Rho3p Regulates Cell Separation by Modulating Exocyst Function in Schizosaccharomyces pombe

Corresponding author: Mohan K. Balasubramanian, Research Link, National University of Singapore, Singapore 117604, Republic of Singapore., mohan{at}tll.org.sg (E-mail)

Communicating editor: P. RUSSELL

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Cytokinesis is the final stage of the cell division cycle in which the mother cell is physically divided into two daughters. In recent years the fission yeast Schizosaccharomyces pombe has emerged as an attractive model organism for the study of cytokinesis, since it divides using an actomyosin ring whose constriction is coordinated with the centripetal deposition of new membranes and a division septum. The final step of cytokinesis in S. pombe requires the digestion of the primary septum to liberate two daughters. We have previously shown that the multiprotein exocyst complex is essential for this process. Here we report the isolation of rho3⁺, encoding a Rho family GTPase, as a high-copy suppressor of an exocyst mutant, sec8-1. Overproduction of Rho3p also suppressed the temperature-sensitive growth phenotype observed in cells lacking Exo70p, another conserved component of the S. pombe exocyst complex. Cells deleted for rho3 arrest at higher growth temperatures with two or more nuclei and uncleaved division septa between pairs of nuclei. rho3 cells accumulate 100-nm vesicle-like structures. These phenotypes are all similar to those observed in exocyst component mutants, consistent with a role for Rho3p in modulation of exocyst function. Taken together, our results suggest the possibility that S. pombe Rho3p regulates cell separation by modulation of exocyst function.

CYTOKINESIS is the stage of cell cycle that physically divides the mother cell into two daughters following DNA synthesis and chromosome segregation (for review, GUERTIN et al. 2002 ). Cytokinesis in Schizosaccharomyces pombe is achieved through the use of a constricting actomyosin ring followed by septum deposition. The division septum consists of one layer of primary septum and two adjacent layers of secondary septa. Finally, cell separation liberates two daughter cells upon dissolution of the primary septum. In comparison to studies of the mechanisms of actomyosin ring and division septum assembly, the process of cell separation remains poorly understood.

Our previous studies indicated that the fission yeast exocyst, a multiprotein complex, is involved in cell separation possibly by mediating docking and fusion vesicles containing cell-wall-degrading enzymes at the division site (WANG et al. 2002 ). The exocyst complex is conserved from yeasts to mammals and has been extensively characterized in budding yeast (HSU et al. 1999 ). The exocyst in Saccharomyces cerevisiae consists of eight components, Sec3p, Sec5p, Sec6p, Sec8p, Sec10p, Sec15p, Exo70p, and Exo84p. A similar complex, termed the Sec6/8 complex, has also been identified in mammals (GRINDSTAFF et al. 1998 ). It has been established that the exocyst is involved in late stages of exocytosis, targeting and tethering post-Golgi vesicles to the plasma membrane (TERBUSH et al. 1996 ; GRINDSTAFF et al. 1998 ). Unlike target-soluble NSF attachment protein receptor proteins (t-SNAREs) that are evenly distributed along the plasma membrane, the exocyst is specifically localized at sites of active secretion.

In S. pombe cells, only five exocyst proteins, Sec6p, Sec8p, Sec10p, Sec15p, and Exo70p, have been identified to date (WANG et al. 2002 ). These proteins form a complex in vivo as in many other eukaryotes. They are concentrated at the cell tip as well as at the division site. They first localize to the division site as a ring structure at early mitosis and split into two rings adjacent to the constricting actomyosin ring, indicative of participation in cytokinesis. A few exocyst deletion mutants have been analyzed and shown to have defects in cell separation. Surprisingly, cell growth, elongation, and septum assembly are not affected in these mutants, suggesting that the primary function of the exocyst in S. pombe is cell separation. The exocyst is also implicated in exocytosis in S. pombe. In exocyst mutants, the post-Golgi secretory vesicles accumulate in the cytoplasm presumably due to a defect in tethering these vesicles to the plasma membrane.

Recently, Rho GTPase proteins have attracted increasing attention for their role in exocytosis (NOVICK and GUO 2002 ). In S. cerevisiae, Rho3p regulates exocytosis by interacting with Exo70p (ROBINSON et al. 1999 ). Although S. pombe Rho3p was recently shown to be involved in polarized cell growth (NAKANO et al. 2002 ), its role in exocytosis was not known. Here we report the isolation of the rho3 gene as a multicopy suppressor of sec8-1, a temperature-sensitive exocyst mutant. We also show that both loss of Rho3p function and expression of a dominant-negative mutant lead to a cell separation defect similar to that observed in exocyst mutants.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Media, reagents, and genetics:
S. pombe strains used in this study are listed in Table 1. Yeast cells were grown on yeast extract with supplements (YES) medium or minimal media with appropriate supplements (MORENO et al. 1991 ). Crosses were performed by mixing appropriate strains directly on YPD plates. Recombinant strains were obtained by tetrad analysis. Yeast transformations were performed by the lithium acetate method (OKAZAKI et al. 1990 ).

Isolation of the rho3 gene:
A genomic DNA library (BALASUNDARAM et al. 1999 ) was introduced into sec8-1 cells to isolate colonies that were able to reverse the temperature sensitivity of sec8-1. Two colonies grew at 36°, one of which turned out to carry a plasmid containing the rho3 gene that is located on cosmid SPAC23C4.08.

Construction of rho3 and the exo70 null mutant:
A PCR-based deletion strategy was utilized to construct the rho3. Primers MOH730 (TGGTTCGCATCGCCTTAATTATTCTAAATTTGATTGTTACCTGAAATGTAGAAGCCAATCTACAGCGCACAAGGACATGTAATCCCACTGGCTATATGTA) and MOH731(ACCCACACTAACGTCATATACAATAATAAACTTCGAACATTAGAAATAAGACTTTTAGGCGCTTTCAAAAGAAAGTGCTTTAGGTAAAGATAAACCGTAC) were used to amplify a product containing the uar4 gene as well as two flanking sequences of rho3. The PCR product was purified and transformed into wild-type diploid cells to select on medium lacking uracil. Correct integration was confirmed by colony PCR analysis.

The exo70 was generated using the standard cloning-based homologous recombination method. Primer pairs MOH655 (GGCGGGATCCTGCGCTGTGCGCAATTACTGATCT) and MOH656 (GGCGGAATTCTTTGCATATAATTTTTACGAAGGA) and MOH657 (GGCGCTCGAGTTCAATATGATGAATTTGGGTCC) and MOH658 (GGCGGGTACCCAAACATCAAATAATATGGTAATTT) were used to amplify 500 bp of exo70 5' untranslated region (UTR) and the 3' UTR region, respectively. They were subsequently cloned into pSK-ura4 in BamHI-EcoRI and XhoI-KpnI fragments. This resulting plasmid was linearized with BamHI and KpnI and introduced into a wild-type diploid strain. Colonies were selected on medium lacking uracil and correct integration was confirmed by PCR.

Generation of mutations in rho3:
The mutant alleles, rho3^Val-25 and rho3^Asn-30, were constructed by an oligonucleotide-directed PCR. For construction of the rho3^Val-25 mutation, primers with 18-mer overlapping sequences containing the mutations MOH738 (CTTGGTGATGTTGCTGCTGGTAAAACCAGTTTG) and MOH739 (CCAGCAGCAACATCACCAAGAATTACGATTTTC) were designed to amplify the rho3 gene as two fragments with both carrying the mutation. These two fragments were mixed and used as templates for another round of PCR to generate a complete open reading frame (ORF) of rho3 with the rho3^Val-25 (Rho3 G25V) mutation, which was cloned into pREP1. The rho3^Asn-30 (Rho3T30N) mutation was constructed by employing a similar strategy using primers MOH740 (GCTGGTAAAAACAGTTTGTTAAATGTATTTACT) and MOH741 (TAACAAACTGTTTTTACCAGCAGCACCATCACC).

Microscopy:
Fluorescence microscopy was performed essentially as described (BALASUBRAMANIAN et al. 1997 ). Cells were viewed using a Leica DMLB microscope with appropriate filters. To visualize DNA, F-actin, and septum material, cells were fixed in 3.7% formaldehyde for 1 min and stained with 4',6-diamidino-2-phenylindole (DAPI), rhodamine-conjugated phalloidin, and calcofluor (Sigma, St. Louis), respectively, as described (BALASUBRAMANIAN et al. 1997 ).

Electron microscopy:
Electron microscopy was performed essentially as described (WANG et al. 2002 ). Cells were fixed in 2% potassium permanganate, dehydrated, and treated with propylene oxide prior to infiltration with Spurr's medium, followed by another change of medium, and incubation at 65° for 1 hr. Finally, cells were embedded in Spurr's resin and the resin was allowed to polymerize at 60° overnight. Ultrathin sections were cut on a Jung Reichert microtome (Leica Mikroskopie and Systeme GmbH, Wetzlar, Germany) and examined using a JEM1010 transmission electron microscope (Jeol, Tokyo) at 100 kV.

Measurement of acid phosphatase secretion:
Levels of acid phosphatase secretion were assayed as described (WANG et al. 2002 ). Briefly, cell culture supernatant was assayed by using p-nitrophenyl phosphate as the substrate for acid phosphatase. The amount of released nitrophenyl was measured with a spectrophotometer at 405 nm.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Isolation of rho3⁺ as a multicopy suppressor of sec8-1:
A temperature-sensitive mutant, sec8-1, was previously found to be defective in cell separation and vesicle fusion in S. pombe (WANG et al. 2002 ). In the process of cloning the sec8 gene by complementation, we isolated a plasmid from a S. pombe genomic library that was able to suppress the growth defect of sec8-1 at 36°. Sequencing of the plasmid insert revealed that it contained the rho3 gene, encoding a rho GTPase protein. As shown in Fig 1A, sec8-1 cells transformed with rho3⁺ grew well and formed healthy colonies at 36°, whereas cells transformed with control plasmids were unable to do so. Thus, the rho3⁺ gene is a multicopy suppressor of the sec8-1 mutation.

View larger version (107K): [in this window] [in a new window] [Download PPT slide]   Figure 1. (a) Isolation of rho3 as a multicopy suppressor of sec8-1 in S. pombe. A sec8-1 strain transformed with a blank control plasmid pREP3-1 (1), a random insert control plasmid pREP3-1-pot1 (2), and a rho3-containing plasmid pREP3-1-rho3 (3) were grown on plates at 24° (left) for 4 days and at 36° (right) for 2 days, respectively. (b) Cell separation phenotype of sec8-1 is suppressed upon overproduction of Rho3p. sec8-1 cells carrying pREP3-1 (left) or pREP3-1-rho3 (right) were grown at 36° and stained with DAPI/aniline blue to visualize DNA and septum. Bar, 10 µm. (c) sec8-1 cells carrying pREP3-1 (left) or pREP3-1-rho3 (right) were grown at 36°, fixed, and processed for electron microscopy. c1 and c2 are magnified regions. Arrows, putative secretory vesicles. Bar, 500 µm. (d) Overexpression of Rho3p is unable to suppress a sec8 strain. A diploid strain carrying the sec8 mutation and a pREP3-1-rho3 plasmid was sporulated and germinated in minimal medium lacking uracil and leucine to select for the sec8 and pREP3-1-rho3 plasmid at 30° for 24 hr. Cells were then stained with DAPI to visualize DNA. DAPI-stained sec8 (middle) and wild-type cells (right) are shown for comparison. Bar, 10 µm.

We next tested whether the cell separation defect of the sec8-1 mutant could be suppressed by overproduction of Rho3p. sec8-1 cells overproducing Rho3p were stained to visualize DNA and septum. Whereas sec8-1 cells carrying the vector alone (Fig 1B, left) were unable to separate following cytokinesis, sec8-1 cells overexpressing Rho3p were capable of separation following cytokinesis (Fig 1B, right). Given that the cell separation phenotype of sec8-1 was suppressed upon overproduction of Rho3p, we performed electron microscopy to examine whether the secretion defect associated with sec8-1 was also suppressed in these cells. As previously described (WANG et al. 2002 ), sec8-1 cells accumulate presumed secretory vesicles (100 nm in diameter, intensely stained after permanganate fixation) in the cytoplasm due to a defect in post-Golgi vesicle trafficking. Interestingly, very few secretory vesicles were detected in sec8-1 cells overexpressing Rho3p (Fig 1C, right, and bottom box c2), whereas control cells accumulated a large number of secretory vesicles as in sec8-1 alone (Fig 1C, left, and top box c1). Thus, overproduction of Rho3p rescues all deleterious phenotypes associated with sec8-1.

rho3 is unable to suppress the sec8 null mutant:
The suppression of the sec8-1 mutant by ectopic expression of Rho3p could be explained by two possibilities. One possibility is that increased levels of Rho3p might bypass the requirement for Sec8p function. In this case, high dosage expression of Rho3p would rescue a sec8-null mutation. Alternatively, high levels of Rho3p might stimulate residual activity of the mutant Sec8-1p. If so, high dosage expression of Rho3p would not rescue the sec8. To distinguish between these possibilities, we investigated whether the high-copy-number rho3 gene was able to suppress a sec8 mutant. A heterozygous diploid carrying a sec8 null mutation marked with ura4⁺ was transformed with plasmid carrying rho3 marked with leu1⁺ and sporulated, and spores were germinated in minimal medium selecting for the sec8 and the plasmid carrying rho3. These germinated spores (Fig 1D, left) were found to exhibit a phenotype similar to that of the sec8 alone (Fig 1D, middle), but were dramatically different from wild type (Fig 1D, right). Thus, overexpression of Rho3p was unable to rescue the loss of Sec8p, indicating that Rho3p suppresses the sec8-1 mutant by stimulating residual function of the mutant Sec8-1p, rather than bypassing the requirement of Sec8p.

rho3 mutant is defective in cell separation and shows genetic interaction with sec8-1 and exo70:
To examine whether Rho3p plays a role in cell separation, we constructed the rho3 deletion mutant (rho3) by replacing the entire rho3 ORF with the ura4 gene. rho3 formed colonies at 24°, showing that the rho3 gene was not essential. Interestingly, rho3 cells exhibited a temperature-sensitive phenotype (Fig 2A). At the permissive temperature (24°), rho3 cells resembled wild-type cells (Fig 2B). Following the shift to the restrictive temperature (36°), rho3 cells were defective in cell separation (Fig 2C). These cells were able to grow and to assemble the actomyosin ring and division septa, but were defective in proper cleavage of the division septum. A majority of the mutant cells failed to separate and showed thickened septa despite normal mitosis and F-actin distribution. This phenotype mimics that of exocyst mutants (WANG et al. 2002 ), indicating that Rho3p is also required for cell separation.

View larger version (109K): [in this window] [in a new window] [Download PPT slide]   Figure 2. (a–c) A rho3 mutant is defective in cell separation at restrictive temperature. (a) To compare relative growth rates, rho3 (left) and wild-type (right) cells were streaked to single colonies on plates and incubated at 24° (top) and at 36° (bottom). (b and c) Phenotype of rho3 cells. rho3 cells were either grown at 24° (b) or shifted to 36° for 4 hr (c) and fixed and stained with DAPI, rhodamine-conjugated phalloidin and calcofluor to visualize DNA, F-actin, and the cell wall, respectively. Bar, 10 µm.

To test for genetic interactions between rho3 and sec8, we crossed a rho3 strain to a sec8-1 strain. Interestingly, the double mutant was inviable whereas both single mutants survived at 24°, indicating that rho3 was synthetically lethal with sec8-1 (Fig 3A). From this cross, there were six parental ditypes, 12 tetrad types, and three NPDs (nonparental ditypes) in which the double mutant(s) died in each tetrad, suggesting a genetic interaction between Rho3p and Sec8p.

View larger version (119K): [in this window] [in a new window] [Download PPT slide]   Figure 3. (a) sec8-1 is synthetically lethal with rho3. Asci from a cross of a sec8-1 mutant strain with a rho3 strain were dissected on YES and grown at 24°. One NPD is shown. Double mutants were unable to form colonies at 24°. (b) exo70 is temperature sensitive. To compare relative growth rates, wild-type (left side) and exo70 (right side) cells were streaked onto single colonies on plates and incubated at 24° (top) and 36° (bottom). (c) exo70 cells were grown at 24° (left) or shifted to 36° for 4 hr (right), fixed, and stained with DAPI/aniline blue to visualize DNA and septum. (d) Overproduction of Rho3p suppresses growth defects of exo70. exo70 cells transformed with pREP3-1 (left side) or pREP3-1-rho3 (right side) were grown on plates and were incubated at 24° or 36°. (e) exo70 shows a negative genetic interaction with rho3. Strains exo70 (1), rho3 (2), and exo70 rho3 (3) were grown at either 24° (left) or 32° (right) for 3 days. (f) The exo70 rho3 double mutant shows more severe defects in cell separation than each single null mutant does. exo70 rho3 cells were grown at 24° (left) or shifted to 32° for 4 hr (right), fixed, and stained with DAPI/aniline blue to visualize DNA and septum.

To test whether rho3 interacted with other exocyst components, we tested the genetic interaction between rho3 and another exocyst mutant, exo70, which exhibited a temperature-sensitive lethal phenotype (Fig 3B) and had a cell separation defect at 36° (Fig 3C). Overproduction of Rho3p was able to suppress growth (Fig 3D) and partially cell separation phenotypes (data not shown) of exo70, confirming a genetic interaction between these gene products. In addition, the double mutant rho3 exo70 failed to grow at 32°, which was permissive for either of the single mutants (Fig 3E), further confirming this genetic interaction. While rho3 exo70 cells showed a mild cell separation defect at 24° (Fig 3F, left), this phenotype was exacerbated at 32° (Fig 3F, right) with most cells arresting with multiple septa, similar to the sec8-1 mutant phenotype. Thus, S. pombe rho3 shows strong genetic interactions with all exocyst components for which conditionally lethal mutants are currently available.

Phenotypes of dominant rho3 mutations:
Rho3p is a member of a family of small GTPases that function as molecular switches. Given that activating and inactivating mutations have been extensively characterized in several ras-related GTPases, we studied the function of Rho3p by characterization of dominant-active and dominant-inactive versions of Rho3p. To analyze the dominant phenotypes of rho3 alleles, we introduced two mutations in rho3 that predict a constitutively active (Rho3G25V) form or a constitutively inactive (Rho3T30N) form by analogy to ras oncogene (BOURNE et al. 1991 ). Cells overexpressing Rho3G25V (Fig 4A) had abnormal cell wall deposition, an effect similar to that reported by NAKANO et al. 2002 using a different active Rho3Q71L mutation. In addition, the position of the division septum was altered in some cells (Fig 4A, arrowhead). Cells overproducing Rho3T30N (Fig 3B) were defective in cell separation as observed with the rho3-deletion mutant. These data suggest that Rho3p is involved in cell separation and might be required for cell polarity and cell wall integrity. The cell wall integrity of Rho3G25V and Rho3T30N mutants was measured by testing their sensitivity to zymolyase digestion. Neither mutant exhibited increased sensitivity to zymolyase (data not shown). However, given that the cells expressing Rho3G25V and RhoT30N, as with the exocyst mutants, lyse upon incubation at the restrictive temperature, it is likely that the integrity of the cell wall is compromised in these cells under restrictive growth conditions.

View larger version (91K): [in this window] [in a new window] [Download PPT slide]   Figure 4. Phenotypes of dominant forms of rho3 mutants. Cells expressing either Rho3-Val-25 (a) or Rho3-Asn-30 (b) under control of an nmt1 promoter were grown in the absence of thiamine at 30° for 24 hr, fixed, and stained with DAPI and calcofluor to visualize DNA and septum, respectively. Bar, 10 µm.

The localization of exocyst proteins is independent of Rho3p:
To investigate whether Rho3p regulates the localization of the exocyst complex at the division site, we examined the localization of exocyst components Sec8-GFP and Sec6-GFP in a rho3 strain. At both 24° (Fig 5A) and 36° (Fig 5B), Sec8-GFP was clearly localized to the division site and growing tip(s) in rho3, suggesting that the localization of Sec8p was independent of Rho3p. Similarly, the localization of Sec6p also seemed to be unaffected in rho3 (data not shown). On the basis of these observations, we propose that regulation of localization of the exocyst complex to the division site is not a likely function of Rho3p.

View larger version (51K): [in this window] [in a new window] [Download PPT slide]   Figure 5. Sec8-GFP localization is rho3 independent. rho3 cells expressing Sec8-GFP were either grown at 24° (a) or shifted to 36° for 4 hr (b) and examined for GFP epifluorescence. Bar, 10 µm.

GFP-Rho3p localizes to the division site and its localization requires a functional exocyst:
To investigate the intracellular localization of Rho3p, we tagged the rho3 gene with green fluorescent protein (GFP) under its native promoter at the chromosomal locus. However, no discernible GFP signal could be observed in these cells, presumably due to low expression levels (data not shown). We then fused the rho3 gene at the amino terminus with GFP, expressed it from the nmt1 promoter of the pREP1 plasmid (BASI et al. 1993 ), and introduced this plasmid into wild-type cells and into a rho3 strain. This plasmid expressing GFP-Rho3p under conditions of repression was able to rescue rho3 at 36° (Fig 6A), indicating that this fusion protein was functional. Under conditions of nmt1 promoter repression, we found that the fusion protein localized to the plasma membrane in interphase. During cell division, GFP-Rho3p was localized to the division site (Fig 6B), similar to exocyst proteins. This suggests that rho3 is a plasma-membrane-bound protein that localizes to the division site during cytokinesis.

View larger version (93K): [in this window] [in a new window] [Download PPT slide]   Figure 6. Localization of GFP-Rho3p in S. pombe. (a) GFP-Rho3p rescues the growth defect of rho3 at 36°. rho3 cells were transformed with plasmids expressing GFP alone (cells on left) or GFP-rho3 (cells on right) from nmt1 promoter at the repressed condition. Cells were grown at 24° (not shown) and 36°. (b) GFP-Rho3p localizes to the plasma membrane. The plasmid containing a fusion of GFP at the amino terminus of Rho3p and under control of the nmt1 promoter was introduced into S. pombe wild-type cells. Cells were grown overnight in the presence of thiamine at 30° and visualized microscopically to examine GFP epifluorescence. (c) GFP-Rho3p localization is dependent on functional Sec8p. Wild type (left) or sec8-1 (right) expressing GFP-Rho3p were examined for GFP-Rho3p epifluorescence at 36°. Bar, 10 µm.

To investigate whether the localization of Rho3p required the function of the exocyst, the plasmid expressing GFP-Rho3p was introduced into sec8-1. Whereas GFP-Rho3p alone localized in wild-type cells (Fig 6C, left), its localization was partially compromised in most sec8-1 cells at 36° in that a significant proportion of the protein was detected in intracellular structures (Fig 6C, right). Even at 24°, Rho3p localization was compromised in a significant portion of sec8-1 cells (data not shown). These data indicate that efficient Rho3 localization to the plasma membrane depends on functional Sec8p, but that Rho3p localization is not solely dependent on exocyst function.

Rho3p is involved in vesicle transport:
Given that we had isolated rho3 as a high-copy suppressor of a mutant defective in vesicle transport, we tested whether Rho3p was also involved in vesicle transport by performing electron microscopy on the rho3 cells. Secretory vesicles were rarely observed in rho3 cells growing at 24° (Fig 7A), similar to observation of wild-type cells (WANG et al. 2002 ). Interestingly, in rho3 cells growing at 36°, a large number of putative secretory vesicles accumulated in the cytoplasm in both uninucleate and binucleate interphase cells, suggesting that Rho3p might play a role in trafficking of secretory vesicles at all stages of the cell cycle (Fig 7B). To further test whether rho3 had defects in secretion, we monitored the transport of acid phosphatase, a protein that transits through the secretory pathway in rho3 cells. rho3 cells secreted much less acid phosphatase at 36° compared to that secreted by wild-type cells (Fig 7C). These results suggest that Rho3p is likely to be involved in post-Golgi vesicle trafficking, possibly by coordinating with the exocyst complex.

View larger version (115K): [in this window] [in a new window] [Download PPT slide]   Figure 7. Rho3p is required for a late stage of exocytosis. (a) Electron microscopic analysis of rho3 cells. rho3 cells were either grown at 24° (a) or shifted to 36° for 4 hr (b) overnight, fixed in permanganate, and processed for ultrastructural analysis. The 100-nm darkly stained structures are presumptive secretory vesicles (arrow in magnified boxes). Bar, 500 nm. (c) rho3 cells secrete lowered levels of acid phosphatase. Wild-type ( and •) and rho3 ( and ) cells were assayed for secreted acid phosphatase activity at 24° ( and ) and 36° (• and ).

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Rho3p, a Ras superfamily small GTPase, shows genetic interaction with the exocyst in fission yeast:
The Ras GTPase superfamily of proteins are regulators of diverse biological processes including cell polarization, morphogenesis, cell growth, and development. By alternating between two different forms, an active GTP-bound state and an inactive GDP-bound state, they act as molecular switches in response to different signals (BOURNE et al. 1990 ). In yeasts, the Rho subfamily consists of six members, Cdc42 and Rho1–Rho5. In S. cerevisiae, CDC42, Rho3, and Rho4 play roles in polarized bud formation, while Rho1, Rho2, and Rho5 are involved in synthesis and maintenance of the cell wall (MADAULE et al. 1987 ; ADAMS et al. 1990 ; JOHNSON and PRINGLE 1990 ; MATSUI and TOH-E 1992 ; CABIB et al. 1998 ; ADAMO et al. 1999 ; SCHMITZ et al. 2002 ). In S. pombe, Cdc42p, Rho1p, and Rho2p were shown to be important for polarized growth and morphogenesis (FAWELL et al. 1992 ; MILLER and JOHNSON 1994 ; NAKANO and MABUCHI 1995 ; NAKANO et al. 1997 ; HIRATA et al. 1998 ). Recently, Rho3p, a novel Rho protein from S. pombe, was shown to interact with diaphanous/formin For3p to regulate polarized cell growth (NAKANO et al. 2002 ). In this study, we report the isolation of the rho3⁺ gene as a multicopy suppressor of sec8-1 and identification of a role of Rho3p in cell separation and exocytosis in S. pombe.

Our previous work established that the multiprotein exocyst complex was essential for cell separation in S. pombe (WANG et al. 2002 ). We proposed that the exocyst possibly targets vesicles containing primary septum-degrading enzymes to the division site. In this study we show that the rho3 gene on a multicopy plasmid is able to fully rescue the growth and cell separation defects of a sec8-1 mutant at 36°. However, rho3 was unable to rescue a sec8 mutant, suggesting that high levels of Rho3p stimulate the residual function of the mutant Sec8-1p, rather than bypassing a requirement for Sec8p. The synthetic lethality between sec8-1 and the rho3 mutant might also be explained by an additive lowering of exocyst function in the double mutant. In this context it is interesting to note that the budding yeast Rho3p has also been shown to rescue conditional mutations in sec8 and exo70. We also found that rho3 was able to suppress a null mutant lacking Exo70p, an exocyst component essential only at higher temperatures, indicating that Rho3p might activate exocyst function, thus bypassing the requirement for Exo70p. In budding yeast, Rho3p has been shown to physically interact with the exocyst complex (ROBINSON et al. 1999 ). However, we have been unable to detect a physical interaction between exocyst proteins (Sec8p, Sec10p, and Exo70p) and Rho3p or Rho3G25V mutants in immunoprecipitation experiments (data not shown). We have also been unable to detect any interaction of Sec8p with Rho3p in a yeast two-hybrid system (data not shown). It is possible that this interaction is transient and therefore difficult to observe.

Unlike in S. cerevisiae, Exo70p is nonessential in fission yeast. However, the exo70 null mutant leads to a temperature-sensitive growth phenotype. We found that double-mutant exo70 rho3 had a more severe cell separation phenotype than each single mutant, indicating that Rho3p might share a redundant function with Exo70p. The molecular basis of this interaction is currently unclear. It is possible that Rho3p or one of its effectors might play a role redundant with Exo70p, leading to the observed genetic interaction. Given similarities in the interactions between Rho3p and the exocyst complex in budding and fission yeasts, it is possible that the exocyst function might be regulated similarly in other cell types as well.

Rho3p is a regulator of cell separation and exocytosis in S. pombe:
Cells depleted of Rho3 protein show defects in cell separation similar to that of exocyst mutants, suggesting that Rho3p is involved in this process. Consistently, overproduction of a dominant-inactive form of Rho3p (Rho3T30N) almost phenocopies rho3. The localization of Rho3p to the division site, as with the exocyst proteins, is consistent with a role for this protein in cell division/separation. As with the exocyst null mutants, we could not observe cell growth, elongation, and cell polarity defects in a rho3 mutant, suggesting that Rho3p is not essential for cell elongation and division septum assembly. rho3 is essential only at higher temperatures, whereas the exocyst complex is essential for cell viability at all temperatures except exo70. It is possible that Rho3p acts redundantly with other proteins that might themselves be critical for viability at lower temperatures. Rho4p is an attractive candidate, although other Rho proteins such as Cdc42p (ZHANG et al. 2001 ) and Rho1p (GUO et al. 2001 ) might also contribute to exocyst function, as shown recently in budding yeast.

We also show that putative secretory vesicles accumulate in rho3 at the restrictive temperature, indicating that Rho3p is required for the targeting and fusion of secretory vesicles to the plasma membrane. A role for Rho3p in exocytosis was also inferred from lowered levels of acid phosphatase secretion in a rho3 compared to wild-type cells. Our data lead us to suggest that Rho3p may play a role in cell separation probably by targeting vesicles containing primary cell-wall-degrading enzymes to the division site via interaction with the exocyst complex. Interestingly, these vesicles are observed in both interphase and mitotic cells, suggesting that in addition to functioning during cell separation, Rho3p might also play a nonessential role in polarized cell growth/elongation. Consistent with this possibility is our finding that Rho3p is detected at the plasma membrane of interphase cells as well.

We find that the polarized localization of Sec8p and Sec6p is not affected in a rho3 strain, suggesting that exocyst proteins localize to the division site in a Rho3p-independent manner. Thus, Rho3p modulates the exocyst function by mechanisms independent of those involved in their proper localization. It is conceivable that maximal activation/function of exocyst is achieved via interaction with Rho3p and other proteins redundant with it. Interestingly, the localization of Rho3p seemed to be severely affected in sec8-1, indicating that the exocyst is important for Rho3p localization. Future studies should unravel the molecular nature of interactions between Rho3p and the exocyst complex.

	FOOTNOTES

¹ Present address: Molecular and Cell Biology, 341 LSA, University of California, Berkeley, CA 94720-3200.

	ACKNOWLEDGMENTS

We acknowledge all members of the TLL-IMCB yeast and fungal biology laboratories for helpful suggestions, advice, and reagents. In particular, we thank Ventris D'Souza, Naweed Naqvi, Snezhana Oliferenko, Suniti Naqvi, and Volker Wachtler for critical reading of the manuscript. This work was supported by research funds from the National Science and Technology Board/Agency for Science, Technology and Research Singapore (until July 2002) and subsequently by internal funds from the Temasek Life Sciences Laboratory.

Manuscript received February 16, 2003; Accepted for publication April 11, 2003.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ADAMO, J. E., G. ROSSI, and P. BRENNWALD, 1999  The Rho GTPase Rho3 has a direct role in exocytosis that is distinct from its role in actin polarity. Mol. Biol. Cell 10:4121-4133.[Abstract/Free Full Text]

ADAMS, A. E., D. I. JOHNSON, R. M. LONGNECKER, B. F. SLOAT, and J. R. PRINGLE, 1990  CDC42 and CDC43, two additional genes involved in budding and the establishment of cell polarity in the yeast Saccharomyces cerevisiae.. J. Cell Biol. 111:131-142.[Abstract/Free Full Text]

BALASUBRAMANIAN, M. K., D. MCCOLLUM, and K. L. GOULD, 1997  Cytokinesis in fission yeast Schizosaccharomyces pombe. Methods Enzymol. 283:494-506.[Medline]

BALASUNDARAM, D., M. J. BENEDIK, M. MORPHEW, V. D. DANG, and H. L. LEVIN, 1999  Nup124p is a nuclear pore factor of Schizosaccharomyces pombe that is important for nuclear import and activity of retrotransposon Tf1. Mol. Cell. Biol. 19:5768-5784.[Abstract/Free Full Text]

BASI, G., E. SCHMID, and K. MAUNDRELL, 1993  TATA box mutations in the Schizosaccharomyces pombe nmt1 promoter affect transcription efficiency but not the transcription start point or thiamine repressibility. Gene 123:131-136.[Medline]

BOURNE, H. R., D. A. SAUNDERS, and F. MCCORMICK, 1990  The GTPase superfamily: a conserved switch for diverse cell functions. Nature 348:125-132.[Medline]

BOURNE, H. R., D. A. SANDERS, and F. MCCORMICK, 1991  The GTPase superfamily: conserved structure and molecular mechanism. Nature 349:117-127.[Medline]

CABIB, E., J. DRGONOVA, and T. DRGON, 1998  Role of small G proteins in yeast cell polarization and wall biosynthesis. Annu. Rev. Biochem. 67:307-333.[Medline]

FAWELL, E., S. BOWDEN, and J. ARMSTRONG, 1992  A homologue of the ras-related CDC42 gene from Schizosaccharomyces pombe.. Gene 114:153-154.[Medline]

GRINDSTAFF, K. K., C. YEAMAN, N. ANANDASABAPATHY, S. C. HSU, and E. RODRIGUEZ-BOULAN et al., 1998  Sec6/8 complex is recruited to cell-cell contacts and specifies transport vesicle delivery to the basal-lateral membrane in epithelial cells. Cell 93:731-740.[Medline]

GUERTIN, D. A., S. TRAUTMANN, and D. MCCOLLUM, 2002  Cytokinesis in eukaryotes. Microbiol. Mol. Biol. Rev. 66:155-178.[Abstract/Free Full Text]

GUO, W., F. TAMANOI, and P. NOVICK, 2001  Spatial regulation of the exocyst complex by Rho1 GTPase. Nat. Cell Biol. 3:353-360.[Medline]

HIRATA, D., K. NAKANO, M. FUKUI, H. TAKENAKA, and T. MIYAKAWA et al., 1998  Genes that cause aberrant cell morphology by overexpression in fission yeast: a role of a small GTP-binding protein Rho2 in cell morphogenesis. J. Cell Sci. 111:149-159.[Abstract]

HSU, S. C., C. D. HAZUKA, D. L. FOLETTI, and R. H. SCHELLER, 1999  Targeting vesicles to specific sites on the plasma membrane: the role of the sec6/8 complex. Trends Cell Biol. 9:150-153.[Medline]

JOHNSON, D. I. and J. R. PRINGLE, 1990  Molecular characterization of CDC42, a Saccharomyces cerevisiae gene involved in the development of cell polarity. J. Cell Biol. 111:143-152.[Abstract/Free Full Text]

MADAULE, P., R. AXEL, and A. M. MYERS, 1987  Characterization of two members of the rho gene family from the yeast Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 84:779-783.[Abstract/Free Full Text]

MATSUI, Y. and A. TOH-E, 1992  Yeast RHO3 and RHO4 ras superfamily genes are necessary for bud growth, and their defect is suppressed by a high dose of bud formation genes CDC42 and BEM1. Mol. Cell. Biol. 12:5690-5699.[Abstract/Free Full Text]

MILLER, P. J. and D. I. JOHNSON, 1994  Cdc42p GTPase is involved in controlling polarized cell growth in Schizosaccharomyces pombe. Mol. Cell. Biol. 14:1075-1083.[Abstract/Free Full Text]

MORENO, S., A. KLAR, and P. NURSE, 1991  Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194:795-823.[Medline]

NAKANO, K. and I. MABUCHI, 1995  Isolation and sequencing of two cDNA clones encoding Rho proteins from the fission yeast Schizosaccharomyces pombe.. Gene 155:119-122.[Medline]

NAKANO, K., R. ARAI, and I. MABUCHI, 1997  The small GTP-binding protein Rho1 is a multifunctional protein that regulates actin localization, cell polarity, and septum formation in the fission yeast Schizosaccharomyces pombe. Genes Cells 2:679-694.[Abstract]

NAKANO, K., J. IMAI, R. ARAI, A. TOH-E, and Y. MATSUI et al., 2002  The small GTPase Rho3 and the diaphanous/formin For3 function in polarized cell growth in fission yeast. J. Cell Sci. 115:4629-4639.[Abstract/Free Full Text]

NOVICK, P. and W. GUO, 2002  Ras family therapy: Rab, Rho and Ral talk to the exocyst. Trends Cell Biol. 12:247-249.[Medline]

OKAZAKI, K., N. OKAZAKI, K. KUME, S. JINNO, and K. TANAKA et al., 1990  High-frequency transformation method and library transducing vectors for cloning mammalian cDNAs by trans-complementation of Schizosaccharomyces pombe. Nucleic Acids Res. 18:6485-6489.[Abstract/Free Full Text]

ROBINSON, N. G., L. GUO, J. IMAI, A. TOH-E, and Y. MATSUI et al., 1999  Rho3 of Saccharomyces cerevisiae, which regulates the actin cytoskeleton and exocytosis, is a GTPase which interacts with Myo2 and Exo70. Mol. Cell. Biol. 19:3580-3587.[Abstract/Free Full Text]

SCHMITZ, H. P., S. HUPPERT, A. LORBERG, and J. J. HEINISCH, 2002  Rho5p downregulates the yeast cell integrity pathway. J. Cell Sci. 115:3139-3148.[Abstract/Free Full Text]

TERBUSH, D. R., T. MAURICE, D. ROTH, and P. NOVICK, 1996  The exocyst is a multiprotein complex required for exocytosis in Saccharomyces cerevisiae. EMBO J. 15:6483-6494.[Medline]

WANG, H., X. TANG, J. LIU, S. TRAUTMANN, and D. BALASUNDARAM et al., 2002  The multiprotein exocyst complex is essential for cell separation in Schizosaccharomyces pombe. Mol. Biol. Cell 13:515-529.[Abstract/Free Full Text]

ZHANG, X., E. BI, P. NOVICK, L. DU, and K. G. KOZMINSKI et al., 2001  Cdc42 interacts with the exocyst and regulates polarized secretion. J. Biol. Chem. 276:46745-46750.[Abstract/Free Full Text]

This article has been cited by other articles:

				W. Zheng, J. Chen, W. Liu, S. Zheng, J. Zhou, G. Lu, and Z. Wang A Rho3 Homolog Is Essential for Appressorium Development and Pathogenicity of Magnaporthe grisea Eukaryot. Cell, December 1, 2007; 6(12): 2240 - 2250. [Abstract] [Full Text] [PDF]

				A. Dunkler and J. Wendland Candida albicans Rho-Type GTPase-Encoding Genes Required for Polarized Cell Growth and Cell Separation Eukaryot. Cell, May 1, 2007; 6(5): 844 - 854. [Abstract] [Full Text] [PDF]

				X.-W. Chen, M. Inoue, S. C. Hsu, and A. R. Saltiel RalA-exocyst-dependent Recycling Endosome Trafficking Is Required for the Completion of Cytokinesis J. Biol. Chem., December 15, 2006; 281(50): 38609 - 38616. [Abstract] [Full Text] [PDF]

				S. A. Rincon, B. Santos, and P. Perez Fission Yeast Rho5p GTPase Is a Functional Paralogue of Rho1p That Plays a Role in Survival of Spores and Stationary-Phase Cells Eukaryot. Cell, March 1, 2006; 5(3): 435 - 446. [Abstract] [Full Text] [PDF]

				J. L. Morrell-Falvey, L. Ren, A. Feoktistova, G. D. Haese, and K. L. Gould Cell wall remodeling at the fission yeast cell division site requires the Rho-GEF Rgf3p J. Cell Sci., December 1, 2005; 118(23): 5563 - 5573. [Abstract] [Full Text] [PDF]

				B. Santos, A. B. Martin-Cuadrado, C. R. Vazquez de Aldana, F. del Rey, and P. Perez Rho4 GTPase Is Involved in Secretion of Glucanases during Fission Yeast Cytokinesis Eukaryot. Cell, October 1, 2005; 4(10): 1639 - 1645. [Abstract] [Full Text] [PDF]

				V. Tajadura, B. Garcia, I. Garcia, P. Garcia, and Y. Sanchez Schizosaccharomyces pombe Rgf3p is a specific Rho1 GEF that regulates cell wall {beta}-glucan biosynthesis through the GTPase Rho1p J. Cell Sci., December 1, 2004; 117(25): 6163 - 6174. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wang, H. Articles by Balasubramanian, M. K. Search for Related Content PubMed PubMed Citation Articles by Wang, H. Articles by Balasubramanian, M. K.