- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Miranda, A.
- Articles by Kuzminov, A.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Miranda, A.
- Articles by Kuzminov, A.
Chromosomal Lesion Suppression and Removal in Escherichia coli via Linear DNA Degradation
Anabel Miranda1,a and Andrei Kuzminovaa Department of Microbiology, University of Illinois, Urbana, Illinois 61801
Corresponding author: Andrei Kuzminov, 601 S. Goodwin Ave., Urbana, IL 61801-3709., kuzminov{at}life.uiuc.edu (E-mail)
Communicating editor: S. LOVETT
| ABSTRACT |
|---|
RecBCD is a DNA helicase/exonuclease implicated in degradation of foreign linear DNA and in RecA-dependent recombinational repair of chromosomal lesions in E. coli. The low viability of recA recBC mutants vs. recA mutants indicates the existence of RecA-independent roles for RecBCD. To distinguish among possible RecA-independent roles of the RecBCD enzyme in replication, repair, and DNA degradation, we introduced wild-type and mutant combinations of the recBCD chromosomal region on a low-copy-number plasmid into a
recA
recBCD mutant and determined the viability of resulting strains. Our results argue against ideas that RecBCD is a structural element in the replication factory or is involved in RecA-independent repair of chromosomal lesions. We found that RecBCD-catalyzed DNA degradation is the only activity important for the recA-independent viability, suggesting that degradation of linear tails of
-replicating chromosomes could be one of the RecBCD's roles. However, since the weaker DNA degradation capacity due a combination of the RecBC helicase and ssDNA-specific exonucleases restores viability of the
recA
recBCD mutant to a significant extent, we favor suppression of chromosomal lesions via linear DNA degradation at reversed replication forks as the major RecA-independent role of the RecBCD enzyme.
TWO-STRAND DNA lesions affect both strands of a DNA duplex opposite each other. In contrast to more common one-strand DNA lesions, two-strand DNA lesions threaten chromosomal integrity, block chromosomal replication, and interfere with chromosomal segregation; in this sense, they can be viewed as chromosomal lesions (![]()
![]()
![]()
![]()
![]()
Consistent with the important role of homologous strand exchange in DNA damage repair, rec mutants are sensitive to DNA-damaging treatments. For example, recBC and recF mutants are sensitive to UV and show synergistic effect if combined in a double mutant, defining the two major independent pathways of recombinational repair (![]()
![]()
![]()
![]()
![]()
The RecBCD enzyme is a multifunctional helicase-nuclease, also known as ExoV (reviewed in ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
25% of RecBCD rates (![]()
![]()
![]()
![]()
![]()
![]()
Biochemical characterization of linear DNA processing by the RecBCD enzyme in the presence of RecA (![]()
![]()
![]()
![]()
![]()
3.5-fold, an effect much stronger than that of recA inactivation (![]()
There are two competing models for the RecA-independent role of RecBCD in E. coli chromosomal metabolism. The first model suggests that the major nonrepair role of RecBCD is in removal of linear tails of the
-replicating chromosomes, thus returning the chromosomes to
-, replication (Fig 1, D to A; ![]()
![]()
![]()
-replicating chromosome cannot produce a circular daughter chromosome (Fig 1, E to F)a situation described as a "
-replication trap" (![]()
-replication trap. According to the other model, RecBCD acts to suppress chromosomal lesions at reversed replication forks by attacking the short linear duplex formed by extruded newly replicated DNA strands (Fig 1C) and thus eliminating the Holliday junction (Fig 1, C to B), which would otherwise be resolved by RuvABC, leading to replication fork breakage (Fig 1, C to D; ![]()
|
| MATERIALS AND METHODS |
|---|
Media, growth conditions, and general methods:
Cells were grown in Luria broth (LB; 10 g tryptone, 5 g yeast extract, 5 g NaCl, 0.25 ml 4 M NaOH/1 liter) or on LB plates (15 g agar/1 liter of LB). When cells were carrying plasmids, the media were supplemented with 100 µg/ml ampicillin. Other antibiotics, when required for strain construction, were used in the following concentrations: 100 µg/ml spectinomycin, 50 µg/ml kanamycin, 12.5 µg/ml chloramphenicol, or 10 µg/ml tetracycline. TM buffer is 10 mM Tris HCl pH 8.0, 10 mM MgSO4. Hershey (H) agar (13 g tryptone, 8 g NaCl, 2 g sodium citrate, 1.3 g glucose, 15 g agar/1 liter) was used for T4 plating (![]()
Bacterial strains:
Bacterial strains are E. coli K-12 (Table 1). Individual recA, recBCD, and recF mutants were confirmed by their characteristic UV sensitivities. In addition, recBCD mutants were confirmed by their ability to plate T4 2 mutant phage (![]()
![]()
|
Oligonucleotides used to replace recF with a cat insertion are:
- AATTCGACATCAACGTTTCTCGCTCATTTATACTTGGGTTTGTGTAGGCTGGAGCTGC and
- CAGAGCGCGGCTTATGTTGTCATGCCAATGAGACTGTAATCATATGAATATCCTCCTTAG.
Oligonucleotides used to replace the recC-ptr-recB-recD region with a kan insertion are:
- TGCGTAACACTCGTACGTCGCATCCGGCAATTACGTTTATTCCGTGTAGGCTGGAGCTGCTTC and
- GACCCGCCTGCATTGCCCGAATCGTCAGTAGTCAGGAGCCGCCATATGAATATCCTCCTTA.
Oligonucleotides used for insertion of a chloramphenicol-resistant gene between yajD and tsx at the position 430,320 bp on the E. coli chromosome are:
- CGCATCCGGCATGAACAAAGCACACGTTGTTAACAATCAGAATGTGTAGGCTGGAGCTGC and
- CAACTTCTGATTATGAAAATGCCGGGATTTATTCCCGGCATATGAATATCCTCCTTAG.
In all cases, parts homologous to the chromosome are underlined.
Plasmids:
A general description of the plasmids is in Table 1. Derivation of the plasmids built for this study is given below:
- pAMP1: the 18.3-kbp recBCD region from pDWS2 cloned as the BamHI fragment into the BamHI site of pWSK29 in such orientation that the recC-ptr-recB-recD region is transcribed in the direction opposite to the lac promoter of the vector.
- pAMP1B: as pAMP1, but the orientation of the BamHI insert is reversed.
- pAMP2: 921-bp EcoRI deletion removes the promoter and the 5' portion of the addB gene from pWSK2988 (
KOOISTRA and VENEMA 1991 ;
KOOISTRA et al. 1993 ).
- pAMP3: the 11.7-kbp recC-ptr-recB region from pSA122 cloned into the BamHI site of pWSK29 in the same orientation as in pAMP1.
- pAMP5: the 18.3-kbp recC-ptr-recB-recD region from pB1082CD cloned into the BamHI site of pWSK29 in the same orientation as in pAMP1. The presumed recBK1082Q mutation could not be confirmed by sequencing; since the non-wild-type behavior of the construct suggested an uncharacterized mutation, we designated the allele recB*CD.
- pAMP7: the 18.3-kbp recC-ptr-recB-recD region from pMY330 cloned into the BamHI site of pWSK29 in the same orientation as in pAMP1.
- pAMP8: the [XhoI-BamHI 4854 bp] fragment from pAMP1, containing recD and the 3' part of recB, cloned at the XhoI and BamHI sites of pWSK29. The orientation of the recD gene in pAMP8 is the same as the orientation of the whole recBCD region in pAMP1.
- pEAK1: the big EcoRI-HindIII fragment of pHGS415, carrying the bla gene and the replication origin, combined with the small EcoRI-HindIII fragment of pMTL21 (
CHAMBERS et al. 1988 ), carrying a multiple cloning site.
- pK134: BamHI-cleaved pEAK1 first combined with the [BamHI-BamHI 11.7-kbp] fragment from pSA122 carrying the recC-ptr-recB region; the resulting plasmid was cleaved with SmaI, and the 14.8-kbp fragment was circularized, thus removing one of the BamHI sites and putting the recC gene under the cat promoter, left from pHSG415.
- pK135: pK134, into the unique BamHI site of which the [BamHI-BamHI 3274 bp] fragment from pBEU14 containing the wild-type recA gene has been inserted such that recA is co-oriented with the recC-ptr-recB genes.
T4 2 mutant plating: A fresh overnight culture is diluted 1000-fold into 2 ml of LB (supplemented with 250 µg of ampicillin if the strain harbors a plasmid) and grown with shaking at 28° to 2 x 108 cells/ml. A total of 100 µl of the growing culture is mixed with 10 µl of either T4 wild-type or T4 2 mutant phages, diluted in TM buffer to produce approximately the same number of plaques on wild-type cells. After a 3-min incubation at room temperature, 1 ml of top H agar is added and the mixture is plated on a 60 x 15 petri plate with H agar and incubated at 37° for 16 hr. The number of plaques of T4 2 mutant phage is divided by the number of plaques of the T4 wild-type phages on the same strain the same day to determine the normalized T4 2 mutant plating.
UV survival: A fresh overnight culture is diluted 100-fold into 2 ml of LB and grown with shaking at 28° to 2 x 108 cells/ml. Tenfold serial dilutions are made in 1% NaCl and spotted by 10 µl in rows of six onto a square petri dish with LB agar. The plate is dried, partially covered with a screen, and exposed to a gradient of doses of UV light in the direction perpendicular to the dilution gradient, so that every dilution column (from 10-1 to 10-6 dilutions) receives its own dose. UV crosslinker (Amersham-Pharmacia), in which all the lamps except the central one are removed and 90% of the remaining lamp is shielded, is used to deliver precise doses of UV (measured by the internal UV sensor). Immediately after the exposure, the plate is covered with aluminum foil and incubated at 37° for 1624 hr. The titer of the culture at the zero dose is used to determine the survival at various UV doses.
Quantitative P1 transduction: In a 1.5-ml microcentrifuge tube, 400 µl of a fresh overnight culture in LB is mixed with 500 µl of 30 mM MgCl2, 15 mM CaCl2, 200 µl of LB, and 30 µl of a P1 lysate of AM6 and incubated for 20 min at 28° with shaking. The cells are pelleted by 1 min centrifugation in a microcentrifuge, resuspended in 1.2 ml of LB supplemented with 20 mM sodium citrate, and incubated with shaking for 1 hr at 28°. A total of 100 µl of the culture is plated on LB + 20 mM sodium citrate plates with single selections, whereas cells from the remaining 1 ml are collected by centrifugation, resuspended in 100 µl of LB, and plated on an LB + 20 mM sodium citrate plate with the double (chloramphenicol + tetracycline) selection. The plates are incubated at 37° for 48 hr before transductants are counted.
Viability: A fresh overnight culture is diluted 100-fold into 2 ml of LB and grown with shaking at 28° to 15 x 108 cells/ml. Two 100-µl aliquots of the culture are taken at the same time: one aliquot is diluted 100-fold into 1% NaCl to stop growth, and the other one is mixed with 0.8 µl of 4 M NaOH to stop cell movement. A total of 5 µl of the NaOH-treated aliquot is used to count cells under the microscope in a Petroff-Houser counting chamber. The 1% NaCl-diluted aliquot is diluted further to achieve the final dilution of 10-5, 100 µl of the final dilution is combined with 3.5 ml of top LB agar, and the mixture is poured over an LB plate. The plate is incubated at 37° for 1636 hr, and the titer of the colony-forming units is divided by the titer of the microscopic count to determine the viability.
Field-inversion gel electrophoresis: Growing cultures of strains to be tested were normalized to OD600 = 0.50.6. Cells from 1.5 ml of the normalized cultures were pelleted by centrifugation and resuspended in 60 µl of TE buffer. After incubation at 37° for 210 min, 5 µl of 10 mg/ml Proteinase K was added, followed by 65 µl of 1.2% molten agarose in 0.2% sarcosyl, 10 mM Tris HCl pH 8.0, 5 mM EDTA, kept at 70°. After vortexing and mixing by pipetting, 110 µl of the cell suspensions were pipetted into plug molds and let solidify for 210 min. Each plug was then placed in a small glass tube containing 1 ml of 1% sarcosyl, 50 mM Tris HCl pH 8.0, and 25 mM EDTA and incubated for 1 hr at 60°. Plugs were inserted into a 1% agarose gel on 0.5x TBE buffer and run at room temperature in a regular agarose gel box with field inversion factor 3:1 at 4 V/cm for 5 hr with ramping 120 sec, then for 5 hr with ramping 2060 sec, and then for 5 hr with ramping 60100 sec. Gels were stained with ethidium bromide before being photographed in UV light.
| RESULTS |
|---|
The phenomenon and possible explanations:
When grown under the standard laboratory conditions, recA mutants are only 4648% viable (Table 2), indicating the frequency of chromosomal damage and demonstrating the importance of repairing it. The two pathways of recA-dependent repair in E. coli are controlled by the recBC and recFOR genes. A
recF mutant has
71% viability (Table 2), which is consistent with inactivation of one of the two recombinational repair pathways. A
recA mutation is epistatic to the
recF mutation for viability (the
recA
recF double mutant has the viability of a single
recA mutant), indicating that RecF has no effect on viability outside the RecA-dependent processes. In contrast, recBC mutants are only
28% viable, suggesting an additional role for RecBCD beyond the RecA-controlled recombinational repair. Indeed, compared with 4648% viability of recA mutants, recA recBC combinations are only 1819% viable (Table 2), supporting a RecA-independent role for RecBCD. recBCD inactivation is epistatic to recF inactivation (Table 2).
|
Pulsed-field gel electrophoresis of undigested chromosomal DNA is employed to detect chromosomal fragmentation: under pulsed-field gel conditions, intact chromosomes stay at the origin, whereas linear subchromosomal fragments migrate into the gel, forming a smear (![]()
![]()
|
We conceived four possibilities for the RecA-independent role of RecBCD, numbered from 1 to 4 irrespective of their likelihood (Fig 1). Possibility 1 is that RecBCD is an integral part of a supramolecular complex at the replication factory (Fig 1, A to B), and that its absence destabilizes other components of the factory, negatively affecting chromosomal replication. Indeed, RecBCD is occasionally reported to purify from cells in complexes with replication enzymes (![]()
![]()
![]()
![]()
![]()
![]()
![]()
-replicating chromosomes (Fig 1, D to A) as part of a chromosomal damage removal mechanism (see Introduction).
The experimental system:
To find the nature of the RecBCD effect on the cell's viability outside the RecA-dependent recombinational repair, we transformed a
recA
recBCD strain with plasmids carrying various alleles of the E. coli recBCD genes or genes with similar functions from Bacillus subtilis (Table 1, plasmids; this study) and determined viability of the resulting strains, looking for the constructs that would restore viability to the
50% level of a single recA mutant. As controls, we used the same plasmids to transform a RecA+ RecBCD+ strain, as well as single
recA or
recBCD deletion mutants. As a vector for all our constructs, we used pSC101-derived pWSK29, which has a high stability and a low copy number (![]()
To assess the functionality of the constructs, we determined to what extent defects of a
recBCD mutant are complemented by the introduced constructs. As mentioned in the Introduction, the two major functions of the RecBCD enzyme are: (1) participation in the RecA-promoted recombinational repair and (2) degradation of linear duplex DNA (ExoV). To determine the recombinational repair capacity of
recBCD mutants transformed with the constructs, we measured their resistance to UV irradiation. Relative to the wild-type cells,
recBCD mutants are quite sensitive to UV due to their defect in repair of double-strand breaks (![]()
![]()
![]()
To simultaneously evaluate both the recombination capacity and the ExoV activity of the constructs in functional interaction with each other, we measured the frequency of generalized P1 transduction in these strains. During P1 transduction, an
100-kbp piece of a donor chromosome, carrying a selectable marker, is introduced into a recipient cell, and recombinants, with the donor marker inserted in the recipient chromosome, are selected for. The formation of these recombinants depends on both RecA and RecBCD functions in the recipient cells (![]()
![]()
![]()
64 kbp. By selecting for growth on tetracycline plus chloramphenicol after transduction, we were selecting for incorporation of the central 64 kbp of the injected 100 kbp (as well as for rare independent double transductants).
We verified how the system works with
recBCD cells transformed with an empty vector or the vector carrying a complete wild-type recBCD region of the chromosome. In the DNA degradation test (T4 2 mutant phage plating), the vector alone behaved essentially as the
recBCD control strain, whereas the recBCD+ plasmid conferred nearly wild-type levels of DNA degradation capacity (Fig 3A). In the recombinational repair test (UV resistance) the vector alone did not provide any resistance over the
recBCD levels, whereas the recBCD+ plasmid conferred close to wild-type levels of UV resistance at doses 27 J/m2 and lower (Fig 3B). With the combined recombinational repair/DNA degradation test, vector alone did not contribute to transduction over the
recBCD levels, whereas the recBCD+ plasmid significantly increased transduction over the background levels, although it failed to bring it to the wild-type levels (Fig 3C). Finally, we measured the viability of wild-type cells, as well as single
recA or
recBCD deletions and of the double
recA
recBCD deletion strains, transformed with vector alone or with the recBCD+ plasmid. Vector alone did not significantly change the viability of the four strains (Fig 3D). In contrast, the recBCD+ plasmid, although having no effect on the viability of wild-type and
recA cells, increased the viability of the
recBCD mutant to the level intermediate between the mutant and the wild type and increased the viability of the
recA
recBCD mutant to the level of the
recA mutant (Fig 3D). Subjecting chromosomal DNA to pulsed-field gels revealed that the recBCD+ plasmid decreases chromosomal fragmentation in both recBCD and recA recBCD mutant cells (Fig 2, lanes e and f). We conclude that (1) the tests for the RecBCD functions are highly sensitive, allowing a distinguishing power of two to three orders of magnitude; (2) the vector itself does not contribute to the RecBCD-attributed characteristics and to the viability; and (3) the recBCD-carrying plasmid does restore some characteristics to the levels of the wild-type cells and some other characteristics to intermediate levels (addressed in the DISCUSSION).
|
RecBCD enzyme does not play a structural role in supramolecular assemblies:
As elaborated above, RecBCD can boost the viability of E. coli independently of RecA in at least four possible ways (Fig 1): (1) by serving as a structural element at the replication factory, (2) by promoting RecA-independent recombinational repair of damaged chromosomes, (3) by suppressing chromosomal damage via degradation of abnormal replication forks, and (4) by returning
-replicating chromosomes to
replication via degradation of linear tails. First, we tested the idea that RecBCD could be an integral part of a supramolecular assembly involved in chromosomal replication/repair (replication factory) and that its absence destabilizes the assembly, negatively affecting the replication process.
To do that, we provided the four test strains with the AddAB enzyme from B. subtilis, the powerful exonuclease/helicase that plays the same role in Bacillus as RecBCD does in E. coli, but has little sequence homology with the E. coli RecBCD and therefore is unlikely to become a part of any supramolecular structure in E. coli. Somewhat surprisingly, the AddAB enzyme complemented not only the DNA degradation deficiency of the
recBCD mutant (Fig 4A), but also restored its recombinational repair proficiency (![]()
![]()
recBCD mutant (to the wild-type levels) and the
recA
recBCD mutant (to the recA mutant levels; Fig 4D), while slightly decreasing the viability of wild-type cells. Inactivation of addAB genes by deletion of the promoter region, as well as the very 5'-terminal part of the addB gene, eliminates all the complementation (Fig 4, AC), elevating the viability of all three mutant strains somewhat (Fig 4D). This shows that the effect of the addAB clone is due to the functional AddAB enzyme, rather than to some sequences in the cloned region. The restoration of the
recA
recBCD mutant viability by the completely nonhomologous AddAB enzyme therefore contradicts the idea that the RecA-independent role of RecBCD is one of a structural element in a replication factory or another supramolecular complex involved in DNA replication.
|
As another test of this idea, we employed the RecB1080CD mutant enzyme of E. coli, which has a single-amino-acid change completely inactivating the only nuclease active center of the enzyme, situated on the RecB subunit. Although presumably structurally very similar to the wild-type enzyme, the mutant enzyme does not show any DNA degradation activity in vitro (![]()
![]()
recBCD mutant cells, this could be a strong indication for the structural role of RecBCD. However, the RecB1080CD mutant enzyme moderately increases the viability of recBCD mutant cells (and, surprisingly, of wild-type cells), but does not improve the viability of a recA single mutant and a recA recBCD double mutant (Fig 5D). These results with the RecB1080CD mutant enzyme argue against the structural role for the RecBCD enzyme in E. coli's DNA replication process.
|
Wild-type levels of DNA degradation or DNA unwinding are important for viability of recA mutants:
The RecBCD enzyme exhibits two groups of enzymatic activities: those important for recombination and those important for DNA degradation, both of which could contribute to the viability of recA mutants, as demonstrated by the effect of the analogous AddAB enzyme from B. subtilis. To see which activity of RecBCD is important for recA-independent survival, we employed the RecB*CD enzyme, which does not restore UV resistance and P1 transduction proficiency to the
recBCD mutant cells, but does restore wild-type levels of DNA degradation, as measured by the T4 2 mutant survival (Fig 5, AC). Thus, the recombination activities of RecBCD are selectively inactivated by the recB* mutation. If the RecB*CD mutant enzyme fails to restore the viability of the
recA
recBCD mutant cells, this would argue against the role of linear DNA degradation in recA-independent survival. However, we found that the RecB*CD mutant enzyme restores the viability of the
recBCD mutant to wild-type levels and upgrades the viability of the recA recBCD mutant to the recA mutant level (Fig 5D), arguing that it is the DNA degradation activity of RecBCD that is important for its RecA-independent contribution to viability.
To verify this conclusion, we employed a recBC+ allele; deletion of recD should selectively inactivate the DNA degradation activities of the RecBCD enzyme, leaving the DNA helicase activity (important for recombinational repair) intact (![]()
![]()
![]()
recBCD mutant cells behave as wild-type cells in the recombinational repair (UV survival) test, are grossly defective in linear DNA degradation (50% permissivity for T4 2 mutant), and hyper-rec in the combined DNA degradation/recombination test (two-marker P1 transduction), reflecting their defect in linear DNA degradation. If the wild-type levels of DNA degradation were important for the recA-independent contribution to viability by RecBCD, the RecBC enzyme would not contribute significantly to the viability of recA recBCD mutants. The plasmid expressing only recBC genes does not influence the viability of the wild-type or recA mutants cells, but, remarkably, it almost doubles the viability of recBCD mutant cells and restores the viability of recA recBCD mutant cells to the levels of recA mutants (Fig 6D). As a control we used a plasmid that expresses only the RecD polypeptide. As expected, this plasmid did not restore any RecBCD-specific activity of the
recBCD mutant cells, nor did it change the viability of the three mutants (Fig 6). Characteristically, the RecD-producing plasmid lowered the viability of the wild-type cells, probably due to the lack of regulation of the DNA degradation, observed in strains overproducing the RecD subunit (![]()
|
DNA unwinding restores viability only if ssDNA-specific degradation is available:
At face value, the result with the RecBC enzyme contradicts the previous result, arguing that the wild-type level of DNA degradation is not as important for viability in the absence of RecA as the recombination-relevant DNA helicase activity of the RecBC(D-) mutant enzyme is. To see if the RecBC enzyme or the complete RecBCD enzyme could promote recombinational repair in the absence of RecA, we verified whether the corresponding plasmids confer any degree of UV resistance or P1 transduction proficiency to the recA recBCD mutant. We found no changes in UV resistance and a very low level of P1 transduction promoted by the RecBCD or RecBC enzymes in the absence of RecA (Fig 7). Thus, the only possible explanation for the surprising restoration of the viability of the
recA
recBCD mutant by the RecBC-producing plasmid is that the attenuated DNA degradation, catalyzed by the combination of RecBC helicase and ssDNA-specific nucleases (Fig 8A; ![]()
![]()
recA
recBCD mutant would diminish the degree to which the viability is restored.
|
|
To test this idea, we constructed a
recA
recBCD variant, with the two major single-strand DNA-specific exonucleases, ExoI (gpxonA) and RecJ, inactivated. To accomplish this, we complemented the strain with a temperature-sensitive plasmid, carrying both recA+ and recBCD+ genes, introduced either a
xonA or a recJ mutation by P1 transduction, and, finally, lost the complementing plasmid. The plasmid was easily lost from the
recA
recBCD
xonA mutant, was lost with some difficulty from the
recA
recBCD recJ mutant, but could not be lost, even after repeated attempts, from the
recA
recBCD
xonA recJ mutant, suggesting that this combination is inviable (in fact, even the
recA
recBCD recJ mutant has an extremely low viability; Fig 8C). Since the double
xonA recJ mutant was inviable in the
recA
recBCD background, we had to do the experiment in
recA
recBCD
xonA and
recA
recBCD recJ mutant strains.
To confirm the ssDNA-exonuclease defects, we introduced the RecBCD+ or the RecBC+ plasmids into the ssDNA-exonuclease-deficient
recA
recBCD cells and measured the level of linear DNA degradation in these cells by T4 2 mutant plating. As expected, T4 2 mutant plating was high on the
recA
recBCD mutant and its
xonA or recJ derivatives (Fig 8B). T4 2 mutant plating decreased to the same low level in all three mutants supplemented by the RecBCD+ (Hel+/Exo+) plasmid (RecBCD degrades dsDNA without the help of ssDNA-specific exonucleases) and was intermediate in the presence of the RecBC+ (Hel+/Exo-) plasmid in the
recA
recBCD cells (Fig 8B). However, compared with the
recA
recBCD strain, T4 2 mutant plating in the presence of pRecBC+ plasmid was four times higher on
recA
recBCD
xonA and seven times higher on
recA
recBCD recJ mutant cells, corroborating their defect in ssDNA-specific exonucleases (Fig 8B).
As expected, the RecBCD+ plasmid completely restored the viability of the ssDNA-exonuclease-deficient
recA
recBCD cells to the viability levels of recA mutants (Fig 8C). RecBC+ plasmid also restored the viability of the
recA
recBCD control strain almost to the recA mutant level. However, the viability of the
recA
recBCD
xonA mutant, and especially of the
recA
recBCD recJ mutant, although improved, was still two- to threefold below the viability of the same mutants, complemented with the complete RecBCD+ region (Fig 8C). In other words, the effects on the two graphs (Fig 8B vs. C) were exactly reversed: the higher T4 2 mutant survival (indicating lower DNA degradation levels) translated into the lower viability of the strain. Thus, ssDNA-specific exonucleases become essential for viability if the complete RecBCD enzyme is replaced with the exonuclease-deficient but helicase-proficient RecBC enzyme. Therefore, the relatively high viability of recA mutants relies on the high affinity of the RecBCD or RecBC enzymes toward double-strand ends and depends on some DNA degradation from these ends.
| DISCUSSION |
|---|
RecBCD of E. coli is a large protein complex with DNA helicase and exonuclease activities, which are implicated in degradation of linear DNA and in recombinational repair of double-strand breaks in the chromosome. recA null mutants are 50% viable, whereas recA recBCD mutants are only 20% viable, indicating a role for the RecBCD enzyme in a recA-independent survival. We conceived four possibilities for such a role (Fig 1): (1) RecBCD is a structural element in the replication factory assembly; (2) RecBCD has RecA-independent recombinational repair activity (uses its DNA helicase activity to reassemble disintegrated replication forks); (3) RecBCD is a chromosomal damage suppressor (uses its high affinity to double-strand ends to attack abnormal replication structures whose alternative processing would lead to chromosomal lesions); and (4) RecBCD has chromosomal damage-removal activity (uses its powerful exonuclease activity to degrade long linear tails of
-replicating chromosomes, thus returning chromosomes to
-replication).
To identify the RecA-independent role for the RecBCD enzyme in the viability of E. coli cells, we employed several constructs, carrying the recBCD chromosomal region on a low-copy-number plasmid (Table 3). The constructs were characterized in
recBCD mutant cells for the DNA degradation capacity (T4 2 mutant survival) and for recombinational repair proficiency (UV resistance) as well as in a combined test for both DNA degradation and recombination (two-marker P1 transduction). Some constructs restored both the DNA degradation and the recombinational repair capacity of the
recBCD mutant, some other constructs restored selectively either DNA degradation or recombinational repair, while yet other constructs restored neither property. In addition, the introduced enzymes were judged either structurally similar or dissimilar to the wild-type RecBCD enzyme on the basis of the sequence homology or the nature of the mutation (Table 3). We then introduced these different constructs into a
recA
recBCD mutant and determined viability of the resulting strains. We found that the RecBCD mutant enzyme lacking any activity due to a point mutation in the active site cannot restore the viability of the
recA
recBCD mutant, which argues against the idea that RecBCD plays the role of a structural element at the replication factory. The enzyme proficient only in DNA degradation restores the viability, which argues for the importance of DNA degradation in prevention/removal of chromosomal lesions. Surprisingly, the enzyme proficient only in DNA unwinding can also restore the viability (Table 3), suggesting recA-independent recombinational repair. However, the constructs that restore the recombinational repair capacity to the
recBCD strain do not restore the recombinational repair capacity to the
recA
recBCD strain, suggesting that the only RecA-independent role of the RecBC enzyme is still in linear DNA degradation. The inability of the helicase-proficient but exonuclease-deficient RecBC enzyme to fully restore the viability of
recA
recBCD strains, deficient in either one of the two major ssDNA-specific exonucleases, confirms this idea. We conclude that the low viability of recA recBCD mutants is due to their loss of the capacity to target linear DNA for limited degradation.
|
We introduced our constructs on a pSC101-derivative plasmid, which is reported to have a copy number of five to seven per chromosome (![]()
recBCD mutant phenotype by the pRecBCD and pRecBC plasmids could be attributed to this severalfold overproduction of the enzyme from plasmid. On the other hand, the recBCD genes in all our plasmids are cloned in opposite orientation relative to the direction of transcription from the truncated lacZ gene, making it possible that the recBCD genes actually are underexpressed. However, when we inverted the wild-type recBCD fragment in the pAMP1 construct, the viability of the
recBCD deletion strain, complemented with the "inverted" construct (pAMP1B), was the same as the viability complemented by the "direct" construct (data not shown), suggesting that the possible lacZ expression does not interfere with the expression of recBCD. The incomplete complementation is unlikely to be due to the plasmid instability, because (1) plasmids are relatively stable in recBC mutants (![]()
![]()
What is the nature of chromosomal lesions suppressed or removed by the RecBCD-promoted DNA degradation? Pulsed-field gel electrophoresis reveals significant chromosome fragmentation in recA mutants, which is roughly doubled in recBCD and recA recBCD mutants (Fig 2; ![]()
![]()
-replicating chromosomes (Fig 1D
A; ![]()
![]()
![]()
![]()
![]()
-replicating chromosome. However, our finding that a more modest DNA degradation activity, due to the combined action of the RecBC helicase plus ssDNA-specific exonucleases ExoI and RecJ (![]()
![]()
-replicating chromosome as the most frequent target of RecBCD. Two additional observations suggest that degradation of linear tails of
-structures cannot be the sole RecA-independent pathway of RecBCD-promoted chromosomal repair: (1) in polA recA, lig recA, and dam recA mutants the chromosome is degraded by RecBCD, but the degradation does not make these mutants viable (![]()
![]()
![]()
![]()
![]()
It was proposed that inhibited replication forks can reverse, extruding the newly synthesized DNA strands into a new duplex and forming a Holliday junction (Fig 1C; ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
B; ![]()
![]()
D; ![]()
![]()
![]()
RecBCD is not the only enzyme hypothesized to be involved in both the formation and subsequent repair/removal of chromosomal lesions. As detailed above, RuvABC is another enzyme involved at both stages. The difference is that, while both RecBCD and RuvABC help to repair chromosomal lesions, RecBCD also suppresses their formation, whereas RuvABC promotes their formation. Still other recombinational repair enzymes, RecG and PriA helicases, are recognized by their in vitro affinity to branched DNA structures as potential early players around inhibited replication forks (![]()
![]()
![]()
![]()
![]()
In summary, we propose that recBCD mutant cells are unable (1) to suppress breakage of inhibited replication forks independently of RecA and (2) to degrade the linear tails of
-replicating chromosomes in the absence of RecA. We propose that this double defect is the reason why the viability of recA recBCD mutants is significantly lower than that of recA mutants. If we add to these two defects the deficiency in repair of broken replication forks, in which RecBCD is involved together with RecA, it becomes clear why recBCD mutants have such a low viability.
| FOOTNOTES |
|---|
1 Present address: Department of Biology, San Diego State University, 5500 Campanile Dr., San Diego, CA 92182-4614. ![]()
| ACKNOWLEDGMENTS |
|---|
We are grateful to Doug Julin, Ichizo Kobayashi, Richard Kolodner, Sidney Kushner, Sue Lovett, Gerry Smith, Frank Stahl, and Gerard Venema for bacterial strains and plasmids. Elena Kouzminova, David Schlesinger, and two anonymous reviewers offered helpful comments on the manuscript. This work was supported by grant MCB-0196020 from the National Science Foundation.
Manuscript received November 8, 2002; Accepted for publication January 6, 2003.
| LITERATURE CITED |
|---|
AMUNDSEN, S. K., A. F. TAYLOR, A. M. CHAUDHURY, and G. R. SMITH, 1986 recD: the gene for an essential third subunit of exonuclease V. Proc. Natl. Acad. Sci. USA 83:5558-5562.
AMUNDSEN, S. K., A. F. TAYLOR, and G. R. SMITH, 2000 The RecD subunit of the Escherichia coli RecBCD enzyme inhibits RecA loading, homologous recombination, and DNA repair. Proc. Natl. Acad. Sci. USA 97:7399-7404.
ANDERSON, D. G. and S. C. KOWALCZYKOWSKI, 1997 The translocating RecBCD enzyme stimulates recombination by directing RecA protein onto ssDNA in a
-regulated manner. Cell 90:77-86.[Medline]
ANDERSON, D. G., J. J. CHURCHILL, and S. C. KOWALCZYKOWSKI, 1997 Chi-activated RecBCD enzyme possesses 5'-3' nucleolytic activity, but RecBC enzyme does not: evidence suggesting that the alteration induced by chi is not simply ejection of the RecD subunit. Genes Cells 2:117-128.[Abstract]
BACHMANN, B. J., 1987 Derivations and genotypes of some mutant derivatives of Escherichia coli K-12, pp. 11901219 in Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology, edited by F. C. NEIDHARDT. American Society for Microbiology, Washington, DC.
BASSETT, C. L. and S. R. KUSHNER, 1984 Exonucleases I, III and V are required for stability of ColE1-related plasmids in Escherichia coli.. J. Bacteriol. 157:661-664.
BIERNE, H., D. VILETTE, S. D. EHRLICH, and B. MICHEL, 1997 Isolation of a dnaE mutation which enhances RecA-independent homologous recombination in the Escherichia coli chromosome. Mol. Microbiol. 24:1225-1234.[Medline]
BRCIC-KOSTIC, K., I. STOJILJKOVIC, E. SALAJ-SMIC, and Z. TRGOVCEVIC, 1992 Overproduction of the RecD polypeptide sensitizes Escherichia coli cells to
-radiation. Mutat. Res. 281:123-127.[Medline]
BREMER, H., and P. P. DENNIS, 1996 Modulation of chemical composition and other parameters of the cell by growth rate, pp. 15531569 in Escherichia coli and Salmonella, edited by F. C. NEIDHARDT. American Society for Microbiology, Washington, DC.
CAPALDO, F. N., G. RAMSEY, and S. D. BARBOUR, 1974 Analysis of the growth of recombination-deficient strains of Escherichia coli K-12. J. Bacteriol. 118:242-249.
CARLSON, K., and E. S. MILLER, 1994 Working with T4, pp. 421426 in Molecular Biology of Bacteriophage T4, edited by J. D. KARAM. American Society for Microbiology, Washington, DC.
CHAMBERS, S. P., S. E. PRIOR, D. A. BARSTOW, and N. P. MINTON, 1988 The pMTL nic- cloning vectors. I. Improved pUC polylinker regions to facilitate the use of sonicated DNA for nucleotide sequencing. Gene 68:139-149.[Medline]
CHAUDHURY, A. M. and G. R. SMITH, 1984 A new class of Escherichia coli recBC mutants: implications for the role of RecBC enzyme in homologous recombination. Proc. Natl. Acad. Sci. USA 81:7850-7854.
CHURCHILL, J. J., D. G. ANDERSON, and S. C. KOWALCZYKOWSKI, 1999 The RecBC enzyme loads RecA protein onto ssDNA asymmetrically and independently of
, resulting in constitutive recombination activation. Genes Dev. 13:901-911.
CLARK, A. J. and A. D. MARGULIES, 1965 Isolation and characterization of recombination-deficient mutants of Escherichia coli K-12. Proc. Natl. Acad. Sci. USA 53:451-459.
CORNET, F., I. MORTIER, J. PATTE, and J.-M. LOUARN, 1994 Plasmid pSC101 harbors a recombination site, psi, which is able to resolve plasmid multimers and to substitute for the analogous chromosomal E. coli site, dif.. J. Bacteriol. 176:3188-3195.
COX, M. M., 2001 Recombinational DNA repair of damaged replication forks in Escherichia coli: questions. Annu. Rev. Genet. 35:53-82.[Medline]
CZONKA, L. N. and A. J. CLARK, 1979 Deletions generated by the transposon Tn10 in the srl-recA region of the Escherichia coli K-12 chromosome. Genetics 93:321-343.
DATSENKO, K. A. and B. L. WANNER, 2000 One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.
ELLIS, H. M., D. YU, T. DITIZIO, and D. L. COURT, 2001 High efficiency mutagenesis, repair and engineering of chromosomal DNA using single-stranded oligonucleotides. Proc. Natl. Acad. Sci. USA 98:6742-6746.
FLORES, M.-J., H. BIERNE, S. D. EHRLICH, and B. MICHEL, 2001 Impairment of lagging strand synthesis triggers the formation of a RuvABC substrate at replication forks. EMBO J. 20:619-629.[Medline]
GREGG, A. V., P. MCGLYNN, R. P. JAKTAJI, and R. G. LLOYD, 2002 Direct rescue of stalled DNA replication forks via the combined action of PriA and RecG helicase activities. Mol. Cell 9:241-251.[Medline]
GROMPONE, G., M. SEIGNEUR, S. D. EHRLICH, and B. MICHEL, 2002 Replication fork reversal in DNA polymerase III mutants of Escherichia coli: a role for the beta clamp. Mol. Microbiol. 44:1331-1339.[Medline]
HASHIMOTO-GOTOH, T., F. C. H. FRANKLIN, A. NORDHEIM, and K. N. TIMMIS, 1981 Specific-purpose plasmid cloning vectors. I. Low copy number, temperature-sensitive, mobilization-defective pSC101-derived containment vectors. Gene 16:227-235.[Medline]
HENDLER, R. W., M. PEREIRA, and R. SCHARFF, 1975 DNA synthesis involving a complexed form of DNA polymerase I in extracts of Escherichia coli.. Proc. Natl. Acad. Sci. USA 72:2099-2103.
HIGGINS, N. P., K. KATO, and B. STRAUSS, 1976 A model for replication repair in mammalian cells. J. Mol. Biol. 101:417-425.[Medline]
HORII, Z.-I. and A. J. CLARK, 1973 Genetic analysis of the RecF pathway of genetic recombination in Escherichia coli K-12: isolation and characterization of mutants. J. Mol. Biol. 80:327-344.[Medline]
HORIUCHI, T. and Y. FUJIMURA, 1995 Recombinational rescue of the stalled DNA replication fork: a model based on analysis of an Escherichia coli strain with a chromosomal region difficult to replicate. J. Bacteriol. 177:783-791.[Abstract]
KOOISTRA, J. and G. VENEMA, 1991 Cloning, sequencing, and expression of Bacillus subtilis genes involved in ATP-dependent nuclease synthesis. J. Bacteriol. 173:3644-3655.
KOOISTRA, J., B. J. HAIJEMA, and G. VENEMA, 1993 The Bacillus subtilis addAB genes are fully functional in Escherichia coli.. Mol. Microbiol. 7:915-923.[Medline]
KORANGY, F. and D. A. JULIN, 1994 Efficiency of ATP hydrolysis and DNA unwinding by the RecBC enzyme from Escherichia coli.. Biochemistry 33:9552-9560.[Medline]
KOWALCZYKOWSKI, S. C., 2000 Initiation of genetic recombination and recombination-dependent replication. Trends Biochem. Sci. 25:156-165.[Medline]
KOWALCZYKOWSKI, S. C., D. A. DIXON, A. K. EGGLESTON, S. D. LAUDER, and W. M. REHRAUER, 1994 Biochemistry of homologous recombination in Escherichia coli.. Microbiol. Rev. 58:401-465.
KUZMINOV, A., 1995 Instability of inhibited replication forks in E. coli.. Bioessays 17:733-741.[Medline]
KUZMINOV, A., 1996 Recombinational Repair of DNA Damage. R. G. Landes, Austin, TX.
KUZMINOV, A., 1999 Recombinational repair of DNA damage in Escherichia coli and bacteriophage
. Microbiol. Mol. Biol. Rev. 63:751-813.
KUZMINOV, A., 2001 DNA replication meets genetic exchange: chromosomal damage and its repair by homologous recombination. Proc. Natl. Acad. Sci. USA 98:8461-8468.
KUZMINOV, A. and F. W. STAHL, 1997 Stability of linear DNA in recA mutant Escherichia coli cells reflects ongoing chromosomal DNA degradation. J. Bacteriol. 179:880-888.
LLOYD, R. G., M. C. PORTON, and C. BUCKMAN, 1988 Effect of recF, recJ, recN, recO and ruv mutations on ultraviolet survival and genetic recombination in a recD strain of Escherichia coli K12. Mol. Gen. Genet. 212:317-324.[Medline]
LOUARN, J.-M., J. LOUARN, V. FRANÇOIS, and J. PATTE, 1991 Analysis and possible role of hyperrecombination in the termination region of the Escherichia coli chromosome. J. Bacteriol. 173:5097-5104.
LOVETT, S. T. and A. J. CLARK, 1984 Genetic analysis of the recJ gene of Escherichia coli K-12. J. Bacteriol. 157:190-196.
LOVETT, S. T., C. LUISI-DELUCA, and R. D. KOLODNER, 1988 The genetic dependence of recombination in recD mutants of Escherichia coli.. Genetics 120:37-45.
LOVETT, S. T., P. T. DRAPKIN, V. A. SUTERA, and T. J. GLUCKMAN-PESKIND, 1993 A sister-strand exchange mechanism for recA-independent deletion of repeated DNA sequences in Escherichia coli.. Genetics 135:631-642.[Abstract]
MANEN, D. and L. CARO, 1991 The replication of plasmid pSC101. Mol. Microbiol. 5:233-237.[Medline]
MARINUS, M. G. and N. R. MORRIS, 1975 Pleiotropic effects of a DNA adenine methylation mutation (dam-3) in Escherichia coli K12. Mutat. Res. 28:15-26.[Medline]
MASTERSON, C., P. E. BOEHMER, F. MCDONALD, S. CHAUDHURY, and I. D. HICKSON et al., 1992 Reconstitution of the activities of the RecBCD holoenzyme of Escherichia coli from the purified subunits. J. Biol. Chem. 267:13564-13572.
MCGLYNN, P., A. A. AL-DEIB, J. LIU, K. J. MARIANS, and R. G. LLOYD, 1997 The DNA replication protein PriA and the recombination protein RecG bind D-loops. J. Mol. Biol. 270:212-221.[Medline]
MCGLYNN, P., R. G. LLOYD, and K. J. MARIANS, 2001 Formation of Holliday junctions by regression of stalled replication forks: RecG stimulates fork regression even when the DNA is negatively supercoiled. Proc. Natl. Acad. Sci. USA 98:8235-8240.
MICHEL, B., S. D. EHRLICH, and M. UZEST, 1997 DNA double-strand breaks caused by replication arrest. EMBO J. 16:430-438.[Medline]
MONK, M. and J. KINROSS, 1972 Conditional lethality of recA and recB derivatives of a strain of Escherichia coli K-12 with a temperature-sensitive deoxyribonucleic acid polymerase I. J. Bacteriol. 109:971-978.
MORGAN, A. R. and A. SEVERINI, 1990 Interconversion of replication and recombination structures: implications for terminal repeats and concatemers. J. Theor. Biol. 144:195-202.[Medline]
MORSE, L. S., L. A. BECK, and C. PAULING, 1976 Effect of chloramphenicol and the recB gene product on DNA metabolism in Escherichia coli K12 strains defective in DNA ligase. Mol. Gen. Genet. 147:79-82.[Medline]
PALAS, K. M. and S. R. KUSHNER, 1990 Biochemical and physical characterization of exonuclease V from Escherichia coli. Comparison of the catalytic activities of the RecBC and RecBCD enzymes. J. Biol. Chem. 265:3447-3454.
PONTICELLI, A. S., D. W. SCHULTZ, A. F. TAYLOR, and G. R. SMITH, 1985 Chi-dependent DNA strand cleavage by RecBC enzyme. Cell 41:145-151.[Medline]
RINKEN, R., B. THOMS, and W. WACKERNAGEL, 1992 Evidence that recBC-dependent degradation of duplex DNA in Escherichia coli recD mutants involves DNA unwinding. J. Bacteriol. 174:5424-5429.
ROMAN, L. and S. C. KOWALCZYKOWSKI, 1989 Characterization of the helicase activity of the Escherichia coli RecBCD enzyme using a novel helicase assay. Biochemistry 28:2863-2873.[Medline]
SCUDIERO, D. and B. STRAUSS, 1974 Accumulation of single-stranded regions in DNA and the block to replication in a human cell line alkylated with methyl methane sulfonate. J. Mol. Biol. 83:17-34.[Medline]
SEIGNEUR, M., V. BIDNENKO, S. D. EHRLICH, and B. MICHEL, 1998 RuvAB acts at arrested replication forks. Cell 95:419-430.[Medline]
SILVERSTEIN, J. L. and E. B. GOLDBERG, 1976 T4 DNA injection. II. Protection of entering DNA from host exonuclease V. Virology 72:212-223.[Medline]
SMITH, G. R., 2001 Homologous recombination near and far from DNA breaks: alternative roles and contrasting views. Annu. Rev. Genet. 35:243-274.[Medline]
SOGO, J. M., M. LOPES, and M. FOIANI, 2002 Fork reversal and ssDNA accumulation at stalled replication forks owing to checkpoint defects. Science 297:599-602.
SYVAOJA, J. E., 1987 ATP-stimulated polymerase activity involving DNA polymerase I and a recB-dependent factor in extracts of Escherichia coli cells. Acta Chem. Scand. 41:332-335.
TAYLOR, A. F., 1988 RecBCD enzyme of Escherichia coli, pp. 231263 in Genetic Recombination, edited by R. KUCHERLAPATI and G. R. SMITH. American Society for Microbiology, Washington, DC.
TELANDER-MUSKAVITCH, K. M., and S. LINN, 1981 RecBC-like enzymes: exonuclease V deoxyribonucleases, pp. 234250 in The Enzymes, edited by P. D. BOYER. Academic Press, New York.
THOMS, B. and W. WACKERNAGEL, 1998 Interaction of RecBCD enzyme with DNA at double-strand breaks produced in UV-irradiated Escherichia coli: requirements for DNA end processing. J. Bacteriol. 180:5639-5645.
UHLIN, B. E. and A. J. CLARK, 1981 Overproduction of the Escherichia coli RecA protein without stimulation of its proteolytic activity. J. Bacteriol. 148:386-390.
UZEST, M., S. D. EHRLICH, and B. MICHEL, 1995 Lethality of rep recB and rep recC double mutants of Escherichia coli.. Mol. Microbiol. 17:1177-1188.[Medline]
VISWANATHAN, M. and S. T. LOVETT, 1998 Single-strand DNA-specific exonucleases in Escherichia coli: roles in repair and mutation avoidance. Genetics 149:7-16.
WACKERNAGEL, W., and C. M. RADDING, 1974 Transformation and transduction of Escherichia coli: the nature of recombinants formed by Rec, RecF, and
Red, pp. 111122 in Mechanisms in Recombination, edited by R. F. GRELL. Plenum Press, New York.
WANG, J. C., R. CHEN, and D. A. JULIN, 2000 A single nuclease active site of the Escherichia coli RecBCD enzyme catalyzes single-stranded DNA degradation in both directions. J. Biol. Chem. 275:507-513.
WANG, R. F. and S. R. KUSHNER, 1991 Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli.. Gene 100:195-199.[Medline]
WANG, T.-C. V. and K. C. SMITH, 1983 Mechanisms for recF-dependent and recB-dependent pathways of postreplication repair in UV-irradiated Escherichia coli uvrB.. J. Bacteriol. 156:1093-1098.
WANG, T.-C. V. and K. C. SMITH, 1986 Postreplicational formation and repair of DNA double-strand breaks in UV-irradiated Escherichia coli uvrB cells. Mutat. Res. 165:39-44.[Medline]
WEISBERG, R. A., and N. STERNBERG, 1974 Transduction of recB- host is promoted by
red+ function, pp. 107109 in Mechanisms in Recombination, edited by R. F. GRELL. Plenum Press, New York.
WHITBY, M. C. and R. G. LLOYD, 1998 Targeting Holliday junctions by the RecG branch migration protein of Escherichia coli.. J. Biol. Chem. 273:19729-19739.
WILLETTS, N. S. and A. J. CLARK, 1969 Characteristics of some multiply recombination-deficient strains of Escherichia coli.. J. Bacteriol. 100:231-239.
WILLETTS, N. S. and D. W. MOUNT, 1969 Genetic analysis of recombination-deficient mutants of Escherichia coli K-12 carrying rec mutations cotransducible with thyA.. J. Bacteriol. 100:923-934.
YU, M., J. SOUAYA, and D. A. JULIN, 1998a The 30-kDa C-terminal domain of the RecB protein is critical for the nuclease activity, but not the helicase activity, of the RecBCD enzyme from Escherichia coli.. Proc. Natl. Acad. Sci. USA 95:981-986.
YU, M., J. SOUAYA, and D. A. JULIN, 1998b Identification of the nuclease active site in the multifunctional RecBCD enzyme by creation of a chimeric enzyme. J. Mol. Biol. 283:797-808.[Medline]
ZIEG, J. and S. R. KUSHNER, 1977 Analysis of genetic recombination between two partially deleted lactose operons of Escherichia coli K12. J. Bacteriol. 131:123-132.
This article has been cited by other articles:
![]() |
K. Zahradka, M. Buljubasic, M. Petranovic, and D. Zahradka Roles of ExoI and SbcCD Nucleases in "Reckless" DNA Degradation in recA Mutants of Escherichia coli J. Bacteriol., March 1, 2009; 191(5): 1677 - 1687. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Dillingham and S. C. Kowalczykowski RecBCD Enzyme and the Repair of Double-Stranded DNA Breaks Microbiol. Mol. Biol. Rev., December 1, 2008; 72(4): 642 - 671. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Thoms, I. Borchers, and W. Wackernagel Effects of Single-Strand DNases ExoI, RecJ, ExoVII, and SbcCD on Homologous Recombination of recBCD+ Strains of Escherichia coli and Roles of SbcB15 and XonA2 ExoI Mutant Enzymes J. Bacteriol., January 1, 2008; 190(1): 179 - 192. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Rotman and A. Kuzminov The mutT Defect Does Not Elevate Chromosomal Fragmentation in Escherichia coli Because of the Surprisingly Low Levels of MutM/MutY-Recognized DNA Modifications J. Bacteriol., October 1, 2007; 189(19): 6976 - 6988. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Guarino, I. Salguero, A. Jimenez-Sanchez, and E. C. Guzman Double-Strand Break Generation under Deoxyribonucleotide Starvation in Escherichia coli J. Bacteriol., August 1, 2007; 189(15): 5782 - 5786. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Kickstein, K. Harms, and W. Wackernagel Deletions of recBCD or recD influence genetic transformation differently and are lethal together with a recJ deletion in Acinetobacter baylyi Microbiology, July 1, 2007; 153(7): 2259 - 2270. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Su, B. B. Stephens, G. Alexandre, and S. K. Farrand Lon protease of the {alpha}-proteobacterium Agrobacterium tumefaciens is required for normal growth, cellular morphology and full virulence. Microbiology, April 1, 2006; 152(Pt 4): 1197 - 1207. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Thermic Functions of Multiple Exonucleases Are Essential for Cell Viability, DNA Repair and Homologous Recombination in recD Mutants of Escherichia coli Genetics, April 1, 2006; 172(4): 2057 - 2069. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Regha, A. K. Satapathy, and M. K. Ray RecD Plays an Essential Function During Growth at Low Temperature in the Antarctic Bacterium Pseudomonas syringae Lz4W Genetics, August 1, 2005; 170(4): 1473 - 1484. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Y. Shi, J. Stansbury, and A. Kuzminov A Defect in the Acetyl Coenzyme A{leftrightarrow}Acetate Pathway Poisons Recombinational Repair-Deficient Mutants of Escherichia coli J. Bacteriol., February 15, 2005; 187(4): 1266 - 1275. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zuniga-Castillo, D. Romero, and J. M. Martinez-Salazar The Recombination Genes addAB Are Not Restricted to Gram-Positive Bacteria: Genetic Analysis of the Recombination Initiation Enzymes RecF and AddAB in Rhizobium etli J. Bacteriol., December 1, 2004; 186(23): 7905 - 7913. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Kouzminova, E. Rotman, L. Macomber, J. Zhang, and A. Kuzminov RecA-dependent mutants in Escherichia coli reveal strategies to avoid chromosomal fragmentation PNAS, November 16, 2004; 101(46): 16262 - 16267. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Harinarayanan and J. Gowrishankar A dnaC Mutation in Escherichia coli That Affects Copy Number of ColE1-Like Plasmids and the PriA-PriB (but Not Rep-PriC) Pathway of Chromosomal Replication Restart Genetics, March 1, 2004; 166(3): 1165 - 1176. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Miranda, A.
- Articles by Kuzminov, A.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Miranda, A.
- Articles by Kuzminov, A.



























