Genetics, Vol. 164, 1345-1353, August 2003, Copyright © 2003

Molecular Markers for Rapidly Identifying Candidate Genes in Chlamydomonas reinhardtii: ERY1 and ERY2 Encode Chloroplast Ribosomal Proteins

Amber K. Bowers1,2,a, Jennifer A. Keller1,a, and Susan K. Dutchera
a Department of Genetics, Washington University School of Medicine, Saint Louis, Missouri 63110

Corresponding author: Susan K. Dutcher, Box 8232, 660 S. Euclid Ave., Washington University School of Medicine, St. Louis, MO 63110., dutcher{at}genetics.wustl.edu (E-mail)

Communicating editor: M. S. SACHS


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

To take advantage of available expressed sequence tags and genomic sequence, we have developed 64 PCR-based molecular markers in Chlamydomonas reinhardtii that map to the 17 linkage groups. These markers will allow the rapid association of a candidate gene sequence with previously identified mutations. As proof of principle, we have identified the genes encoded by the ERY1 and ERY2 loci. Mendelian mutations that confer resistance to erythromycin define three unlinked nuclear loci in C. reinhardtii. Candidate genes ribosomal protein L4 (RPL4) and L22 (RPL22) are tightly linked to the ERY1 locus and ERY2 locus, respectively. Genomic DNA for RPL4 from wild type and five mutant ery1 alleles was amplified and sequenced and three different point mutations were found. Two different glycine residues (G102 and G112) are replaced by aspartic acid and both are in the unstructured region of RPL4 that lines the peptide exit tunnel of the chloroplast ribosome. The other two alleles change a splice site acceptor site. Genomic DNA for RPL22 from wild type and three mutant ery2 alleles was amplified and sequenced and revealed three different point mutations. Two alleles have premature stop codons and one allele changes a splice site acceptor site.


A large collection of chemically induced mutations exists in Chlamydomonas reinhardtii (DUTCHER 2000 Down; HARRIS 2001 Down). Several approaches have been used to identify the gene products of various loci. A locus of interest can be cloned by complementation (PURTON and ROCHAIX 1994 Down; ZHANG et al. 1994 Down; FUNKE et al. 1997 Down), by identifying new alleles with an insertional tag (TAM and LEFEBVRE 1993 Down), by identifying new alleles with a transposable element (SCHNELL and LEFEBVRE 1993 Down), or by positional cloning from a nearby physical marker (DUTCHER et al. 2002 Down). The availability of expressed sequence tags and genomic sequences that have mapped onto a physical/genetic map make it possible to identify candidate genes for various loci. RANUM et al. 1988 Down and VYSOTSKAIA et al. 2001 Down have developed restriction fragment polymorphism markers for use with Southern blots and single nucleotide polymorphisms, respectively. The availability of mapped molecular markers that can be scored quickly and easily should make it possible to rapidly identify mutations that correspond to a candidate sequence.

Erythromycin is an antibiotic that blocks the peptide exit tunnel of bacterial and other prokaryotic-like ribosomes (GALE et al. 1981 Down; GABASHVILI et al. 2001 Down). Resistance to erythromycin is conferred by mutations in ribosomal proteins L22 and L4 in bacteria. In addition, resistance is conferred by mutations in the 23S ribosomal RNA in domain V as well as by mutations in loci that encode 6-N',N'-adenosyl dimethyltransferase or dimethyladenosine transferase. The absence of methylation of 2508A in 23S rRNA confers resistance (LAI and WEISBLUM 1971 Down). These sequences are possible candidate genes. The unicellular green alga, C. reinhardtii, is sensitive to erythromycin. Using radiolabeled erythromycin, METS and BOGORAD 1971 Down showed the site of action of erythromycin to be the chloroplast of Chlamydomonas.

Mutations in Chlamydomonas that confer resistance to erythromycin have been isolated in both nuclear and chloroplast loci. Genes for the 23S rRNA are located in the chloroplast and two mutations in the rDNA confer resistance (HARRIS et al. 1989 Down; MAUL et al. 2002 Down). Mutations in three nuclear loci (ERY1, ERY2, and ERY3) also confer resistance to erythromycin. These loci map to linkage groups X, XIV, and I, respectively (HANSON and BOGORAD 1977 Down, HANSON and BOGORAD 1978 Down; EVES and CHIANG 1982 Down). Alterations in the mobility of chloroplast ribosomal proteins from ery1 and ery2 mutant strains have been observed on one- and two-dimensional gels (METS and BOGORAD 1972 Down; DAVIDSON et al. 1974 Down).

Mutations that confer resistance to erythromycin provide proof of principle that we can identify and then map candidate sequences with respect to previously identified mutant loci. We have identified the gene products for two of the three nuclear ERY loci. The ERY1 locus encodes ribosomal protein L4 (RPL4) and the ERY2 locus encodes ribosomal protein L22 (RPL22).


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Strains and culture media:
Crosses were made between CC1952 and several laboratory strains derived from strain 137c using protocols described previously (HARRIS 1989 Down). CC-1952 is a strain isolated from the wild that has extensive molecular polymorphisms relative to the lab strain, 137c (GROSS et al. 1988 Down). Strains are listed in Table 1. Media were as described (LUX and DUTCHER 1991 Down).


 
View this table:
In this window
In a new window

 
Table 1. Strains used in this work

In agreement with current nomenclature rules for C. reinhardtii, the alleles at the ERY1 loci are changed from ery1a, ery1b, ery1c, and ery1d to ery1-1, ery1-2, ery1-3, and ery1-4. Ery11, ery12, and ery14 (HARRIS et al. 1974 Down) are named ery1-6, ery1-7, and ery1-8. The same changes have been made for ERY2 alleles and are listed in Table 1.

PCR protocol:
Primers for the mapping markers were chosen using Primer3 (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi; ROZEN and SKALETSKY 2000 Down). DNA was isolated as described (JOHNSON and DUTCHER 1991 Down). The mapping was performed in 25-µl reactions using Taq polymerase with 20 mM Tris, 50 mM KCl, pH 8.3 buffer with 20 pmol of each primer, 5% DMSO, 1 nM dNTP, and MgCl2 concentrations as indicated in Table 2. The cycling parameters were 95° for 5 min, 95° for 1 min, at the temperature in Table 2 for 1 min, 72° for 1 min per kilobase of product length, repeated 30 times, and 72° for 10 min. Restriction digests were performed directly on the PCR products as indicated in Table 2. Products were displayed on 2.0% agarose gels with ethidium bromide.


 
View this table:
In this window
In a new window

 
Table 2. Chlamydomonas homologs found in ESTs and BAC library

Colony PCR:
DNA from colonies from tetrads of ery1 x CC1952 and ery2 x CC1952 was made using the REDextract-N-AMP blood PCR kit (Sigma, St. Louis). The kit was used according to the manufacturer's directions with the exception that 20-µl reactions were used. Restriction digests were performed in the PCR mix directly.

Screening the bacterial artificial chromosome library:
PCR products from genomic DNA were used to screen filters obtained from Genome Systems (now available from Clemson University Genomics Institute) using random primed labeling methods as described elsewhere (DUTCHER et al. 2002 Down). Identification of additional bacterial artificial chromosome (BAC) clones was made by searching the JGI database of BAC end sequence (http://bahama.jgi-psf.org/prod/bin/chlamy/home.chlamy) using BLASTn or tBLASTn (ALTSCHUL et al. 1990 Down).

Sequencing:
Isolated genomic DNA from wild type and ery1 mutant strains was amplified using primers GCACTTCGCATTGTTTAGGT and CGTCCTCAATGATGATGTGGT or GCCAGGCCATCCTAAACTAA. Klentaq long and accurate polymerase (BARNES 1994 Down) was used with the following conditions to amplify DNA for sequencing: 35 cycles of 1 min at 94°, 2 min at 52°, and 10 min at 68°. A final 30-min extension period at 68° was included. The product was purified from a 1% agarose gel using the gel purification kit from QIAGEN (Valencia, CA). For ERY2, four pairs of primers were used with Klentaq long and accurate polymerase to amplify DNA with the following conditions: 35 cycles of 1 min at 94°, 2 min at 56°, and 10 min at 68°. No gel purification was needed. The DNA was sequenced using BigDyeV.3 in conjugation with the protein and nucleic acid chemistry laboratory (Washington University School of Medicine). For ERY1 DNA, seven forward and seven reverse primers were used for sequencing. For ERY2 DNA, three forward and three reverse primers were used for sequencing. The Sequencher Program (Gene Codes, Ann Arbor, MI) was used for assembling the sequence reads into contigs.

Modeling the protein structure:
The protein sequences of RPL4 and RPL22 were submitted to SwissModel (http://www.expasy.org/swissmod/) to be fit to the crystal structures of the homologous proteins from Harloarcula marismortui (IFFK) and Deinococcus radiodurans (1LNR; GUEX et al. 1999 Down). The predicted chloroplast signal peptide was removed for the modeling, as there was no similarity with the bacterial sequences used for crystallization. The predicted structure was examined using Deep View: Swiss-PDF viewer.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Physical markers for mapping:
To facilitate the rapid mapping of sequence obtained from expressed sequence tags (ESTs) and genomic sequence, we have developed molecular PCR-based mapping markers that distinguish between alleles in two Chlamydomonas strains (137c and CC1952; GROSS et al. 1988 Down; VYSOTSKAIA et al. 2001 Down). Many of the loci were selected on the basis of their previously known map position (http://www.biology/duke.edu/chlamy_genome/) and loci within 10–15 map units of their respective centromeres were preferentially chosen. PCR products for 64 markers were amplified using the primers and conditions that are listed in supplementary material available on the web (Appendix 1 at http://www.genetics.org/supplemental/). These markers ranged in length from 200 to >1000 bp. Eleven of the 64 markers generate PCR products in the two strains that are distinguishable on 2% agarose gels. The remaining 55 markers require digestion by a restriction enzyme to produce a distinguishable marker as indicated in Appendix 2, available online at http://www.genetics.org/supplemental/.

Meiotic progeny panel:
Genomic DNA was isolated (JOHNSON and DUTCHER 1991 Down) from 172 meiotic progeny from crosses of 137c-derived strains and the polymorphic strain, CC1952 (Table 1). These DNAs were placed into 96-well microtiter plates for monitoring the segregations of the markers in Appendix 1, available online at http://www.genetics.org/supplemental/. Fig 1 shows 2.0% agarose gels for three different markers. The segregation for LC1 on linkage group II and LC5 on linkage group XIX was performed with 94 meiotic progeny and two parental strains; segregation for acetyl glutamate kinase on linkage group I was performed with 82 meiotic progeny and two parental strains. The last two lanes in the bottom right of Fig 1A–C, contain the parental DNA. We find that 40–100% of the DNA samples from meiotic progeny produce products that can be interpreted with an average success rate of 80%. The segregation of the 62 markers was determined for up to 172 meiotic progeny; some markers were analyzed from only one of the plates of progeny. The linkage analysis is shown graphically in Fig 2. (The full set of data is shown in Appendix 2 at http://www.genetics.org/supplemental/).



View larger version (137K):
In this window
In a new window
Download PPT slide
 
Figure 1. Segregation of LC1, LC5, and AGK in meiotic progeny. DNA from 94 meiotic progeny was used for PCR with primers to (A) LC1, a dynein light chain; (B) LC5, a dynein light chain, and (C) AGK, acetyl gluatamate kinase. In A–C, the 137c and CC1952 parents are shown at the bottom right.



View larger version (26K):
In this window
In a new window
Download PPT slide
 
Figure 2. Map locations of the physical markers (presented in Appendixes 1 and 2 at http://www.genetics.org/supplemental/). One set of markers could not be placed on any one of the linkage groups. This should not be considered evidence for a new linkage group, as we have not examined centromere linkage. Slash lines on linkage VI indicate that the two sides are >50 map units apart. Accession numbers for acronym entries not in ChlamyDB or Table 2 are as follows: ACOR, BI873565; AGK, BM519173; ALAD, U19876; ALDO, X69969; ARS, X52304; ASPK, AF014927; CCS1, U71000; CDC48, BU647835; Cna19, BE337032; DC1, BU646668; EB1, BG843058; FA4, BI718037; FNR1, U10545; GP40, AF525923; HSP70A, M76725; HSP70B, X96502; KAT, AF205377; LAO, U78797; PP1, AF156101; PRF, BQ821551; PRI, BU653640; TRX, X78822; S926, X62135; STK, AF33023; TcTex1, AF039437; VPS26, BM003137; and ZSP, S44199. Accession numbers for anonymous ESTs are BE05, BE056715; BI99, BI993933; BI52, BI528510; BQ80, BQ808040; and BQ82, BQ824925.

Mapping ESTs to candidate genetic loci:
Many mutations have been identified in C. reinhardtii, but few of their gene products are known (DUTCHER 2000 Down; HARRIS 2001 Down). We set out to determine if we could identify the gene products for several previously characterized loci using a candidate gene approach. Loci that confer resistance to erythromycin often encode ribosomal proteins in eubacteria (SPAHN and PRESCOTT 1996 Down). Three nuclear loci that confer resistance to erythromycin in C. reinhardtii (ERY1–ERY3; DAVIDSON et al. 1978 Down) have previously been identified.

ESTs for ribosomal proteins:
Resistance to erythromycin in bacteria is conferred by mutations in ribosomal proteins L4 and L22, in domain V of the 23S rDNA gene, and in methyladenosine transferase. We searched the EST database for homologs of L4 and L22 ribosomal proteins (RPL4 and RPL22) and found matches (Table 2). Bogorad and colleagues established that a single ribosomal protein was altered in some ery1 alleles. This protein was called L6 in their numbering scheme on the basis of its mobility in two-dimensional gels. Although no equivalence to the Escherichia coli L6 protein was implied by their numbering (HANSON and BOGORAD 1978 Down), we found an EST for the Chlamydomonas L6 homolog and established a linked molecular marker for it as well. We identified an EST that shows similarity to a dimethyl adenosine transferase (DMAT) as well as its genomic DNA sequence (LI et al. 2003 Down).

DNA from 40, 43, and 40 meiotic progeny from crosses of ery1, ery2, or ery3 by CC1952, respectively, was obtained and used in colony PCR with primers for RPL4, RPL22, and the DMAT homolog. We were unable to generate a polymorphism for RPL6 so we used a nearby gene, BI99. We observed complete linkage between RPL4 and ERY1 and between RPL22 and ERY2. BI99 and DMAT showed no linkage to any of the ERY loci (Appendix 2 at http://www.genetics.org/supplemental/). BI99 showed linkage to markers on linkage group IX, and DMAT showed linkage to markers on linkage group III (Appendix 2 at http://www.genetics.org/supplemental/). No loci that confer drug resistance have been mapped to either of these regions to date.

ERY1 encodes RPL4:
Previously, seven alleles that confer resistance to erythromycin were shown to be linked to one another (HANSON and BOGORAD 1977 Down) and this locus was designated ERY1 (HARRIS 1989 Down). We sequenced 2536 bp of genomic DNA from wild type and from five of the mutant strains. The predicted Chlamydomonas protein is 243 amino acids long. It has 58% identity to the homolog in Nicotiana tabacum and 57% identity to the homolog in Nostoc sp. PPC7120, a cyanobacterium. The amino terminus, which is likely to be the chloroplast transit signal, shows little similarity among these three proteins (Fig 3). Two alleles, ery1-2 and ery1-6, have a single nucleotide change of G to A that results in a change in the splice site from GT to AT at the end of exon 2. This change results in the loss of the restriction enzyme recognition site for StyI and cosegregates with erythromycin resistance in 43 meiotic progeny for the ery1-2 allele and in 12 meiotic progeny for ery1-6. The ery1-5 allele has a single nucleotide change from G to A that results in a glycine-to-aspartic acid change at amino acid 102. This mutation results in the acquisition of an NruI recognition site and cosegregates with erythromycin resistance in 10 meiotic progeny. The ery1-3 and ery1-7 alleles have a G-to-A mutation that results in a glycine-to-aspartic acid change at amino acid 112. This mutation results in the acquisition of a BccI recognition site and cosegregates with erythromycin resistance in 9 ery1-7 meiotic progeny. Thus, we observed no recombination between the ery1 DNA polymorphisms and the erythromycin resistance phenotype. In addition, five different alleles have three different missense mutations.



View larger version (49K):
In this window
In a new window
Download PPT slide
 
Figure 3. Alignment of ribosomal protein L4 from Chlamydomonas with the sequences from tobacco (GenBank T01739), Nostoc sp. PPCC 7120 (NP_488254), and E. coli (NP_417778) using Clustal X. The identities among the four sequences are indicated by an asterisk above the alignments. The identities among three of the four sequences are indicated by a period above the alignments. The similarities among the four sequences are indicated by a colon above the alignments. Amino acids G, P, S, and T are colored orange; amino acids H, K, and R are colored salmon; amino acids F, W, and Y are colored blue; amino acids D and E are colored purple; the amino acid P is colored yellow; and amino acids I, L, M, and V are colored green. The predicted chloroplast signal sequence is indicated by a black line below the alignments. The five sequenced ery1 alleles have three changes. Three alleles (ery1-3, ery1-5, and ery1-7) have two different point mutations that change a glycine to an aspartic acid (shown in blue below the alignment). The ery1-2 and ery1-6 alleles have a splice site acceptor change as discussed in the text; the end of the affected exon is indicated by a blue +.

ERY2 encodes RPL22:
Previously, seven linked alleles were identified as conferring resistance to erythromycin (METS and BOGORAD 1972 Down; DAVIDSON et al. 1978 Down) and this locus was designated ERY2 (HARRIS 1989 Down). We sequenced 1077 bp of genomic DNA from wild type and three of these mutant strains. The predicted Chlamydomonas protein is 171 amino acids long. It is 57% identical to the homolog from Medicago sativa and 55% identical to the homolog from Porphyra purpurea, a red alga. The ery2-2 and ery2-5 alleles have a G-to-T change that results in the introduction of an amber codon at amino acid 108 (Fig 4). The ery2-4 allele has a G-to-A change resulting in an alteration in the splice site from the consensus GT to AT. If the message in ery2-4 were not spliced, the protein would be truncated prematurely at a stop codon in the intron. These changes result in the acquisition of the restriction recognition sites for BfaI and the loss of an HphI recognition site for the ery2-2 and ery2-4 alleles, respectively.



View larger version (34K):
In this window
In a new window
Download PPT slide
 
Figure 4. Alignment of ribosomal protein L22 (RPL22) from Chlamydomonas with the sequences from M. sativa (GenBank T09389), P. purpurea (NP_053919), and E. coli (NP_417774) using Clustal X. The identities among the four sequences are indicated by an asterisk above the alignments. The identities among three of the four sequences are indicated by a period above the alignments. The similarities among the four sequences are indicated by a colon above the alignments. Amino acids G, P, S, and T are colored orange; amino acids H, K, and R are colored salmon; amino acids F, W, and Y are colored blue; amino acids D and E are colored purple; the amino acid P is colored yellow; and amino acids I, L, M, and V are colored green. The predicted chloroplast signal sequence is indicated by a black line below the alignments. The ery2-2 and ery2-4 alleles have a stop codon that terminates the predicted proteins at the blue asterisk. The ery2-5 allele has an altered splice site acceptor change as discussed in the text; the end of the affected exon is indicated by a blue +.

DNA from 20 meiotic progeny from crosses of ery2-2 x CC1952 and 20 meiotic progeny from crosses of ery2-4 x CC1952 were analyzed for segregation of the mutant alleles with respect to the CC1952 allele. We observed no recombination between the ery2 DNA polymorphism and the erythromycin resistance phenotype. The resistance phenotype is tightly linked to the physical marker. In addition, three different alleles have two different point mutations.

Resistance to other macrolide antibiotics:
Tylosin and spiromycin are used extensively for treatment of animals with bacterial infections. These antibiotics, like erythromycin, bind in the narrow part of the peptide exit tunnel to occlude peptide exit (HANSEN et al. 2002 Down). The side chain of spiromycin contacts RPL4 and the side chain of tylosin contacts RPL22. We asked if the mutations in ery1 and ery2 confer resistance to these related antibiotics. Wild-type strains are sensitive to 75 µg/ml of both compounds. The seven ery1 alleles confer resistance to both tylosin and spiromycin from 75 to 300 µg/ml while the three ery2 alleles confer resistance only to tylosin in the same concentration range.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

We have developed 64 PCR-based molecular markers that can be easily scored. Thirty of these are based on the data from the Chlamydomonas Genome Project that provided a framework. New markers include genes for the enzymes of the tryptophan biosynthetic pathway. We have mapped the genes for anthranilate synthase-ß (ASB), phosophoribosyl transferase (PRT), anthranilate phosphoribosyl isomerase (PAI), indole 3-glycerol phosphate synthase (IGPS), and tryptophan synthetase-{alpha} (TSA; Fig 2; Table 2). Originally, MAA loci were identified by resistance to 5-methylanthranilic acid (DUTCHER et al. 1992 Down; PALOMBELLA and DUTCHER 1998 Down). Many mutations that confer resistance to 5-MAA in Arabidopsis are in genes that encode enzymes of the tryptophan biosynthetic pathway (LAST and FINK 1988 Down). TSA maps to linkage group XII/XIII near the MAA1 locus, IGPS maps to linkage group XIV near the MAA4 locus, PAI maps to linkage group III, PRT maps to linkage group IV, and ASB maps to linkage group XV. Thus, the linkage between these loci and these genes provides further evidence for the efficacy of placing genomic and expressed sequence tags onto the genetic map to facilitate the identification of the genes that correspond to previously identified mutations.

We show that ERY1 encodes ribosomal protein L4 by linkage and sequencing multiple alleles. DAVIDSON et al. 1978 Down suggested the protein encoded by the ery1-2 allele had both a different isoelectric point and a different molecular weight from the wild-type protein. The change in the splice site acceptor site would be consistent with this observation. Under several scenarios, translation will stop prematurely in the third exon.

The G102D and G112D changes are near the alteration that confers resistance to erythromycin in E. coli (CHITTUM and CHAMPNEY 1994 Down). In resistant E. coli, the K63 is changed to a glutamic acid. Clearly, this is a region that is important for conferring resistance. In this K63E mutant in E. coli, erythromycin fails to bind to the ribosome (CHITTUM and CHAMPNEY 1995 Down). The change from glycine to aspartic acid in ery1-3 is consistent with the change in isoelectric point observed by DAVIDSON et al. 1974 Down.

Isolation of ribosomes from ery2 mutant strains suggested that the Ery2-4 protein had an alteration that was observable by one-dimensional gel electrophoresis with urea (METS and BOGORAD 1972 Down, METS and BOGORAD 1974 Down), but the other mutant proteins had no alteration in their mobility. We are surprised that other alleles did not show alterations in these older studies as ery2-2 and ery2-3 alleles have amber codons that should produce truncated proteins. It is likely that all three mutant proteins are truncated.

We have used prediction programs to ask if RPL22 and RPL4 have signal sequence for import of the proteins into the chloroplast using ChloroP and TargetP (EMANUELSSON et al. 1999 Down, EMANUELSSON et al. 2000 Down). Both programs predict signal sequences of 69 and 42 amino acids as indicated by the underlines in Fig 3 and Fig 4. TargetP predicts that the signal sequences are mitochondrial rather than chloroplast import sequences. However, known Chlamydomonas chloroplast proteins, G3PD, RISP, and Photosystem I apoprotein A, also gave scores with TargetP that suggested the signal peptide was mitochondrial. This program is not optimized for signal sequences from Chlamydomonas, but remains useful. Alignment of RPL22 and RPL4 against bacterial proteins also suggests the presence of signal sequences. As shown in Fig 3 and Fig 4, the first 60 and 42 amino acids showed little or no similarity to the protein from other organisms. This lack of similarity provides evidence that this region corresponds to the signal sequence.

Erythromycin physically blocks the peptide exit tunnel (GABASHVILI et al. 2001 Down). In E. coli mutant strains, L4 mutant ribosomes do not bind erythromycin and have a smaller tunnel size while L22 mutant ribosomes are able to bind erythromycin, but have a larger tunnel opening (GABASHVILI et al. 2001 Down). On the basis of the crystal structure of the H. marismortui protein (HANSEN et al. 2002 Down) and cryoelectron microscopy, RLP22 lines the peptide exit tunnel. The ery2 alleles, which are predicted to result in truncated proteins, may create a peptide exit tunnel opening that is larger so that the erythromycin molecule cannot block the tunnel.

Erythromycin is one member of the macrolide family of antibiotics. It has a 14-membered lactone ring and one sugar group. Spiromycin and tylosin have 16-membered lactone rings and two sugar groups attached. X-ray crystallography of ribosomes from H. marismortui in the presence of these antibiotics shows that these compounds form covalent bonds with the 23S rRNA. The forosamine sugar moiety of spiromycin contacts protein L4 and the mycinose sugar moiety of tylosin lies along the peptide exit tunnel and contacts protein L22 (HANSEN et al. 2002 Down). The ery1 mutations in RPL4 confer resistance to both of the compounds, but the ery2 mutations in RPL22 confer resistance only to tylosin. It is possible that the interaction of the mycinose sugar moiety of tylosin positions it so that the absence of the carboxy terminus of RPL22 is not sufficient to open the peptide exit tunnel. We modeled the sequence of RPL22 from Chlamydomonas onto the structure of RPL22 from H. marismortui using SwissModel (GUEX et al. 1999 Down). There are three major differences between the known structure and the modeled structure for Chlamydomonas (Fig 5). First, the divergent amino terminus of the protein cannot be predicted from the crystal structure. Second, one of the helices in H. marismortui is missing from the modeled structure. Third, the angle of the extended loop is different (Fig 5A). To show the extent of the truncation predicted in the ery2-2 or ery2-4 alleles, the wild-type model (in green) is superimposed on the truncated model (in black). The loop, which is thought to line the peptide exit tunnel, is missing. At present, we have no biochemical data to support the idea that the truncated protein is present.



View larger version (23K):
In this window
In a new window
Download PPT slide
 
Figure 5. Predicted structure of L22 from Chlamydomonas using SwissModel. (A) The confirmation of L22 from H. marismortui (in blue) and the predicted structure of L22 from Chlamydomonas (in green) are shown. Several differences are seen between the two structures. The first 60 amino acids of Chlamydomonas L22 were not used in modeling. One of the helices in H. marismortui is significantly different in the modeled structure as seen at about 11 o'clock. In addition, the angle of the extended loop is different. (B) The predicted protein from the ery2-2 allele (green) is compared to the full-length L22 protein (black) from Chlamydomonas to show the extent of the truncation.

The region of RPL4 that contains the glycine-to-aspartic acid mutations at 102 and 112 was not modeled onto the H. marismortui L4 protein as this region was unordered and is not in the crystal structure. It is reasonable to suspect that this region forms a hydrophobic face and that the addition of aspartic acid to this face would disrupt it and possibly block erythromycin binding.

Strains with the ery2 mutation may serve as an excellent recipient for transformation as one could select both positively and negatively for the different alleles. The mutant strain is unable to grow at 15°, which would allow for selection of the wild-type ERY2 DNA while resistance to erythromycin at 25° is dominant to the wild-type allele (HANSON and BOGORAD 1977 Down).


*  FOOTNOTES

Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under accession nos. AY226165, AY226166, and AY227028. Back
1 These authors contributed equally to this work. Back
2 Present address: Department of Biology, University of California, San Diego, CA. Back


*  ACKNOWLEDGMENTS

We thank Naomi Morrissette and a reviewer for useful comments on the manuscript. This work was supported by a grant from the National Institutes of Health to S.K.D. (GM-32843). Amber Bowers was a summer research fellow of the Washington University Howard Hughes Medical Institute Summer Fellowship Program.

Manuscript received February 14, 2003; Accepted for publication April 21, 2003.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ALTSCHUL, S. F., W. GISH, W. MILLER, E. W. MYERS, and D. L. LIPAN, 1990  Basic local alignment search tool. J. Mol. Biol. 215:403-410.[Medline]

BARNES, W. M., 1994  PCR amplification of up to 35 kb DNA with high fidelity and high yield from lambda bacteriophage templates. Proc. Natl. Acad. Sci. USA 91:2216-2220.[Abstract/Free Full Text]

CHITTUM, H. S. and W. S. CHAMPNEY, 1994  Ribosomal protein gene sequence changes in erythromycin-resistant mutants of Escherichia coli.. J. Bacteriol. 176:6192-6198.[Abstract/Free Full Text]

CHITTUM, H. S. and W. S. CHAMPNEY, 1995  Erythromycin inhibits the assembly of the large ribosomal subunit in growing Escherichia coli cells. Curr. Microbiol. 30:273-279.[Medline]

DAVIDSON, J. N., M. R. HANSON, and L. BOGORAD, 1974  An altered chloroplast ribosomal protein in ery-M1 mutants of Chlamydomonas reinhardi.. Mol. Gen. Genet. 132:119-129.[Medline]

DAVIDSON, J. N., M. R. HANSON, and L. BOGORAD, 1978  Erythromycin resistance and the chloroplast ribosome in Chlamydomonas reinhardi.. Genetics 89:281-297.[Abstract/Free Full Text]

DUTCHER, S. K., 2000  Chlamydomonas reinhardtii: biological rationale for genomics. J. Eukaryot. Microbiol. 47:340-349.[Medline]

DUTCHER, S. K., R. E. GALLOWAY, W. R. BARCLAY, and G. POORTINGA, 1992  Tryptophan analog resistance mutations in Chlamydomonas reinhardtii.. Genetics 131:593-607.[Abstract]

DUTCHER, S. K., N. S. MORRISSETTE, A. M. PREBLE, C. RACKLEY, and J. STANGA, 2002  {epsilon}-Tubulin is an essential component of the centriole. Mol. Biol. Cell 13:3859-3869.[Abstract/Free Full Text]

EMANUELSSON, O., H. NIELSEN, and G. VON HEIJNE, 1999  ChloroP, a neural network-based method for predicting chloroplast transit peptides and their cleavage sites. Protein Sci. 8:978-984.[Medline]

EMANUELSSON, O., H. NIELSEN, S. BRUNAK, and G. VON HEIJNE, 2000  Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J. Mol. Biol. 300:1005-1016.[Medline]

EVES, E. M. and K. S. CHIANG, 1982  Genetics of Chlamydomonas reinhardtii diploids. I. Isolation and characterization and meiotic segregation pattern of a homozygous diploid. Genetics 100:35-60.[Abstract/Free Full Text]

FUNKE, R. P., J. L. KOVAR, and D. P. WEEKS, 1997  Intracellular carbonic anhydrase is essential to photosynthesis in Chlamydomonas reinhardtii at atmospheric levels of CO2. Demonstration via genomic complementation of the high-CO2-requiring mutant ca-1. Plant Physiol. 114:237-244.[Abstract]

GABASHVILI, I. S., S. T. GREGORY, M. VALLE, R. GRASSUCCI, and M. WORBS et al., 2001  The polypeptide tunnel system in the ribosome and its gating in erythromycin resistance mutants of L4 and L22. Mol. Cell 8:181-188.[Medline]

GALE, E. F., E. CUNDLIFFE, P. E. REYNOLDS, M. H. RICHMOND and J. J. WARING, 1981 The Molecular Basis of Antibiotic Action. John Wiley & Sons, London.

GROSS, C. H., L. P. RANUM, and P. A. LEFEBVRE, 1988  Extensive restriction fragment length polymorphisms in a new isolate of Chlamydomonas reinhardtii.. Curr. Genet. 13:503-508.[Medline]

GUEX, N., A. DIEMAND, and M. C. PEITSCH, 1999  Protein modeling for all. Trends Biochem. Sci. 24:364-367.[Medline]

HANSEN, J. L., J. A. IPPOLITO, N. BAN, P. NISSEN, and P. B. MOORE et al., 2002  The structures of four macrolide antibiotics bound to the large ribosomal subunit. Mol. Cell 10:117-128.[Medline]

HANSON, M. R. and L. BOGORAD, 1977  Complementation analysis of the ery-M1 locus in Chlamydomonas reinhardi.. Mol. Gen. Genet. 153:271-277.

HANSON, M. R. and L. BOGORAD, 1978  The ery-M2 group of Chlamydomonas reinhardi: cold-sensitive, erythromycin-resistant mutants deficient in chloroplast ribosomes. J. Gen. Microbiol. 105:253-262.

HARRIS, E. H., 1989 The Chlamydomonas Sourcebook. Academic Press, San Diego.

HARRIS, E. H., 2001  Chlamydomonas as a model organism. Annu. Rev. Plant Physiol. Plant Mol. Biol. 52:363-406.[Medline]

HARRIS, E. H., J. E. BOYNTON, and N. W. GILLHAM, 1974  Chloroplast ribosome biogenesis in Chlamydomonas. Selection and characterization of mutants blocked in ribosome formation. J. Cell Biol. 63:160-179.[Abstract/Free Full Text]

HARRIS, E. H., B. D. BURKHART, N. W. GILLHAM, and J. E. BOYNTON, 1989  Antibiotic resistance mutations in the chloroplast 16S and 23S rRNA genes of Chlamydomonas reinhardtii: correlation of genetic and physical maps of the chloroplast genome. Genetics 123:281-292.[Abstract/Free Full Text]

JOHNSON, D. E. and S. K. DUTCHER, 1991  Molecular studies of linkage group XIX of Chlamydomonas reinhardtii: evidence against a basal body location. J. Cell Biol. 113:339-346.[Abstract/Free Full Text]

LAI, C. J. and B. WEISBLUM, 1971  Altered methylation of ribosomal RNA in an erythromycin-resistant strain of Staphylococcus aureus.. Proc. Natl. Acad. Sci. USA 68:856-860.[Abstract/Free Full Text]

LAST, R. L. and G. R. FINK, 1988  Tryptophan-requiring mutants of the plant Arabidopsis thaliana.. Science 240:305-310.[Abstract/Free Full Text]

LI, J. B., S. LIN, H. JIA, H. WU, and B. A. ROE et al., 2003  Analysis of Chlamydomonas reinhardtii genome structure using large-scale sequencing of regions on linkage groups I and III. J. Eukarot. Microbiol. 50:145-155.

LUX, F. G., III and S. K. DUTCHER, 1991  Genetic interactions at the FLA10 locus: suppressors and synthetic phenotypes that affect the cell cycle and flagellar function in Chlamydomonas reinhardtii.. Genetics 128:549-561.[Abstract]

MAUL, J. E., J. W. LILLY, L. CUI, C. W. DEPAMPHILIS, and W. MILLER et al., 2002  The Chlamydomonas reinhardtii plastid chromosome: islands of genes in a sea of repeats. Plant Cell 14:2659-2679.[Abstract/Free Full Text]

METS, L. J. and L. BOGORAD, 1971  Mendelian and uniparental alterations in erythromycin binding by plastid ribosomes. Science 174:707-709.[Abstract/Free Full Text]

METS, L. and L. BOGORAD, 1972  Altered chloroplast ribosomal proteins associated with erythromycin-resistant mutants in two genetic systems of Chlamydomonas reinhardtii.. Proc. Natl. Acad. Sci. USA 69:3779-3783.[Abstract/Free Full Text]

METS, L. J. and L. BOGORAD, 1974  Two-dimensional polyacrylamide gel electrophoresis: an improved method for ribosomal proteins. Anal. Biochem. 57:200-210.[Medline]

PALOMBELLA, A. L. and S. K. DUTCHER, 1998  Identification of the gene encoding the tryptophan synthase beta-subunit from Chlamydomonas reinhardtii.. Plant Physiol. 117:455-464.[Abstract/Free Full Text]

PURTON, S. and J. D. ROCHAIX, 1994  Complementation of a Chlamydomonas reinhardtii mutant using a genomic cosmid library. Plant Mol. Biol. 24:533-537.[Medline]

RANUM, L. P., M. D. THOMPSON, J. A. SCHLOSS, P. A. LEFEBVRE, and C. D. SILFLOW, 1988  Mapping flagellar genes in Chlamydomonas using restriction fragment length polymorphisms. Genetics 120:109-122.[Abstract/Free Full Text]

ROZEN, S., and H. J. SKALETSKY, 2000 Primer3 on the WWW for general users and for biologist programmers, pp. 365–386 in Bioinformatics Methods and Protocols: Methods in Molecular Biology, edited by S. KRAWETZ and S. MISENER. Humana Press, Totowa, NJ.

SCHNELL, R. A. and P. A. LEFEBVRE, 1993  Isolation of the Chlamydomonas regulatory gene NIT2 by transposon tagging. Genetics 134:737-747.[Abstract]

SPAHN, C. M. and C. D. PRESCOTT, 1996  Throwing a spanner in the works: antibiotics and the translation apparatus. J. Mol. Med. 74:423-439.[Medline]

TAM, L.-W. and P. A. LEFEBVRE, 1993  Cloning flagellar genes in Chlamydomonas reinhardtii by DNA insertional mutagenesis. Genetics 135:375-384.[Abstract]

VYSOTSKAIA, V. S., D. E. CURTIS, A. V. VOINOV, P. KATHIR, and C. D. SILFLOW et al., 2001  Development and characterization of genome-wide single nucleotide polymorphism markers in the green alga Chlamydomonas reinhardtii.. Plant Physiol. 127:386-389.[Free Full Text]

ZHANG, H., P. L. HERMAN, and D. P. WEEKS, 1994  Gene isolation through genomic complementation using an indexed library of Chlamydomonas reinhardtii DNA. Plant. Mol. Biol. 24:663-672.[Medline]




This article has been cited by other articles:


Home page
GeneticsHome page
O. Vallon and S. Dutcher
Treasure Hunting in the Chlamydomonas Genome
Genetics, May 1, 2008; 179(1): 3 - 6.
[Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. S. Miller, J. M. Esparza, A. M. Lippa, F. G. Lux III, D. G. Cole, and S. K. Dutcher
Mutant Kinesin-2 Motor Subunits Increase Chromosome Loss
Mol. Biol. Cell, August 1, 2005; 16(8): 3810 - 3820.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
P. J. Ferris, S. Waffenschmidt, J. G. Umen, H. Lin, J.-H. Lee, K. Ishida, T. Kubo, J. Lau, and U. W. Goodenough
Plus and Minus Sexual Agglutinins from Chlamydomonas reinhardtii
PLANT CELL, February 1, 2005; 17(2): 597 - 615.
[Abstract] [Full Text] [PDF]