| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Corresponding author: Edward K. Kentner, Life Sciences Bldg., University of Georgia, Athens, GA 30602., ekentner{at}arches.uga.edu (E-mail)
Communicating editor: J. A. BIRCHLER
| ABSTRACT |
|---|
The Louisiana iris species Iris brevicaulis and I. fulva are morphologically and karyotypically distinct yet frequently hybridize in nature. A group of high-copy-number TY3/gypsy-like retrotransposons was characterized from these species and used to develop molecular markers that take advantage of the abundance and distribution of these elements in the large iris genome. The copy number of these IRRE elements (for iris retroelement), is
1 x 105, accounting for
610% of the
10,000-Mb haploid Louisiana iris genome. IRRE elements are transcriptionally active in I. brevicaulis and I. fulva and their F1 and backcross hybrids. The LTRs of the elements are more variable than the coding domains and can be used to define several distinct IRRE subfamilies. Transposon display or S-SAP markers specific to two of these subfamilies have been developed and are highly polymorphic among wild-collected individuals of each species. As IRRE elements are present in each of 11 iris species tested, the marker system has the potential to provide valuable comparative data on the dynamics of retrotransposition in large plant genomes.
THE majority of chromosomal DNA in plants with large genomes is repetitive and is likely composed of various classes of mobile elements (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
LTR retrotransposons are class I mobile elements related to infectious retroviruses (![]()
![]()
![]()
![]()
![]()
![]()
![]()
Plant retrotransposons have been shown to be activated by several forms of stress to the host plant, including wounding, tissue culture, pathogen attack, and chemical treatment (![]()
![]()
![]()
![]()
![]()
![]()
![]()
The Louisiana iris species complex has a long history as a model system for studying the evolutionary implications of natural hybridization (e.g., ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The goal of this study was to characterize LTR retrotransposons from the large iris genome to take advantage of the abundance and distribution of these elements for the development of molecular markers useful for hybridization and speciation research. Two families of related Ty3/gypsy-like LTR retrotransposons were characterized using PCR and genomic library screens. These IRRE elements (for iris retroelement) account for 610% of the
9650-Mb iris genome and are transcriptionally active in I. brevicaulis, I. fulva, and their F1 and backcross hybrids. IRRE elements were detected in each of 11 iris species tested, but not in several related genera. Transposon display or S-SAP primers specific to two subfamilies of IRRE elements were used to generate large numbers of markers in I. brevicaulis and I. fulva, and the technique can be adapted for use in other iris species as well.
| MATERIALS AND METHODS |
|---|
Materials:
All material from Louisiana iris species (I. brevicaulis, I. fulva, I hexagona, and I. nelsonii) was obtained from wild-collected plants maintained at the University of Georgia Plant Biology Department greenhouses. Other species were collected from natural populations in Georgia (I. cristata, I. verna, and Sisyrinchium sp.) and California (I. bracteata, I. crysophylla, I. douglasiana, I. missouriensis, and I. longipetala) or were obtained from plants cultivated in the University of Georgia Plant Biology Department greenhouses (Acidanthera bicolor and Neomarica longifolia). Seed of the genome size standard Allium cepa cv. Ailsa Craig was provided by Michael Bennett (Royal Botanical Garden Kew).
Nucleic acid extraction:
DNA was extracted using the CTAB procedure of ![]()
![]()
600 µg of leaf RNA using an Oligotex mRNA purification kit (QIAGEN). First-strand cDNA was obtained using the Superscript cDNA synthesis kit (Invitrogen, Carlsbad, CA).
Cloning procedures:
Repetitive elements from I. fulva and I. brevicaulis were isolated by constructing small insert (
200900 bp) genomic libraries for each species in the plasmid vector pBlueScript II (Stratagene, La Jolla, CA) following partial digestion of genomic DNA with Sau3AI. Libraries were probed with sheared
-32P-labeled total genomic DNA (random primers labeling kit, Invitrogen) from either I. fulva or I. brevicaulis. Plasmid clones showing homology to retrotransposons in database searches were used to probe phage libraries constructed by cloning
5- to 10-kb Sau3AI genomic fragments into the
ZAP express phage vector (Stratagene). PCR products were cloned using the TOPO TA cloning kit (Invitrogen).
Polymerase chain reaction:
Retrotransposon fragments containing the 3' end of the integrase domain and the 5' end of the 3' LTR were amplified using the primer pair LTRSCREENF (CACAYTTGTTYGACTCGTRAGG)/LTRSCREENR (TYRTGCAAGATGTACTTGCC). PCR amplifications were performed on 50200 ng of genomic DNA in 30-µl reaction volumes containing 1.5 units of Amplitaq DNA polymerase (Perkin Elmer/Applied Biosystems, Foster City, CA), 0.2 mM each dNTP, 1.5 mM MgCl2, and the buffer supplied with the enzyme. Cycling conditions were 94° for 3 min, followed by 32 cycles of 94° for 45 sec, 52° for 45 sec, 72° for 1 min, and ending with 72° for 6 min. Reverse transcriptase (RT)-PCR was performed using the same primers and cycling conditions except that 1 µl of first-strand cDNA or 1 µl of the DNase-treated template RNA for cDNA synthesis (negative controls) was used as a template.
Transposon display:
Total genomic DNA (
500 ng) was digested overnight at 37° with an excess (50 units) of EcoRI. Standard EcoRI amplified fragment length polymorphism adapters (![]()
Preamplification reactions contained 10 pmol of primers homologous to the adapters plus two selective bases (![]()
Selective amplifications were performed in 10 µl containing 1 µl of the 10:1 diluted preamplification reaction, 5 pmol of adapter primer plus four selective bases, 3 pmol 33P-labeled IRRE1-A1 primer (CGTATAAAATACGTACACAAGAG) or IRRE1-C primer (TCCAATTACGTATAAAATACG), 1.5 units AmpliTaq DNA polymerase (Perkin Elmer/Applied Biosystems), 0.2 mM each dNTP, 2.5 mM MgCl2, and the buffer supplied with the enzyme. The cycling conditions were 94° for 3 min, followed by 30 cycles of 94° for 30 sec, 56° for 50 sec (IRRE1-A1) or 51° for 30 sec (IRRE1-C), 72° for 1 min, and a final elongation of 72° for 3 min. The amplification products were run on polyacrylamide sequencing gels and visualized by autoradiography.
DNA sequencing and analysis:
DNA clones from the plasmid library screens were sequenced by the Molecular Genetics Instrumentation Facility at the University of Georgia.
-clones and cloned PCR products were sequenced using the Big Dye terminator sequencing kit (Perkin Elmer/Applied Biosystems) on an ABI 377 automated DNA sequencer (Perkin Elmer/Applied Biosystems). A primer walking strategy was employed to sequence the
-clones and universal sequencing primers were used to sequence the cloned PCR products. DNA and amino acid sequences were aligned with the ClustalW Service at the European Bioinformatics Institute (http://www2.ebi.ac.uk/clustalw) using the default parameters, and GeneDoc (http://www.psc.edu/biomed/genedoc) was used to manually edit and box-shade the alignments. Neighbor-joining trees were constructed using MEGA 2.1 (http://www.megasoftware.net/), and the sliding window analysis was carried out using DnaSp (![]()
Flow cytometry:
Nuclear DNA content was measured by flow cytometry according to ![]()
![]()
![]()
![]()
Copy-number determination:
Two methods, dot blot hybridizations and a genomic library screen were used to determine the copy number of the retrotransposon internal domains and LTRs. Two probes labeled with
-32P by random priming (Invitrogen) were used. The internal domain probe was FR-3, a 761-bp plasmid clone containing the end of the integrase core domain and the downstream sequence (chromodomain) ending
100 bp before the start of the 3' LTR. The LTR probe was BR-5, a 542-bp plasmid clone containing an LTR fragment ending 10 bp before the 3' end of the LTR (Fig 1).
|
Serial dilutions of FR-3 or BR-5 and genomic DNA from I. brevicaulis, I. fulva, I. hexagona, and I. nelsonii were spotted onto GeneScreen hybridization membranes (New England Nuclear, Boston) using a dot blot apparatus (GIBCO BRL, Gaithersburg, MD). Two replicate dots containing 1, 10, 25, 50, and 100 ng of genomic DNA were made for each species (for a total of 10 dots per species). Internal domain and LTR spots were also replicated twice and contained 0.01, 0.05, 0.125, 0.25, and 0.5 ng of either FR-3 or BR-5. The total amount of DNA in each spot was adjusted to 100 ng with salmon sperm DNA, and the DNA was bound to the membrane using ultraviolet light. DNAs were quantified by fluorimetry (Hoefer Scientific, San Francisco), adjusted to the same concentration, and then checked on agarose gels stained with ethidium bromide before the final dilutions were made. Two identical blots were probed with either FR-3 or BR-5 before a final wash of 0.1x SSC and 0.1% SDS at 65° for 15 min. Hybridization signals from each dot were quantified with a STORM phosphoimager (Molecular Dynamics, Piscataway, NJ) and the average number of counts per copy in the FR-3 and BR-5 dots was used to calculate the total number of copies present in each genomic dot. The genome size measurements obtained by flow cytometry for each species were then used to calculate the number of genomes per dot, and the number of copies of each probe per genome was determined by dividing the number of copies per genomic dot by the number of genomes per dot. As regressions of DNA quantity vs. hybridization signal were nearly perfectly linear (R2 > 0.99, data not shown) for each series of dots, the copy numbers reported are the average copy number calculated from all dots of a given species.
Copy number estimates were obtained for FR-3 and BR-5 by screening the I. brevicaulis primary
-phage library (average insert size of
6900 bp) and counting the number of positive plaques. Replicate filters were made so that the fraction of the library screened was identical for both probes. A total of 3192 plaques containing
22 Mb were screened and copy numbers were calculated by dividing the number of positive plaques by the proportion of the genome screened (
0.11%).
Gel blot analysis:
DNA gel blot analysis was performed using GeneScreen hybridization transfer membranes (New England Nuclear) following the manufacturer's "salt transfer protocol" for transferring DNA to the membrane and the "aqueous hybridization buffer for DNA" protocol for prehybridization and hybridization. Following overnight hybridization at 65° the membranes were washed twice with 2x SSC and 1% SDS at 60° for 15 min before a final 15-min wash at 25° with 0.1x SSC.
RNA gel blot analysis was performed as described by ![]()
5 µg of poly(A)+ RNA isolated from I. brevicaulis leaf tissue. The blot was subjected to a final wash in 5 mM Tris-HCl pH 8.0 and 0.1% SDS at 65° for 15 min.
| RESULTS |
|---|
Isolation and characterization of iris LTR retrotransposons:
The cloning strategy for isolating iris retrotransposons was based on the expectation that the highest copy-number repeats should be LTR retrotransposons. High copy repetitive sequences were isolated from small-insert I. brevicaulis (IB) and I. fulva (IF) genomic libraries by probing with sheared total DNA from the genome used to construct the library. Sixteen IB clones and 12 IF clones were recovered and 7 randomly chosen clones from each species were confirmed to be repetitive by DNA gel blot hybridization (data not shown) before all 28 clones were fully sequenced. BLASTX searches revealed that 10 of the 28 clones share sequence similarity with the coding regions of LTR retrotransposons in the public databases.
To obtain the LTR sequence information necessary for the development of the primers for transposon display (see below),
-phage libraries were constructed and probed. Two clones, FR3 (fulva repeat 3) and BR8 (brevicaulis repeat 8), were chosen to probe I. fulva and I. brevicaulis
-phage libraries, respectively, on the basis of their high level of amino acid similarity to Ty3/Gypsy-like elements in the databases. FR3 is a 761-bp integrase/chromodomain fragment and BR8 is a 426-bp RNaseH fragment. Both probes hybridized strongly with >5% of the plaques screened. Six I. fulva clones hybridizing to the FR3 probe (
FR3s) and eight I. brevicaulis clones hybridizing to the BR8 probe (
BR8s) were chosen for DNA sequencing. Three of the
FR3 clones and four of the
BR8 clones were fully sequenced and the rest of the clones were partially sequenced from each end. The sequencing of a clone was abandoned when it became clear that it did not contain fragments useful for defining the LTR ends (our primary objective) or, in a few cases, when regions that were difficult to sequence were encountered.
The sequence of the larger fragments contained in the
-clones revealed that both of the probes were fragments of elements belonging to closely related Ty3/Gypsy-like retrotransposons. The elements were named IRRE, using the naming scheme that has been applied to rice (RIRE; ![]()
![]()
![]()
![]()
![]()
![]()
|
|
While retrotransposon proteins are well conserved and easily recognizable, LTR sequences are highly variable in length and in primary sequence and generally cannot be identified for uncharacterized elements using database searches. Instead, LTRs must be defined as direct repeats flanking the coding region of an element. Attempts to define the IRRE LTRs using this strategy were complicated by the length of the LTRs relative to the average insert size of the libraries from which the clones were derived (
-phage library average insert sizes: I. fulva,
6200 bp; I. brevicaulis,
6900 bp), so a complete IRRE sequence was reconstructed from a series of overlapping
-clones representing paralogous copies of the element (Fig 1). Variable, but identifiable direct repeats of
2.83.0 kb flanking the coding region of several clones were identified as likely LTRs. The LTRs end in the typical 5' TG preceded by a polypurine tract (PPT) and in a 3' CA followed by a primer binding site (PBS). The putative PBS is most similar to the cytoplasmic isoleucine tRNA from L. luteus (Fig 1; ![]()
![]()
). In all cases, the sequence similarity between the clones either dropped off abruptly at the end of the LTRs (representing the flanking genomic DNA) or continued into the coding regions (either the gag or the integrase) of the element, as expected (data not shown).
The iris genome contains diverse subfamilies of IRRE elements:
Alignment of the LTR sequences from the
-clones clearly indicated that the IRRE1 and IRRE2 families can be divided into subfamilies of elements sharing diagnostic nucleotide residues at many positions. To further define these subfamilies and to derive the LTR-end consensus sequences necessary for the design of transposon display primers, the PCR primer pair LTRSCREENF/LTRSCREENR was used to amplify IRRE fragments consisting of the noncoding region after the stop codon of the pol domain and the first
280 bp of the 3' LTR (Fig 1). These primers are degenerate and were designed to amplify as many IRRE variants as possible given the available sequence information. A total of 34 of these PCR products were cloned from genomes of I. brevicaulis and I. fulva and sequenced, revealing remarkable LTR diversity among IRRE elements. The relationships among IRRE subfamilies as defined by these LTR sequences is presented in the neighbor-joining tree of Fig 4. While the adjacent internal domain is relatively conserved among all of the sequenced PCR products, the LTR sequences contain numerous insertion/deletion polymorphisms of
330 bp that are most often shared by several sequences. The overall size of the region corresponding to these PCR products among 59 genomic and cDNA sequences (see below) varies from 382 to 498 bp.
|
Retrotransposons are transcribed from promoter elements typically located in the 5' end of the LTR. To identify potential IRRE promoter sequences, each PCR product was analyzed with eukaryotic promoter prediction software (http://www.fruitfly.org/seq_tools/promoter.html). A region of the LTR was consistently identified as a likely (score ≥0.90) TATA box and transcriptional start site. To confirm this result, a sliding window analysis of nucleotide diversity across the alignment of genomic PCR products was performed to search for conserved and, therefore, possible functional domains within the IRRE LTR sequences (Fig 5). Two highly conserved regions were detected, one of them corresponding to the putative PPT/LTR end and the other located
150 bp downstream in the alignment. This second conserved region corresponds to the putative promoter sequences independently identified by the promoter prediction software.
|
Louisiana iris genome size:
Because an estimation of total genome size is required to calculate the copy number of IRRE elements, flow cytometry was used to measure the C values of each of the four hybridizing Louisiana iris species (Fig 6). The values measured for each species (I. brevicaulis, 2C = 19.75 pg; I. fulva, 2C = 19.57 pg; I. hexagona, 2C = 19.59 pg; I. nelsonii, 2C = 20.04 pg) are comparable to the available data for other Iris species (iris median is 19.05 pg; ![]()
81% of the
3400 species that have been measured (![]()
|
Copy-number estimation of IRRE elements:
Two methods were used to determine the genomic copy number of IRRE elements, dot blot hybridizations and a genomic library screen. Estimates were obtained for each of the four hybridizing Louisiana iris species using dot blots and independently estimated for I. brevicaulis by screening the primary phage library used to isolate the IRRE clones (the I. fulva library was amplified and was therefore inappropriate for copy-number determination). The results obtained for both methods are presented in Table 1 and indicate that between 6.5 x 104 and 1 x 105 copies of IRRE elements are present per haploid genome. Assuming an average element size of 11 kb, IRRE sequences are estimated to account for
610% of the Louisiana iris genome.
|
Estimation of the number of solo LTRs:
Recombination between the LTRs of a retrotransposon can result in the loss of internal sequences, leaving behind a solo LTR. The ratio of intact elements to solo LTRs for the barley retrotransposon BARE-1 has been shown to be highly variable among barley species, with the excess of LTR sequences reported to be 7- to 42-fold greater than the expected two-to-one ratio (![]()
-clones differ by as much as 30% in the probe region and the hybridization wash conditions were stringent. If the LTRs evolve faster than the internal domains, then the LTR probe would hybridize to fewer IRRE subfamilies than the internal probe would, resulting in an underestimate of the number of LTRs. To test for this possibility, comparisons of nucleotide similarity for the region homologous to the LTR probe (BR5) and for the element protein core domains were made among all pairs of
-clones containing the appropriate sequences. In these comparisons, the nucleotide sequence of the region homologous to the LTR probe is significantly more divergent among element copies than are the coding regions (randomization test, P < 0.001), suggesting that the region of the IRRE LTR corresponding to the probe evolves at a faster rate than the element coding regions.
IRRE elements are transcriptionally active:
To test for the possible transcriptional activity of IRRE elements, an I. fulva x I. brevicaulis interspecific mapping population was assayed using RT-PCR. The parents (i.e., "pure" I. brevicaulis and I. fulva), several F1 plants, and five back crosses to each parent were assayed for IRRE transcripts using the LTRSCREEENF/LTRSCREENR primer pair. Transcripts were present in all of the genotypes tested (Fig 7). Contamination by genomic DNA was ruled by negative controls, which used the DNase-treated RNA as the amplification template. For I. brevicaulis, transcripts were also detected on Northern blots (data not shown), but only when a relatively large amount of poly(A)+ RNA (
5 µg) was used, suggesting that IRRE transcripts are not particularly abundant. To verify that the amplified bands represent IRRE fragments, 21 cloned PCR products were sequenced from I. brevicaulis, I. fulva, and an F1 hybrid between them. The two bands evident in all of the RT-PCR reactions represent different subfamilies of elements containing insertion/deletion polymorphisms with the larger band representing at least two sequence variants that result in similar overall fragment length.
|
IRRE retrotransposons are useful molecular markers:
One of the primary reasons for characterizing LTR retrotransposons from Louisiana iris species was to develop transposon display or S-SAP markers (![]()
![]()
-clones. The LTR sequence of the two subfamilies is divergent in the region suitable for transposon display primer sites, enabling the design of subfamily-specific primers.
To test the level of polymorphism of the IRRE retrotransposon-based markers, 10 wild-collected individuals each of I. fulva and I. brevicaulis were screened using primers specific for the IRRE1-A1 and IRRE1-C subfamilies (Fig 8). Both sets of primers amplified numerous bands from each species, and a high proportion of these bands are polymorphic among the individuals tested (Table 2). Several of the monomorphic bands appear to be species-specific markers (Table 2), which are particularly useful for studying natural hybridization. However, transposon display generates dominant markers, and high-frequency insertions may not be distinguishable from fixed insertions when the number of individuals sampled is small. Assuming that the monomorphic bands in the sample are fixed, the proportion of polymorphic loci is significantly different between the two species for both elements (exact test: IRRE1-A1, P < 0.0001; IRRE1-C, P = 0.023). No significant difference in the level of polymorphism between the two element subfamilies was detected within either species (exact test: I. brevicaulis, P = 0.813; I. fulva, P = 0.085), suggesting that the timing and/or level of retrotranspositional activity is not dramatically different for the two subfamilies. The majority of bands generated for both subfamilies is likely to represent individual loci as they segregate in normal Mendelian ratios in a separate set of linkage mapping experiments using these markers (A. BOUCK, E. KENTNER, R. PEELER, M. ARNOLD and S. WESSLER, unpublished data).
|
|
IRRE retrotransposons are present in many iris species:
To investigate the taxonomic distribution of IRRE LTR retrotransposons, we assayed their presence in 11 iris species and in three other genera of Iridaceae by PCR and/or Southern hybridizations (Fig 9). The results for both techniques were consistent in all cases. IRRE elements are present in all members of the genus Iris examined, although the hybridization signal on Southern blots is much stronger in the Louisiana iris than in other members of the genus (Fig 9). This result could be due to the sequence divergence of IRRE elements in the genomes of more distantly related iris, lower IRRE copy number in these genomes, or both. For the California irises (Fig 9A, lanes 57) preliminary results obtained by sequencing IRRE PCR products suggest that the lower hybridization signal may be due to sequence divergence (E. KENTNER, unpublished data).
|
| DISCUSSION |
|---|
The IRRE elements are typical Ty3/Gypsy-like LTR retrotransposons that occur in high copy number in the genomes of each of the four species of hybridizing Louisiana iris. LTR retrotransposons are major components of plant genomes, and the phylogenetic relationships among a diverse set of these elements or element fragments from many plant species have been determined (e.g., ![]()
![]()
![]()
Several subfamilies of IRRE elements can be distinguished on the basis of the sequence variation in their LTR ends. This variation is similar to the variation documented among the Tnt1 subfamilies of tobacco (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Although the 3' ends of the IRRE LTRs are less variable than the 5' ends containing the putative promoter elements, the sequence of the 3' end of the LTR corresponding to the copy number probe is more variable among IRRE copies than is the sequence of the internal probe. Given the level of LTR variation among IRRE subfamilies and the size of the iris genome, the accurate quantification of the ratio of intact elements to solo LTRs may require an alternative strategy such as the construction and screening of BAC libraries, which would be very difficult considering the size of the iris genome. As discussed by ![]()
At
0.751.0 x 105 copies, IRRE elements are abundant in the Louisiana iris genome, but well within the range that has been observed for LTR retrotransposons in other plant genomes. For example, the Ty3/gypsy-like element Huck accounts for
10% of the 2.5 x 109-bp maize genome with a copy number exceeding 1 x 105 (![]()
![]()
![]()
To date, only a handful of plant LTR retrotransposons have been shown to be transcriptionally active, with activation most often associated with biotic or abiotic stresses (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Transposon display markers were developed for two subfamilies of IRRE elements and insertional polymorphism was assayed in wild-collected individuals of I. brevicaulis and I. fulva. For markers derived from both subfamilies of elements, the proportion of polymorphic loci is higher for I. brevicaulis than for I. fulva. The allozyme data of ![]()
![]()
![]()
![]()
![]()
![]()
![]()
Retrotransposons closely related to the IRRE elements cloned from I. brevicaulis and I. fulva are present in each of 11 iris species tested. The sample includes a representation of species belonging to the subgenus Limniris (the beardless iris), and it is likely that all native North American iris contain these elements. The LTR ends of IRRE elements can be readily amplified from all of these species using the degenerate primers, and these products can be cloned and sequenced using standard techniques. The sequence of the LTR ends can then be used to define additional IRRE subfamilies for transposon display development. As the preliminary sequencing of LTR ends from several species outside of the series Hexagonae (the Louisiana iris) have yielded divergent complements of IRRE subfamilies (E. KENTNER, unpublished data), the application of these markers to other iris species may require this additional step of subfamily discovery and definition. The markers should be useful for many applications in evolutionary biology and genetics and it will be interesting to compare insertional polymorphism among IRRE subfamilies and among iris species to gain insight into the dynamics of retrotransposition in large plant genomes.
| FOOTNOTES |
|---|
Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under accession nos.
AY245285,
AY245286,
AY245287,
AY245288,
AY245289,
AY245290,
AY245291,
AY245292,
AY245293,
AY245294,
AY245295,
AY245296,
AY245297,
AY245298,
AY245299,
AY245300,
AY245301,
AY245302,
AY245303,
AY245304,
AY245305,
AY245306,
AY245307,
AY245308,
AY245309,
AY245310,
AY245311,
AY245312,
AY245313,
AY245314,
AY245315,
AY245316,
AY245317,
AY245318,
AY245319,
AY245320,
AY245321,
AY245322,
AY245323,
AY245324,
AY245325,
AY245326,
AY245327,
AY245328,
AY245329,
AY245330,
AY245331,
AY245332,
AY245333,
AY245334,
AY245335,
AY245336,
AY245337,
AY245338,
AY245339,
AY245340,
AY245341,
AY245342,
AY245343,
AY245344,
AY245345,
AY245346,
AY245347,
AY245348,
AY245349,
AY245350,
AY245351,
AY245352,
AY245353,
AY245354,
AY245355,
AY245356,
AY245357,
AY245358,
AY245359,
AY245360,
AY245361,
AY245362,
AY245363,
AY245364,
AY245365,
AY245366,
AY245367,
AY245368,
AY245369,
AY245370,
AY245371,
AY245372,
AY245373,
AY245374,
AY245375. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank Mike Scanlon, Brad Bernstein, and Ryan Peeler for assistance in the laboratory and Ning Jiang, Cedric Feschotte, Scott Cornman, and Amy Bouck for critical reading of the manuscript. E.K.K. was supported by a training grant from the National Science Foundation (DBI 9602223).
Manuscript received December 3, 2002; Accepted for publication February 26, 2003.
| LITERATURE CITED |
|---|
ANDERSON, E. A., 1949 Introgressive Hybridization. John Wiley & Sons, New York.
ARAUJO, P. G., J. M. CASACUBERTA, A. P. P. COSTA, R. Y. HASHIMOTO, and M. A. GRANDBASTIEN et al., 2001 Retrolyc1 subfamilies defined by different U3 LTR regulatory regions in the Lycopersicon genus. Mol. Genet. Genomics 266:35-41.[Medline]
ARNOLD, M. L., 1993 Iris nelsonii (Iridaceae): origin and genetic composition of a homoploid hybrid species. Am. J. Bot. 80:577-583.
ARNOLD, M. L., 1997 Natural Hybridization and Evolution. Oxford University Press, Oxford.
ARNOLD, M. L., 2000 Anderson's paradigm: Louisiana irises and the study of evolutionary phenomena. Mol. Ecol. 9:1687-1698.[Medline]
ARNOLD, M. L., J. L. HAMRICK, and B. D. BENNETT, 1990 Allozyme variation in Louisiana irises: a test for introgression and hybrid speciation. Heredity 65:297-306.
BARCISZEWSKA, M., G. KEITH, G. DIRHEIMER, and J. BARCISZEWSKI, 1988 The nucleotide-sequence of transfer RNAser and transfer RNAile of yellow lupin seeds. Nucleic Acids Res. 16:8175.
BARTOLOME, C., X. MASIDE, and B. CHARLESWORTH, 2002 On the abundance and distribution of transposable elements in the genome of Drosophila melanogaster.. Mol. Biol. Evol. 19:926-937.
BEGUIRISTAIN, T., M. A. GRANDBASTIEN, P. PUIGDOMENECH, and J. M. CASACUBERTA, 2001 Three Tnt1 subfamilies show different stress-associated patterns of expression in tobacco. Consequences for retrotransposon control and evolution in plants. Plant Physiol. 127:212-221.
BENNETT, M. D., A. V. COX and I. J. LEITCH, 1998 Angiosperm DNA C-values database. http://www.rbgkew.org.uk/cval/database1.html.
BENNETZEN, J. L., 2002 Mechanisms and rates of genome expansion and contraction in flowering plants. Genetica 115:29-36.[Medline]
BOWEN, N. J. and J. F. MCDONALD, 1999 Genomic analysis of Caenorhabditis elegans reveals ancient families of retroviral-like elements. Genome Res. 9:924-935.
BURKE, J. M., T. J. VOSS, and M. L. ARNOLD, 1998 Genetic interactions and natural selection in Louisiana iris hybrids. Evolution 52:1304-1310.
CARR, M., J. R. SOLOWAY, T. E. ROBINSON, and J. F. Y. BROOKFIELD, 2002 Mechanisms regulating the copy numbers of six LTR retrotransposons in the genome of Drosophila melanogaster.. Chromosoma 110:511-518.[Medline]
CASACUBERTA, J. M., S. VERNHETTES, and M. A. GRANDBASTIEN, 1995 Sequence variability within the tobacco retrotransposon Tnt1 population. EMBO J. 14:2670-2678.[Medline]
CASACUBERTA, J. M., S. VERNHETTES, C. AUDEON, and M. A. GRANDBASTIEN, 1997 Quasispecies in retrotransposons: a role for sequence variability in Tnt1 evolution. Genetica 100:109-117.[Medline]
CHARLESWORTH, B. and C. H. LANGLEY, 1989 The population genetics of Drosophila transposable elements. Annu. Rev. Genet. 23:251-287.[Medline]
CHARLESWORTH, D. and S. I. WRIGHT, 2001 Breeding systems and genome evolution. Curr. Opin. Genet. Dev. 11:685-690.[Medline]
CURCIO, M. J. and D. J. GARFINKEL, 1999 New lines of host defense: inhibition of Ty1 retrotransposition by Fus3p and NER/TFIIH. Trends Genet. 15:42-45.
DOYLE, J. J. and J. L. DOYLE, 1987 A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 19:11-15.
FESCHOTTE, C., J. JIANG, and S. R. WESSLER, 2002 Plant transposable elements: where genetics meets genomics. Nat. Rev. Genet. 3:329-341.[Medline]
FLAVELL, A., E. DUNBAR, R. ANDERSON, S. PEARCE, and R. HARTLEY et al., 1992 Ty1-copia group retrotransposons are ubiquitous and heterogeneous in higher plants. Nucleic Acids Res. 20:3639-3644.
FLAVELL, R. B., M. D. BENNETT, J. B. SMITH, and D. B. SMITH, 1974 Genome size and proportion of repeated nucleotide-sequence DNA in plants. Biochem. Genet. 12:257-269.[Medline]
FU, H. H. and H. K. DOONER, 2002 Intraspecific violation of genetic colinearity and its implications in maize. Proc. Natl. Acad. Sci. USA 99:9573-9578.
GALBRAITH, D. W., G. M. LAMBERT, J. MACAS and J. DOLEZEL, 1997 Analysis of nuclear DNA content and ploidy in higher plants, pp. 7.6.17.6.22 in Current Protocols in Cytometry, edited by J. P. ROBINSON, Z. DARZYNKIEWICZ, P. DEAN, A. ORFAO, P. RABINOVITCH, C. C. STEWART, H. TANKE and L. WHEELESS. John Wiley & Sons, New York.
GRANDBASTIEN, M.-A., 1998 Activation of plant retrotransposons under stress conditions. Trends Plant Sci. 3:181-187.
HAMRICK, J. L. and M. J. W. GODT, 1996 Effects of life history traits on genetic diversity in plant species. Philos. Trans. R. Soc. Lond. B Biol. Sci. 351:1291-1298.
HULL, R., 1999 Classification of reverse transcribing elements: a discussion document. Arch. Virol. 144:209-214.[Medline]
JOHNSTON, J. S., M. D. BENNETT, A. L. RAYBURN, D. W. GALBRAITH, and H. J. PRICE, 1999 Reference standards for determination of DNA content of plant nuclei. Am. J. Bot. 86:609-613.
JOSEPH, J. L., J. W. SENTRY, and D. R. SMYTH, 1990 Interspecies distribution of abundant DNA sequences in Lilium. J. Mol. Evol. 30:146-154.
KALENDAR, R., J. TANSKANEN, S. IMMONEN, E. NEVO, and A. H. SCHULMAN, 2000 Genome evolution of wild barley (Hordeum spontaneum) by BARE-1 retrotransposon dynamics in response to sharp microclimatic divergence. Proc. Natl. Acad. Sci. USA 97:6603-6607.
KIDWELL, M. G., 2002 Transposable elements and the evolution of genome size in eukaryotes. Genetica 115:49-63.[Medline]
KIMURA, Y., Y. TOSA, S. SHIMADA, R. SOGO, and M. KUSABA et al., 2001 OARE-1, a Ty1-copia retrotransposon in oat activated by abiotic and biotic stresses. Plant Cell Physiol. 42:1345-1354.
KUMAR, A. and J. L. BENNETZEN, 1999 Plant retrotransposons. Annu. Rev. Genet. 33:479-532.[Medline]
LABRADOR, M., M. FARRE, F. UTZET, and A. FONTDEVILA, 1999 Interspecific hybridization increases transposition rates of Osvaldo. Mol. Biol. Evol. 16:931-937.[Abstract]
LEETON, P. R. J. and D. R. SMYTH, 1993 An abundant LINE-like element amplified in the genome of Lilium speciosum.. Mol. Gen. Genet. 237:97-104.[Medline]
LEVIN, H. L., 2002 Newly identified retrotransposons of the Ty3/gypsy class in fungi, plants, and vertebrates, pp. 684701 in Mobile DNA II, edited by N. L. CRAIG, R. CRAIGIE, M. GELLERT and A. M. LAMBOWITZ. American Society for Microbiology Press, Washington, DC.
MALIK, H. S. and T. H. EICKBUSH, 1999 Modular evolution of the integrase domain in the Ty3/Gypsy class of LTR retrotransposons. J. Virol. 73:5186-5190.