- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Data Supplement
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Bowers, A. K.
- Articles by Dutcher, S. K.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Bowers, A. K.
- Articles by Dutcher, S. K.
Molecular Markers for Rapidly Identifying Candidate Genes in Chlamydomonas reinhardtii: ERY1 and ERY2 Encode Chloroplast Ribosomal Proteins
Amber K. Bowers1,2,a, Jennifer A. Keller1,a, and Susan K. Dutcheraa Department of Genetics, Washington University School of Medicine, Saint Louis, Missouri 63110
Corresponding author: Susan K. Dutcher, Box 8232, 660 S. Euclid Ave., Washington University School of Medicine, St. Louis, MO 63110., dutcher{at}genetics.wustl.edu (E-mail)
Communicating editor: M. S. SACHS
| ABSTRACT |
|---|
To take advantage of available expressed sequence tags and genomic sequence, we have developed 64 PCR-based molecular markers in Chlamydomonas reinhardtii that map to the 17 linkage groups. These markers will allow the rapid association of a candidate gene sequence with previously identified mutations. As proof of principle, we have identified the genes encoded by the ERY1 and ERY2 loci. Mendelian mutations that confer resistance to erythromycin define three unlinked nuclear loci in C. reinhardtii. Candidate genes ribosomal protein L4 (RPL4) and L22 (RPL22) are tightly linked to the ERY1 locus and ERY2 locus, respectively. Genomic DNA for RPL4 from wild type and five mutant ery1 alleles was amplified and sequenced and three different point mutations were found. Two different glycine residues (G102 and G112) are replaced by aspartic acid and both are in the unstructured region of RPL4 that lines the peptide exit tunnel of the chloroplast ribosome. The other two alleles change a splice site acceptor site. Genomic DNA for RPL22 from wild type and three mutant ery2 alleles was amplified and sequenced and revealed three different point mutations. Two alleles have premature stop codons and one allele changes a splice site acceptor site.
A large collection of chemically induced mutations exists in Chlamydomonas reinhardtii (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Erythromycin is an antibiotic that blocks the peptide exit tunnel of bacterial and other prokaryotic-like ribosomes (![]()
![]()
![]()
![]()
Mutations in Chlamydomonas that confer resistance to erythromycin have been isolated in both nuclear and chloroplast loci. Genes for the 23S rRNA are located in the chloroplast and two mutations in the rDNA confer resistance (![]()
![]()
![]()
![]()
![]()
![]()
![]()
Mutations that confer resistance to erythromycin provide proof of principle that we can identify and then map candidate sequences with respect to previously identified mutant loci. We have identified the gene products for two of the three nuclear ERY loci. The ERY1 locus encodes ribosomal protein L4 (RPL4) and the ERY2 locus encodes ribosomal protein L22 (RPL22).
| MATERIALS AND METHODS |
|---|
Strains and culture media:
Crosses were made between CC1952 and several laboratory strains derived from strain 137c using protocols described previously (![]()
![]()
![]()
|
In agreement with current nomenclature rules for C. reinhardtii, the alleles at the ERY1 loci are changed from ery1a, ery1b, ery1c, and ery1d to ery1-1, ery1-2, ery1-3, and ery1-4. Ery11, ery12, and ery14 (![]()
PCR protocol:
Primers for the mapping markers were chosen using Primer3 (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi; ![]()
![]()
|
Colony PCR:
DNA from colonies from tetrads of ery1 x CC1952 and ery2 x CC1952 was made using the REDextract-N-AMP blood PCR kit (Sigma, St. Louis). The kit was used according to the manufacturer's directions with the exception that 20-µl reactions were used. Restriction digests were performed in the PCR mix directly.
Screening the bacterial artificial chromosome library:
PCR products from genomic DNA were used to screen filters obtained from Genome Systems (now available from Clemson University Genomics Institute) using random primed labeling methods as described elsewhere (![]()
![]()
Sequencing:
Isolated genomic DNA from wild type and ery1 mutant strains was amplified using primers GCACTTCGCATTGTTTAGGT and CGTCCTCAATGATGATGTGGT or GCCAGGCCATCCTAAACTAA. Klentaq long and accurate polymerase (![]()
Modeling the protein structure:
The protein sequences of RPL4 and RPL22 were submitted to SwissModel (http://www.expasy.org/swissmod/) to be fit to the crystal structures of the homologous proteins from Harloarcula marismortui (IFFK) and Deinococcus radiodurans (1LNR; ![]()
| RESULTS |
|---|
Physical markers for mapping:
To facilitate the rapid mapping of sequence obtained from expressed sequence tags (ESTs) and genomic sequence, we have developed molecular PCR-based mapping markers that distinguish between alleles in two Chlamydomonas strains (137c and CC1952; ![]()
![]()
Meiotic progeny panel:
Genomic DNA was isolated (![]()
|
|
Mapping ESTs to candidate genetic loci:
Many mutations have been identified in C. reinhardtii, but few of their gene products are known (![]()
![]()
![]()
![]()
ESTs for ribosomal proteins:
Resistance to erythromycin in bacteria is conferred by mutations in ribosomal proteins L4 and L22, in domain V of the 23S rDNA gene, and in methyladenosine transferase. We searched the EST database for homologs of L4 and L22 ribosomal proteins (RPL4 and RPL22) and found matches (Table 2). Bogorad and colleagues established that a single ribosomal protein was altered in some ery1 alleles. This protein was called L6 in their numbering scheme on the basis of its mobility in two-dimensional gels. Although no equivalence to the Escherichia coli L6 protein was implied by their numbering (![]()
![]()
DNA from 40, 43, and 40 meiotic progeny from crosses of ery1, ery2, or ery3 by CC1952, respectively, was obtained and used in colony PCR with primers for RPL4, RPL22, and the DMAT homolog. We were unable to generate a polymorphism for RPL6 so we used a nearby gene, BI99. We observed complete linkage between RPL4 and ERY1 and between RPL22 and ERY2. BI99 and DMAT showed no linkage to any of the ERY loci (Appendix 2 at http://www.genetics.org/supplemental/). BI99 showed linkage to markers on linkage group IX, and DMAT showed linkage to markers on linkage group III (Appendix 2 at http://www.genetics.org/supplemental/). No loci that confer drug resistance have been mapped to either of these regions to date.
ERY1 encodes RPL4:
Previously, seven alleles that confer resistance to erythromycin were shown to be linked to one another (![]()
![]()
|
ERY2 encodes RPL22:
Previously, seven linked alleles were identified as conferring resistance to erythromycin (![]()
![]()
![]()
|
DNA from 20 meiotic progeny from crosses of ery2-2 x CC1952 and 20 meiotic progeny from crosses of ery2-4 x CC1952 were analyzed for segregation of the mutant alleles with respect to the CC1952 allele. We observed no recombination between the ery2 DNA polymorphism and the erythromycin resistance phenotype. The resistance phenotype is tightly linked to the physical marker. In addition, three different alleles have two different point mutations.
Resistance to other macrolide antibiotics:
Tylosin and spiromycin are used extensively for treatment of animals with bacterial infections. These antibiotics, like erythromycin, bind in the narrow part of the peptide exit tunnel to occlude peptide exit (![]()
| DISCUSSION |
|---|
We have developed 64 PCR-based molecular markers that can be easily scored. Thirty of these are based on the data from the Chlamydomonas Genome Project that provided a framework. New markers include genes for the enzymes of the tryptophan biosynthetic pathway. We have mapped the genes for anthranilate synthase-ß (ASB), phosophoribosyl transferase (PRT), anthranilate phosphoribosyl isomerase (PAI), indole 3-glycerol phosphate synthase (IGPS), and tryptophan synthetase-
(TSA; Fig 2; Table 2). Originally, MAA loci were identified by resistance to 5-methylanthranilic acid (![]()
![]()
![]()
We show that ERY1 encodes ribosomal protein L4 by linkage and sequencing multiple alleles. ![]()
The G102D and G112D changes are near the alteration that confers resistance to erythromycin in E. coli (![]()
![]()
![]()
Isolation of ribosomes from ery2 mutant strains suggested that the Ery2-4 protein had an alteration that was observable by one-dimensional gel electrophoresis with urea (![]()
![]()
We have used prediction programs to ask if RPL22 and RPL4 have signal sequence for import of the proteins into the chloroplast using ChloroP and TargetP (![]()
![]()
Erythromycin physically blocks the peptide exit tunnel (![]()
![]()
![]()
Erythromycin is one member of the macrolide family of antibiotics. It has a 14-membered lactone ring and one sugar group. Spiromycin and tylosin have 16-membered lactone rings and two sugar groups attached. X-ray crystallography of ribosomes from H. marismortui in the presence of these antibiotics shows that these compounds form covalent bonds with the 23S rRNA. The forosamine sugar moiety of spiromycin contacts protein L4 and the mycinose sugar moiety of tylosin lies along the peptide exit tunnel and contacts protein L22 (![]()
![]()
|
The region of RPL4 that contains the glycine-to-aspartic acid mutations at 102 and 112 was not modeled onto the H. marismortui L4 protein as this region was unordered and is not in the crystal structure. It is reasonable to suspect that this region forms a hydrophobic face and that the addition of aspartic acid to this face would disrupt it and possibly block erythromycin binding.
Strains with the ery2 mutation may serve as an excellent recipient for transformation as one could select both positively and negatively for the different alleles. The mutant strain is unable to grow at 15°, which would allow for selection of the wild-type ERY2 DNA while resistance to erythromycin at 25° is dominant to the wild-type allele (![]()
| FOOTNOTES |
|---|
Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under accession nos.
AY226165,
AY226166, and
AY227028. ![]()
1 These authors contributed equally to this work. ![]()
2 Present address: Department of Biology, University of California, San Diego, CA. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank Naomi Morrissette and a reviewer for useful comments on the manuscript. This work was supported by a grant from the National Institutes of Health to S.K.D. (GM-32843). Amber Bowers was a summer research fellow of the Washington University Howard Hughes Medical Institute Summer Fellowship Program.
Manuscript received February 14, 2003; Accepted for publication April 21, 2003.
| LITERATURE CITED |
|---|
ALTSCHUL, S. F., W. GISH, W. MILLER, E. W. MYERS, and D. L. LIPAN, 1990 Basic local alignment search tool. J. Mol. Biol. 215:403-410.[Medline]
BARNES, W. M., 1994 PCR amplification of up to 35 kb DNA with high fidelity and high yield from lambda bacteriophage templates. Proc. Natl. Acad. Sci. USA 91:2216-2220.
CHITTUM, H. S. and W. S. CHAMPNEY, 1994 Ribosomal protein gene sequence changes in erythromycin-resistant mutants of Escherichia coli.. J. Bacteriol. 176:6192-6198.
CHITTUM, H. S. and W. S. CHAMPNEY, 1995 Erythromycin inhibits the assembly of the large ribosomal subunit in growing Escherichia coli cells. Curr. Microbiol. 30:273-279.[Medline]
DAVIDSON, J. N., M. R. HANSON, and L. BOGORAD, 1974 An altered chloroplast ribosomal protein in ery-M1 mutants of Chlamydomonas reinhardi.. Mol. Gen. Genet. 132:119-129.[Medline]
DAVIDSON, J. N., M. R. HANSON, and L. BOGORAD, 1978 Erythromycin resistance and the chloroplast ribosome in Chlamydomonas reinhardi.. Genetics 89:281-297.
DUTCHER, S. K., 2000 Chlamydomonas reinhardtii: biological rationale for genomics. J. Eukaryot. Microbiol. 47:340-349.[Medline]
DUTCHER, S. K., R. E. GALLOWAY, W. R. BARCLAY, and G. POORTINGA, 1992 Tryptophan analog resistance mutations in Chlamydomonas reinhardtii.. Genetics 131:593-607.[Abstract]
DUTCHER, S. K., N. S. MORRISSETTE, A. M. PREBLE, C. RACKLEY, and J. STANGA, 2002
-Tubulin is an essential component of the centriole. Mol. Biol. Cell 13:3859-3869.
EMANUELSSON, O., H. NIELSEN, and G. VON HEIJNE, 1999 ChloroP, a neural network-based method for predicting chloroplast transit peptides and their cleavage sites. Protein Sci. 8:978-984.[Medline]
EMANUELSSON, O., H. NIELSEN, S. BRUNAK, and G. VON HEIJNE, 2000 Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J. Mol. Biol. 300:1005-1016.[Medline]
EVES, E. M. and K. S. CHIANG, 1982 Genetics of Chlamydomonas reinhardtii diploids. I. Isolation and characterization and meiotic segregation pattern of a homozygous diploid. Genetics 100:35-60.
FUNKE, R. P., J. L. KOVAR, and D. P. WEEKS, 1997 Intracellular carbonic anhydrase is essential to photosynthesis in Chlamydomonas reinhardtii at atmospheric levels of CO2. Demonstration via genomic complementation of the high-CO2-requiring mutant ca-1. Plant Physiol. 114:237-244.[Abstract]
GABASHVILI, I. S., S. T. GREGORY, M. VALLE, R. GRASSUCCI, and M. WORBS et al., 2001 The polypeptide tunnel system in the ribosome and its gating in erythromycin resistance mutants of L4 and L22. Mol. Cell 8:181-188.[Medline]
GALE, E. F., E. CUNDLIFFE, P. E. REYNOLDS, M. H. RICHMOND and J. J. WARING, 1981 The Molecular Basis of Antibiotic Action. John Wiley & Sons, London.
GROSS, C. H., L. P. RANUM, and P. A. LEFEBVRE, 1988 Extensive restriction fragment length polymorphisms in a new isolate of Chlamydomonas reinhardtii.. Curr. Genet. 13:503-508.[Medline]
GUEX, N., A. DIEMAND, and M. C. PEITSCH, 1999 Protein modeling for all. Trends Biochem. Sci. 24:364-367.[Medline]
HANSEN, J. L., J. A. IPPOLITO, N. BAN, P. NISSEN, and P. B. MOORE et al., 2002 The structures of four macrolide antibiotics bound to the large ribosomal subunit. Mol. Cell 10:117-128.[Medline]
HANSON, M. R. and L. BOGORAD, 1977 Complementation analysis of the ery-M1 locus in Chlamydomonas reinhardi.. Mol. Gen. Genet. 153:271-277.
HANSON, M. R. and L. BOGORAD, 1978 The ery-M2 group of Chlamydomonas reinhardi: cold-sensitive, erythromycin-resistant mutants deficient in chloroplast ribosomes. J. Gen. Microbiol. 105:253-262.
HARRIS, E. H., 1989 The Chlamydomonas Sourcebook. Academic Press, San Diego.
HARRIS, E. H., 2001 Chlamydomonas as a model organism. Annu. Rev. Plant Physiol. Plant Mol. Biol. 52:363-406.[Medline]
HARRIS, E. H., J. E. BOYNTON, and N. W. GILLHAM, 1974 Chloroplast ribosome biogenesis in Chlamydomonas. Selection and characterization of mutants blocked in ribosome formation. J. Cell Biol. 63:160-179.
HARRIS, E. H., B. D. BURKHART, N. W. GILLHAM, and J. E. BOYNTON, 1989 Antibiotic resistance mutations in the chloroplast 16S and 23S rRNA genes of Chlamydomonas reinhardtii: correlation of genetic and physical maps of the chloroplast genome. Genetics 123:281-292.
JOHNSON, D. E. and S. K. DUTCHER, 1991 Molecular studies of linkage group XIX of Chlamydomonas reinhardtii: evidence against a basal body location. J. Cell Biol. 113:339-346.
LAI, C. J. and B. WEISBLUM, 1971 Altered methylation of ribosomal RNA in an erythromycin-resistant strain of Staphylococcus aureus.. Proc. Natl. Acad. Sci. USA 68:856-860.
LAST, R. L. and G. R. FINK, 1988 Tryptophan-requiring mutants of the plant Arabidopsis thaliana.. Science 240:305-310.
LI, J. B., S. LIN, H. JIA, H. WU, and B. A. ROE et al., 2003 Analysis of Chlamydomonas reinhardtii genome structure using large-scale sequencing of regions on linkage groups I and III. J. Eukarot. Microbiol. 50:145-155.
LUX, F. G., III and S. K. DUTCHER, 1991 Genetic interactions at the FLA10 locus: suppressors and synthetic phenotypes that affect the cell cycle and flagellar function in Chlamydomonas reinhardtii.. Genetics 128:549-561.[Abstract]
MAUL, J. E., J. W. LILLY, L. CUI, C. W. DEPAMPHILIS, and W. MILLER et al., 2002 The Chlamydomonas reinhardtii plastid chromosome: islands of genes in a sea of repeats. Plant Cell 14:2659-2679.
METS, L. J. and L. BOGORAD, 1971 Mendelian and uniparental alterations in erythromycin binding by plastid ribosomes. Science 174:707-709.
METS, L. and L. BOGORAD, 1972 Altered chloroplast ribosomal proteins associated with erythromycin-resistant mutants in two genetic systems of Chlamydomonas reinhardtii.. Proc. Natl. Acad. Sci. USA 69:3779-3783.
METS, L. J. and L. BOGORAD, 1974 Two-dimensional polyacrylamide gel electrophoresis: an improved method for ribosomal proteins. Anal. Biochem. 57:200-210.[Medline]
PALOMBELLA, A. L. and S. K. DUTCHER, 1998 Identification of the gene encoding the tryptophan synthase beta-subunit from Chlamydomonas reinhardtii.. Plant Physiol. 117:455-464.
PURTON, S. and J. D. ROCHAIX, 1994 Complementation of a Chlamydomonas reinhardtii mutant using a genomic cosmid library. Plant Mol. Biol. 24:533-537.[Medline]
RANUM, L. P., M. D. THOMPSON, J. A. SCHLOSS, P. A. LEFEBVRE, and C. D. SILFLOW, 1988 Mapping flagellar genes in Chlamydomonas using restriction fragment length polymorphisms. Genetics 120:109-122.
ROZEN, S., and H. J. SKALETSKY, 2000 Primer3 on the WWW for general users and for biologist programmers, pp. 365386 in Bioinformatics Methods and Protocols: Methods in Molecular Biology, edited by S. KRAWETZ and S. MISENER. Humana Press, Totowa, NJ.
SCHNELL, R. A. and P. A. LEFEBVRE, 1993 Isolation of the Chlamydomonas regulatory gene NIT2 by transposon tagging. Genetics 134:737-747.[Abstract]
SPAHN, C. M. and C. D. PRESCOTT, 1996 Throwing a spanner in the works: antibiotics and the translation apparatus. J. Mol. Med. 74:423-439.[Medline]
TAM, L.-W. and P. A. LEFEBVRE, 1993 Cloning flagellar genes in Chlamydomonas reinhardtii by DNA insertional mutagenesis. Genetics 135:375-384.[Abstract]
VYSOTSKAIA, V. S., D. E. CURTIS, A. V. VOINOV, P. KATHIR, and C. D. SILFLOW et al., 2001 Development and characterization of genome-wide single nucleotide polymorphism markers in the green alga Chlamydomonas reinhardtii.. Plant Physiol. 127:386-389.
ZHANG, H., P. L. HERMAN, and D. P. WEEKS, 1994 Gene isolation through genomic complementation using an indexed library of Chlamydomonas reinhardtii DNA. Plant. Mol. Biol. 24:663-672.[Medline]
This article has been cited by other articles:
![]() |
O. Vallon and S. Dutcher Treasure Hunting in the Chlamydomonas Genome Genetics, May 1, 2008; 179(1): 3 - 6. [Full Text] [PDF] |
||||
![]() |
M. S. Miller, J. M. Esparza, A. M. Lippa, F. G. Lux III, D. G. Cole, and S. K. Dutcher Mutant Kinesin-2 Motor Subunits Increase Chromosome Loss Mol. Biol. Cell, August 1, 2005; 16(8): 3810 - 3820. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Ferris, S. Waffenschmidt, J. G. Umen, H. Lin, J.-H. Lee, K. Ishida, T. Kubo, J. Lau, and U. W. Goodenough Plus and Minus Sexual Agglutinins from Chlamydomonas reinhardtii PLANT CELL, February 1, 2005; 17(2): 597 - 615. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Data Supplement
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Bowers, A. K.
- Articles by Dutcher, S. K.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Bowers, A. K.
- Articles by Dutcher, S. K.







