sequence after digestion with SacII. Correct insert direction of the 3' flanking sequence was confirmed by restriction mapping and PCR. The plasmid pargBC-5F-3F was then digested with BssHII and separated on a 1% agarose gel. The 4.2-kb fragment containing argB with swoC flanking sequences (5F-argB-3F) was purified using the QIAGEN (Valencia, CA) gel purification kit.

The linear fragment containing 5F-argB-3F was transformed into A. nidulans diploid strain A852. Transformants were selected for growth on minimal medium lacking arginine. Genomic DNA of 72 transformants was isolated and digested with KpnI. Southern blot was performed with random-labeled 3' flanking sequence as the probe. Putative homologous integrants were confirmed by Southern blot with BamHI and KpnI double digestion. A single heterozygous diploid transformant with argB replacing swoC on one chromosome and a wild-type swoC on the other was treated with benomyl to induce haploidization as described for mitotic mapping. In total, 206 haploid sectors were scored for genotype. None of the haploid colonies grew on minimal medium without arginine supplement.

Construction of the swoC C-terminal deletion allele:
The construction of the C-terminal deletion allele was essentially the same as the null allele except that the truncated swoC gene lacking the final 294 bases was inserted into pargBC-1 (MOMANY and HAMER 1997 ) after double digestion with EcoRI and PstI. This swoC C-terminal deletion fragment was amplified by high-fidelity PCR using primers 5' CTGCAGTGATGGTCAGGACTGG and 5' AACTGCAGAACCAATCCATTGGGGCTGGGGTGGCTTCGTTGG (with addition of the PstI site). The resulting plasmid pargBC-N-swoC was ligated with the 3' flanking sequence as described above. The linear fragment containing truncated-swoC-argB-3F was transformed into A. nidulans diploid strain A852. Screening and confirmation were performed essentially as described for the null mutant construct.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Phenotypic characterization of the swoC1 mutant
Nuclear division is uncoupled from polarity establishment in the swoC1 mutant: Previous work has shown that uninucleate spores switch from isotropic to polar growth after the first round of mitosis in wild-type A. nidulans (MOMANY and TAYLOR 2000 ) (Fig 1, a and b). In the current study, 80% of swoC1 mutant spores did not switch to polar growth until the second round of mitosis at 30° (Fig 1C and Fig D). This observation suggests that nuclear division and polar growth are uncoupled in the swoC1 mutant even at permissive temperature.

View larger version (58K): In this window In a new window Download PPT slide   Figure 1. Polarity establishment is delayed in the swoC1 mutant. Conidia of wild-type A773 and swoC1 mutant AXL8 were incubated for 6 hr (a and b) and 8 hr (c and d), respectively, at permissive temperature (30°), fixed, and stained with Hoechst 33258. (a and b) wild type; (c and d) swoC1 mutant. The top and bottom rows show differential interference contrast (DIC) and fluorescent images of the same field. Bar, 5 µm.

Previous work has shown that the swoC1 mutant grows isotropically at restrictive temperature (42°) for 13 hr and accumulates six nuclei on average (MOMANY et al. 1999 ). To determine if the swoC1 mutant arrests isotropic growth upon extended incubation, we observed the growth of swoC1 after 24 hr incubation at restrictive temperature. We found that the swoC1 mutant grew into giant, balloon-like cells and accumulated a large number of nuclei (Fig 2B and Fig C). Some cells were at least 15 times larger than a wild-type conidium and contained >30 nuclei. Even after 53 hr at restrictive temperature, about half of the population survived (data not shown), indicating that the mutant is viable and nuclear division is not blocked by the polar growth defect. This supports our previous assertion that polar growth and nuclear division are carried out by two independent pathways in A. nidulans (MOMANY and TAYLOR 2000 ).

View larger version (46K): In this window In a new window Download PPT slide   Figure 2. The swoC1 mutant continues isotropic growth with extended incubation at restrictive temperature. Conidia of (a) wild-type A773 and (b and c) swoC1 mutant AXL8 were incubated at restrictive temperature (42°) for (a and b) 12 hr or (c) 24 hr, fixed, and stained with Hoechst 33258. The top and bottom rows show DIC and fluorescent images of the same field. Bar, 5 µm.

The swoC1 mutant sends out multiple germ tubes simultaneously at random sites: Previous work concluded that the swoC1 mutant does not establish polarity at restrictive temperature on the basis of failure to send out germ tubes within 2 hr (just over one cell cycle) after shift from restrictive to permissive temperature (MOMANY et al. 1999 ). To determine if the swoC1 mutant loses the competence for polar growth after sustained isotropic expansion, the swoC1 mutant was incubated at restrictive temperature for 4, 10, and 24 hr (Fig 3, a–c) and then shifted to permissive temperature for 10 hr (several cell cycles). The swoC1 mutant sent out germ tubes in all cases (Fig 3, d–f). Even after 53 hr at restrictive temperature, mutant cells sent out germ tubes upon temperature shift (data not shown). This suggests that the competence for polar growth either is retained in the swoC1 mutant at restrictive temperature or can be established after release of the temperature block. Interestingly, the longer the incubation at restrictive temperature, the more germ tubes the swoC1 mutant sent out after shift to permissive temperature (Fig 3). To determine if these multiple polarity sites are activated simultaneously after the temperature block is released, we incubated the swoC1 mutant at restrictive temperature for 20 hr and shifted to permissive temperature for 3 hr (more than one cell cycle). We found that many germ tubes emerged at random sites (Fig 3G). Because these germ tubes were all the same length after 3 hr growth at permissive temperature, we assume that they emerged simultaneously. In contrast, in wild-type A. nidulans, germ tubes emerge sequentially, usually in a bipolar pattern (Fig 2A; HARRIS et al. 1999 ; MOMANY and TAYLOR 2000 ). Our results show that more than one polarity apparatus may form simultaneously in the swoC1 mutant and suggest that polarity establishment may be tied to membrane volume.

View larger version (137K): In this window In a new window Download PPT slide   Figure 3. The swoC1 mutant sends out multiple germ tubes after extended incubation at restrictive temperature. Conidia of swoC1 mutant AXL8 were incubated at restrictive temperature (42°) for (a) 4 hr, (b) 10 hr, and (c) 24 hr and shifted to permissive temperature (30°) for 10 hr (d, e, and f, respectively). (g) Conidia of swoC1 mutant AXL8 were incubated at restrictive temperature (42°) for 20 hr and shifted to permissive temperature (30°) for 3 hr. Bars, 5 µm.

The swoC1 mutant is defective in endocytosis: One possible explanation for a connection between increased membrane volume and increased germ tube emergence in the swoC1 mutant would be a failure to remove accumulated polarity establishment markers from the plasma membrane during isotropic expansion. Indeed in S. cerevisiae, an endocytic block causes isotropic cell growth, similar to the swoC1 mutant swollen phenotype (reviewed by PRUYNE and BRETSCHER 2000 ). To investigate endocytosis of the swoC1 mutant we used FM4-64, a membrane-selective dye that is internalized from the plasma membrane to internal membranes of organelles by endocytosis (VIDA and EMR 1995 ) and has been used to investigate endocytosis and vesicle trafficking in filamentous fungi (FISCHER-PARTON et al. 2000 ). Wild type and the swoC1 mutant were incubated at restrictive temperature, and cells were labeled with FM4-64 for 30 min. In the presence of NaZ₃, the metabolic inhibitor, FM4-64 labeled only the plasma membrane of wild type and the swoC1 mutant (Fig 4B and Fig D). In the absence of NaZ₃, FM4-64 labeled plasma membrane and internal organelles of wild type during both isotropic growth and polar growth (Fig 4C). Under the same conditions, FM4-64 labeled only the plasma membrane of the swoC1 mutant (Fig 4A), showing that the swoC1 mutant is defective in endocytosis at restrictive temperature.

View larger version (38K): In this window In a new window Download PPT slide   Figure 4. The swoC1 mutant is defective in endocytosis. Conidia of wild-type A773 and swoC1 mutant AXL8 were incubated at 42° for 16 hr and treated with 20 µM FM4-64 or 20 µM FM4-64 with 10 mM NaZ3 for 30 min. (a) swoC1; (b) swoC1 with NaZ3; (c) wild type (inset: wild type growing isotropically at 42° for 4 hr); (d) wild type with NaZ3. Bars, 5 µm.

Early delay in polarity establishment causes a nuclear distribution defect during vegetative growth and conidiation in the swoC1 mutant: To determine whether an early delay in polarity establishment affects later vegetative growth, we incubated wild type and swoC1 at restrictive temperature for 9 hr (the swoC1 mutant averaged four nuclei) and shifted to permissive temperature for 15 hr. We measured the length and nuclear number of subapical compartments (n = 120). Subapical compartment length and nuclear number were relatively uniform in the wild type and in the swoC1 mutant grown at permissive temperature for the duration of the experiment (Fig 5 and data not shown). However, subapical compartment length and nuclear number varied greatly in the swoC1 mutant after temperature downshift (Fig 5). Occasionally, we observed compartments without nuclei in the mutant (Fig 5A, Fig C). Empty compartments were never observed in wild type. In wild type, the majority of compartments were between 10 and 60 µm with 60% falling between 30 and 40 µm and 23% falling between 40 and 50 µm (Fig 5B). In the swoC1 mutant after temperature downshift, subapical compartment length ranged from <10 µm to >110 µm with only 26% falling between 30 and 40 µm, and 20% falling between 40 and 50 µm. In wild type, nuclear number per compartment was between 1 and 7, with 87% of compartments containing two to four nuclei (Fig 5C). In swoC1, however, nuclear number per compartment ranged from 1 to 20, with only 47% of compartments containing two to four nuclei. The compartment length variation in the swoC1 mutant probably reflects nuclear position variation since in this filamentous fungus, the site of septation is determined by nuclear position (WOLKOW et al. 1996 ).

View larger version (17K): In this window In a new window Download PPT slide   Figure 5. The swoC1 mutant shows variation in subapical compartment length and nuclear number after a delay in polarity establishment. Conidia of wild-type A773 and swoC1 mutant AXL8 were incubated at restrictive temperature (42°) for 9 hr and shifted to permissive temperature (30°) for 15 hr. Cells were fixed and stained with Hoechst 33258 and calcofluor. Nuclear number per compartment and compartment length were measured (n = 120). (A) Micrographs of swoC1 (a–c) and wild type (d): (a) swoC1 compartment with crowded nuclei; (b) swoC1 compartment with 10 nuclei; (c) swoC1 compartment with no nuclei; (d) wild-type compartments with relatively uniform length and two to four nuclei. Arrows point to septa. Bar, 5 µm. (B) Compartment length. (C) Number of nuclei per compartment.

In wild-type A. nidulans, asexual reproduction produces uniform uninucleate conidia on a reproductive structure called the conidiophore (TIMBERLAKE 1991 ; ADAMS et al. 1998 ). Conidiophore development starts as aerial hyphae elongate and swell at the tip to form a vesicle (Fig 6A). From the vesicle forms a layer of primary sterigmata called metulae (Fig 6B). The metulae bud twice to form a layer of uninulceate phialides (Fig 6C). The phialides produce chains of uninucleate conidia after repeated mitotic division and cytokinesis (Fig 6D). Mitosis, nuclear migration, and cytokinesis must be tightly coordinated to ensure normal conidiation. To determine whether an early delay in polarity establishment affects asexual reproduction in the swoC1 mutant, we incubated wild type and the swoC1 mutant at restrictive temperature for 9 hr, shifted to permissive temperature for 2 days, and observed conidiophores. After this slight delay in polarity establishment, all mutant conidiophores (n > 50) appeared to be missing cell layers (Fig 6G and Fig H). About 5.5% of swoC1 conidia contained more than one nucleus and 4.5% contained no nucleus (n = 200). The swoC1 mutant incubated only at permissive temperature showed lower levels of these morphological defects with 1% of conidia containing more than one nucleus or no nucleus (data not shown).

View larger version (158K): In this window In a new window Download PPT slide   Figure 6. The swoC1 mutant shows abnormal conidiation after a delay in polarity establishment. (a–d) Wild-type A773 and (e–h) swoC1 mutant AXL8 were grown at 42° for 9 hr and shifted to 30° for 2 days. Cells were fixed in 100% ethanol. (a) Vesicle; (b) metulae; (c) phialides; (d) chains of conidia; (e) metulae; (f–h) chains of conidia. Bar, 10 µm.

The swoC gene encodes rRNA pseudouridine synthase
The swoC gene maps near the centromere of chromosome III: To identify the chromosome on which the swoC gene lies, we took advantage of the parasexual cycle in A. nidulans (KAFER 1977 ). A heterozygous diploid was made between the swoC1 mutant strain AGA22 and the mitotic mapping strain A104, which has a marker on each chromosome. The diploid was treated with the microtubule-destabilizing drug benomyl to stimulate chromosome loss until a stable haploid state was reached. The chromosomes in each haploid sector are expected to represent a random mixture derived from either the swoC1 mutant or the mitotic mapping strain. The genotypes of all haploid sectors were scored. The phenA2 marker on chromosome III segregated 100% in repulsion to the swoC1 temperature-sensitive phenotype in these haploid sectors. Therefore the swoC gene is on chromosome III.

To define the position of the swoC gene on chromosome III, the swoC1 mutant strain AGA22 was crossed with the meiotic mapping strain A457. The distance between the swoC1 allele and other markers on chromosome III was determined by recombination frequency. The swoC1 allele was tightly linked to the phenA2 marker near the centromere of chromosome III.

The swoC gene encodes a homolog of rRNA pseudouridine synthase: On the basis of the physical map of A. nidulans (http://gene.genetics.uga.edu/), 20 cosmids near the centromere of chromosome III were chosen from the chromosome-specific library and transformed into the swoC1 mutant. Only cosmid W21H06 complemented the swoC1 ts- phenotype.

In a separate experiment, three autonomously replicating plasmids from a random plasmid library were also found to restore the swoC1 mutant to wild-type growth at restrictive temperature. Restriction mapping showed that these three plasmids contained overlapping genomic DNA inserts (data not shown).

Southern blotting indicated that the three high-copy plasmids shared a common fragment with the W21H06 cosmid (data not shown), showing that the plasmids contain the authentic swoC gene, rather than a suppressor of the swoC1 mutation. The smallest plasmid, p8c1, was chosen for sequencing using a transposon-tagging strategy. Only one ORF was identified in the 8-kb A. nidulans genomic DNA insert in plasmid p8c1. This is not surprising since the swoC gene localizes to the gene-poor centromere-proximal region. Using the NCBI Blast program, the predicted SwoCp was found to be 70% identical with S. cerevisiae Cbf5p, 71% identical with Kluyveromyces lactis Cbf5p, and 63% identical with Homo sapiens Dkc1p (Fig 7). All are members of a highly conserved family of eukaryotic rRNA pseudouridine synthases. Like other members of this family, SwoCp contains serveral predicted domains: a pseudouridylate synthase domain (TruB), an RNA-binding domain (PUA), a microtubule (MT)-binding domain, a nuclear localization signal (NLS), and a coiled-coil protein-protein interaction domain (Fig 7).

View larger version (88K): In this window In a new window Download PPT slide   Figure 7. Alignment of rRNA pseudouridine synthases. SwoC1p is from A. nidulans (accession no. AY057454), KlCbf5p is from K. lactis (accession no. O13473), ScCbf5p is from S. cerevisiae (accession no. NP_013276), and Dkc1p is from H. sapiens (accession no. O60832). Black background indicates identical or highly similar residues. Dark and light gray backgrounds indicate 75 and 50% shared similar residues, respectively. Position of E10 Tn insertion is indicated by an arrow below the sequence. The swoC1 V338F mutation is indicated by an asterisk and an F below the sequence. The positions of predicted motifs are indicated by the broken line beneath the sequence and labeled as follows: TRUB, pseudouridylate synthase domain; PUA, RNA-binding domain; MT-binding, microtubule-binding domain; NLS, nuclear localization signal; coiled-coil, protein-protein interaction domain.

Sequencing of the swoC1 mutant allele amplified from strain AXL8 by PCR showed a G-to-T mutation at base 1220, which results in a valine-to-phenylalanine substitution at amino acid 338 in the predicted PUA domain.

Deletion of the swoC gene is lethal in A. nidulans: Even though elimination of all detectable pseudouridine residues in rRNA from S. cerevisiae has no phenotype (BOUSQUET-ANTONELLI et al. 1997 ), deletion of the CBF5 gene is lethal in yeast (GANOT et al. 1997 ). rRNA pseudouridine synthase knock-out mutants have not yet been described for other organisms. Because we expected that deletion of swoC was likely to be lethal in A. nidulans, we constructed a heterozygous diploid wherein one copy of the swoC gene was replaced with the argB marker by homologous integration (Fig 8). We induced haploidization of the heterozygous diploid and scored haploid sectors (KAFER 1977 ). None of the 206 haploid sectors recovered was argB+, indicating that only haploids with the intact swoC gene survived. Therefore, the swoC gene is essential in A. nidulans.

View larger version (32K): In this window In a new window Download PPT slide   Figure 8. Heterozygous diploid strains with swoC null allele and C-terminal deletion allele. Left, the Southern blot (1) heterozygous diploid with one copy of swoC replaced by argB and (2) the heterozygous diploid with argB replacing the C terminus of swoC. Genomic DNA was digested with KpnI and probed with randomly labeled 3' flanking sequence. Sizes (kilobases) based on molecular markers are shown at left. Right, the restriction map of (a) wild-type swoC, (b) argB replacement of swoC, and (c) argB replacement of swoC C terminus. Fragment sizes after restriction digestion are indicated at the bottom. K, KpnI; 5F and 3F, 5' and 3' flanking sequences, respectively.

The C terminus of SwoCp is dispensable: To determine which portion of the swoC gene is required to complement the swoC1 mutation, we took advantage of the transposon inserts in plasmid p8c1 created for sequencing swoC. Two p8c1 plasmids with transposons in the first exon and the third exon (p8c1-A11) of the gene were not able to restore the swoC1 mutant to wild-type growth at restrictive temperature (Fig 9C and data not shown). The p8c1 plasmid with a transposon in the first intron (p8c1-H07) also did not complement the swoC1 phenotype (Fig 9B), likely because A. nidulans, which usually has 40- to 100-bp introns, could not properly process the 5-kb intron resulting from transposon insertion. Most interestingly, the plasmid p8c1 with a transposon in the C terminus (p8c1-E10) complemented the swoC1 phenotype (Fig 9A). The E10 insertion is predicted to remove 98 amino acids from the C terminus of the encoded protein including the MT-binding domain, NLS, and coiled-coil domain. Distribution of nuclei and compartment length were similar in swoC1 mutant strains transformed with either the intact p8c1 or p8c1-E10 (data not shown). Two explanations are possible: either the C terminus is not essential for SwoCp or the truncated swoC gene product can function together with the swoC1 mutated gene product to restore the wild-type phenotype. To distinguish between these explanations, we constructed a heterozygous diploid wherein the C terminus of one copy of the swoC gene was replaced with the argB marker by homologous integration (Fig 8). We induced haploidization of the heterozygous diploid and scored haploid sectors (KAFER 1977 ). Of 380 haploid sectors recovered, 327 haploid sectors were argB+, indicating that the C terminus is, indeed, dispensable.

View larger version (28K): In this window In a new window Download PPT slide   Figure 9. Transposon insertions affect the ability of p8c1 to complement swoC1. The swoC1 mutant carrying p8c1 with transposon insertions was grown at restrictive temperature (42°) for 2 days. The swoC1 mutant was transformed with (a) p8c1-E10, (b) p8c1-H07, (c) p8c1-A11, (d) p8c1, and (e) no plasmid. Positions of insertions are indicated diagrammatically at right. Shaded bars, exons; solid lines, introns.

The swoC1 mutant shows no detectable defect in pseudouridine synthesis or rRNA processing: Pseudouridination is one of the two most abundant nucleic acid modifications and occurs predominantly in rRNA (MADEN and HUGHES 1997 ; OFENGAND 2002 ). In eukaryotes, 1% of rRNA nucleic acids are pseudouridines (reviewed by CHARETTE and GRAY 2000 ; OFENGAND 2002 ). Evidence suggests that the box H/ACA small nuclear ribonucleoprotein particles (snRNPs) may be the universal complex responsible for all eukaryotic rRNA pseudouridine synthesis using boxH/ACA snRNAs as a guide and Cbf5p as the key enzyme in the complex (BOUSQUET-ANTONELLI et al. 1997 ; PECULIS 1997 ; LAFONTAINE et al. 1998 ; WATKINS et al. 1998 ; ZEBARJADIAN et al. 1999 ; CHARETTE and GRAY 2000 ; WATANABE and GRAY 2000 ; YANG et al. 2000 ; PIENKOWSKA and SZWEYKOWSKA-KULINSKA 2001 ; OFENGAND 2002 ). To determine if A. nidulans uses the same box H/ACA snRNP complex for rRNA pseudouridine synthesis, we searched A. nidulans databases and found homologs of other genes predicted to encode box H/ACA snRNP proteins (Gar1p, Nhp2p, and Nop10p) in addition to SwoCp. The presence of these highly conserved proteins makes it very likely that A. nidulans uses the same mechanism for rRNA pseudouridine synthesis.

Since >90% of total RNA is rRNA, we expected to see a gross decrease of pseudouridine in total RNA if the swoC1 phenotype is due to loss of pseudouridine synthesis activity. Total RNA isolated from overnight cultures of wild type and the swoC1 mutant grown at restrictive and permissive temperatures was enzymatically digested. We used HPLC coupled with MS to separate and identify pseudouridine. HPLC has long been used to detect modified nucleic acids (RUSSO et al. 1984 ; AMURO et al. 1988 ; POMERANTZ and MCCLOSKEY 1990 ; UMEGAE et al. 1990 ; PALMISANO et al. 1995 ; SHINGFIELD and OFFER 1999 ; PATTESON et al. 2001 ). Three independent experiments showed that pseudouridine levels were similar in the swoC1 mutant and wild type at both temperatures (Fig 10 and data not shown). The other major modified nucleic acid, 2'-O-methylated adenosine, was also detected in both the swoC1 mutant and wild type, indicating that our analysis was adequately sensitive (Fig 10). These results suggest that the swoC1 mutation does not grossly affect pseudouridine synthesis in vivo.

View larger version (21K): In this window In a new window Download PPT slide   Figure 10. The swoC1 mutant shows normal pseudouridine level. Total RNA was isolated from wild type and swoC1 incubated at 42° for 18 hr, enzymatically digested, and analyzed by HPLC-MS. Numbered peaks were identified by MS as follows: (1) pseudouridine, (2) cytidine, (3) uridine, (4) guanosine, (5) adenosine, and (6) 2'-O-methylated adenosine.

In S. cerevisiae, certain mutations in CBF5 cause defects in pre-rRNA processing and steady-state levels of mature cytoplasmic ribosomes (CADWELL et al. 1997 ). To determine if the swoC1 mutant phenotype could be caused by defective rRNA processing, we isolated total RNA from the swoC1 mutant and wild type and probed with oligonucleotides designed on the basis of 18S, ITS1, ITS2, and 25S sequences of A. nidulans (LAFONTAINE et al. 1998 ). The swoC1 mutant and wild type showed identical band size and intensity of mature rRNA products (data not shown) and accumulation of pre-rRNA was not detected. A Northern blot probed with ITS1-5.8S-ITS2 PCR product also showed no difference between wild type and the swoC1 mutant cultured at restrictive temperature. These results suggest that rRNA processing is normal in the swoC1 mutant, consistent with our observation that at restrictive temperature the swoC1 mutant has sustained isotropic growth. Sustained growth is unlikely to occur if there is a severe defect in rRNA processing since breaking dormancy and growing isotropically both require protein synthesis (HERMAN and RINE 1997 ; WENDLAND 2001 ).

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Polarity establishment cues persist or are reinitiated in swoC1:
In S. cerevisiae, budding occurs once in each cell cycle. Sites for bud emergence are tagged by cortical markers laid down during the previous round of budding. Cdc42p is recruited to these sites, where it drives polar growth through interactions with the cytoskeleton and polarity maintenance apparatus (MADDEN and SNYDER 1992 ; ZIMAN et al. 1993 ; KRON et al. 1994 ; CHANT et al. 1995 ; GOODSON et al. 1996 ; SHAFAATIAN et al. 1996 ; YABE et al. 1996 ; SANTOS and SNYDER 1997 ; MADDEN and SNYDER 1998 ; SHULMAN and ST. JOHNSTON 1999 ; SVOBODA et al. 2001 ). The identities of cortical polarity markers tagging the sites for germ tube emergence are not yet known in filamentous fungi. It is not clear whether the germ tube emergence marker is laid down during formation of the spore or after dormancy is broken (MOMANY 2002 ).

In the swoC1 mutant, an extreme delay in polarity establishment did not cause loss of competence for polar growth, suggesting that the underlying polarity markers either persist or can be formed despite a delay. While polar growth could still occur when swoC1 was shifted from restrictive to permissive temperature, the normal bipolar pattern of germ tube emergence was disrupted. We were especially surprised by the increase in the number of germ tubes with increased incubation time at restrictive temperature (Fig 3). Given the endocytosis defect of the swoC1 mutant, it is possible that new polarity markers are synthesized during incubation at restrictive temperature and that failure to remove these markers leads to the emergence of multiple germ tubes in random positions after release of the temperature block. It is also possible that the increased number of nuclei that accumulate in the swoC1 mutant at restrictive temperature triggers the synthesis of additional polarity markers. A. nidulans nud mutants also accumulate nuclei and send out multiple germ tubes when they polarize, though the mechanism is not clear (XIANG et al. 1999 ). In regenerating yeast protoplasts containing several nuclei, multiple buds emerged simultaneously at random sites thought to be determined by the positions of the nuclei (SVOBODA et al. 2001 ).

Delayed polarity establishment perturbs nuclear distribution and development in swoC1:
In wild-type A. nidulans the isotropic-to-polar switch normally occurs just after the first mitosis, when spores have two nuclei. Polar growth and nuclear division continue, nuclei become distributed evenly along the germ tube, and the hypha is partitioned by evenly spaced septa (HARRIS et al. 1994 ; MOMANY and TAYLOR 2000 ). Previous work has shown that although nuclear division and polar growth are coordinated, they are not dependent (MOMANY and TAYLOR 2000 ). The swoC1 mutant continues nuclear division in the absence of polar growth, consistent with the notion that nuclear division and polar growth employ independent pathways. Surprisingly, a slight delay in polarity establishment in the swoC1 mutant resulted in abnormally spaced nuclei and septa and conidiophores with missing layers. It is possible that the abnormal septal spacing and conidiophore development resulted from the subtle nuclear distribution defect. Nuclear positioning has been shown to determine the septation site in A. nidulans (WOLKOW et al. 1996 ) and conidiation requires coordination of growth, nuclear distribution, and cytokinesis (ADAMS et al. 1998 ). However, it is also possible that the swoC1 mutation affects an unidentified signal also involved in nuclear distribution, septation, and asexual development. Regardless of the mechanism, such clear morphological consequences of delayed polarity establishment suggest that spatial cues for development must be properly set up very early in hyphal growth.

The swoC1 phenotype is likely related to cryptic function in the PUA domain:
Surprisingly, the gene that complemented the swoC1 ts- phenotype was >60% identical with rRNA pseudouridine synthases from other eukaryotes. On the basis of our inability to detect any change in multiple activities associated with rRNA pseudouridine synthases, it is reasonable to propose that we cloned a suppressor rather than the authentic swoC gene. However, we genetically mapped the swoC1 mutation to the centromere of chromosome III. Only cosmid W21H06 from the chromosome III centromere region complemented the swoC1 ts- phenotype. The rRNA pseudouridine synthase gene from complementing plasmids hybridized to the W21H06 cosmid. In addition, sequencing revealed a point mutation in the PUA domain in the swoC1 mutant allele. Thus the rRNA pseudouridine synthase gene is the authentic swoC gene and not a suppressor.

If swoC encodes a pseudouridine synthase, why do we fail to detect any changes in pseudouridine levels or rRNA processing in the swoC1 mutant? The most obvious explanation is that the mutation affects some function of SwoCp other than pseudouridine synthesis. Mutations in the TruB catalytic sites of CBF5 inhibit pseudouridine synthesis and rRNA processing. Indeed, the TruB domain is intact in the swoC1 mutant allele. This is consistent with work on yeast Cbf5p and the E. coli pseudouridine synthase RluD, implying that the pseudouridine synthesis function of the enzyme is not critical for cell growth while the protein itself is essential (BOUSQUET-ANTONELLI et al. 1997 ; GUTGSELL et al. 2001 ; OFENGAND 2002 ).

Our results suggest that the unknown essential function of SwoCp may require the PUA domain. The swoC1 mutation occurs in the PUA domain, a conserved RNA-binding domain found in both archaea and eukaryotes (BECKER et al. 1997 ; ARAVIND and KOONIN 1999 ). Interestingly, another pseudouridine synthase in yeast, which modifies cytoplasmic and mitochondrial tRNAs, does not contain a PUA domain, consistent with the idea that the PUA domain may contribute to binding of a specific RNA structure (BECKER et al. 1997 ). The swoC1 V338F mutation may disrupt the ability of SwoCp to bind certain RNA substrates, while retaining the pseudouridine synthase enzyme activity. In X-linked dysteratosis congenita patients, many mutations of DKC1 occur in or around the PUA domain (KNIGHT et al. 1999 ). These mutations may alter the interaction of Dkc1p with telomerase hTR, which has a box H/ACA motif (MITCHELL et al. 1999 ). We did not detect any telomere length change in the swoC1 mutant after numerous replications at restrictive temperature (our unpublished observation).

It is possible that an RNA substrate of SwoCp other than box H/ACA snoRNA might be affected by the swoC1 mutation. Indeed, asymmetric distribution of RNA is critical for development in many organisms (MICKLEM 1995 ; STEPHEN et al. 1999 ; VAN EEDEN and ST. JOHNSTON 1999 ; STEBBINGS 2001 ). In Drosophila and Xenopus, mRNA localizes to opposite poles of the oocyte. Perhaps SwoCp participates in a similar asymmetric mRNA localization in A. nidulans development. It is also possible that the PUA domain might serve as a DNA-binding domain since yeast Cbf5p has been shown to bind centromere and kinetochore complexes in vitro (JIANG et al. 1993 ).

We cannot rule out the possibility that the swoC1 mutation does not directly cause the nonpolar phenotype. Many different mutations have been reported to result in a nonpolar phenotype. In yeast, defects in a 60S ribosomal subunit protein QSR1 (EISINGER et al. 1997 ), a C53 subunit of RNA polymerase (MANN et al. 1992 ), and a ubiquitin ligase SCF (PATTON et al. 2000 ) result in formation of large unbudded cells. In A. nidulans, two polarity-defective ts- mutants (podG and podH) have defects in the -subunit of mitochondrial phenylalanyl-tRNA synthase and transcription factor IIF interacting component of the CTD phosphatase, respectively (OSHEROV et al. 2000 ). This evidence suggests that polarity establishment requires coordination of multiple processes. The swoC1 mutation may perturb one or more of these processes, which in turn may block polarity establishment.

	FOOTNOTES

Sequence data from this article have been deposited with the GenBank Data Libraries under accession no. AY057454.

	ACKNOWLEDGMENTS

We thank Brian Shaw for assistance in sequencing and identification of complementing plasmid and for valuable suggestions, Gretel Guest for AGA22 construction, and Greg May for providing the plasmid library used in this work. This work was sponsored by Department of Energy biosciences grant DE-FG02-97ER20275 to M.M.

Manuscript received April 11, 2003; Accepted for publication May 16, 2003.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ADAMS, T. H., J. K. WIESER, and J. H. YU, 1998  Asexual sporulation in Aspergillus nidulans.. Microbiol. Mol. Biol. Rev. 62:35-54.

AMURO, Y., H. NAKAOKA, S. SHIMOMURA, S. TAMURA, and T. HADA et al., 1988  Rapid high-performance liquid chromatography for pseudouridine assay in serum and urine. Clin. Chim. Acta 172:117-122.

ARAVIND, L. and E. V. KOONIN, 1999  Novel predicted RNA-binding domains associated with the translation machinery. J. Mol. Evol. 48:291-302.

BACHEWICH, C. and I. B. HEATH, 1998  Radial F-actin arrays precede new hypha formation in Saprolegnia: implications for establishing polar growth and regulating tip morphogenesis. J. Cell Sci. 111(Pt. 14):2005-2016.

BALLANCE, D. J., 1986  Sequences important for gene expression in filamentous fungi. Yeast 2:229-236.

BECKER, H. F., Y. MOTORIN, R. J. PLANTA, and H. GROSJEAN, 1997  The yeast gene YNL292w encodes a pseudouridine synthase (Pus4) catalyzing the formation of psi55 in both mitochondrial and cytoplasmic tRNAs. Nucleic Acids Res. 25:4493-4499.

BOUSQUET-ANTONELLI, C., Y. HENRY, P. G'ELUGNE, J. M. CAIZERGUES-FERRER, and T. KISS, 1997  A small nucleolar RNP protein is required for pseudouridylation of eukaryotic ribosomal RNAs. EMBO J. 16:4770-4776.

CADWELL, C., H. J. YOON, Y. ZEBARJADIAN, and J. CARBON, 1997  The yeast nucleolar protein Cbf5p is involved in rRNA biosynthesis and interacts genetically with the RNA polymerase I transcription factor RRN3. Mol. Cell. Biol. 17:6175-6183.

CHANT, J., 1999  Cell polarity in yeast. Annu. Rev. Cell Dev. Biol. 15:365-391.

CHANT, J., M. MISCHKE, E. MITCHELL, I. HERSKOWITZ, and J. R. PRINGLE, 1995  Role of Bud3p in producing the axial budding pattern of yeast. J. Cell Biol. 129:767-778.

CHARETTE, M. and M. W. GRAY, 2000  Pseudouridine in RNA: what, where, how, and why. IUBMB Life 49:341-351.

DEZ, C., A. HENRAS, B. FAUCON, D. LAFONTAINE, and M. CAIZERGUES-FERRER et al., 2001  Stable expression in yeast of the mature form of human telomerase RNA depends on its association with the box H/ACA small nucleolar RNP proteins Cbf5p, Nhp2p and Nop10p. Nucleic Acids Res. 29:598-603.

EISINGER, D. P., F. A. DICK, and B. L. TRUMPOWER, 1997  Qsr1p, a 60S ribosomal subunit protein, is required for joining of 40S and 60S subunits. Mol. Cell. Biol. 17:5136-5145.

FIDDY, C. and A. P. TRINCI, 1976  Mitosis, septation, branching and the duplication cycle in Aspergillus nidulans.. J. Gen. Microbiol. 97:169-184.

FISCHER-PARTON, S., R. M. PARTON, P. C. HICKEY, J. DIJKSTERHUIS, and H. A. ATKINSON et al., 2000  Confocal microscopy of FM4–64 as a tool for analysing endocytosis and vesicle trafficking in living fungal hyphae. J. Microsc. 198:246-259.

GANOT, P., M. L. BORTOLIN, and T. KISS, 1997  Site-specific pseudouridine formation in preribosomal RNA is guided by small nucleolar RNAs. Cell 89:799-809.

GOODSON, H. V., B. L. ANDERSON, H. M. WARRICK, L. A. PON, and J. A. SPUDICH, 1996  Synthetic lethality screen identifies a novel yeast myosin I gene (MYO5): myosin I proteins are required for polarization of the actin cytoskeleton. J. Cell Biol. 133:1277-1291.

GUTGSELL, N. S., M. D. DEL CAMPO, S. RAYCHAUDHURI, and J. OFENGAND, 2001  A second function for pseudouridine synthases: a point mutant of RluD unable to form pseudouridines 1911, 1915, and 1917 in Escherichia coli 23S ribosomal RNA restores normal growth to an RluD-minus strain. RNA 7:990-998.

HARRIS, S. D., J. L. MORRELL, and J. E. HAMER, 1994  Identification and characterization of Aspergillus nidulans mutants defective in cytokinesis. Genetics 136:517-532.

HARRIS, S. D., A. F. HOFMANN, H. W. TEDFORD, and M. P. LEE, 1999  Identification and characterization of genes required for hyphal morphogenesis in the filamentous fungus Aspergillus nidulans.. Genetics 151:1015-1025.

HEISS, N. S., S. W. KNIGHT, T. J. VULLIAMY, S. M. KLAUCK, and S. WIEMANN et al., 1998  X-linked dyskeratosis congenita is caused by mutations in a highly conserved gene with putative nucleolar functions. Nat. Genet. 19:32-38.

HERMAN, P. K. and J. RINE, 1997  Yeast spore germination: a requirement for Ras protein activity during re-entry into the cell cycle. EMBO J. 16:6171-6181.

JIANG, W., K. MIDDLETON, H. J. YOON, C. FOUQUET, and J. CARBON, 1993  An essential yeast protein, CBF5p, binds in vitro to centromeres and microtubules. Mol. Cell. Biol. 13:4884-4893.

KAFER, E., 1977  Meiotic and mitotic recombination in Aspergillus and its chromosomal aberrations. Adv. Genet. 19:33-131.

KNIGHT, S. W., N. S. HEISS, T. J. VULLIAMY, S. GRESCHNER, and G. STAVRIDES et al., 1999  X-linked dyskeratosis congenita is predominantly caused by missense mutations in the DKC1 gene. Am. J. Hum. Genet. 65:50-58.

KRON, S. J., C. A. STYLES, and G. R. FINK, 1994  Symmetric cell division in pseudohyphae of the yeast Saccharomyces cerevisiae.. Mol. Biol. Cell 5:1003-1022.

LAFONTAINE, D. L., C. BOUSQUET-ANTONELLI, Y. HENRY, M. CAIZERGUES-FERRER, and D. TOLLERVEY, 1998  The box H + ACA snoRNAs carry Cbf5p, the putative rRNA pseudouridine synthase. Genes Dev. 12:527-537.

MA, G. C. and E. KAFER, 1974  Genetic analysis of the reciprocal translocation T2(I;8) of Aspergillus using the technique of mitotic mapping in homozygous translocation diploids. Genetics 77:11-23.

MADDEN, K. and M. SNYDER, 1992  Specification of sites for polarized growth in Saccharomyces cerevisiae and the influence of external factors on site selection. Mol. Biol. Cell 3:1025-1035.

MADDEN, K. and M. SNYDER, 1998  Cell polarity and morphogenesis in budding yeast. Annu. Rev. Microbiol. 52:687-744.

MADEN, B. E. and J. M. HUGHES, 1997  Eukaryotic ribosomal RNA: the recent excitement in the nucleotide modification problem. Chromosoma 105:391-400.

MANN, C., J. Y. MICOUIN, N. CHIANNILKULCHAI, I. TREICH, and J. M. BUHLER et al., 1992  RPC53 encodes a subunit of Saccharomyces cerevisiae RNA polymerase C (III) whose inactivation leads to a predominantly G1 arrest. Mol. Cell. Biol. 12:4314-4326.

MARCINIAK, R. A., F. B. JOHNSON, and L. GUARENTE, 2000  Dyskeratosis congenita, telomeres and human ageing. Trends Genet. 16:193-195.

MICKLEM, D. R., 1995  mRNA localisation during development. Dev. Biol. 172:377-395.

MITCHELL, J. R., J. CHENG, and K. COLLINS, 1999  A box H/ACA small nucleolar RNA-like domain at the human telomerase RNA 3' end. Mol. Cell. Biol. 19:567-576.

MOMANY, M., 2002  Polarity in filamentous fungi: establishment, maintenance and new axes. Curr. Opin. Microbiol. 5:580-585.

MOMANY, M. and J. E. HAMER, 1997  The Aspergillus nidulans septin encoding gene, aspB, is essential for growth. Fungal Genet. Biol. 21:92-100.

MOMANY, M. and I. TAYLOR, 2000  Landmarks in the early duplication cycles of Aspergillus fumigatus and Aspergillus nidulans: polarity, germ tube emergence and septation. Microbiology 146:3279-3284.

MOMANY, M., P. J. WESTFALL, and G. ABRAMOWSKY, 1999  Aspergillus nidulans swo mutants show defects in polarity establishment, polarity maintenance and hyphal morphogenesis. Genetics 151:557-567.

OFENGAND, J., 2002  Ribosomal RNA pseudouridines and pseudouridine synthases. FEBS Lett. 514:17-25.

OSHEROV, N. and G. MAY, 2000  Conidial germination in Aspergillus nidulans requires RAS signaling and protein synthesis. Genetics 155:647-656.

OSHEROV, N., J. MATHEW, and G. S. MAY, 2000  Polarity-defective mutants of Aspergillus nidulans.. Fungal Genet. Biol. 31:181-188.

PALMISANO, F., T. ROTUNNO, M. LA SORSA, C. G. ZAMBONIN, and I. ABBATE, 1995  Simultaneous determination of pseudouridine, neopterine and creatinine in urine by ion-pair high-performance liquid chromatography with in-series ultraviolet and fluorescence detection. Analyst 120:2185-2189.

PATTESON, K. G., L. P. RODICIO, and P. A. LIMBACH, 2001  Identification of the mass-silent post-transcriptionally modified nucleoside pseudouridine in RNA by matrix-assisted laser desorption/ionization mass spectrometry. Nucleic Acids Res. 29:E49.

PATTON, E. E., C. PEYRAUD, A. ROUILLON, Y. SURDIN-KERJAN, and M. TYERS et al., 2000  SCF(Met30)-mediated control of the transcriptional activator Met4 is required for the G(1)-S transition. EMBO J. 19:1613-1624.

PECULIS, B., 1997  RNA processing: pocket guides to ribosomal RNA. Curr. Biol. 7:R480-R482.

PIENKOWSKA, J. and Z. SZWEYKOWSKA-KULINSKA, 2001  Pseudouridine synthases—enzymes introducing the most abundant modified nucleoside in nucleic acids—pseudouridine. Postepy. Biochem. 47:232-242.

POMERANTZ, S. C. and J. A. MCCLOSKEY, 1990  Analysis of RNA hydrolyzates by liquid chromatography-mass spectrometry. Methods Enzymol. 193:796-824.

PRUYNE, D. and A. BRETSCHER, 2000  Polarization of cell growth in yeast. J. Cell Sci. 113:571-585.

RASMUSSEN, C. D., K. P. LU, R. L. MEANS, and A. R. MEANS, 1992  Calmodulin and cell cycle control. J. Physiol. 86:83-88.

ROBERTS, R. L. and G. R. FINK, 1994  Elements of a single MAP kinase cascade in Saccharomyces cerevisiae mediate two developmental programs in the same cell type: mating and invasive growth. Genes Dev. 8:2974-2985.

ROZE, L. V., N. MAHANTI, R. MEHIGH, D. G. MCCONNELL, and J. E. LINZ, 1999  Evidence that MRas1 and MRas3 proteins are associated with distinct cellular functions during growth and morphogenesis in the fungus Mucor racemosus.. Fungal Genet. Biol. 28:171-189.

RUSSO, T., F. SALVATORE, and F. CIMINO, 1984  Determination of pseudouridine in tRNA and in acid-soluble tissue extracts by high-performance liquid chromatography. J. Chromatogr. 296:387-393.

SAMBROOK, J., E. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SANTOS, B. and M. SNYDER, 1997  Targeting of chitin synthase 3 to polarized growth sites in yeast requires Chs5p and Myo2p. J. Cell Biol. 136:95-110.

SHAFAATIAN, R., M. A. PAYTON, and J. D. REID, 1996  PWP2, a member of the WD-repeat family of proteins, is an essential Saccharomyces cerevisiae gene involved in cell separation. Mol. Gen. Genet. 252:101-114.

SHINGFIELD, K. J. and N. W. OFFER, 1999  Simultaneous determination of purine metabolites, creatinine and pseudouridine in ruminant urine by reversed-phase high-performance liquid chromatography. J. Chromatogr. B Biomed. Sci. Appl. 723:81-94.

SHULMAN, J. M. and D. ST. JOHNSTON, 1999  Pattern formation in single cells. Trends Cell Biol. 9:M60-M64.

STEBBINGS, H., 2001  Cytoskeleton-dependent transport and localization of mRNA. Int. Rev. Cytol. 211:1-31.

STEPHEN, S., N. J. TALBOT, and H. STEBBINGS, 1999  Poly(A) mRNA is attached to insect ovarian microtubules in vivo in a nucleotide-sensitive manner. Cell Motil. Cytoskeleton 43:159-166.

SVOBODA, A., I. SLANINOVA, and A. HOLUBAROVA, 2001  Cytoskeleton in regenerating protoplasts and restoration of cell polarity in the yeast Saccharomyces cerevisiae.. Acta Biol. Hung. 52:325-333.

TIMBERLAKE, W. E., 1991  Temporal and spatial controls of Aspergillus development. Curr. Opin. Genet. Dev. 1:351-357.

TRINCI, A. P. J. and N. R. MORRIS, 1979  Morphology and growth of a temperature-sensitive mutant of Aspergillus nidulans which forms aseptate mycelia at non-permissive temperatures. J. Gen. Microbiol. 114:53-59.

UMEGAE, Y., H. NOHTA, and Y. OHKURA, 1990  Determination of pseudouridine in human urine and serum by high-performance liquid chromatography with post-column fluorescence derivatization. J. Chromatogr. 515:495-501.

VAN EEDEN, F. and D. ST. JOHNSTON, 1999  The polarisation of the anterior-posterior and dorsal-ventral axes during Drosophila oogenesis. Curr. Opin. Genet. Dev. 9:396-404.

VIDA, T. A. and S. D. EMR, 1995  A new vital stain for visualizing vacuolar membrane dynamics and endocytosis in yeast. J. Cell Biol. 128:779-792.

WATANABE, Y. and M. W. GRAY, 2000  Evolutionary appearance of genes encoding proteins associated with box H/ACA snoRNAs: cbf5p in Euglena gracilis, an early diverging eukaryote, and candidate Gar1p and Nop10p homologs in archaebacteria. Nucleic Acids Res. 28:2342-2352.

WATKINS, N. J., A. GOTTSCHALK, G. NEUBAUER, B. KASTNER, and P. FABRIZIO et al., 1998  Cbf5p, a potential pseudouridine synthase, and Nhp2p, a putative RNA-binding protein, are present together with Gar1p in all H BOX/ACA-motif snoRNPs and constitute a common bipartite structure. RNA 4:1549-1568.

WENDLAND, J., 2001  Comparison of morphogenetic networks of filamentous fungi and yeast. Fungal Genet. Biol. 34:63-82.

WENDLAND, J. and P. PHILIPPSEN, 2001  Cell polarity and hyphal morphogenesis are controlled by multiple rho-protein modules in the filamentous ascomycete Ashbya gossypii.. Genetics 157:601-610.

WOLKOW, T. D., S. D. HARRIS, and J. E. HAMER, 1996  Cytokinesis in Aspergillus nidulans is controlled by cell size, nuclear positioning and mitosis. J. Cell Sci. 109:2179-2188.

XIANG, X., W. ZUO, V. P. EFIMOV, and N. R. MORRIS, 1999  Isolation of a new set of Aspergillus nidulans mutants defective in nuclear migration. Curr. Genet. 35:626-630.

YABE, T., T. YAMADA-OKABE, S. KASAHARA, Y. FURUICHI, and T. NAKAJIMA et al., 1996  HKR1 encodes a cell surface protein that regulates both cell wall beta-glucan synthesis and budding pattern in the yeast Saccharomyces cerevisiae.. J. Bacteriol. 178:477-483.

YAGHMAI, R., A. KIMYAI-ASADI, K. ROSTAMIANI, N. S. HEISS, and A. POUSTKA et al., 2000  Overlap of dyskeratosis congenita with the Hoyeraal-Hreidarsson syndrome. J. Pediatr. 136:390-393.

YANG, Y., C. ISAAC, C. WANG, F. DRAGON, and V. POGACIC et al., 2000  Conserved composition of mammalian box H/ACA and box C/D small nucleolar ribonucleoprotein particles and their interaction with the common factor Nopp140. Mol. Biol. Cell 11:567-577.

YELTON, M. M., J. E. HAMER, and W. E. TIMBERLAKE, 1984  Transformation of Aspergillus nidulans by using a trpC plasmid. Proc. Natl. Acad. Sci. USA 81:1470-1474.

ZEBARJADIAN, Y., T. KING, M. J. FOURNIER, L. CLARKE, and J. CARBON, 1999  Point mutations in yeast CBF5 can abolish in vivo pseudouridylation of rRNA. Mol. Cell. Biol. 19:7461-7472.

ZIMAN, M., D. PREUSS, J. MULHOLLAND, J. M. O'BRIEN, and D. BOTSTEIN et al., 1993  Subcellular localization of Cdc42p, a Saccharomyces cerevisiae GTP-binding protein involved in the control of cell polarity. Mol. Biol. Cell 4:1307-1316.

This article has been cited by other articles:

				C. P. Semighini and S. D. Harris Regulation of Apical Dominance in Aspergillus nidulans Hyphae by Reactive Oxygen Species Genetics, August 1, 2008; 179(4): 1919 - 1932. [Abstract] [Full Text] [PDF]

				R. Bhabhra, D. L. Richie, H. S. Kim, W. C. Nierman, J. Fortwendel, J. P. Aris, J. C. Rhodes, and D. S. Askew Impaired Ribosome Biogenesis Disrupts the Integration between Morphogenesis and Nuclear Duplication during the Germination of Aspergillus fumigatus Eukaryot. Cell, April 1, 2008; 7(4): 575 - 583. [Abstract] [Full Text] [PDF]

				C. Normand, R. Capeyrou, S. Quevillon-Cheruel, A. Mougin, Y. Henry, and M. Caizergues-Ferrer Analysis of the binding of the N-terminal conserved domain of yeast Cbf5p to a box H/ACA snoRNA RNA, October 1, 2006; 12(10): 1868 - 1882. [Abstract] [Full Text] [PDF]

				S. Barth, A. Hury, X.-h. Liang, and S. Michaeli Elucidating the Role of H/ACA-like RNAs in trans-Splicing and rRNA Processing via RNA Interference Silencing of the Trypanosoma brucei CBF5 Pseudouridine Synthase J. Biol. Chem., October 14, 2005; 280(41): 34558 - 34568. [Abstract] [Full Text] [PDF]

				X. Lin and J. Heitman Chlamydospore Formation during Hyphal Growth in Cryptococcus neoformans Eukaryot. Cell, October 1, 2005; 4(10): 1746 - 1754. [Abstract] [Full Text] [PDF]

				S. D. Harris, N. D. Read, R. W. Roberson, B. Shaw, S. Seiler, M. Plamann, and M. Momany Polarisome Meets Spitzenkorper: Microscopy, Genetics, and Genomics Converge Eukaryot. Cell, February 1, 2005; 4(2): 225 - 229. [Full Text] [PDF]

				A. G. RUSSELL, M. N. SCHNARE, and M. W. GRAY Pseudouridine-guide RNAs and other Cbf5p-associated RNAs in Euglena gracilis RNA, July 1, 2004; 10(7): 1034 - 1046. [Abstract] [Full Text] [PDF]