help button home button Genetics JPET
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zuber, S.
Right arrow Articles by Andrianopoulos, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zuber, S.
Right arrow Articles by Andrianopoulos, A.
Genetics, Vol. 164, 487-499, June 2003, Copyright © 2003

The G-Protein {alpha}-Subunit GasC Plays a Major Role in Germination in the Dimorphic Fungus Penicillium marneffei

Sophie Zubera, Michael J. Hynesa, and Alex Andrianopoulosa
a Department of Genetics, University of Melbourne, 3010 Victoria, Australia

Corresponding author: Alex Andrianopoulos, University of Melbourne, 3010 Victoria, Australia., alex.a{at}unimelb.edu.au (E-mail)

Communicating editor: M. S. SACHS


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The opportunistic human pathogen Penicillium marneffei exhibits a temperature-dependent dimorphic switch. At 25°, multinucleate, septate hyphae that can undergo differentiation to produce asexual spores (conidia) are produced. At 37° hyphae undergo arthroconidiation to produce uninucleate yeast cells that divide by fission. This work describes the cloning of the P. marneffei gasC gene encoding a G-protein {alpha}-subunit that shows high homology to members of the class III fungal G{alpha}-subunits. Characterization of a {Delta}gasC mutant and strains carrying a dominant-activating gasCG45R or a dominant-interfering gasCG207R allele show that GasC is a crucial regulator of germination. A {Delta}gasC mutant is severely delayed in germination, whereas strains carrying a dominant-activating gasCG45R allele show a significantly accelerated germination rate. Additionally, GasC signaling positively affects the production of the red pigment by P. marneffei at 25° and negatively affects the onset of conidiation and the conidial yield, showing that GasC function overlaps with functions of the previously described G{alpha}-subunit GasA. In contrast to the S. cerevisiae ortholog Gpa2, our data indicate that GasC is not involved in carbon or nitrogen source sensing and plays no major role in either hyphal or yeast growth or in the switch between these two forms.


MOST fungal infections in both animals and plants are initiated by contact of the host with spores, which begin the infective process by undergoing germination. The early molecular events involved in sensing and transmitting the signal to germinate are not well understood, but represent a key issue in understanding the early steps of fungal infections (D'ENFERT 1997 Down; OSHEROV and MAY 2001 Down). The opportunistic human pathogen Penicillium marneffei is a dimorphic ascomycete that exhibits a temperature-dependent dimorphic switch (SEGRETAIN 1959 Down; GARRISON and BOYD 1973 Down; ANDRIANOPOULOS 2002 Down). After germination of the asexual spore (conidium) at 25°, multinucleate, septate hyphae are produced by apical growth and lateral branching. Exposure of hyphae to an air interface induces asexual development at 25°, producing conidia borne on specialized multicellular structures called conidiophores. The conidia represent the primary means for dispersal. At 37°, such as after inhalation by a host, conidia germinate to produce hyphae that undergo a process known as arthroconidiation, in which septation and nuclear division become coupled. The hyphae lay down double septa and, following cell separation, produce single uninucleate yeast cells that divide by fission and disseminate throughout the body (CHAN and CHOW 1990 Down; COOPER and MCGINNIS 1997 Down; VOSSLER 2001 Down).

Heterotrimeric guanine nucleotide-binding proteins (G-proteins) act as signal transducers that couple cell surface receptors to cytoplasmic effector proteins and are conserved in all eukaryotes. The G-protein-coupled receptors (GPCR) sense various agonists such as photons, odorants, neurotransmitters, pheromones, and sugars. Upon activation of the G{alpha}-subunit triggered by conformational change of the receptor, GDP is exchanged for GTP and the G{alpha}-subunit dissociates from the Gß{gamma} complex. Both G{alpha}- and Gß{gamma}-subunits are able to trigger downstream signaling pathways by interacting with various targets such as phosphodiesterases, protein kinases, adenylyl cyclases, phospholipases, and ion channels (KAZIRO et al. 1991 Down; SIMON et al. 1991 Down; NEER 1995 Down; HAMM and GILCHRIST 1996 Down).

In fungi, three different classes of G{alpha}-subunits have been identified. The class III fungal G{alpha}-subunits are particularly interesting, as many members play crucial roles in the regulation of various morphological and developmental processes as well as pathogenicity (BOLKER 1998 Down; BORGES-WALMSLEY and WALMSLEY 2000 Down).

Most of our knowledge about class III fungal G{alpha}-subunits comes from studies of the morphological switch from yeast to pseudohyphal growth in the model organism Saccharomyces cerevisiae. The G{alpha}-subunit Gpa2 in S. cerevisiae is required for the induction of pseudohyphal growth in diploid yeast cells in response to nitrogen starvation in the presence of an abundant fermentable carbon source such as glucose. The mechanism by which Gpa2 is involved in transducing the nitrogen starvation signal has not yet been defined (KUBLER et al. 1997 Down; LORENZ and HEITMAN 1997 Down; LORENZ et al. 2000 Down). However, Gpa2 has been shown to interact with the GPCR Gpr1 whose expression is upregulated during nitrogen starvation (XUE et al. 1998 Down). Gpr1 has been proposed to be a glucose receptor. When glucose is added to a yeast culture previously starved for glucose, a rapid and transient increase in cyclic adenosine 3', 5'-monophosphate (cAMP) is observed. This response is impaired in both {Delta}gpa2 and {Delta}gpr1 mutants and a dominant-activating GPA2 allele bypasses the need for high extracellular glucose concentrations normally required to activate the Gpr1-Gpa2 system (COLOMBO et al. 1998 Down; KRAAKMAN et al. 1999 Down; ROLLAND et al. 2000 Down). The addition of exogenous cAMP restores the pseudohyphal growth defect observed in both {Delta}gpa2 and {Delta}gpr1 mutants and is evidence of Gpa2 signaling through the cAMP-dependent protein kinase A (cAMP-PKA) pathway (KUBLER et al. 1997 Down; LORENZ and HEITMAN 1997 Down).

In S. cerevisiae, the regulation of pseudohyphal growth is regulated not only by the Gpr1-Gpa2 system, but also by Ras2, which signals both to the cAMP-PKA pathway and to protein kinases involved in mitogen-activated protein kinase signaling, such as Ste20, Ste11, and Ste7 (TODA et al. 1985 Down; MOESCH et al. 1996 Down). Strains carrying a dominant-activating RAS2 allele show greatly enhanced pseudohyphal growth (GIMENO et al. 1992 Down). Interestingly, Ras2 also plays a crucial role in ascospore germination. Spores harboring a {Delta}ras2 mutation show a delay in germination, whereas overexpression of the RAS2 gene leads to an increased rate of germination (HERMAN and RINE 1997 Down). The role of the Gpr1-Gpa2 system in germination has not been investigated.

Git3 and Gpa2 in Schizosaccharomyces pombe are orthologs of Gpr1 and Gpa2 in S. cerevisiae. As in S. cerevisiae, the Git3-Gpa2 system responds to glucose and subsequently stimulates the cAMP-PKA pathway (ISSHIKI et al. 1992 Down; WELTON and HOFFMAN 2000 Down). This signaling pathway is crucial for the efficient initiation of spore germination as spores harboring mutations in gpa2, cyr1 (encoding for adenylate cyclase), or pka1 (encoding for PKA) are severely impaired in germination (HATANAKA and SHIMODA 2001 Down). Additionally, the Git3-Gpa2 system is also required for mating in response to nitrogen starvation (ISSHIKI et al. 1992 Down).

In the filamentous fungus Aspergillus nidulans, the taxonomically closest model fungus to P. marneffei, a cAMP-PKA pathway has recently been shown to be required for efficient germination of conidia. The presence of water and a carbon source such as glucose is sufficient to activate a conidium and trigger germination. During this early commitment step trehalose is rapidly mobilized before any morphological changes are evident. This is followed by an isotropic growth stage (swelling) involving water uptake and cell wall growth, and eventually wall deposition becomes polarized, resulting in the formation of a germ tube (D'ENFERT 1997 Down; OSHEROV and MAY 2001 Down). Deletion of the A. nidulans gene encoding PKA (pkaA) results in delayed germ tube emergence while deletion of the gene encoding adenylate cyclase (cyaA) makes this delay even more pronounced (FILLINGER et al. 2002 Down). Similar to the role of S. cerevisiae Ras2 in ascospore germination, A. nidulans strains overproducing a dominant-activating form of RasA produce giant swollen conidia with multiple nuclei that fail to produce germ tubes. RasA has also been suggested to mediate carbon source sensing during the germination process (SOM and KOLAPARTHI 1994 Down; OSHEROV and MAY 2000 Down).

FadA, the only G{alpha}-subunit that has been hitherto characterized in A. nidulans, is a key regulator of conidiation and the production of secondary metabolites. A strain carrying a dominant-activating fadAG42R allele is aconidial and does not produce the mycotoxin sterigmatocystin (ST; YU et al. 1996 Down; HICKS et al. 1997 Down). Interestingly, conidiation is partially restored in a {Delta}pkaA fadAG42R double mutant, showing that PKA activity in A. nidulans inhibits conidiation as well as ST production (SHIMIZU and KELLER 2001 Down). Although this suggests that FadA signaling is partially mediated by PkaA, the data also show that FadA signals in a PkaA-independent fashion (SHIMIZU and KELLER 2001 Down).

We have previously reported that the P. marneffei G{alpha}-subunit GasA, an ortholog of A. nidulans FadA, is a key regulator of conidiation. Strains carrying a dominant-activating gasAG42R allele are locked in vegetative growth and are therefore aconidial, while strains carrying the dominant-interfering gasAG203R allele show inappropriate conidiation. GasA is also a regulator of secondary metabolites, but is not involved in dimorphic switching or yeast growth at 37° (ZUBER et al. 2002 Down). This work describes the cloning of the P. marneffei gasC gene encoding a G-protein {alpha}-subunit that shows high homology to members of the class III fungal G{alpha}-subunits. Characterization of a {Delta}gasC mutant and strains carrying a dominant-activating gasCG45R or a dominant-interfering gasCG207R allele show that GasC is a crucial regulator of germination. This is the first report showing that a G{alpha}-subunit is involved in germination in filamentous fungi. Furthermore, GasC is a regulator of secondary metabolites and, to a lesser extent, a regulator of conidiation, showing that GasC function overlaps with that of GasA. In contrast to Gpa2 in S. cerevisiae, our data indicate that GasC is not involved in carbon or nitrogen source sensing. Moreover, GasC plays no major role in either hyphal or yeast growth or in the switch between these two forms.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Fungal strains, media, and growth conditions:
Fungal strains used in this study and their genotypes are listed in Table 1. Transformation of the P. marneffei strain SPM4 and the A. nidulans strain A770 was performed as previously described (ANDRIANOPOULOS and HYNES 1988 Down; BORNEMAN et al. 2001 Down). The {Delta}gasC mutant strain (TS32-7-8) was generated by transformation of SPM4 with 500 ng of a gel-purified NotI/XhoI fragment from pSZ5103 and selection for pyrG+. SPM4 was transformed with the appropriate plasmids to create strains carrying the dominant-interfering gasCG207R, the dominant-activating gasCG45R, the wild-type gasC, the double dominant-interfering [gasAG203RgasCG207R], and the double dominant-activating [gasAG42RgasCG45R] alleles. The A. nidulans strain A770 was transformed with the appropriate plasmids to create strains carrying the dominant-interfering gasCG207R, the dominant-activating gasCG45R, and the wild-type gasC allele.


 
View this table:
[in this window]
[in a new window]

 
Table 1. Fungal strains used in this study

At 25°, P. marneffei strains were grown on Aspergillus nitrogen-free medium (ANM) or ANM without any carbon source (CF) and supplemented with 10 mM {gamma}-amino butyric acid (GABA) or 10 mM ammonium sulfate [(NH4)2SO4] as a nitrogen source (COVE 1966 Down). Glucose as a carbon source was used at concentrations of 1 or 0.1% (w/v); ethanol as a carbon source was used at a concentration of 1% (v/v). Where appropriate, the media were supplemented with 0.3 M NaCl, 0.3 M KCl, 0.5 M sorbitol, or 10 mM theophylline + 0.1 mM dibutyryl-cAMP (dbcAMP). At 37°, P. marneffei strains were grown on S. cerevisiae synthetic dextrose (SD) medium or on brain heart infusion (BHI) broth (Oxoid; AUSUBEL et al. 1994 Down). A. nidulans strains were grown at 37° on ANM supplemented with 10 mM ammonium tartrate (NH4T) or 10 mM ammonium sulfate [(NH4)2SO4] as a nitrogen source. Glucose as a carbon source was used at concentrations of 1 or 0.1% (w/v). Where appropriate, the media were supplemented with 1 M NaCl. Strains SPM4 and A770 were grown in the presence of 10 mM uracil and, where appropriate, transformants were tested on media containing 10 mM uracil to confirm that the observed phenotypes were unrelated to poor expression of the pyrG selectable marker. The growth conditions used for the preparation of P. marneffei for RNA extractions have been described previously (BORNEMAN et al. 2001 Down).

Molecular techniques:
Plasmid DNA was isolated using the high-purity plasmid kit (Roche Diagnostics). Genomic DNA from P. marneffei was isolated as previously described (BORNEMAN et al. 2001 Down). RNA was prepared using the FastRNA kit (Bio101, Vista, CA) as previously described (BORNEMAN et al. 2001 Down). Southern and Northern blotting was performed with Amersham Hybond N+ membranes according to the manufacturer's instructions. Filters were hybridized using [{alpha}-32P]dATP-labeled probes by standard methods (SAMBROOK et al. 1998 Down). As a loading control Northern blots were probed with a histone H3 gene probe (EHINGER et al. 1990 Down).

Degenerate PCR was performed on genomic DNA of strain FRR2161 using the sense primer FENVT (5' GCTTCGAGAACGTGACCTCCRTNATHTTYTG 3') and the antisense primer KETIL (5' CAGGGCGTTCTGCAGGATNGTYTCYTT 3'), corresponding to highly conserved regions specific to the fungal G{alpha} III class. Primers were designed using the consensus-degenerate hybrid oligonucleotide primers (CODEHOP) method (ROSE et al. 1998 Down). PCR conditions consisted of a hot start with cycling parameters of 94° for 30 sec, 45° for 30 sec, and 72° for 1 min, with 35 cycles in a Mastercycler gradient thermocycler (Eppendorf, Madison WI). The products were cloned into pGEMTeasy (Promega, Madison, WI). A 550-bp insert with high homology to several members of the fungal G{alpha} III class was used to probe a 7- to 8-kb SacII/BglII size-selected FRR2161 genomic library in pBluescript II SK+ (Stratagene, La Jolla, CA). Sequencing of a positive clone (pSZ4928) revealed that it contained the entire coding region, but only 194 bp of 5' untranslated region. Therefore, a 3- to 4-kb PstI/HindIII size-selected FRR2161 genomic library in pBluescript II SK+ was probed and a second positive clone (pSZ4977) was isolated. A 2.4-kb HindIII fragment of pSZ4928 was cloned into pSZ4977 linearized with HindIII to create a full-length gasC clone (pSZ5038). Sequencing was performed by the Australian Genome Research Facility and analyzed with Sequencher 3.1.1 (Gene Codes, Ann Arbor, MI). The GenBank accession number of the P. marneffei gasC gene is AY170625. Database searches and sequence comparisons were performed using the Australian National Genomic Information Service. Sequence alignments were performed using Eclustalw (GCG software package; THOMPSON et al. 1994 Down) and MacBoxShade sequence analysis tools.

To disrupt gasC, a derivative of pSZ5038 containing a 2.1-kb PstI/HindIII fragment downstream of gasC was digested with SpeI and PstI and a 2.2-kb SpeI/PstI fragment containing the pyrG cassette of pAB4626 was inserted (BORNEMAN et al. 2002 Down). This plasmid was digested with SpeI and SmaI and a 2-kb SpeI/SalI end-filled fragment of pSZ4977 containing sequences upstream of gasC was inserted, generating the knock-out plasmid pSZ5103.

The dominant-activating gasCG45R and the dominant-interfering gasCG207R alleles were created by inverse PCR (MCPHERSON et al. 1991 Down) using gasC.dom.up (5' CGGGAAAGTGGAAAGTCAACC 3'; 770–790; base mismatches are underlined), gasC.dom.lo (5' GGAGCCTGTAGATTAGATAAAACAAG 3'; 744–769), gasC.neg.up (5' CGTCAACGCAGTGAACGAAAGAAATG 3'; 1357–1382; base mismatches are underlined), and gasC.neg.lo (5' GCCGACATCAAACATGCTATAAC 3'; 1334–1356), respectively. The plasmids pSZ5112 (gasCG45R) and pSZ5113 (gasCG207R) were sequenced and used to recreate full-length gasC clones, pSZ5114 and pSZ5115. A 4.1-kb XbaI/BamHI fragment of pSZ5114 and pSZ5115 was cloned into pALX223 digested with XbaI and BamHI to generate pSZ5135 (gasCG45R) and pSZ5136 (gasCG207R), respectively. The plasmid pALX223 contains the pyrG gene for direct selection in the P. marneffei SPM4 strain and the A. nidulans A770 strain (A. ANDRIANOPOULOS, unpublished data). Additionally, the full-length wild-type gasC allele was cloned into pALX223, generating pSZ5134. The plasmid carrying the double dominant-activating [gasAG42RgasCG45R] alleles (pSZ5447) was created by inserting a 4-kb XbaI/BamHI fragment of pSZ5114 (gasCG45R) into pSZ5030 (gasAG42R; ZUBER et al. 2002 Down) digested with Xba and BamHI. The plasmid carrying the double dominant-interfering gasAG203RgasCG207R alleles (pSZ5448) was created by inserting a 4-kb XbaI/BamHI fragment of pSZ5115 (gasCG207R) into pSZ5089 (gasAG203R; ZUBER et al. 2002 Down) digested with XbaI and BamHI.

Quantitation of conidial yields:
Conidia (1 x 105) of each strain were spread on 1% ANM + GABA, 1% ANM + GABA + 0.3 M NaCl, 0.1% ANM + GABA, and 0.1% ANM + (NH4)2SO4 solid medium and incubated at 25° for 8 days. Conidia from a defined area (2.5 cm2) were harvested and an appropriate dilution counted with a hemocytometer.

Germination experiments:
Conidia (2 x 106) of each strain were inoculated into 300 µl of 0.1% ANM + (NH4)2SO4, CF + EtOH + (NH4)2SO4, or CF + (NH4)2SO4 liquid medium and incubated at 25° in a 24-well microtiter plate without shaking. Germlings were viewed on an inverted Olympus IX70 microscope at the time points specified. Images were captured digitally using a Photometrics Coolsnap fx camera at the appropriate time points and processed using IPlab (Scanalytics) and Adobe Photoshop software.

Microscopy:
P. marneffei strains were grown on slides covered with thin layers of solid medium and resting in liquid medium (BORNEMAN et al. 2000 Down). Slides were mounted with the addition of 500 µg/µl of 4',6-diamidino-2-phenylindole (DAPI) and viewed using either differential interference contrast (DIC) or epifluorescence optics on a Reichart Jung Polyvar II microscope. Images were captured digitally using a SPOT CCD camera (Diagnostic Instruments) and processed using Adobe Photoshop software.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

P. marneffei GasC is related to class III fungal G{alpha}-proteins:
A gene encoding a G{alpha}-subunit from P. marneffei was isolated using a degenerate primer PCR-based approach with primers specific to class III fungal G{alpha}-proteins. Sequence analysis of the 550-bp PCR product showed significant homology to members of the fungal G{alpha} III class (BOLKER 1998 Down). Southern blot analysis using the amplification product as a probe indicated a gene present in single copy in P. marneffei (data not shown). This gene was designated gasC (G{alpha}-subunit) and the amplification product was used to screen a partial genomic DNA library. The clone containing the entire gasC gene was sequenced and is predicted to contain five introns on the basis of comparison with closely related homologs (Fig 1A). The deduced GasC protein sequence of 358 amino acids shows 88.2% identity with the putative G{alpha}-subunit encoded by the A. fumigatus gene AFA5C11.9c (accession no. AL713629) and 87.9% identity with the G{alpha}-subunit GanB from A. nidulans (accession no. AF198116; Fig 1B). This shows that P. marneffei GasC is a member of the fungal G{alpha} III class.



View larger version (0K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. The gasC gene of P. marneffei encodes a G{alpha}-subunit of a heterotrimeric G-protein related to class III fungal G{alpha}-proteins. (A) Gene structure and partial restriction map of the gasC gene corresponding to pSZ5038. The region predicted to encode the GasC protein is indicated by shaded boxes representing the exons and interrupted by five introns. The solid arrow shows the direction of transcription. The dashed line represents the sequenced part of the clone. The sequence deleted in the {Delta}gasC mutant is indicated. (B) Alignment of the deduced amino acid sequence of P. marneffei GasC with A. nidulans GanB (An.GanB; AF198116), U. maydis Gpa3 (Um.Gpa3; U85777), and S. pombe Gpa2 (Sp.Gpa2; D13366). The dominant-activating (G45R) and the dominant-interfering (G207R) mutations described in the text are indicated by # and *, respectively. The conserved regions highly specific to class III fungal G{alpha}-subunits, indicated by arrows, were used to design degenerate primers for PCR. Identical (solid background) and similar (shaded background) amino acids are marked.

gasC is expressed during all growth stages:
RNA from wild-type P. marneffei was isolated from three growth and developmental stages: vegetative hyphal cells grown in liquid medium at 25°, conidiating (asexually developing) cultures at 25°, and yeast cells at 37°. Northern blot analysis using a 0.6-kb gasC fragment as a probe identified a single 1.4-kb transcript. The gasC transcript was readily detected and showed the same expression level in all three developmental stages, suggesting that gasC is constitutively expressed in P. marneffei (Fig 2).



View larger version (0K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Northern blot analysis of gasC expression. Total RNA from P. marneffei wild type was isolated from yeast cultures (37°), vegetative mycelia grown in liquid at 25° (25° veg), and asexually developing cultures (25° dev). RNA from each of the three growth stages (37°, 25° veg, and 25° dev) was hybridized with probes specific for either gasC or histone H3 (H3). Histone H3 was used as a loading control.

Generation of gasC mutant alleles:
To investigate the function of GasC, a number of mutant gasC alleles were generated. A knock-out plasmid (pSZ5103) in which the entire gasC coding sequence was replaced with the A. nidulans pyrG gene (Fig 1A) was used to transform the SPM4 strain and delete gasC by homologous gene replacement. A total of 39 transformants were isolated by direct selection for pyrG+ and subjected to Southern blot analysis. A {Delta}gasC mutant in which the endogenous copy of the gene had been deleted was isolated (data not shown). Dominant-activating (G45R) and dominant-interfering (G207R) gasC alleles were created by inverse PCR (see MATERIALS AND METHODS). The glycine 45 to arginine mutation is predicted to inactivate the GTPase activity of GasC, resulting in a GTP-bound G{alpha}-subunit that constitutively signals. In contrast, the glycine 207 to arginine mutation is predicted to block the conformational switch that accompanies GTP binding and is necessary for Gß{gamma} release, resulting in the G{alpha}-subunit being unable to signal (KAZIRO et al. 1991 Down; KURJAN et al. 1991 Down). The plasmids carrying the dominant-activating gasCG45R allele (pSZ5135), the dominant-interfering gasCG207R allele (pSZ5136), and the wild-type gasC allele (pSZ5134) were transformed into the strain SPM4 and transformants were isolated by direct selection for pyrG+. Southern blot analysis on genomic DNA from these transformants was performed to estimate the number of integrated plasmid copies present in each transformant, as indicated in Table 1. Both low- and high-copy-number transformants were analyzed. Attempts to introduce the wild-type and dominant mutant alleles of gasC into the null background did not yield any transformants and further experimentation showed that protoplasts of this strain were severely compromised in their capacity to regenerate (data not shown).

GasC-mediated signaling affects conidiation:
To determine the effect of GasC on conidiation, the colony morphology of the different gasC mutant strains was examined (Fig 3A). In the {Delta}gasC mutant, conidiation was denser and more uniform across the colony compared to the wild type, while strains carrying the dominant-activating gasCG45R allele were delayed in conidiation and produced excessive aerial hyphae, resulting in a clustered and nonuniform conidiation pattern. These phenotypes were more severe in transformants carrying high numbers of the dominant-activating gasCG45R allele. In strains carrying high numbers of the wild-type gasC allele, the effects on conidiation were similar to those observed using the dominant-activating gasCG45R allele, although less severe (data not shown). The conidiation pattern of the strains carrying the dominant-interfering gasCG207R allele was very similar to wild-type P. marneffei, irrespective of plasmid copy number.



View larger version (0K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. GasC affects conidiation. (A) Colonial morphology of P. marneffei wild type, {Delta}gasC mutant, dominant-interfering gasCG207R (TS32-7-4), and dominant-activating gasCG45R (TS32-5-1) strains. The strains were grown on ANM + GABA for 10 days at 25°. Plates showing colony morphology are shown (above) and magnified sections (x10) depict conidiophores (below). White arrowheads indicate conidiophore structures. (B and C) Quantitation of conidial yield in the wild-type, {Delta}gasC mutant, dominant-interfering gasCG207R, and dominant-activating gasCG45R strains under hyperosmotic conditions (B) and different nitrogen sources (C). Conidia (1 x 105) of each strain were spread on 1% ANM + GABA plates (open bars in B), 1% ANM + GABA + 0.3 M NaCl plates (cross-hatched bars in B), 0.1% ANM + GABA plates (open bars in C), and 0.1% ANM + (NH4)2SO4 plates (cross-hatched bars in C) and incubated at 25° for 8 days. Subsequently, conidia from a defined area (2.5 cm2) were harvested for counting. Values are the average of three replicates and standard errors are indicated. Values indicated for the dominant-interfering gasCG207R (TS32-7-4, TS43-5-2) and the dominant-activating gasCG45R (TS32-5-1, TS32-4-6) strains are an average of two independent transformants.

To quantitate the effect of GasC on conidiation, conidial yields of each of the gasC mutant strains were examined under various conditions including hyperosmotic conditions and different nitrogen sources. Hyperosmotic growth conditions (0.3 M NaCl) lowered the conidial yield of the wild type, the {Delta}gasC mutant, and strains expressing the dominant-interfering gasCG207R allele compared to the effects of normal osmotic conditions, but no significant differences in conidial yields between these strains were evident (Fig 3B). In contrast to many other fungal species, P. marneffei is sensitive to higher concentrations of salt and cannot grow on 1 M NaCl (S. ZUBER and A. ANDRIANOPOULOS, unpublished data). Under normal osmotic conditions, the strains carrying the dominant-activating gasCG45R allele produced approximately five times fewer conidia than the other strains produced, consistent with its clustered and nonuniform conidiation pattern (see above), while hyperosmotic conditions (0.3 M NaCl) resulted in a complete lack of conidiation (Fig 3B). Very similar responses were also observed on 0.3 M KCl and 0.5 M sorbitol (data not shown). Furthermore, in the presence of 0.3 M NaCl the onset of conidiation was initiated earlier in the {Delta}gasC mutant than in the wild type. Dense conidiation was visible after 4 days in the {Delta}gasC mutant, whereas no conidiophores were present in the wild type at this point in time (data not shown). In P. marneffei, conidiation varies depending on the nitrogen source. Conidiation is greater when grown on medium containing GABA as a sole nitrogen source than when grown on ammonium (A. BORNEMAN and A. ANDRIANOPOULOS, unpublished data). Quantitation of conidial yields showed that all strains produced roughly five times fewer conidia on ammonium than on GABA (Fig 3C), suggesting that the regulation of conidiation by GasC is in a pathway independent of nitrogen source sensing.

Conidiation in P. marneffei is also influenced by carbon limitation. Under carbon-limiting conditions (0.1% glucose), conidiophores are precociously formed within 2 days, whereas under carbon-sufficient conditions (1% glucose) conidiophores appear only after 5 days (ANDRIANOPOULOS 2002 Down). The {Delta}gasC mutant and strains carrying the dominant-interfering gasCG207R allele displayed the same conidiation characteristics as the wild type displayed on low and high glucose after 3 days incubation. In contrast, strains carrying the dominant-activating gasCG45R allele failed to produce conidiophores after 3 days on either low or high glucose. This is consistent with the delay in conidiation of these strains (see above) and shows that the expression of the dominant-activating gasCG45R allele leads to a delay in conidiation irrespective of the carbon status (data not shown).

GasC is involved in the regulation of secondary metabolite production:
P. marneffei produces a red pigment during filamentous growth at 25°. Nutritional conditions, especially the nitrogen source, have a significant impact on the amount of this secondary metabolite produced (ANDRIANOPOULOS 2002 Down). On medium containing GABA as a sole nitrogen source, the {Delta}gasC mutant and strains carrying the dominant-interfering gasCG207R allele produced less pigment than the wild type produced and appeared white. In contrast, strains carrying the dominant-activating gasCG45R allele showed an overproduction of red pigment relative to the wild type and appeared dark red (Fig 4). All strains produced more pigment on medium containing glutamine as a sole nitrogen source than on GABA, but the differences between the strains were similar to those on GABA (data not shown). When ammonium was the sole nitrogen source, all strains failed to produce red pigment such that the wild-type, {Delta}gasC mutant, and dominant-interfering gasCG207R mutant strains appeared white while the strains carrying the dominant-activating gasCG45R allele showed a slight yellow coloration (data not shown).



View larger version (0K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. GasC regulates the production of red pigment. P. marneffei wild type, {Delta}gasC mutant, dominant-interfering gasCG207R (TS32-7-4), and dominant-activating gasCG45R (TS32-5-1) strains were grown on 1% ANM + GABA for 10 days at 25°. Images were captured from the underside of the plate. Colonies appear dark when red pigment is present.

GasC plays a major role in conidial germination:
After 10 hr of incubation at 25°, 25% of wild-type conidia have germinated and show a germ tube (Fig 5A). Strains carrying the dominant-activating gasCG45R allele showed an accelerated germination rate compared to that of the wild type, such that 20% of the conidia had produced a germ tube after 6 hr incubation, whereas strains expressing the dominant-interfering gasCG207R allele showed a slower germination rate compared to that of the wild type. The {Delta}gasC mutant was severely delayed in germination, requiring up to 27 hr to achieve 25% germination. In contrast to the wild type and the other strains that exhibit relatively synchronous conidial germination, the conidia of the {Delta}gasC mutant germinated asynchronously with some conidia failing to produce a germ tube after 40 hr (Fig 5B). The severity of the germination defect for strains carrying the dominant-activating gasCG45R allele was copy-number dependent, such that high-copy-number transformants germinated faster than low-copy-number transformants. High-copy-number transformants carrying the dominant-interfering gasCG207R allele germinated as quickly as the wild type and only low-copy-number transformants showed a delay in germination compared to the wild type (data not shown).



View larger version (0K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. GasC plays a major role in conidial germination. (A) Kinetics of conidial germ tube outgrowth in P. marneffei wild type, {Delta}gasC mutant, dominant-interfering gasCG207R (TS43-5-12), and dominant-activating gasCG45R (TS32-5-4) strains. Conidia (2 x 106) of each strain were inoculated into 300 µl 0.1% ANM + (NH4)2SO4 and incubated at 25°. Conidia showing germ tube outgrowth were counted in at least two independent microscopic fields at the time points specified. Results are expressed as percentage of conidia per field. Results are representative of three different experiments and standard deviations are indicated. (B) Asynchronous germination in the P. marneffei {Delta}gasC mutant compared to wild type. Conidia (2 x 106) of each strain were inoculated into 300 µl 0.1% ANM + (NH4)2SO4. Representative pictures obtained by light microscopy after 15 and 25.5 hr incubation at 25° are shown. (C) Kinetics of germ tube outgrowth in P. marneffei wild type, {Delta}gasC mutant, and dominant-activating gasCG45R (TS32-5-4) on ethanol compared to glucose. Conidia (2 x 106) of each strain were inoculated into 300 µl CF + EtOH + (NH4)2SO4 (solid symbols) and 0.1% ANM + (NH4)2SO4 (open symbols), respectively, and incubated at 25°. Conidia showing a germ tube outgrowth were counted in at least two independent microscopic fields at the time points specified. Results are expressed as the percentage of conidia per field and are representative of two different experiments. Standard deviations are indicated.

To investigate the role of GasC in germination further, we followed germination kinetics of the different gasC mutant strains under various nutritional conditions. The germination kinetics of the wild type and the gasC mutants under carbon-limiting (0.1% glucose) vs. carbon-sufficient conditions (1% glucose) were identical (data not shown). When ethanol was compared to glucose as sole carbon source, all strains germinated more slowly on ethanol and the kinetic shift in the germination rate on glucose vs. ethanol was very similar for all strains (Fig 5C). If GasC plays a role in sensing the presence of a carbon source, strains carrying the dominant-activating gasCG45R allele should be able to germinate in the absence of any carbon source. However, even after 48 hr, none of the strains showed any signs of germination. The conidia did not appear swollen and did not show a germ tube (data not shown).

In A. nidulans, cAMP signaling has recently been shown to be involved in spore germination (FILLINGER et al. 2002 Down). To test if elevated levels of cAMP could suppress the delay in germination observed in the {Delta}gasC mutant, dbcAMP was used in conjunction with the phosphodiesterase inhibitor theophylline and germination of the gasC mutant strains was examined. The kinetics of spore germination for any given strain were identical in the presence or absence of dbcAMP and theophylline (data not shown), suggesting that GasC in P. marneffei may not signal through the cAMP-PKA pathway. Alternatively, the compounds may not be able to efficiently enter ungerminated spores.

GasC is not required for yeast growth at 37°:
The morphology of yeast colonies for the {Delta}gasC mutant and strains carrying the dominant-interfering gasCG207R allele were indistinguishable from wild-type yeast colonies. However, strains carrying the dominant-activating gasCG45R allele exhibited an increase in filamentation and invasive growth at the colony edges compared to the wild type (Fig 6A). In addition, the {Delta}gasC mutant produced slightly smaller colonies than those the wild type produced. This probably reflects the fact that spores of the {Delta}gasC mutant germinate less efficiently, leading to some smaller yeast colonies. Prolonged incubation allowed these colonies to reach wild-type size, supporting the hypothesis that this phenotype is due to the germination defect and not to an additional growth defect. Furthermore, no differences in growth were observed between the different gasC mutants in hyperosmotic conditions (0.3 M NaCl) at 37° (data not shown).



View larger version (0K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. GasC is not required for yeast growth at 37°. Colonial morphologies of P. marneffei wild-type, {Delta}gasC mutant, dominant-interfering gasCG207R (TS43-5-12), and dominant-activating gasCG45R (TS32-5-4) strains. The strains were grown on SD at 37° for 4 days. The colony edges of the dominant-activating gasCG45R strain are slightly more filamentous compared to those of the wild type. (B) Microscopic examination of P. marneffei wild type, {Delta}gasC mutant, dominant-interfering gasCG207R (TS43-5-12), and dominant-activating gasCG45R (TS32-5-4) strains. Strains were grown on BHI at 37° for 4 days. Bars, 20 µm. (Top) DIC and (bottom) DAPI-stained epifluorescence of nuclei.

The different gasC mutant strains were incubated at 37° for 4 days and moved to 25° to induce the yeast-hyphal dimorphic switch. Like the wild type, all strains produced a filamentous colony periphery after 24 hr, showing that GasC is not required for the yeast-to-hyphal dimorphic switch. Similarly, the hyphal-to-yeast dimorphic switch was investigated by examining the production of yeast cells at 37° microscopically. All the gasC mutants were able to produce yeast cells that were indistinguishable from the yeast cells produced by the wild type, indicating that this developmental pathway is not affected in any of the gasC mutant strains (Fig 6B). Together, these results indicate no major role for GasC in the dimorphic switch or the maintenance of yeast growth at 37°.

Characterization of P. marneffei strains carrying gasA and gasC mutations:
We have previously shown that the G{alpha}-subunit GasA in P. marneffei is a key regulator of conidiation and to a lesser extent also regulates the production of red pigment produced by P. marneffei at 25° (ZUBER et al. 2002 Down). Both of these processes are also regulated by the G{alpha}-subunit GasC (see above). To examine the relationship between these two G{alpha}-subunits, double dominant-activating [gasAG42R, gasCG45R] and double dominant-interfering [gasAG203R, gasCG207R] mutants were produced using a plasmid carrying both dominant-activating gasAG42R and gasCG45R alleles (pSZ5447) and a plasmid carrying both dominant-interfering gasAG203R and gasCG207R alleles (pSZ5448; see MATERIALS AND METHODS). These plasmids were transformed into P. marneffei and transformants isolated by direct selection for pyrG+.

At 25° the double dominant-activating [gasAG42R, gasCG45R] mutants displayed thick aerial hyphae and completely lacked conidiophores and conidia, as observed in the dominant-activating gasAG42R mutants alone (ZUBER et al. 2002 Down). These strains also showed overproduction of the red pigment as noted for the dominant-activating gasCG45R mutant alone (see above). However, they did not show any phenotype additional to that observed in either of the single mutants (data not shown). The double dominant-interfering [gasAG203R, gasCG207R] mutants were impaired in the production of the red pigment and appeared white, but otherwise similar to the wild type (data not shown). At 37° the morphology of yeast colonies for the double dominant-interfering [gasAG203R, gasCG207R] mutants was indistinguishable from wild-type yeast colonies. The double dominant-activating [gasAG42R, gasCG45R] mutants, however, exhibited an increase in filamentation and invasive growth at the colony edges, as observed in the dominant-activating gasCG45R mutants alone (see above). Together, this shows that the double mutants exhibited no observable additive effects.

GasC function is conserved in A. nidulans:
The high homology between GasC and the uncharacterized A. nidulans homolog GanB suggests that the two proteins may play a similar role (Fig 1B). To assess the role of GasC in A. nidulans, the plasmids carrying the dominant-activating gasCG45R allele (pSZ5135) and the dominant-interfering gasCG207R allele (pSZ5136) were transformed into the A. nidulans strain A770 and transformants were isolated by direct selection for pyrG+. Southern blot analysis of genomic DNA for these transformants was performed to estimate the number of plasmid copies integrated in each transformant (data not shown).

The A. nidulans wild type and strains carrying the dominant-interfering gasCG207R allele were indistinguishable from each other. Strains carrying the dominant-activating gasCG45R allele, however, showed a delay in conidiation and a reduced number of conidia when compared to the wild type (Fig 7A). Similar to P. marneffei, this phenotype was copy-number dependent and easily detectable only in high-copy-number transformants (data not shown). Monitoring the kinetics of germ tube outgrowth in A. nidulans wild type showed that after 6 hr of incubation at 37° 50% of conidia had begun to germinate and showed a germ tube (Fig 7B). The strains carrying the P. marneffei dominant-activating gasCG45R allele showed an accelerated germination rate, such that 30% of the conidia had produced a germ tube after only 4 hr incubation. Similar to P. marneffei, the severity of the germination defect for strains carrying the dominant-activating gasCG45R allele was copy-number dependent, such that high-copy-number transformants germinated faster than low-copy-number transformants. Taken together, these results show that GasC plays the same role in A. nidulans as it does in P. marneffei and suggest that GanB may play a role in A. nidulans similar to the one GasC plays in P. marneffei.



View larger version (0K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 7. GasC function is conserved in A. nidulans. (A) Colonial morphology of A. nidulans wild type, a transformant carrying the P. marneffei dominant-interfering gasCG207R allele (TSA770.N3), and a transformant carrying the P. marneffei dominant-activating gasCG45R allele (TSA770.D23). The level of conidiation is reflected by darker coloration of the colony. Strains were grown on 1% ANM + NH4T for 2 days at 37°. (B) Kinetics of germ tube outgrowth in A. nidulans wild type and transformants carrying the P. marneffei dominant-activating gasCG45R allele. Conidia (2 x 106) of each strain were inoculated into 300 µl of 0.1% ANM + (NH4)2SO4 at 37° and conidia showing a germ tube were counted in at least two independent microscopic fields at the time points specified. Results are expressed as a percentage of conidia per field. Results are representative of two different experiments and standard deviations are indicated. Values indicated for the gasCG45R strains are an average of two independent transformants (TSA770.D23, TSA770.D19).


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

GasC is a class III fungal G{alpha}-subunit involved in germination:
We have identified a new G-protein {alpha}-subunit encoding gene, gasC, in the dimorphic fungus P. marneffei. GasC is a class III fungal G{alpha}-subunit similar to S. cerevisiae Gpa2, S. pombe Gpa2, Ustilago maydis Gpa3, Cryptococcus neoformans Gpa1, Neurospora crassa Gna3, and others (NAKAFUKU et al. 1988 Down; ISSHIKI et al. 1992 Down; TOLKACHEVA et al. 1994 Down; REGENFELDER et al. 1997 Down; BOLKER 1998 Down; KAYS et al. 2000 Down). We have shown that GasC plays a major role in conidial germination in P. marneffei. This is the first report showing that a G{alpha}-subunit is involved in germination in filamentous fungi. A {Delta}gasC mutant is severely delayed in germination, whereas strains carrying a dominant-activating gasCG45R allele, leading to constitutive activation of the signaling pathway, show a significantly accelerated germination rate compared to that of the wild type. The involvement of a G{alpha}-subunit in germination is of considerable interest due to its potential involvement in sensing and transmitting the signal to germinate, a hitherto poorly understood process.

GasC does not mediate carbon source sensing during germination:
The presence of water and a fermentable carbon source such as glucose is sufficient to activate a spore and to trigger spore germination in many fungi (D'ENFERT 1997 Down; HERMAN and RINE 1997 Down; OSHEROV and MAY 2001 Down). In S. pombe the GasC homolog Gpa2 mediates glucose sensing and is crucial for ascospore germination (HATANAKA and SHIMODA 2001 Down). In contrast, the results presented here suggest that GasC plays either a minor role or no role in transmitting a carbon source signal during germination. This conclusion is based on the observation that strains carrying the dominant-activating gasCG45R allele are not able to germinate in the absence of any carbon source. In support of this is the fact that all strains germinated more slowly on ethanol than on glucose (Fig 5C), suggesting that if GasC was the main glucose sensor, strains carrying the dominant-activating gasCG45R allele would be expected to show the same germination rate on any carbon source by bypassing the requirement for the activating signal. This result suggests a fundamental difference between yeasts and filamentous fungi in the signaling components used for glucose sensing. The observation that the {Delta}gasC mutant spores are not completely blocked in germination and will eventually germinate is a strong indication that GasC is linked to a very early sensor triggering germination and that downstream factors or alternate pathways can compensate for the absence of GasC signaling. A likely alternate pathway is that involving Ras. A. nidulans strains overproducing a dominant-activating rasA allele produce giant swollen spores with multiple nuclei that fail to produce germ tubes, demonstrating the critical role of RasA in the later events of spore germination such as progression from isotropic to polarized growth (SOM and KOLAPARTHI 1994 Down). Whether RasA also plays a role during initiation of germination is unclear at this stage (OSHEROV and MAY 2000 Down; FILLINGER et al. 2002 Down). Therefore, we propose that GasC signaling is crucial for activation of the spore and that other signaling pathways such as the Ras pathway are required for postinitiation events of the germination process. This model predicts that strains carrying the dominant-activating gasCG45R allele should initiate germination even in the absence of a carbon source. One possible explanation why this was not evident is if the dominant-activating gasCG45R strains initiate germination, but in the absence of a carbon source never reach the isotropic or polarized growth stages. Early markers of germination would be needed to further dissect the role of GasC in the germination process (FILLINGER et al. 2002 Down; OSHEROV et al. 2002 Down).

GasC-mediated signaling affects secondary metabolite production and conidiation:
The G{alpha}-subunit GasC not only is involved in germination, but also plays a role in the regulation of secondary metabolite production and conidiation (Fig 8). Dominant-activating gasCG45R strains positively affect the production of the red pigment by P. marneffei at 25° (Fig 4). Furthermore, the effects of the dominant-activating gasCG45R allele suggest that GasC signaling negatively affects the onset of conidiation and the conidial yield (Fig 3). In S. cerevisiae Gpa2 is linked to a glucose sensing receptor and is involved in the transmission of the signal for nitrogen starvation (KUBLER et al. 1997 Down; LORENZ and HEITMAN 1997 Down; COLOMBO et al. 1998 Down; KRAAKMAN et al. 1999 Down). In contrast to the situation in S. cerevisiae, GasC does not appear to be involved in sensing the quality of the nitrogen source present in the medium, as all strains were able to respond to changes in nitrogen source and to alter the production of red pigment. Similarly, the fact that the conidial yield of all strains was lowered by the same factor on ammonium vs. GABA indicates that the regulation of conidiation by GasC is independent of the nitrogen source (Fig 3C). GasC does not appear to be linked to a sensor for carbon limitation in the initiation process of conidiation. In wild-type P. marneffei the formation of conidiophores is delayed by high levels of glucose. The {Delta}gasC mutant would have been expected to precociously conidiate irrespective of the carbon status if GasC signaling was inhibiting conidiation by responding to conditions of carbon sufficiency.



View larger version (0K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 8. Proposed model for signal transduction pathways regulating germination, conidiation, and secondary metabolite production in P. marneffei. In P. marneffei, the G{alpha}-subunit GasC plays a major role in the regulation of germination. GasC also regulates secondary metabolites and to a lesser extent conidiation, as well as being involved in the response to hyperosmotic conditions. The G{alpha}-subunit GasA is a key regulator of conidiation and to a lesser extent also regulates the production of the red pigment (ZUBER et al. 2002 Down). The degree of regulation of a certain process by GasC and GasA is indicated by the thickness of the line.

This suggests that conidiation may be initiated by a more general stress response rather than by a specific response to carbon. In this respect, the phenotypes exhibited by the gasC mutants under hyperosmotic conditions are of particular interest. Strains carrying the dominant-activating gasCG45R allele are completely blocked in conidiation under these conditions (Fig 3B) and the onset of conidiation in the {Delta}gasC mutant is early compared to the wild type. Together these effects suggest an active role for GasC in transmitting the signal leading to hyperosmotic stress response and suggests that class III fungal G{alpha}-subunits not only are involved in transmitting nutritional signals as in S. cerevisiae and S. pombe, but also might be involved in transmitting a wider range of signals depending on the environment encountered by a given species. In the corn smut fungus U. maydis, the G{alpha}-subunit Gpa3, a homolog of S. cerevisiae Gpa2, regulates mating, dimorphic switching, and pathogenicity. In U. maydis, a {Delta}gpa3 mutant cannot respond to a pheromone, whereas a constitutively active gpa3 allele allows pheromone-independent mating, demonstrating that Gpa3 plays an active role in transmitting the pheromone signal. Furthermore, the {Delta}gpa3 mutant is nonpathogenic and Gpa3 has been proposed to transmit signals coming from the host plant (REGENFELDER et al. 1997 Down; KRUGER et al. 1998 Down). Similarly, in the human pathogen C. neoformans, another class III fungal G{alpha}-subunit, Gpa1, regulates processes such as mating and virulence. The C. neoformans Gpa1 has been proposed to be linked to sensors of glucose, nitrogen, and iron deprivation. The specific receptors that initiate these signaling cascades and their link to Gpa1, however, remain to be elucidated (TOLKACHEVA et al. 1994 Down; ALSPAUGH et al. 1997 Down). Our data also indicate no major role for GasC in the dimorphic switch or the maintenance of yeast growth at 37° (Fig 6). This is in contrast to the situation in S. cerevisiae and U. maydis where Gpa2 and Gpa3 are required for pseudohyphal growth and dimorphic switching, respectively (KUBLER et al. 1997 Down; LORENZ and HEITMAN 1997 Down; REGENFELDER et al. 1997 Down) and further emphasizes the diversity of processes regulated by the class III fungal G{alpha}-subunits.

GasC signaling and the cAMP-PKA pathway:
The signal transduction pathway downstream of GasC remains to be determined. Of particular interest, however, is the fact that the {Delta}gasC mutant shows a delay in germination and a highly asynchronous germination pattern that resembles the delay and asynchronous germination pattern seen in the A. nidulans {Delta}cyaA mutant (Fig 5A and Fig B; FILLINGER et al. 2002 Down). A delay in germination is also seen in the A. nidulans {Delta}pkaA mutant (FILLINGER et al. 2002 Down). In addition to germination, PkaA in A. nidulans also plays a role in the production of secondary metabolites and conidiation (SHIMIZU and KELLER 2001 Down), which are the three processes regulated by GasC in P. marneffei. This supports a model in which GasC signals through the cAMP-PKA pathway (Fig 8). The observation that dbcAMP and theophylline were unable to suppress the delay in the germination rate of the {Delta}gasC mutant may be due to the impermeability of ungerminated spores, as has been suggested for similar studies (OSHEROV and MAY 2000 Down).

Overlapping roles of the two G{alpha}-subunits GasA and GasC:
In P. marneffei GasA-mediated signaling blocks conidiation and to a lesser extent regulates production of the red pigment (ZUBER et al. 2002 Down). Conversely, GasC is a weaker regulator of conidiation, but a stronger regulator of pigment production. The overlapping roles between these two G{alpha}-subunits may suggest that they share downstream signaling components or effectors. The weak regulation of conidiation through GasC and pigment production through GasA could be indirect effects resulting from cross-activation of the main programs regulated by each of the G{alpha}-subunits. In support of this are the phenotypes displayed by the strains carrying the dominant-interfering gasCG207R allele, which suggest that this mutation blocks signaling only partially. High-copy-number transformants show a slightly but significantly lower yield in conidiation compared to the wild type and {Delta}gasC mutant (Fig 3B and Fig C), while low-copy-number transformants are not as delayed in germination as the {Delta}gasC mutant (Fig 5A). Overexpression of the dominant-interfering gasCG207R allele may result in an interaction with the ß{gamma}-subunit that normally interacts with GasA leading to enhanced GasA signaling, which would explain the lower conidial yield observed in the dominant-interfering gasCG207R strains. Alternatively, it has recently been shown that S. cerevisiae Gpa2 interacts with a member of a new class of ß-subunits composed of kelch repeats, which are predicted to fold into structures strikingly similar to the WD-40-based ß-subunits (HARASHIMA and HEITMAN 2002 Down). If GasC also interacts with this new class of ß-subunit, the interaction could be different at the molecular level, making the dominant-interfering gasCG207R mutation less efficient than that in a G{alpha}-subunit that associates with a classic Gß-subunit. Overlapping roles for G{alpha}-subunits have previously been noted in N. crassa where conidiation is regulated by Gna1 and Gna3 belonging to class I and III fungal G{alpha}-subunits, respectively. Similar to the {Delta}gasC mutant, the {Delta}gna3 mutant exhibits shorter aerial hyphae and premature dense conidiation. The {Delta}gna1 mutant also shows shorter aerial hyphae and is delayed in conidiation (IVEY et al. 1996 Down; KAYS et al. 2000 Down).

The G{alpha}-subunit FadA from A. nidulans is a close homolog of GasA and is known to regulate conidiation and secondary metabolism (YU et al. 1996 Down; HICKS et al. 1997 Down). A. nidulans FadA has been shown to signal both through PkaA and in a PkaA-independent fashion (SHIMIZU and KELLER 2001 Down). On the basis of our observation that GasC functions similarly in both A. nidulans and P. marneffei (Fig 7), we speculate that GanB might play a role in A. nidulans similar to the one GasC plays in P. marneffei and that both might have a role in cAMP-PKA signaling. This makes the relationship between GasA, GasC, and the signal transduction pathways transmitting their respective signals very intriguing. The characterization of the gasA, gasC double mutant did not detect any synergistic effects, suggesting that GasA and GasC act independently and probably respond to different environmental cues to coordinately regulate conidiation and pigment production (Fig 8). To identify the specific signals and receptors linked to both GasA and GasC, as well as the signaling pathways used to transmit these signals to downstream effectors, is an important issue.


*  FOOTNOTES

Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under accession no. AY170625. Back


*  ACKNOWLEDGMENTS

This work was supported by a grant from the Australian Research Council and Novozyme A/S. S. Zuber was supported by an International Postgraduate Research Scholarship and a Melbourne Research Scholarship.

Manuscript received December 8, 2002; Accepted for publication March 3, 2003.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ALSPAUGH, J. A., J. R. PERFECT, and J. HEITMAN, 1997  Cryptococcus neoformans mating and virulence are regulated by the G-protein {alpha}-subunit GPA1 and cAMP. Genes Dev. 11:3206-3217.[Abstract/Free Full Text]

ANDRIANOPOULOS, A., 2002  Control of morphogenesis in the human fungal pathogen Penicillium marneffei.. Int. J. Med. Microbiol. 292:331-347.[Medline]

ANDRIANOPOULOS, A. and M. J. HYNES, 1988  Cloning and analysis of the positively acting regulatory gene amdR from Aspergillus nidulans.. Mol. Cell. Biol. 8:3532-3541.[Abstract/Free Full Text]

AUSUBEL, F. M., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN et al., 1994 Current Protocols in Molecular Biology. Wiley, New York.

LKER, M., 1998  Sex and crime: heterotrimeric G proteins in fungal mating and pathogenesis. Fungal Genet. Biol. 25:143-156.[Medline]

BORGES-WALMSLEY, M. I. and A. R. WALMSLEY, 2000  cAMP signaling in pathogenic fungi: control of dimorphic switching and pathogenicity. Trends Microbiol. 8:133-141.[Medline]

BORNEMAN, A. R., M. J. HYNES, and A. ANDRIANOPOULOS, 2000  The abaA homologue of Penicillium marneffei participates in two developmental programmes: conidiation and dimorphic growth. Mol. Microbiol. 38:1034-1047.[Medline]

BORNEMAN, A. R., M. J. HYNES, and A. ANDRIANOPOULOS, 2001  An STE12 homolog from the asexual, dimorphic fungus Penicillium marneffei complements the defect in sexual development of an Aspergillus nidulans steA mutant. Genetics 157:1003-1014.[Abstract/Free Full Text]

BORNEMAN, A. R., M. J. HYNES, and A. ANDRIANOPOULOS, 2002  A basic helix-loop-helix protein with similarity to the fungal morphological regulators, Phd1p, Efg1p and StuA, controls conidiation but not dimorphic growth in Penicillium marneffei.. Mol. Microbiol. 44:621-631.[Medline]

CHAN, Y. F. and T. C. CHOW, 1990  Ultrastructural observations on Penicillium marneffei in natural human infection. Ultrastruct. Pathol. 14:439-452.[Medline]

COLOMBO, S., P. MA, L. CAUWENBERG, J. WINDERICKX, and M. CRAUWELS et al., 1998  Involvement of distinct G-proteins, Gpa2 and Ras, in glucose- and intracellular acidification-induced cAMP signaling in the yeast Saccharomyces cerevisiae.. EMBO J. 17:3326-3341.[Medline]

COOPER, C. R. J. and M. R. MCGINNIS, 1997  Pathology of Penicillium marneffei: an emerging acquired immunodeficiency syndrome-related pathogen. Arch. Pathol. Lab. Med. 121:798-804.[Medline]

COVE, D. J., 1966  The induction and repression of nitrate reductase in the fungus Aspergillus nidulans.. Biochim. Biophys. Acta 113:51-56.[Medline]

D'ENFERT, C., 1997  Fungal spore germination: insights from the molecular genetics of Aspergillus nidulans and Neurospora crassa.. Fungal Genet. Biol. 21:163-172.

EHINGER, A., S. H. DENISON, and G. S. MAY, 1990  Sequence, organization and expression of the core histone genes of Aspergillus nidulans.. Mol. Gen. Genet. 222:416-424.[Medline]

FILLINGER, S., M. K. CHAVEROCHE, K. SHIMIZU, N. KELLER, and C. D'ENFERT, 2002  cAMP and RAS signaling independently control spore germination in the filamentous fungus Aspergillus nidulans.. Mol. Microbiol. 44:1001-1016.[Medline]

GARRISON, R. G. and K. S. BOYD, 1973  Dimorphism of P. marneffei as observed by electron microscopy. Can. J. Microbiol. 19:1305-1309.[Medline]

GIMENO, C. J., P. O. LJUNGDAHL, C. A. STYLES, and G. R. FINK, 1992  Unipolar cell divisions in the yeast S. cerevisiae lead to filamentous growth: regulation by starvation and RAS. Cell 68:1077-1090.[Medline]

HAMM, H. E. and A. GILCHRIST, 1996  Heterotrimeric G proteins. Curr. Opin. Cell Biol. 8:189-196.[Medline]

HARASHIMA, T. and J. HEITMAN, 2002  The G{alpha} protein Gpa2 controls yeast differentiation by interacting with kelch repeat proteins that mimic Gß subunits. Mol. Cell 10:163-173.[Medline]

HATANAKA, M. and C. SHIMODA, 2001  The cyclic AMP/PKA signal pathway is required for initiation of spore germination in Schizosaccharomyces pombe.. Yeast 18:207-217.[Medline]

HERMAN, P. K. and J. RINE, 1997  Yeast spore germination: a requirement for Ras protein activity during re-entry into the cell cycle. EMBO J. 16:6171-6181.[Medline]

HICKS, J. K., J.-H. YU, N. P. KELLER, and T. H. ADAMS, 1997  Aspergillus sporulation and mycotoxin production both require inactivation of the FadA G{alpha} protein-dependent signaling pathway. EMBO J. 16:4916-4923.