Genetics, Vol. 164, 977-988, July 2003, Copyright © 2003

Dntf-2r, a Young Drosophila Retroposed Gene With Specific Male Expression Under Positive Darwinian Selection

Esther Betrána and Manyuan Longa
a Department of Ecology and Evolution, University of Chicago, Chicago, Illinois 60637

Corresponding author: Manyuan Long, University of Chicago, 1101 E. 57th St., Chicago, IL 60637., mlong{at}midway.uchicago.edu (E-mail)

Communicating editor: M. A. F. NOOR


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

A direct approach to investigating new gene origination is to examine recently evolved genes. We report a new gene in the Drosophila melanogaster subgroup, Drosophila nuclear transport factor-2-related (Dntf-2r). Its sequence features and phylogenetic distribution indicate that Dntf-2r is a retroposed functional gene and originated in the common ancestor of D. melanogaster, D. simulans, D. sechellia, and D. mauritiana, within the past 3–12 million years (MY). Dntf-2r evolved more rapidly than the parental gene, under positive Darwinian selection as revealed by the McDonald-Kreitman test and other evolutionary analyses. Comparative expression analysis shows that Dntf-2r is male specific whereas the parental gene, Dntf-2, is widely expressed in D. melanogaster. In agreement with its new expression pattern, the Dntf-2r putative promoter sequence is similar to the late testis promoter of ß2-tubulin. We discuss the possibility that the action of positive selection in Dntf-2r is related to its putative male-specific functions.


IT has been more than 3 decades since gene duplication was suggested to be a major source of evolutionary novelties (OHNO 1970 Down). We are now able to examine this process in detail. Analyses of genome sequences have revealed high frequencies of gene duplicates in vertebrates, invertebrates, and plants (ARABIDOPSIS GENOME INITIATIVE 2000; BLANC et al. 2000 Down; RUBIN et al. 2000 Down; BALL and CHERRY 2001 Down; LI et al. 2001 Down; GU et al. 2002 Down), which may suggest rapid evolution of novel functions. Our understanding of detailed molecular processes and underlying population evolutionary processes most often depends upon the direct observation of a young gene duplicate (LONG et al. 1999 Down; LONG 2001 Down; BETRAN and LONG 2002 Down). Examples of genes recently arisen [<3 million years ago (MYA)] by several different mechanisms have been found in Drosophila: jingwei (jgw; LONG and LANGLEY 1993 Down), Adh-Finnegan (BEGUN 1997 Down), Sdic (NURMINSKY et al. 1998 Down, NURMINSKY et al. 2001 Down), exuperantia 1 X copy (YI and CHARLESWORTH 2000 Down), and Sphinx (WANG et al. 2002 Down; for a more comprehensive review see LONG 2001 Down). Jgw was created after a retroposition event that recruited duplicated exons of a neighboring gene. Sdic is the product of the fusion of two previously duplicated genes. Exuperantia 1 X copy is a transposition of a whole gene by ectopic recombination. In these examples, positive selection has been shown to have played a crucial role in their evolution (LONG and LANGLEY 1993 Down; NURMINSKY et al. 1998 Down; YI and CHARLESWORTH 2000 Down; NURMINSKY et al. 2001 Down; LLOPART et al. 2002 Down).

Previous work (LONG and LANGLEY 1993 Down) has revealed that retroposition can generate duplicates in Drosophila and leave clear evidence of the molecular process that generated the new gene copy from the parental copy. A newly derived retroposed gene can be identified by examining the hallmarks of retroposition (LI 1997 Down): (1) one member of the pair is intronless in the coding region of similar sequence (new copy) while the other contains introns (parental copy); (2) the new copy contains a poly(A) tract; and (3) the new copy may still be flanked by short duplicate sequences. Properties 2 and 3 can be used to infer new retroposed genes if the parental genes do not contain introns. In a genome-wide analysis of retroduplicates, we inferred parental and derived copies by examining these fingerprints of retroposition process (BETRAN et al. 2002 Down). At the threshold of >70% protein sequence identity, we identified 24 pairs of retroposition events with various ages (BETRAN et al. 2002 Down). Here, we report the evolutionary analysis of one of these retroposed genes, Nuclear transport factor-2-related [Dntf-2r (CG10174)] and its parental gene, Dntf-2 (CG1740). Dntf-2, which contains three introns, is located on the X chromosome, whereas Dntf-2r, which contains no introns, is likely a recent retroposed copy of Dntf-2 and is located on the left arm of chromosome 2 in D. melanogaster. In addition, Dntf-2r contains a putative poly(A) tract at the end of the retroposed region (Fig 1). We determined the age of Dntf-2r by surveying its phylogenetic distribution using fluorescence in situ hybridization (FISH) experiments, genomic Southern blot, and PCR analyses. We found that Dntf-2r is present in only four species of Drosophila: D. melanogaster, D. simulans, D. sechellia, and D. mauritiana, suggesting that Dntf-2r originated recently, 3–12 MYA (LACHAISE et al. 1988 Down). Analysis of polymorphism and divergence for the new and parental genes reveals that Dntf-2r is a new functional gene whose protein has been subject to both purifying and positive Darwinian selection. Analyses of expression patterns in D. melanogaster indicate that Dntf-2r is male specific, in contrast to the wide expression of Dntf-2.



View larger version (48K):
In this window
In a new window
Download PPT slide
 
Figure 1. Alignment of the Dntf-2r gene with its parental gene Dntf-2 for D. melanogaster. The Dntf2r mRNA sequence in this species is shown in italics. The putative promoter, coding region, and poly(A) tract of Dntf2r are shown in boldface type.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Phylogenetic distribution of Dntf-2r:
The phylogenetic distribution of Dntf-2r was determined by FISH to polytene chromosomes, Southern analysis, and polymerase chain reactions on the species of the melanogaster subgroup: D. melanogaster, D. simulans, D. sechellia, D. mauritiana, D. yakuba, D. teissieri, D. erecta, and D. orena. A probe of ~300 bp comprising the coding region of Dntf-2r was hybridized to polytene chromosomes of D. melanogaster, D. simulans, D. yakuba, and D. erecta following the WANG et al. 2000 Down protocol. The probe was synthesized by PCR from Dntf-2r and digoxygenin (DIG) labeled by random priming after gel purification of the specific band. For Southern analysis, 2 µg of genomic DNA from species of the melanogaster subgroup were digested and blotted to nylon membrane (SAMBROOK et al. 1989 Down). Hybridizations and detection were carried out following the immunochemiluminescent protocol of Roche (Indianapolis). We did PCR with flanking and homologous primers for the Dntf-2r gene. Primer sequences were 5' GCAGGGCGCATTGTTCAG 3' and 5' CATACGCCTGCCAATACGAGT 3' to amplify Dntf-2r from its flanking region and 5' TTGTCCAGCAGTACTACGCC 3' and 5' AGCCACGAAGAGGGATCCTC 3' to amplify Dntf-2r from its coding region.

DNA samples and sequencing:
Single male fly genomic DNA was obtained using a Puregene kit. Dntf-2r and Dntf-2 were amplified by PCR from this genomic DNA. D. melanogaster samples come from a worldwide distribution: OK17, HG84, and Z(s)56 from Africa; yep3, yep18, yep25, Cof3, BLI5, cal4, y10, and y2 from Australia; 253.4, 253.27, 253.30, and 253.38 from Taiwan; Closs3, Closs10, Closs16, Closs19, and Seattle from the United States; Rio from Brazil; and Rinanga, Bdx, Besançon, Prunay, and Capri from France. Other stocks used were D. simulans from Florida (provided by J. Coyne), D. sechellia (provided by J. Coyne), D. mauritiana (163.1, LEMEUNIER and ASHBURNER 1976 Down), and D. yakuba (115, LEMEUNIER and ASHBURNER 1976 Down). Oligoprimers 5' ATCGGATCGGATTTCCCATAATCT 3'/5' TGCCGAGCTTGTTGTTATCATCTG 3' and 5' CTGGCGGCCCATTTTGTTGACA 3'/5' AGAAAAGTCGTCCCGAGCGAGGAA 3' were used to amplify Dntf-2 in D. melanogaster and D. yakuba (outgroup sequence; see below) and 5' TGCAGGGCGCATTGTTCAG 3' and 5' CATACGCCTGCCAATACGAGT 3' to amplify Dntf-2r in D. melanogaster, D. simulans, D. sechellia, and D. mauritiana, the four species where the gene is present. Haplotypes were obtained by direct sequencing for Dntf-2 since it is on the X chromosome. Nine alleles of D. melanogaster Dntf-2 were sequenced. For Dntf-2r, on the second chromosome, PCRs of individuals heterozygous at more than one site were cloned into a TOPO cloning vector (Invitrogen, San Diego) and one clone was sequenced to infer the haplotype. Only 1 allele randomly chosen in heterozygous individuals was analyzed, giving a total of 26 alleles. PCR products were sequenced directly after purification [QIAGEN (Valencia, CA) kit] on an ABI automated DNA sequencer (Applied Biosystems, Foster City, CA), using fluorescent DyeDeoxy terminator reagents.

Sequence analysis:
Sequences were aligned by means of Clustal W (THOMPSON et al. 1994 Down). Polymorphism and divergence patterns were studied in Dntf-2 and Dntf-2r to determine the relative importance of natural selection and drift in the evolution of these genes.

Synonymous and nonsynonynous substitutions per site (KS and KA) were computed following GOLDMAN and YANG 1994 Down and YANG 1998 Down, using PAML 3.1 software (YANG 1997 Down). This method accounts for transition/transversion bias ({kappa}), for different base frequencies at different codon positions, and for the genetic code structure (GOLDMAN and YANG 1994 Down; YANG 1998 Down). A model of a single rate for all sites was specified ({alpha} = 0; YANG 1997 Down, YANG 1998 Down). For the analysis, a tree with Dntf-2 of D. yakuba as outgroup (Fig 2A) was used. This tree was obtained by considering the age of the gene (see RESULTS) and the phylogenetic information (TING et al. 2000 Down). KA/KS ratio differences in different lineages were tested using the maximum-likelihood ratio test. Log likelihoods of different models were compared with a {chi}2 distribution with as many degrees of freedom as the difference in number of variable parameters of the nested models (YANG 1998 Down). Maximum-likelihood estimates of parameters for each branch (branch length and {omega} = KA/ KS) together with the estimate of {kappa} can be used to calculate KA and KS per branch and construct nonsynonynous and synonymous trees.



View larger version (12K):
In this window
In a new window
Download PPT slide
 
Figure 2. (A) Gene and species genealogy used in the analyses of KA/KS. (B) KS (left) and KA (right) divergence tree for Dntf-2r and Dntf-2 estimated under the "6 KA/KS ratio" model (Table 3). Estimated numbers of substitutions are shown in every branch.

{pi}, the average number of nucleotide differences per site between two random sequences (TAJIMA 1989 Down), and {theta}W, Watterson's estimate of {theta} from the number of segregating sites (WATTERSON 1975 Down), were calculated. Both values estimate the equilibrium neutral parameter {theta} = 4Neµ for autosomal loci and {theta} = 3Neµ for X-linked loci, where Ne is the effective population size and µ is the neutral mutation rate. The difference between {pi} and {theta}W (Tajima's D) reveals nonequilibrium conditions in the history of the sample. Tajima's D (TAJIMA 1989 Down) was calculated and tested by 10,000 simulations using DNAsp 3.53 (ROZAS and ROZAS 1999 Down). Fay and Wu's H test (FAY and WU 2000 Down) was also applied to the polymorphism data of Dntf-2r. The H statistic was used to measure the excess of derived variants at high frequency, a hallmark of recent positive selection (FAY and WU 2000 Down; OTTO 2000 Down). Fay and Wu's H test was computed at http://crimp.lbl.gov/htest.html and tested by 10,000 simulations. Recombination rate (R per gene) for all those simulations was estimated from the data using DNAsp 3.53 (ROZAS and ROZAS 1999 Down).

Under neutrality, intraspecific variation is correlated with interspecific divergence (KIMURA 1983 Down). Deviations from this expectation can result from a number of causes including positive Darwinian selection (MCDONALD and KREITMAN 1991 Down; NIELSEN 2001 Down). We compared intraspecific variation with interspecific divergence at synonymous and replacement sites (MCDONALD and KREITMAN 1991 Down). DNAsp 3.53 software was used to carry out this comparison (ROZAS and ROZAS 1999 Down).

Expression analysis:
Tissues were homogenized and total RNA was prepared, as described by the QIAGEN protocol, from ~200 males and females, 15 virgin females, 15 gonadectomized males, 100 testes plus accessory glands, and 100 testes of D. melanogaster. Gonadectomized males (males from which we removed testes and accessory glands), testes plus accessory glands, and testes were obtained by dissecting mature males in saline solution. After dissection, tissues were preserved in RNA-later solution (Ambion, Austin, TX) at -20° after soaking them at 4° overnight until they were processed. mRNA was prepared from the total RNA of ~200 males and females following the QIAGEN protocol.

The full-length sequence of the D. melanogaster Dntf-2r transcript from testis was obtained by 5' and 3' rapid amplification of cDNA ends (RACE) experiments. Single-strand cDNA was synthesized from mRNA using Superscript (GIBCO-BRL, Gaithersburg, MD). Oligo(dT) was used to prime the synthesis of the 3' end of the cDNA. Oligo(dT) and the specific primers 5' TTGTCCAGCAGTACTACGCC 3' and 5' TCGTCCTTGGAAGACTAAAA 3' were used to PCR amplify the 3' end. The nested PCR product was subcloned and sequenced. Primer 5' AGCCACGAAGAGGGATCCTC 3' was used to synthesize the 5' end of the Dntf-2r cDNA. This cDNA was tailed with dCTP by using terminal transferase (GIBCO-BRL 5' race system). Oligo(dG) adaptors and the nested primers 5' TTGGGCTTCAGCAAAAAGAT 3' and 5' GGGGATCGTCATCGCATTT 3' were used to PCR amplify the 5' end of the cDNA (GIBCO-BRL 5' race system).

RT-PCR was conducted on total RNA from virgin females, gonadectomized males, testes plus accessory glands, and testes for Dntf-2r and Dntf-2. Analysis of expression of intronless genes (such as Dntf-2r) is challenging because genomic contamination can produce a band of the same size as that expected from the cDNA. Therefore, we digested possible contaminating DNA from the total RNA (DNase I amplification grade; GIBCO-BRL) and ran controls including DNA-digested total RNA without retrotranscriptase. Single-strand complementary DNA (cDNA) was synthesized using Superscript and oligo(dT) (GIBCO-BRL). RT-PCR was carried out using specific primers 5' TTGTCCAGCAGTACTACGCC 3'/5' AGCCACGAAGAGGGATCCTC 3' for Dntf-2r and 5' TTGTGCAGCAGTACTATGCG 3'/5' GGCCACAAAGAAGGTGCCTG 3' for Dntf-2.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Structure of Dntf-2r:
The complete D. melanogaster Dntf-2r transcript is given in Fig 1. The transcript consists of the retroposed regions and recruits seven additional nucleotides from its 5' flanking region and four nucleotides from its 3' flanking region. Unlike jingwei (LONG and LANGLEY 1993 Down), Dntf-2r did not recruit any new coding region. Note that a nonconsensus polyadenylation signal must be used for this gene.

Phylogenetic distribution of Dntf-2r:
We dated the appearance of Dntf-2r by establishing which species have the duplication, using several complementary techniques. Fig 3A shows polytene in situ hybridization in D. melanogaster, D. simulans, D. yakuba, and D. erecta. Positive hybridization of Dntf-2r probe in band 2L36F is shown in D. melanogaster and D. simulans. Two additional signals (not shown) were observed in the D. melanogaster and D. simulans genome corresponding to Dntf-2 (X chromosome) and a lighter secondary signal (3R). Only two hybridization signals were observed in D. yakuba and D. erecta, in the X and 3R. Both signals are shown in D. erecta in addition to the lack of hybridization in 36F (2R in this species due to a pericentric inversion; see ASHBURNER 1989 Down). Only Dntf-2 (X chromosome) hybridization is shown in D. yakuba.



View larger version (52K):
In this window
In a new window
Download PPT slide
 
Figure 3. (A) Polytene in situ hybridization with a probe of Dntf-2r in D. melanogaster, D. simulans, D. yakuba, and D. erecta. (B) Southern blot hybridized with a probe of Dntf-2r. Species name is shown at top of each lane. EcoRI digest is shown. (C) Dntf-2r was amplified with flanking region primers. One band of the same size was obtained in D. melanogaster, D. sechellia, D. simulans, and D. mauritiana (Table 1). A shorter band was obtained for D. yakuba, D. teissieri, and D. erecta. This band was sequenced in D. yakuba, D. teissieri, and D. erecta. Sequences aligned well with the flanking sequence of Dntf-2r but the gene insert (new gene) was missing (Fig 4). (D) Dntf-2r was amplified with primers from the coding region. One band of the same size was obtained in D. melanogaster, D. sechellia, D. simulans, and D. mauritiana. No band of the expected size was obtained for D. yakuba, D. teissieri, and D. erecta.

Southern blot analysis (Fig 3B) shows extra strong bands in D. melanogaster, D. simulans, D. mauritiana, and D. sechellia corresponding to Dntf-2r. Fig 3C and Fig D, shows PCR with primers in the flanking and coding regions, respectively. A short product (lacking the Dntf-2r insertion) was obtained for D. yakuba, D. teissieri, and D. erecta (Fig 3C). The products from D. yakuba, D. teissieri, and D. erecta were sequenced. The sequence confirmed that this short fragment corresponds to the flanking region of Dntf-2r (Fig 4). In addition, primers in the coding region were unable to amplify Dntf-2r in D. yakuba, D. teissieri, and D. erecta (Fig 3D).



View larger version (54K):
In this window
In a new window
Download PPT slide
 
Figure 4. Alignment of the flanking region of Dntf-2r of D. melanogaster with the short product (lacking the Dntf-2r insertion) obtained from D. yakuba, D. teissieri, and D. erecta. The first and last codons of Dntf-2r are shown in boldface type.

These data established that the distribution of Dntf-2r is limited to the four species in the D. melanogaster clade: D. melanogaster, D. simulans, D. sechellia, and D. mauritiana. Therefore, the Dntf-2r gene is between 3 and 12 million years old (i.e., the time length from the common ancestor of all D. melanogaster subgroup species to the four-species clade; see LACHAISE et al. 1988 Down).

Sequence analysis:
Sequence variants in the coding region for Dntf-2 and Dntf-2r in related species are shown in Table 1, and Table 2 shows variants for the noncoding region of Dntf-2 in D. melanogaster.


 
View this table:
In this window
In a new window

 
Table 1. DNA sequence variation in the coding region of Dntf-2r and Dntf-2


 
View this table:
In this window
In a new window

 
Table 2. DNA sequence variation in the Dntf-2 region

Divergence analyses were carried out using the consensus sequence for D. melanogaster and two alleles (haplotypes 1 and 2) for D. mauritiana (Table 2). Log-likelihood values and maximum-likelihood estimates of the KA/KS ratio for each branch of the tree for Dntf-2r and Dntf-2 sequences (Fig 2A) under several models are given in Table 3. A free-ratio model (B) was first applied to the data (YANG 1998 Down). This model with 23 parameters differs significantly from the one-ratio model (A) with 13 parameters (ln LB = -935.41, ln LA = -948.38; X2(10) = 2({Delta} ln L) = 25.94; P = 0.0038). Thus, we conclude that {omega}(KA/KS) differs among different branches of the tree. However, model B does not differ significantly from model C, the six-ratio model (X2(5) = 0.12; P > 0.05). So, the six-ratio model is the simplest model that still contains all the information from the free model. Fig 2B shows the estimated numbers of synonymous and replacement substitutions per branch under model C. Now that we know that there are differences in KA/KS ratios along the tree, we want to answer two questions. Is DNTF-2R evolving faster than DNTF-2? If so, is positive Darwinian selection acting in any of the Dntf-2r lineages? We compared different models to answer these questions.


 
View this table:
In this window
In a new window

 
Table 3. Log-likelihood values and parameters estimated under different maximum-likelihood models

Model A vs. C [X2(5) = 25.82; P = 0.0001], A vs. D [X2(1) = 11.6; P = 0.0007], and A vs. F [X2(2) = 19.56; P = 0.00006] tests reveal that DNTF-2 evolved much more slowly than DNTF-2R (KA/KS = 0.0499 vs. KA/KS = 0.5405 on average, respectively). Model C does not differ from model F [X2(3) = 6.26; P > 0.05], showing that KA/KS for Dntf-2 is on average very small: ~0.0502. Thus, Dntf-2 evolved under strong purifying selection, suggesting high functional constraint. The significantly accelerated evolution of DNTF-2R (A vs. D and A vs. F) can be the result of two different phenomena: relaxation of selection or positive Darwinian selection for novel function after the duplication. Relaxation of selection would occur if the protein product translated from Dntf-2r is under less constraint than the protein from Dntf-2. However, if amino acid substitutions in a lineage occur faster than the neutral rate, KA/KS ratios will exceed 1, revealing the action of positive selection.

Relaxation of selective constraints and positive selection in Dntf-2r can be investigated by considering additional models. Model F is significantly more likely than both model D [X2(1) = 7.96; P = 0.0048] and model E [X2(2) = 12.48; P = 0.00195], and model G is more likely than model E [X2(1) = 10.92; P = 0.00095], revealing that KA/KS ratios are significantly <1 in some Dntf-2r lineages (12-1, 12-2, 9-10, 9-5, and 8-9). Thus, we see clear effects of purifying selection in these branches (KA/KS ~ 0.33), indicating functional constraint for this gene. However, KA/KS ratios could be larger than or equal to one in segments 11-12, 11-3, 10-11, and 10-4 because model F is not a significant improvement over model G [X2(1) = 1.56; P > 0.05]—which does not support the action of positive selection. Significance of the other likelihood-ratio tests remains after correcting for multiple comparisons (Bonferroni correction, P < 0.005; SOKAL and ROHLF 1995 Down).

We have shown that the KA/KS ratio that maximizes the likelihood is ~0.33 in some Dntf-2r lineages and >=1.0000 in others. However, these values do not discriminate between the alternatives of relaxation of selection or positive selection on Dntf-2r. This is because the boundary KA/KS > 1 sets a high threshold for testing positive selection (KREITMAN and AKASHI 1995 Down; WYCKOFF et al. 2000 Down). Only a part of the protein is likely to be susceptible to advantageous mutations while the remainder remains subject to purifying selection.

Polymorphism data (Table 1 and Table 2) were analyzed next. Levels of variation at synonymous and nonsynonymous sites and sites in noncoding regions were calculated (Table 4). The Dntf-2 sequence is variable only in noncoding regions, confirming the action of strong purifying selection on its coding region. Tajima's D for Dntf-2 was 0.7416 (P > 0.10); i.e., the frequency spectrum shows no deviation from neutrality.


 
View this table:
In this window
In a new window

 
Table 4. Polymorphism analysis of Dntf-2r and Dntf-2

We detected variation in the coding region for Dntf-2r in D. melanogaster (Table 1 and Table 4). Tajima's D for Dntf-2r was -0.45276 (P > 0.10) and Fay and Wu's H was -1.8338 (P = 0.0752; assuming the value of back mutation of 0.10 and recombination rate estimated for the data, 0.0344 per base, and using Dntf-2 of D. melanogaster as ancestral sequence). Although the frequency spectrum of Dntf-2r variation in the coding region shows no deviation from neutrality, the negative Fay and Wu's H is at a marginal level of significance, suggesting that the three derived sites (117, 239, and 303) are at high frequency. Thus, these derived alleles may have been driven by the effects of positive Darwinian selection. While these tests can detect selection, they have power to detect it only for a short time (~0.5N generations in the favorable case of no recombination; SIMONSEN et al. 1995 Down; FAY and WU 2000 Down). This is equivalent to only ~0.05 MY if we consider 106 as the population size and 10 generations per year for Drosophila.

The McDonald-Kreitman test (MCDONALD and KREITMAN 1991 Down), which considers both within- and between-species variation, was next performed for the Dntf-2r data. Table 5 shows the results for three comparisons with D. melanogaster. The comparisons (D. melanogaster vs. D. mauritiana, D. melanogaster vs. D. simulans, and D. melanogaster vs. D. sechellia) are not independent (see Fig 2). However, if we consider the comparison in which we have polymorphism data for both species (D. melanogaster vs. D. mauritiana), we see the most significant pattern (P = 0.0072). The significance remains after Bonferroni correction for multiple comparisons (P < 0.017; SOKAL and ROHLF 1995 Down). We also made a comparison pooling all the independent information we have in the four species: divergence, mapped in every independent lineage from Fig 2B (R/S = 32/12), and polymorphism from Table 5 (R/S = 3/8). This test shows a highly significant excess of amino acid replacements (G = 7.648; P = 0.0057). The significantly higher ratios of replacement to silent substitutions compared to the ratios of replacement to silent polymorphic sites are consistent with positive selection in the Dntf-2r lineages.


 
View this table:
In this window
In a new window

 
Table 5. Dntf-2r McDonald-Kreitman test

Dntf-2r expression and promoter analysis:
RT-PCR results for Dntf-2r and Dntf-2 in different tissues of D. melanogaster are shown in Fig 5. We differentially amplified the two genes with specific primers. We observed that while Dntf-2 is expressed in all tissues studied, Dntf-2r is expressed only in testes.



View larger version (98K):
In this window
In a new window
Download PPT slide
 
Figure 5. RT-PCR for (A) Dntf-2r and (B) Dntf-2 in D. melanogaster. Lane 1, PCR from female cDNA; lane 2, gonadectomized male cDNA; lane 3, testes plus accessory gland cDNA; lanes 4–6, the respective negative controls after DNA digestion; and lane 7, negative control of the PCR. (C) RT-PCR from testes cDNA for Dntf-2r and Dntf-2. Lane 1, testes cDNA; lane 2, negative control after DNA digestion; lane 3, the negative control of the PCR for Dntf-2r; lane 4, testes cDNA; lane 5, negative control after DNA digestion; and lane 6, negative control of the PCR for Dntf-2.

The ß2-tubulin gene has a late testis-specific promoter (MICHIELS et al. 1989 Down). This promoter is known to exhibit only two elements: ß2-tubulin upstream element 1 (ß2UE1; 14 bp), which is essential for spermatocyte-specific expression, and a quantitative element (7 bp; MICHIELS et al. 1989 Down). Interestingly, we identified a region of sequence similarity with these late testis-specific promoter elements of ß2-tubulin at -42 bp from the transcription initiation site of Dntf-2r in D. melanogaster. Dntf-2r putative promoter elements, upstream element (ATCAGC-TTAGCGGT -62) and quantitative element (GGATATT -42), have a 57% nucleotide identity with the ß2UE1 (ATC-GCAGTAGTCTA) and a 100% identity with the ß2-tubulin quantitative element (GGATATT) of D. hydei, respectively.

Examination of the flanking region of the insertion site in D. teissieri, D. yakuba, and D. erecta (outgroups lacking the insertion; Fig 4) reveals similarity to the 5' putative promoter sequence of Dntf-2r in D. melanogaster. The GGATATT putative quantitative element is present in these outgroup sequences as well as three nucleotides TAG of the putative Dntf-2r upstream element (see Fig 4). This would favor the hypothesis that Dntf-2r developed a new promoter with late testis expression after retroposition by acquiring only a few modifications to the preexisting 5' sequence.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

We investigated evolution of a recently originated gene and its parental copy in D. melanogaster, Dntf-2r (CG10174) and Dntf-2 (CG1740). Sequence comparison revealed that the new gene was generated in a retroposition event. Recent work on the parental copy Dntf-2 in D. melanogaster revealed that this gene, playing a role in the nuclear transport of proteins with nuclear localization signals, is essential for the antimicrobial immune response (BHATTACHARYA and STEWARD 2002 Down). This important role is in agreement with the strong sequence constraint on Dntf-2 that we observed: there was no variation in the coding region within D. melanogaster and the KA/KS ratio was ~0.05 between D. melanogaster and D. yakuba.

On the other hand, there was no information on the function of Dntf-2r. Our sequence analyses of divergence and polymorphism for this gene, as well as our expression evidence, indicate that this gene may produce a functional protein. First, we observed that polymorphism is higher for synonymous than for replacement sites: {pi}R/{pi}S = 0.11 (Table 4), revealing the action of purifying selection. Second, KA/KS ratios for substitutions in Dntf-2r are on average significantly lower than unity (~0.5), which is not consistent with the hypothesis that the gene is a pseudogene in many of the species. The KA/KS ratio of ~0.5 for Dntf-2r is higher than that for Dntf-2. However, the McDonald-Kreitman test revealed a significant excess of amino acid substitutions, suggesting that the accelerated protein sequence evolution is likely a consequence of the action of positive Darwinian selection. Consistent with this interpretation, the Fay-Wu test, with an H statistic of marginal significance, gives a strong hint of an excess of high-frequency variants that would be coupled with the fixation of beneficial mutations. Thus, both purifying selection and adaptive evolution detected in these analyses argue that Dntf-2r encodes a protein, possibly with an evolving novel function. Dntf-2r provides new evidence for the role of positive Darwinian selection in the origin of new genes.

Whether or not a retroposed sequence recruits a new promoter is a critical step to its future fate. If a retroposed sequence integrates in a genomic region devoid of expression potential, it would be doomed to evolve into a pseudogene (JEFFS and ASHBURNER 1991 Down). However, Dntf-2r has developed a tissue-specific expression pattern in D. melanogaster while Dntf-2 is widely expressed in this species (this work and BHATTACHARYA and STEWARD 2002 Down). Consistent with these results, we observe that the 5' flanking region of Dntf-2r in D. melanogaster is similar to the ß2-tubulin promoter elements: ß2UE1, which is essential for spermatocyte-specific expression, and the quantitative element. Although Dntf-2r tissue expression remains to be analyzed in D. simulans, D. mauritiana, and D. sechellia, a similar pattern of expression may be possible, considering that the two putative promoter elements are 100% conserved in these species (data not shown). The Dntf-2r retroposed sequence, as expected from its mRNA origin, did not contain the promoter sequence of the parental gene. It instead recruited a novel 5' regulatory sequence from the insertion site, needing few mutations to become a promoter and leading to a testis-specific pattern of expression. The examination of the D. teissieri, D. yakuba, and D. erecta orthologous regions of the insertion site for Dntf-2r reveals an element similar to the putative promoter sequence of Dntf-2r in D. melanogaster with only a few substitutions. However, it is unclear if this previously existing sequence is a functional promoter for some unknown gene in the region or is just a random genomic sequence that happens to be similar to a promoter sequence. Given its high similarity to the promoter region of ß2-tubulin and its similar expression site (testis), it would be tempting to take the first possibility as a working hypothesis in further research. The promoter capabilities of the 5' preexisting sequence and the 5' region of Dntf-2r in D. melanogaster should be further investigated to test this hypothesis. In conclusion, the Dntf-2r gene is a chimera: the regulatory sequences and protein-coding regions originated from different sources.

An accelerated rate of evolution has been widely observed in some reproduction-related genes, probably due to competition among sperm from different males, female choice, and/or intersexual genomic conflict (EBERHARD 1985 Down; METZ and PALUMBI 1996 Down; TING et al. 1998 Down; TSAUR et al. 1998 Down; AGUADE 1999 Down; WYCKOFF et al. 2000 Down; SWANSON et al. 2001A Down, SWANSON et al. 2001B Down). We can speculate that the detected positive Darwinian selection on Dntf-2r may be related to its newly evolved male-specific function(s). On the other hand, Dntf-2 is also expressed in the germline. The strong purifying selection on this parental gene could be a consequence of its expression in other tissues, a possibly different timing in germline expression, or a different function.

It is known that, in Drosophila, X inactivation occurs early in spermatogenesis (LIFSCHYTZ and LINDSLEY 1972 Down). This implies that Dntf-2 (on the X chromosome) is inactivated at an early stage in spermatogenesis. Dntf-2r on an autosome and expressed in male germline stages could carry out newly evolved function(s) in spermatogenesis. Although this is a plausible interpretation, an alternative scenario ought to be discussed: Dntf-2r maintains the functions of its X-linked parental copy, Dntf-2, in male germline cells after X inactivation. In this scenario, the signature of positive selection observed in the Dntf-2r sequence must be explained by its being subject to a new set of selective pressures in a specific testis tissue despite maintaining the same function. However, this explanation would encounter a difficulty. X inactivation in Drosophila evolved before Dntf-2r originated, since there is evidence for X inactivation in D. pseudoobscura (LIFSCHYTZ and LINDSLEY 1972 Down), which diverged from the melanogaster subgroup ~40 MYA (POWELL 1997 Down). LIFSCHYTZ and LINDSLEY 1972 Down observed that in the spermatocytes of D. pseudoobscura, the arm of the X homologous to the D. melanogaster X chromosome is heteropycnotic, whereas the other arm homologous to the right arm of the D. melanogaster second chromosome does not show heteropycnosis. Thus, there would be a long period (at least 30 MY) from the emergence of the X inactivation to the origin of Dntf-2r, during which the putative Dntf-2 function would be silenced in late male germline stages. Silencing of a previously existing function for such a long evolutionary period might not be tolerable. Thus, it is more parsimonious to assume that the Dntf-2r does not maintain the same function as its parental copy. The observed accelerated substitution in the protein encoded by Dntf-2r is more likely a consequence of positive selection for novel function.


*  FOOTNOTES

Sequence data from this article have been deposited with EMBL/GenBank Data Libraries under accession nos. AY150763–65, AY150768, AY150770–73, AY150775–78, AY150780–87, AY150789–90, AY150792–93, AY150796–97, and AY301039, AY301040, AY301041, AY301042, AY301043, AY301044, AY301045, AY301046, AY301047, AY301048, AY301049, AY301050, AY301051, AY301052, AY301053, AY301054, AY301055, AY301056, AY301057, AY301058, AY301059, AY301060, AY301061. Back


*  ACKNOWLEDGMENTS

We thank J. Coyne, P. Gibert, F. Lemeunier, and M.-L. Wu for providing Drosophila strains used in this work; Janice Spofford for critically reading the manuscript; and members of the Long lab, especially Kevin Thornton, for valuable discussions. We also thank two anonymous reviewers for their comments and corrections that improved the manuscript. This work was supported by grants from National Science Foundation (Career Award) and Packard Fellowship in Science and Engineering to M.L.

Manuscript received September 20, 2002; Accepted for publication March 4, 2003.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

AGUADÉ, M., 1999  Positive selection drives the evolution of the Acp29AB accessory gland protein in Drosophila. Genetics 152:543-551.[Abstract/Free Full Text]

Analysis of the genome sequence of the flowering plant Arabidopsis thaliana.. (2000) Nature 408:796-815.[Medline]

ASHBURNER, M., 1989 Drosophila: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

BALL, C. A. and J. M. CHERRY, 2001  Genome comparisons highlight similarity and diversity within the eukaryotic kingdoms. Curr. Opin. Chem. Biol. 5:86-89.[Medline]

BEGUN, D., 1997  Origin and evolution of a new gene descended from alcohol dehydrogenase in Drosophila. Genetics 145:375-382.[Abstract]

BETRÁN, E. and M. LONG, 2002  Expansion of genome coding regions by acquisition of new genes. Genetica 115(1):65-80.[Medline]

BETRÁN, E., K. THORNTON, and M. LONG, 2002  Retroposed new genes out of the X in Drosophila.. Genome Res. 12:1854-1859.[Abstract/Free Full Text]

BHATTACHARYA, A. and R. STEWARD, 2002  The Drosophila homolog of NTF-2, the nuclear transport factor-2, is essential for immune response. EMBO Rep. 3(4):378-383.[Medline]

BLANC, G., A. BARAKAT, R. GUYOT, R. COOKE, and M. DELSENY, 2000  Extensive duplication and reshuffling in the Arabidopsis genome. Plant Cell 12:1093-1101.[Abstract/Free Full Text]

EBERHARD, W. G., 1985 Sexual Selection and Animal Genitalia. Harvard University Press, Cambridge, MA.

FAY, J. C. and C.-I WU, 2000  Hitchhiking under positive Darwinian selection. Genetics 155:1405-1413.[Abstract/Free Full Text]

GOLDMAN, N. and Z. YANG, 1994  A codon-based model of nucleotide substitution for protein-coding DNA sequences. Mol. Biol. Evol. 11:725-736.[Abstract]

GU, Z., A. CAVALCANTI, F-C. CHEN, P. BOUMAN, and W.-H. LI, 2002  Extent of gene duplication in the genomes of Drosophila, nematode, and yeast. Mol. Biol. Evol. 19:256-262.[Abstract/Free Full Text]

JEFFS, P. and M. ASHBURNER, 1991  Processed pseudogenes in Drosophila.. Proc. R. Soc. Lond. Ser. B 244:151-159.[Medline]

KIMURA, M., 1983 The Neutral Theory of Molecular Evolution. Cambridge University Press, Cambridge, UK.

KREITMAN, M. and H. AKASHI, 1995  Molecular evidence for natural selection. Annu. Rev. Ecol. Syst. 26:403-422.

LACHAISE, D., M.-L. CARIOU, J. R. DAVID, F. LEMEUNIER, and L. TSACAS et al., 1988  Historical biogeography of the Drosophila melanogaster species subgroup. Evol. Biol. 22:159-225.

LEMEUNIER, F. and M. ASHBURNER, 1976  Relationships in the melanogaster species subgroup of the genus Drosophila (Sophophora). II. Phylogenetic relationships between six species based upon polytene banding sequences. Proc. R. Soc. Lond. Ser. B 193:257-294.

LI, W. H., 1997 Molecular Evolution. Sinauer Associates, Sunderland, MA.

LI, W. H., Z. GU, H. WANG, and A. NEKRUTENKO, 2001  Evolutionary analyses of the human genome. Nature 409:847-849.[Medline]

LIFSCHYTZ, E. and D. L. LINDSLEY, 1972  The role of X-chromosome inactivation during spermatogenesis. Proc. Natl. Acad. Sci. USA 69:182-186.[Abstract/Free Full Text]

LLOPART, A., J. M. COMERON, F. BRUNET, D. LACHAISE, and M. LONG, 2002  Intron presence/absence polymorphism in Drosophila driven by positive Darwinian selection. Proc. Natl. Acad. Sci. USA 99(12):8121-8126.[Abstract/Free Full Text]

LONG, M., 2001  Evolution of novel genes. Curr. Opin. Genet. Dev. 11(6):673-680.[Medline]

LONG, M. and C. H. LANGLEY, 1993  Natural selection and the origin of jingwei, a chimeric processed functional gene in Drosophila. Science 260:91-95.[Abstract/Free Full Text]

LONG, M., W. WANG, and J. ZHANG, 1999  Origin of new genes and source for N-terminal domain of the chimerical gene, jingwei, in Drosophila.. Gene 238:135-141.[Medline]

MCDONALD, J. H. and M. KREITMAN, 1991  Adaptative protein evolution at the Adh locus in Drosophila.. Nature 351:652-654.[Medline]

METZ, E. C. and S. R. PALUMBI, 1996  Positive selection and sequence rearrangements generate extensive polymorphism in the gamete recognition protein binding. Mol. Biol. Evol. 13:397-406.[Abstract]

MICHIELS, F., A. GASCH, B. KALTSCHMIDT, and R. RENKAWITZ-POHL, 1989  A 14 bp promoter element directs the testis specificity of the Drosophila beta 2 tubulin gene. EMBO J. 8:1559-1565.[Medline]

NIELSEN, R., 2001  Statistical tests of selective neutrality in the age of genomics. Heredity 86:641-647.[Medline]

NURMINSKY, D. I., M. V. NURMINSKAYA, D. DE AGUIAR, and D. L. HARTL, 1998  Selective sweep of a newly evolved sperm-specific gene in Drosophila. Nature 396:572-575.[Medline]

NURMINSKY, D., D. DE AGUILAR, C. D. BUSTAMANTE, and D. L. HARTL, 2001  Chromosomal effects of rapid gene evolution in Drosophila melanogaster. Science 291:128-130.[Abstract/Free Full Text]

OHNO, S., 1970 Evolution by Gene Duplication. Springer, Berlin.

OTTO, S. P., 2000  Detecting the form of selection from DNA sequence data. Trends Genet. 16:526-529.[Medline]

POWELL, J. R., 1997 Progress and Prospects in Evolutionary Biology—The Drosophila Model. Oxford University Press, New York.

ROZAS, J. and R. ROZAS, 1999  DnaSP version 3: an integrated program for molecular population genetics and molecular evolution analysis. Bioinformatics 15:174-175.[Abstract/Free Full Text]

RUBIN, G. M., M. D. YANDELL, J. R. WORTMAN, G. L. G. MIKLOS, and C. R. NELSON et al., 2000  Comparative genomics of the eukaryotes. Science 287:2204-2215.[Abstract/Free Full Text]

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SIMONSEN, K. L., G. A. CHURCHILL, and C. F. AQUADRO, 1995  Properties of statistical tests of neutrality for DNA polymorphism data. Genetics 141:413-429.[Abstract]

SOKAL, R. R., and F. J. ROHLF, 1995 Biometry. Freeman, San Francisco.

SWANSON, W. J., C. F. AQUADRO, and V. D. VACQUIER, 2001a  Polymorphism in abalone fertilization proteins is consistent with the neutral evolution of the egg's receptor for lysin (VERL) and positive Darwinian selection of sperm lysin. Mol. Biol. Evol. 18:376-383.[Abstract/Free Full Text]

SWANSON, W. J., A. G. CLARK, H. M. WALDRIP-DAIL, M. F. WOLFNER, and C. F. AQUADRO, 2001b  Evolutionary EST analysis identifies rapidly evolving male reproductive proteins in Drosophila. Proc. Natl. Acad. Sci. USA 98:7375-7379.[Abstract/Free Full Text]

TAJIMA, F., 1989  Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585-595.[Abstract/Free Full Text]

TING, C.-T., S.-C. TSAUR, M. L. WU, and C.-I WU, 1998  A rapidly evolving homeobox at the site of a hybrid sterility gene. Science 282:1501-1504.[Abstract/Free Full Text]

TING, C.-T., S.-C. TSAUR, and C.-I WU, 2000  The phylogeny of closely related species as revealed by the genealogy of a speciation gene, Odysseus. Proc. Natl. Acad. Sci. USA 97:5313-5316.[Abstract/Free Full Text]

THOMPSON, J. D., D. G. HIGGINS, and T. J. GIBSON, 1994  CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.[Abstract/Free Full Text]

TSAUR, S. C., C. T. TING, and C.-I WU, 1998  Positive selection driving the evolution of a gene of male reproduction, Acp26Aa, of Drosophila: II. Divergence versus polymorphism. Mol. Biol. Evol. 15:1040-1046.[Abstract]

WANG, W., J. ZHANG, C. ALVAREZ, A. LLOPART, and M. LONG, 2000  The origin of the Jingwei gene and the complex modular structure of its parental gene, yellow emperor, in Drosophila melanogaster. Mol. Biol. Evol. 17:1294-1301.[Abstract/Free Full Text]

WANG, W., F. G. BRUNET, E. NERO, and M. LONG, 2002  Origin of sphinx, a young chimeric RNA gene in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 99(7):4448-4453.[Abstract/Free Full Text]

WATTERSON, G. A., 1975  On the number of segregating sites in genetical models without recombination. Theor. Popul. Biol. 7:256-276.[Medline]

WYCKOFF, G. J., W. WANG, and C.-I WU, 2000  Rapid evolution of male reproductive genes in the descent of man. Nature 403:304-309.[Medline]

YANG, Z., 1997  PAML: a program package for phylogenetic analysis by maximum likelihood. Comput. Appl. Biosci. 13:555-556.[Free Full Text]

YANG, Z., 1998  Likelihood ratio tests for detecting positive selection and application to primate lysozyme evolution. Mol. Biol. Evol. 15:568-573.[Abstract]

YI, S. and B. CHARLESWORTH, 2000  A selective sweep associated with a recent gene transposition in Drosophila miranda.. Genetics 156:1753-1763.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
GeneticsHome page
A. Llopart and J. M. Comeron
Recurrent Events of Positive Selection in Independent Drosophila Lineages at the Spermatogenesis Gene roughex
Genetics, June 1, 2008; 179(2): 1009 - 1020.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. M. Mikhaylova, K. Nguyen, and D. I. Nurminsky
Analysis of the Drosophila melanogaster Testes Transcriptome Reveals Coordinate Regulation of Paralogous Genes
Genetics, May 1, 2008; 179(1): 305 - 315.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
A. Bhutkar, S. M. Russo, T. F. Smith, and W. M. Gelbart
Genome-scale analysis of positionally relocated genes
Genome Res., December 1, 2007; 17(12): 1880 - 1887.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
K. R. Thornton
The Neutral Coalescent Process for Recent Gene Duplications and Copy-Number Variants
Genetics, October 1, 2007; 177(2): 987 - 1000.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
M.-S. Shiao, P. Khil, R. D. Camerini-Otero, T. Shiroishi, K. Moriwaki, H.-T. Yu, and M. Long
Origins of New Male Germ-line Functions from X-Derived Autosomal Retrogenes in the Mouse
Mol. Biol. Evol., October 1, 2007; 24(10): 2242 - 2253.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
D. J. Begun, H. A. Lindfors, A. D. Kern, and C. D. Jones
Evidence for de Novo Evolution of Testis-Expressed Genes in the Drosophila yakuba/Drosophila erecta Clade
Genetics, June 1, 2007; 176(2): 1131 - 1137.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
E. Betran, Y. Bai, and M. Motiwale
Fast Protein Evolution and Germ Line Expression of a Drosophila Parental Gene and Its Young Retroposed Paralog
Mol. Biol. Evol., November 1, 2006; 23(11): 2191 - 2202.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. Proschel, Z. Zhang, and J. Parsch
Widespread Adaptive Evolution of Drosophila Genes With Sex-Biased Expression
Genetics, October 1, 2006; 174(2): 893 - 900.
[Abstract] [Full Text] [PDF]


Home page