Genetics, Vol. 163, 895-904, March 2003, Copyright © 2003

Multiple Translational Control Sequences in the 5' Leader of the Chloroplast psbC mRNA Interact With Nuclear Gene Products in Chlamydomonas reinhardtii

William Zergesa, Andrea H. Auchincloss1,b, and Jean-David Rochaixb
a Biology Department, Concordia University, Montreal, Quebec H3G 1M8, Canada
b Departments of Molecular Biology and Plant Biology, University of Geneva, CH 1211, Geneva 4, Switzerland

Corresponding author: Jean-David Rochaix, University of Geneva, 30 Quai Ernest-Ansermet, CH 1211, Geneva 4, Switzerland., jean-david.rochaix{at}molbio.unige.ch (E-mail)

Communicating editor: V. L. CHANDLER


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Translation of the chloroplast psbC mRNA in the unicellular eukaryotic alga Chlamydomonas reinhardtii is controlled by interactions between its 547-base 5' untranslated region and the products of the nuclear loci TBC1, TBC2, and possibly TBC3. In this study, a series of site-directed mutations in this region was generated and the ability of these constructs to drive expression of a reporter gene was assayed in chloroplast transformants that are wild type or mutant at these nuclear loci. Two regions located in the middle of the 5' leader and near the initiation codon are important for translation. Other deletions still allow for partial expression of the reporter gene in the wild-type background. Regions with target sites for TBC1 and TBC2 were identified by estimating the residual translation activity in the respective mutant backgrounds. TBC1 targets include mostly the central part of the leader and the translation initiation region whereas the only detected TBC2 targets are in the 3' part. The 5'-most 93 nt of the leader are required for wild-type levels of transcription and/or mRNA stabilization. The results indicate that TBC1 and TBC2 function independently and further support the possibility that TBC1 acts together with TBC3.


PLASTIDS of plants and eukaryotic algae maintain and express the genomes they inherited from their endosymbiont bacterial ancestor(s). The translational machinery of plastids has many components in common with eubacterial translational systems, e.g., 5S, 16S, 23S rRNAs, tRNAs, initiation factors, elongation factor EF-1A (EF-Tu), and ribosomal proteins (HARRIS et al. 1994 Down; SUGIURA et al. 1998 Down). In most cases examined in Chlamydomonas reinhardtii, the Shine-Dalgarno (SD) sequence, which recruits the small ribosomal subunit to the initiation codon of bacterial mRNAs by base pairing with the 3' end of the 16S rRNA, is not required for translation in plastids (STERN et al. 1997 Down; FARGO et al. 1998 Down; ZERGES 2000 Down; see DISCUSSION). Translation of plastid mRNAs occurs in the absence of the 5' met 7G cap structures and 3' poly(A) tails used by cytoplasmic mRNAs to direct the small ribosomal subunit to their AUG initiation codons. Moreover, some similarities between translation in plastids and eukaryotic nuclear cytosolic systems have been found, including stimulatory effects of 3' mRNA termini (ROTT et al. 1998 Down) and a possible role of a poly (A)-binding protein (reviewed by DANON 1997 Down; ZERGES 2000 Down).

The importance of translational control sequences within the 5' leaders of many chloroplast mRNAs has been revealed by fusing them to reporter genes and by their ability to confer translational regulation of the reporter by environmental factors such as light (STAUB and MALIGA 1993 Down) or trans-acting factors (NICKELSEN et al. 1994 Down; ZERGES and ROCHAIX 1994 Down; STAMPACCHIA et al. 1997 Down; ZERGES et al. 1997 Down). For a few plastid mRNAs of C. reinhardtii, cis-acting translational control sequences have been identified within 5' leaders by site-directed and random mutations (reviewed by DANON 1997 Down; STERN et al. 1997 Down; BRUICK and MAYFIELD 1999 Down; NICKELSEN et al. 1999 Down; ZERGES 2000 Down). Some appear to function as unstructured RNA, while others have secondary and tertiary structural features, which appear to be important (ROCHAIX et al. 1989 Down; MAYFIELD et al. 1994 Down; HIGGS et al. 1999 Down). Many cis-acting sequences could interact with protein factors, as determined by in vitro RNA-protein-binding assays (ZERGES and ROCHAIX 1994 Down), genetic experiments (YOHN et al. 1996 Down, YOHN et al. 1998 Down), and in vivo footprinting with dimethyl sulfate (HIGGS et al. 1999 Down). Unlike most known eubacterial translational control elements, which are repressive and situated close to the translation initiation codon (GOLD 1988 Down), the characterized chloroplast elements have positive roles in translation and many are distant from the translation initiation codon in the 5' leader (MAYFIELD et al. 1994 Down; SAKAMOTO et al. 1994 Down; ZERGES et al. 1997 Down; reviewed by DANON 1997 Down; STERN et al. 1997 Down; BRUICK and MAYFIELD 1999 Down; ZERGES 2000 Down).

Translation of the psbC mRNA in the chloroplast of the unicellular eukaryotic alga C. reinhardtii is controlled by interactions between its 547-nucleotide (nt) 5' leader and the products of the nuclear loci TBC1, TBC2, and TBC3. (psbC encodes the 51-kD chlorophyll-binding PSII reaction center subunit P6, the homolog of the CP43 protein in vascular plants.) The region of the psbC 5' leader between positions 222 and 320 is required for translation initiation (ZERGES et al. 1997 Down). (The 5' end of the mRNA is +1.) This central region has the potential to form a stable stem-loop secondary structure (see Fig 1; ROCHAIX et al. 1989 Down). Two bulges in the stem, caused by two sites of noncomplementarity between the strands, are essential for translation because a mutation that eliminates them, psbC-FuD34 (Fig 1), completely abolishes translation of the mRNA (ROCHAIX et al. 1989 Down; ZERGES et al. 1997 Down). A point mutation at position 227 within this region (Fig 1, psbC-F34suI) partially reverses the translation block caused by the TBC1 mutation, but not that caused by a TBC2 mutation. Thus, this position is critical for the trans-acting role of TBC1 (ROCHAIX et al. 1989 Down; ZERGES and ROCHAIX 1994 Down).



View larger version (59K):
In this window
In a new window
Download PPT slide
 
Figure 1. Identification of functional regions within the psbC 5' leader. The sequence of the 547-nt psbC 5' leader (ROCHAIX et al. 1989 Down) is shown with the relevant regions indicated as follows. Horizontal arrows indicate the complementary sequences that result from two inverted repeats in the DNA from which the 5' leader is transcribed. Regions that are partially required for translation are indicated with striped boxes (27–222) and open boxes (321–378). The regions that are important for translation are indicated with a shaded box: 223–320 and 519–532. "TBC1" and "TBC3" indicate the target regions of the factors that are encoded or controlled by these loci. The region that is dispensable for translation and partially required for the interactions with TBC1 and TBC2 is indicated by a box with a dashed border and is underlined. The GUG initiation codon is in boldface type. The SD-like sequence (GGAGG) is indicated as "SD." The mutations psbC-FuD34 and psbC-F34suI are indicated.

A dominant nuclear suppressor mutation partially reverses the translational blocks caused by mutations of this central region (psbC-FuD34 and a deletion of this region) and tbc1-F34. This suppressor mutation has a weak phenotype on its own and induces a twofold decrease in the rate of synthesis and in the accumulation of P6 (ZERGES et al. 1997 Down). Thus, this suppressor mutation identifies a third nuclear locus, TBC3, which could be involved in the initiation of translation of psbC mRNA, possibly through other factors. Like the cis-acting suppressor mutation psbC-F34suI, the tbc3-rb1 suppressor mutation does not reverse the translational block caused by a mutation in TBC2, tbc2-F64 (ZERGES et al. 1997 Down). Our current model is described in the DISCUSSION.

While TBC1 and TBC3 have not yet been characterized at the molecular and biochemical levels, the TBC2 coding sequence predicts a protein of 1115 residues with nine copies of a novel degenerate 39-amino-acid repeat with a quasi-conserved PPPEW motif near its C-terminal end (AUCHINCLOSS et al. 2002 Down). The central region of the protein displays partial amino acid sequence identity with Crp1, a protein in Zea mays that is implicated in the processing and translation of the chloroplast petA and petD mRNAs. The Tbc2 protein cofractionates with chloroplast stroma, is associated with a 400-kD protein complex, and has been proposed to play a role in the specific translation of the psbC mRNA.

In this study, the psbC 5' leader was dissected for sequences that control translation and interact, directly or indirectly, with the TBC1, TBC2, and TBC3 gene products. We have generated mutant and hybrid psbC 5' leaders and examined their ability to mediate a response to the products of the nuclear genes TBC1, TBC2, and possibly TBC3.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Construction of psbC 5' leader deletions:
To construct the mutant 5' leaders shown in Fig 2A, DNA fragments that flank the deletions were generated as two series. In one series fragments extend from position -68 bp [with respect to the site corresponding to the 5' terminus of mature psbC mRNA (ROCHAIX et al. 1989 Down)] to various positions within the 5' leader (93, 167, 222, 320, 391, 467, 519, and 532; see Fig 1 and Fig 2A). In the second series, DNA fragments extend from the GUG initiation codon in an upstream direction to various endpoints within the 5' leader (positions 484, 475, 408, 379, 321, 223, 168, 95, 27, and 3; see Fig 1 and Fig 2A). To generate many of these 5' leader subfragments, two series of deletions were generated with ExoIII. First, a fragment of the psbC 5' flanking and 5' leader sequences (between positions -68 and +550, the third base of the GUG initiation codon), which had been generated by PCR and cloned in a previous study (ZERGES and ROCHAIX 1994 Down), was excised by digestion with ClaI and BamHI, rendered blunt at its ends, and cloned into the HincII site of the pBluescribe vectors pBS+ and pBS- (Stratagene, La Jolla, CA). Each recombinant plasmid was digested with BamHI and KpnI, which cleave adjacent to and on the same side of the insert, for the pBS+ at the distal side and for the pBS- clone at the proximal side, i.e., near the GUG initiation codon. Short treatments (30–90 sec) with ExoIII and S1 nuclease (at 30°) followed by intramolecular ligation (GUO and WU 1983 Down; SAMBROOK and RUSSELL 2001 Down) generated a series of plasmids with varying amounts of sequences deleted from one end of the 5' leader or the other. Deletion endpoints were determined by DNA sequencing (SAMBROOK and RUSSELL 2001 Down). Various combinations of these partial 5' leaders were combined by ligating HindIII (rendered blunt)-SacI fragments with 5' flanking and distal 5' leader regions into plasmids with the proximal 5' leader sequences digested with SacI and HindIII (rendered blunt). Other endpoints were generated by PCR, cloned, sequenced to verify that no errors had occurred during PCR (SAMBROOK and RUSSELL 2001 Down), and used to generate 5' leader deletion mutants in similar cloning steps to create the set of deletion-mutant 5' leaders shown in Fig 2A. Mutagenesis of the SD-like sequence was performed by PCR with an oligonucleotide that hybridizes 67–81 nt upstream from the 5' end of the transcription unit and a mutagenic oligonucleotide (5' CCATGGACACTTTGCATTAGGAGGGTACAAATTATTTTGATT 3'), which hybridizes to sequences from 516 to 551 (Fig 1) and introduces a CCTCC in place of the SD-like sequence, GGAGG.



View larger version (39K):
In this window
In a new window
Download PPT slide
 
Figure 2. Analyses of the effects of psbC 5' leader deletions on spc resistance conferred by chimeric psbC-aadA-rbcL reporter genes. (A) The predicted stem-loop structure (diamond-shaped) and the target regions of TBC1, TBC2, and TBC3 are indicated at the top. The psbC 5' leader is shown with the series of deletion mutants. (B) Levels of spc resistance are given for strains that are wild type (wt) or mutant (m) for TBC1, TBC2, or TBC3. n.d., not determined. RNA levels are indicated by + (wild-type level), +/- (low), and - (undetectable).

The resulting fragments with the 5' flanking region and mutant 5' leaders were excised from their plasmid vector by digestion with ClaI and NcoI. The corresponding restriction sites were present within the 5' and 3' oligonucleotides. They were ligated to similarly digested cg20-atpB-INT, a chloroplast transformation vector containing the aadA coding sequence translationally fused within the NcoI site. Fused to the 3' end of aadA are the 3' untranslated region (UTR) and 3' flanking sequence of the chloroplast rbcL gene, which serves to generate processed transcripts of uniform length (GOLDSCHMIDT-CLERMONT 1991 Down).

To generate the hybrid psbC-atpA 5' leader, PCR was used to amplify a DNA fragment with the oligonucleotide that hybridizes 67–81 nt upstream of the 5' end and an oligonucleotide that hybridizes immediately 5' to the SD-like element of psbC. This fragment was cloned into a plasmid vector and sequenced to exclude mutations introduced during PCR. This fragment was excised by digestion at the ClaI and XhoI sites introduced at its 5' and 3' extremities, respectively, and ligated into similarly digested p-atpB-INT, a plasmid containing a chimeric gene with the atpA 5' leader translationally fused to aadA, containing the rbcL 3' untranslated region and flanking sequences (GOLDSCHMIDT-CLERMONT 1991 Down). Digestion of this plasmid with ClaI and XhoI excises most of the atpA 5' flanking region and 5' leader, but not the proximal 57 nt and ATG initiation codon (Fig 4; DRON et al. 1982 Down; LEU et al. 1992 Down). This resulted in a fusion of the distal 533 nt of the psbC 5' leader, up to but not including the SD-like sequence, to the proximal 57 nt of the atpA 5' leader, translationally fused to the aadA coding sequence.



View larger version (80K):
In this window
In a new window
Download PPT slide
 
Figure 3. RNA-gel blot analysis of the psbC-aadA-rbcL chimeric mRNAs. Total RNA isolated from homoplasmic transformants was fractionated by agarose gel electrophoresis, blotted, and hybridized with a probe corresponding to the aadA coding sequence to detect the psbC-aadA-rbcL chimeric mRNA (indicated by an arrowhead). To control for the amounts of RNA loaded in each lane, the filter was hybridized with a RbcS2 probe.



View larger version (27K):
In this window
In a new window
Download PPT slide
 
Figure 4. Analysis of chimeric psbC-atpA 5' leaders. (A) Maps show the 5' leaders of the chimeric genes psbC-aadA-rbcL, psbC-atpA-aadA-rbcL, and atpA-aadA-rbcL. The initiation codons are indicated. The psbC-atpA 5' leader consists of the 533 5'-terminal nt of the psbC 5' leader and the 57 3'-terminal nt of the atpA 5' leader (indicated by a shaded box). It is followed by the 75 5'-terminal nt of the atpA coding sequence, which had been fused to aadA (GOLDSCHMIDT-CLERMONT 1991 Down). (B) spc resistance levels conferred by the chimeric genes in strains with nuclear backgrounds that are wild type or mutant for TBC1 or TBC2. (C) RNA-gel blot analysis of the chimeric mRNAs of A in the wild-type, TBC1, and TBC2 mutant background. The filter was hybridized with a probe specific for the psbC coding region (which is not present in the reporter gene) to control for the amount of total RNA in each lane. The lower RNA band observed in lanes 1–4 is due to some unknown processing event and has been observed previously (GOLDSCHMIDT-CLERMONT 1991 Down).

These chloroplast transformation vectors have the atpB gene as a marker to select for rescue of the photosynthesis deficiency of FuD50, a mutant with a deletion of the 3' portion of this chloroplast gene (WOESSNER et al. 1986 Down; GOLDSCHMIDT-CLERMONT 1991 Down). Thus, following delivery of the DNA into the chloroplast by a biolistic particle gun (ZUMBRUNN et al. 1989 Down), stable insertions of the reporter and marker genes by homologous recombination can be selected on "minimal" medium, which requires photosynthesis for growth. Homoplasmic transformants (strains with all copies of the multicopy chloroplast genome transformed) were selected on minimal medium and identified by genomic Southern blot analysis as described previously (ZERGES and ROCHAIX 1994 Down).

Culture conditions and genetic analyses:
Strains were grown in Tris/acetate/phosphate medium (GORMAN and LEVINE 1965 Down). Cultures were grown under a light intensity of 100–150 µE/m2/sec. Induction of gametes, crosses, maturation of zygotes, and tetrad dissections were carried out as described previously (GOLDSCHMIDT-CLERMONT et al. 1990 Down). Mutant strains carried tbc1-F34, tbc2-F64, or tbc3-rb1 (ROCHAIX et al. 1989 Down; ZERGES and ROCHAIX 1994 Down; ZERGES et al. 1997 Down). Growth tests were performed by spotting 10 µl of each culture (103 cells) on media solidified with agar (Difco) and varying concentrations of spectinomycin [spc (Sigma, St. Louis); corrected for its partial purity] in petri plates and observed for growth and photographed after 5–7 days of incubation at 24° under dim light. Growth is defined as the appearance of an even distribution of cells throughout the circular area that received the inoculated cells. Cell growth was equal to that observed for cells grown in the absence of spectinomycin. Papillary growth occurring over longer periods was excluded and considered as nongrowth. To distinguish wild-type and mutant progeny for TBC3, mt- progeny were testcrossed to FuD34 (mt+) and their progeny were tested for phototrophic growth on minimal medium.

RNA-gel blot analyses:
Samples (10 µg) of total RNA prepared with Tri-reagent (Sigma) were electrophoresed through a 1% agarose gel (containing formaldehyde), transferred to Hybond-C+ membrane (Amersham, Buckinghamshire, UK), and probed with double-stranded DNA probes, which had been labeled with random primers using [{alpha}-32P]dATP (SAMBROOK and RUSSELL 2001 Down). The aadA probe was a 0.81-kb NcoI-PstI cloned DNA fragment corresponding to the aadA structural gene (GOLDSCHMIDT-CLERMONT 1991 Down). The relative amounts of the RNA in the samples were standardized by probing the blots with either 32P-labeled DNA fragments derived from psbC [0.95-kb HindIII fragment from the chloroplast DNA fragment R9 (ROCHAIX 1978 Down)] or a PstI cDNA fragment from the nuclear rbcS2 gene (GOLDSCHMIDT-CLERMONT and RAHIRE 1986 Down).


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

To identify regions of the 547-nt psbC 5' leader that promote translation and control it through interactions with the products of TBC1, TBC2i, and TBC3, a series of mutant 5' leaders was generated (Fig 2A). Each was fused to the aadA reporter gene, which was linked previously to the 3' UTR of the chloroplast rbcL gene (ZERGES and ROCHAIX 1994 Down). The resulting chimeric psbC-aadA-rbcL reporter genes were introduced into the chloroplast genome by biolistic transformation (see MATERIALS AND METHODS).

We decided to use aadA as a reporter for this study because detection of P6 synthesis by in vivo pulse labeling does not provide a very sensitive assay as the signal drops below background levels when the rate of synthesis of P6 is <20–30% of the wild-type level. In contrast, spc resistance conferred by aadA provides a highly sensitive assay. We acknowledge that the lack of a calibration curve between spectinomycin resistance and aadA expression at low resistance levels makes some of our measurements qualitative. Nevertheless, the results described below demonstrate clear and reproducible differences in spc resistance levels between wild-type and mutant nuclear backgrounds, which reveal differences in requirements for 5' UTR sequences for the interactions with the three nucleus-encoded functions.

To distinguish translational effects from effects on earlier steps of gene expression, it was necessary to determine the level of accumulation and the size of each chimeric mRNA expressed in the chloroplast of the transformants. As seen in Fig 3, RNA-gel blot analyses revealed that the deletions alter the electrophoretic mobility of the chimeric mRNAs consistent with the lengths of the deleted regions. Deletions of sequences between positions 95 and 532 do not significantly reduce the steady-state levels of the chimeric mRNAs (Fig 3). However, reduced mRNA levels were detected from the chimeric genes with deletions {Delta}3–222 and, to a lesser extent, {Delta}27–93 (Fig 3). Thus, sequences within the 5'-most 93 nt of the 5' leader are required for transcription, 5' end processing (ROCHAIX 1996 Down), and/or mRNA stabilization (NICKELSEN 1998 Down). It appears that the mRNA with the {Delta}27–93 deletion is partially active in translation because aadA expression was detected (Fig 2). Replacement of the SD-like sequence (GGAGG, positions 535–539) in some experiments was observed to moderately increase the level of the mRNA (Fig 3), while in other trials no increase was observed (data not shown).

Two regions of the psbC 5' leader are required for translation and are separated by a dispensable region:
To identify regions of the psbC 5' leader that control translation from its initiation codon, the level of aadA reporter gene expression was determined by assaying the degree of spc resistance of at least five transformants for each chimeric reporter gene. Spc resistance is a measure of aadA expression because it correlates with levels of the streptomycin/spectinomycin adenyltransferase protein and its activity (ZERGES et al. 1997 Down; FARGO et al. 1998 Down, FARGO et al. 1999 Down, FARGO et al. 2001 Down). [Our antiserum against this protein (ZERGES and ROCHAIX 1994 Down) lost its specificity during storage and could not be used.] Growth was assayed in the presence of spc at concentrations of 50, 100, 250, 500, 750, and 1000 µg/ml. Strains resistant to 1000 µg/ml spc were tested for growth in the presence of 1500, 2000, 3000, 4000, 5000, and 6000 µg/ml spc. The maximum spc concentration to which each chimeric reporter gene conferred resistance is shown in the first column of Fig 2B. For example, the chimeric gene with the wild-type psbC 5' leader confers resistance to 5000 µg/ml spc, but not to 6000 µg/ml. Mutations that alter spc resistance without producing a corresponding change in the steady-state level of the chimeric mRNA should affect translation from the psbC 5' leader.

Translational effects were observed for most mutations. Deletions affecting sequences 3' to position 95 do not drastically alter the level of the mRNA and vary in their ability to promote translation, as revealed by the variable levels of spc resistance that they confer. For example, deletions of sequences located between positions 379 and 519 ({Delta}379–519, {Delta}408–519, {Delta}475–519) do not dramatically alter the level of spc resistance and, therefore, the level of translation of the aadA reporter gene; transformants expressing these chimeric mRNAs are resistant to spc concentrations between 1000 and 3000 µg/ml (Fig 2B, column 1). Thus, sequences in the 379–519 region are only weakly required for translation (Fig 2).

In contrast, two regions are required for translation. The larger is located between positions 95 and 378 and appears to contain distinct elements, which are required to varying degrees. For example, deletions affecting sequences between positions 95 and 222 ({Delta}95–222, {Delta}95–167, and {Delta}168–222) drastically lower the level of spc resistance to 50 µg/ml, relative to the chimeric mRNA with the wild-type 5' leader (Fig 2B). The {Delta}27–93 deletion results in a reduced level of the chimeric mRNA and confers a level of spc resistance similar to that of {Delta}95–222, {Delta}95–167, and {Delta}168–222, suggesting a less stringent requirement for sequences in the 27–93 interval than in the 95–222 interval. As reported previously, the central region of the psbC 5' leader has the potential to form a stable stem-loop structure (ROCHAIX et al. 1989 Down) and is required for translation (ZERGES et al. 1997 Down). Immediately downstream of this central element are 58 nt that are partially required for translation; deletions removing the bases 321–391 reduce spc resistance (100 µg/ml). The finding that {Delta}379–519 does not significantly reduce spc resistance delimits this partially required region to positions 321–378. The second region required for translation, located between 519 and 532 close to the GUG initiation codon, is defined by two deletions ({Delta}321–532 and {Delta}484–532) that severely reduce spc resistance without affecting the chimeric mRNA levels and deletions ({Delta}379–519, {Delta}408–519, and {Delta}475–519) that still allow for high spc resistance. This required region could extend to the SD-like element (GGAGG, positions 534–538) because its replacement considerably reduces spc resistance (to 100 µg/ml spc, Fig 2B). Translation is probably more drastically reduced because this SD-like sequence replacement was observed in many experiments to augment the level of the mRNA by severalfold (Fig 3).

cis-acting targets of TBC1 and TBC2:
The previous finding that the 5' leader of the psbC mRNA can confer all genetic interactions with mutant alleles of TBC1, TBC2, and TBC3 upon expression of the aadA reporter gene (ZERGES and ROCHAIX 1994 Down; ZERGES et al. 1997 Down) indicates that these nuclear loci either encode or control factors that interact with the psbC 5' leader and are involved in its ability to promote translation from its GUG initiation codon (see Introduction).

To identify regions in the psbC 5' leader that are involved in these interactions, for example, RNA sequences or structures that bind to regulatory factors encoded or controlled by TBC1 or TBC2, we first asked whether the mutant TBC1 and TBC2 alleles alter expression of the aadA reporter gene from the mutant psbC 5' leaders. It was possible to look only at effects on expression from the mutant 5' leaders that give a detectable level of expression in the presence of wild-type TBC1 and TBC2 alleles. We expected that deletion of a target RNA element could result in independence from the wild-type TBC1 or TBC2 functions.

Transformant strains carrying a mutant chimeric reporter gene and wild type for TBC1 and TBC2 were crossed individually to strains carrying mutant alleles for either TBC1 or TBC2. As the resulting progeny are haploid and their endogenous psbC gene is wild type, the wild-type and mutant progeny for the nuclear locus could be distinguished by their ability to grow photoautotrophically (i.e., in a medium that selects for photosynthesis) or not, respectively, and by analyses of their fluorescence transients (BENNOUN and BEAL 1997 Down). Moreover, unlike mutations that abolish photosynthesis, 5' leader mutations that abolish expression of aadA produce no effect on viability in the absence of spc and thus impose no selective pressure for reversion.

The chimeric reporter gene is inherited by >95% of progeny because the chloroplast genome is inherited in a non-Mendelian fashion, predominantly from the mating-type plus (mt+) parent. To confirm the presence of the chimeric gene in the progeny analyzed and to exclude possible effects of the TBC1 or TBC2 mutations on the level of the chimeric mRNAs, total RNA was prepared from three progeny strains (wild type, tbc1 mutant, or tbc2 mutant) and analyzed by RNA-gel blotting. The presence of the psbC-aadA-rbcL mRNA revealed that the chimeric reporter gene was inherited by all progeny tested (data not shown). Although some variations in the levels of certain chimeric mRNAs were observed between different experiments and preparations, none could fully account for the effects of the TBC1 or TBC2 mutations on spc resistance (as described below). Moreover, the mutant alleles of TBC1 or TBC2 were not associated with any reproducible alterations of the electrophoretic mobility of the chimeric mRNAs.

The level of spc resistance was determined for 5–20 progeny strains (from the crosses described above) for the translatable mutant chimeric genes and for either mutant or wild type for TBC1 or TBC2 (Fig 2B). Wild-type progeny for TBC1 and TBC2 showed the same level of spc resistance as their parental strain did, as both carry the same chimeric reporter gene. Differing levels of spc resistance were observed for the PSII-deficient progeny that had inherited a mutant allele of either TBC1 or TBC2 (Fig 2B, columns 2 and 3).

As described above, the deletions that remove sequences between positions 27 and 222 ({Delta}27–93, {Delta}95–222, {Delta}95–167, and {Delta}168–222) strongly diminish translation. Progeny strains that inherited a mutant allele of either TBC1 or TBC2 are sensitive to 50 µg/ml spc (Fig 2B). Thus, that translation from these mutant 5' leaders still requires the wild-type functions of TBC1 and TBC2 indicates that sequences between positions 27 and 222 probably do not contain major cis-acting sequences that are required for the interactions with these nuclear gene products. Similarly, the SD-like sequence (positions 534–538, Fig 1) also does not appear to constitute an essential part of the TBC1 or TBC2 cis-acting targets because the level of spc resistance conferred by the chimeric mRNA without this sequence was abolished by the mutant alleles of TBC1 and TBC2 (Fig 2B).

Because the deletions {Delta}223–320 and {Delta}484–532 abolish translation of the chimeric mRNAs (neither mRNA confers spc resistance), it was not possible to determine whether the Tbc1 and Tbc2 products require these 5' leader sequences to promote translation. However, the previous finding that the point mutation at position 227 (Fig 1) suppresses the mutant phenotype produced by tbc1-F34 (but not by a mutant allele of TBC2) revealed a functional relationship between this site and TBC1 function (ROCHAIX et al. 1989 Down; ZERGES and ROCHAIX 1994 Down).

cis-acting target sequences of TBC1 are located between positions 321 and 519 of the psbC 5' leader:
In addition to this genetic interaction of TBC1 with position 227 of the 5' leader, sequences located 3' to the central region also appear to be involved in the interaction with TBC1. The 5' leader with deletion {Delta}321–391 is exceptional in that the mutant tbc1 allele does not diminish translation further; both wild-type and mutant progeny for TBC1 are resistant to 100 µg/ml spc (Fig 2B). The major TBC1 target within this region appears to be confined between 321 and 378 because {Delta}379–391 drives only a low level of expression in the TBC1 mutant background. The importance of the 321–378 region was observed only for TBC1, as the mutant tbc2 allele further reduces translation of the chimeric mRNA with the {Delta}321–391 deletion: the progeny with the mutant TBC2 allele are sensitive to the lowest spc concentration tested (50 µg/ml; Fig 2B).

The tbc1 and tbc2 mutant alleles showed more complex interactions with chimeric mRNAs with deletions of sequences between positions 379 and 519 ({Delta}379–519, {Delta}408–519, {Delta}475–519). Recall that these deletions only partially lower the level of spc resistance in the presence of wild-type alleles for both TBC1 and TBC2 (Fig 2B, column 1). Expression of aadA from the chimeric mRNAs with these deletions was drastically reduced in the progeny that inherited the mutant allele of either TBC1 or TBC2. But unlike the expression of mRNA bearing the wild-type psbC 5' leader, expression of these mutant mRNAs was not completely abolished by the trans-acting nuclear mutations (Fig 2B, columns 2 and 3). These deletions thus weakly suppress the tbc1 and tbc2 mutations. The observation that translation from mutant 5' leaders with sequences between 379 and 519 deleted is only partially dependent upon the wild-type functions TBC1 and TBC2 suggests that sequences in this region mediate some of the trans-acting effects of these nuclear gene products.

The response to TBC1, but not TBC2, requires the psbC translation initiation region:
It was not possible to determine whether deletion of the psbC translation initiation region (the 14 nt with the SD-like element and initiation codon, Fig 1) affects the dependencies on the wild-type functions of the nuclear loci because it is fundamentally required for translation. Therefore, these sequences were replaced with the 57 3'-terminal nt of the 5' leader of the atpA mRNA and its ATG initiation codon (Fig 4). The psbC-atpA-aadA-rbcL reporter gene was integrated into the C. reinhardtii chloroplast genome, homoplasmic transformant strains were obtained, and they were crossed to mt- strains that carry a mutant allele for either TBC1 or TBC2 (MATERIALS AND METHODS). To control for any effects of the TBC1 and TBC2 mutations on translation from the atpA AUG initiation codon, transformants for an atpA-aadA-rbcL chimeric reporter gene (GOLDSCHMIDT-CLERMONT 1991 Down) were analyzed in parallel.

RNA-gel blot analyses of the mRNAs expressed from both chimeric genes, atpA-aadA-rbcL and psbC-atpA-aadA-rbcL, revealed that these mRNAs accumulate and neither this accumulation nor the molecular weights of the mRNAs are significantly altered by the presence of the mutant alleles of TBC1 or TBC2 in the nuclear background (Fig 4). Tests of spc resistance revealed that translation of the atpA-aadA-rbcL mRNA is independent of the wild-type TBC1 and TBC2 functions: mutant progeny for either loci are as spc resistant as their wild-type siblings (Fig 4). Translation of the psbC-atpA-aadA-rbcL chimeric mRNA was also unaltered by the mutant allele of TBC1: these progeny are nearly as spc resistant as their wild-type siblings. Thus, replacement of the psbC translation initiation region alleviates the requirement for the wild-type TBC1 function. Strains with the psbC-atpA-aadA-rbcL chimeric reporter gene and the mutant TBC2 allele, however, are severely affected in the translation of the psbC-atpA-aadA-rbcL chimeric mRNA; they are sensitive to low levels of spc (Fig 4). Thus, the 5'-terminal 533 nt of the psbC 5' leader can confer the requirement for wild-type TBC2 function across 57 nt of atpA 5' leader sequences to translation initiation at its AUG initiation codon. This excludes the involvement of the GUG initiation codon, and sequences immediately 5' to it, in the role of TBC2.

Effect of tbc3-rb1 on mutant psbC 5' leaders:
Because tbc3-rb1 has been characterized only genetically as a dominant suppressor of mutations affecting the psbC 5' leader and the trans-acting TBC1 locus without null or loss-of-function alleles we are unable to make any firm inferences regarding TBC3 function or its mechanism of action. Nevertheless, we were able to localize regions of the psbC 5' leader that contain sequences that interact with TBC3 either directly or indirectly. We tested the ability of the tbc3-rb1 suppressor mutation to stimulate translation of the psbC-aadA-rbcL mRNAs with the deletions that diminish translation and do not prevent accumulation of the mRNA (i.e., {Delta}95–167, {Delta}168–222, {Delta}223–320, {Delta}321–391, {Delta}321–319, {Delta}484–532, {Delta}SD). Deletions that are not suppressed could affect sequences that are required for some interaction with TBC3, while suppression would indicate that the deleted sequences are not required. Transformant strains (mt+) carrying a mutant chimeric psbC-aadA-rbcL reporter gene were crossed to a mt- strain carrying the tbc3-rb1 mutation. All progeny inherited the chimeric reporter gene in the chloroplast genome and either the wild-type or the mutant TBC3 allele. To exclude effects of the tbc3-rb1 suppressor mutation on transcription or stability of the chimeric reporter mRNAs, RNA-gel blot analyses were performed. For each deletion the levels of RNA were comparable in the presence of the wild-type or tbc3 mutant allele (data not shown).

As shown previously, the tbc3-rb1 mutation partially restores translation from psbC 5' leaders with either the {Delta}223–320 deletion or the psbC-FuD34 mutation (ROCHAIX et al. 1989 Down; ZERGES et al. 1997 Down). Similarly, the levels of spc resistance conferred by chimeric genes with the deletions {Delta}321–391 and {Delta}484–532 revealed that translation is stimulated by the tbc3-rb1 suppressor allele in the absence of these sequences (Fig 2B, column 4). In contrast, tbc3-rb1 was unable to increase translation in mutants affected in two distinct regions of the psbC leader: deletions {Delta}27–93, {Delta}95–167, {Delta}168–222, {Delta}95–222, and the SD-like sequence (Fig 2). In both cases wild-type and mutant progeny for TBC3 showed similar low, but detectable, levels of spc resistance (Fig 2B, column 4). Thus, the TBC3 suppressor mutation is able to increase the level of expression from mutant psbC leaders affected in the middle part, but not from those with lesions in the 5'- and 3'-terminal part. The mechanistic significance of these data will have to await the molecular identification of the TBC3 product.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

In prokaryotes, translation is most frequently regulated by repressive cis-acting elements, which form secondary structures or bind to proteins that block access of the small ribosomal subunit to the translation initiation region (GOLD 1988 Down; KOZAK 1999 Down). This led us to expect repressive sequences in the psbC 5' leader, which, when deleted, would result in constitutive translation of the mRNA that is independent of the wild-type functions of the TBC1 and TBC2 loci (ROCHAIX et al. 1989 Down). However, similar to results of analyses of other chloroplast 5' leaders (SAKAMOTO et al. 1994 Down; HIGGS et al. 1999 Down; NICKELSEN et al. 1999 Down), we found no repressive sequences; none of the 5' leader deletions resulted in an increased level of expression in otherwise wild-type strains (Fig 2). In addition, insertion of overlapping psbC 5' leader regions and of the entire 5' leader into the atpA leader did not render aadA expression dependent upon wild-type TBC1 and TBC2 loci (W. ZERGES and J. D. ROCHAIX, unpublished data). These data suggest that TBC1 and TBC2 and their cis-acting target sequences activate translation (and that these functions can be replaced by analogous activators in the atpA 5' leader). Thus, unlike eubacterial translational regulatory elements, sequences throughout the psbC 5' leader are required for translation, the largest region being separated from the translation initiation region by 140 nt of dispensable sequences within the 379–519 interval.

Five regions containing cis-acting sequences that are required for translation were identified. Partial requirements were found for sequences in three regions: 95–222, 321–378, and the SD-like sequence GGAGG, located 10 nt upstream of the GUG initiation codon (positions 534–538; see Fig 1). Two regions are important for translation: the central region between positions 223 and 320 (ZERGES et al. 1997 Down) and, at the 3' end of the 5' leader, sequences between positions 519 and 532.

The translational requirement for the SD-like sequence indicates that it could function by base pairing with the 3' end of the 16S rRNA to position the small ribosomal subunit at the initiation codon. However, this sequence could be part of a larger translational element comprising the 28 nt 5' to the initiation codon, as sequences immediately 5' to the SD-like sequence are strictly required for translation (Fig 1 and Fig 2).

Site-directed replacement mutations of the SD-like sequences of five mRNAs [petD (SAKAMOTO et al. 1994 Down), atpB, atpE, rps4, and rps7 (FARGO et al. 1998 Down)] had little or no effect on their translation in vivo. Deletion of a SD-like sequence in the psbA 5' leader of the chloroplast psbA mRNA (encoding the D1 subunit of the photosystem II reaction center) abolished translation, but also severely reduced the level of the mRNA (MAYFIELD et al. 1994 Down). Similar to results reported here for psbC, replacement of the SD-like sequence in the 5' leader of the C. reinhardtii psbD mRNA reduced translation, but did not abolish it (NICKELSEN et al. 1999 Down). SD sequences could have a more prominent role in translation of highly expressed mRNAs of cyanobacteria (OSADA et al. 1999 Down) and chloroplasts (NICKELSEN et al. 1999 Down) and from initiation codons with otherwise suboptimal contexts for small subunit binding (ESPOSITO et al. 2001 Down).

Several sequence elements within the 5' leaders of chloroplast mRNAs have been found to promote their translation. A sequence of 17 nt located near the 5' end of the tobacco psbA mRNA has a positive influence on translation (EIBL et al. 1999 Down). A predicted stem-loop structure in the 5' leader of the C. reinhardtii psbA mRNA has been proposed to interact with translational activation factors and to regulate translation of the psbA mRNA in response to light (MAYFIELD et al. 1994 Down). However, this sequence is present only in a minor form of the psbA RNA, but absent from the mature mRNA. In the 5' leader of the C. reinhardtii chloroplast rps7 mRNA several mutations that affect the predicted folding pattern of the RNA also block translation, suggesting that the folding pattern of the RNA is important for its ability to drive translation (FARGO et al. 1999 Down). The organization of the cis-acting translational elements in the 5' leader of the C. reinhardtii chloroplast petD mRNA is most similar to that of the psbC 5' leader. Translation from both 5' leaders requires three distinct sequence elements (SAKAMOTO et al. 1994 Down; HIGGS et al. 1999 Down). Translation from the 5' leader of the psbD mRNA in C. reinhardtii requires a U-rich sequence 15–20 nt distal to the initiation codon and a SD-like sequence (NICKELSEN et al. 1999 Down). Translation from the psbC 5' leader requires an element 16–28 nt 5' to the GUG initiation codon; however, this element is not U-rich (Fig 1).

Using the mutant psbC 5' leaders with deletions that allow a detectable level of translation, it was possible to determine whether the deleted sequences mediate the trans-acting functions of TBC1 or TBC2. For example, dependence upon the wild-type TBC1 function was abolished by deletion {Delta}321–391, but not by {Delta}379–391 (Fig 2). Therefore, sequences in the 321–378 interval are required for the interaction with factor(s) encoded by or controlled by TBC1. The TBC1 independence of translation from the hybrid psbC-atpA 5' leader (Fig 4) revealed that TBC1 requires the 3' end of the 5' leader to promote translation (and an element in the 57 nt of the atpA 5' leader can substitute for this interaction). A less probable explanation is that TBC1 relieves repression by an unidentified sequence in the translation initiation region (the 14 nt, including the SD-like sequence and the GUG initiation codon).

Each of the translatable 5' leaders still requires TBC2. Thus, much of the 5' leader could be excluded as containing TBC2 target sequences; the intervals 95–222 and 321–391 are not involved (Fig 1 and Fig 2). However, a weak requirement for TBC2 function could be identified for the 391–519 region. These results could reflect repeated TBC2 target sequences, which are dispersed throughout the 5' leader such that elements located outside of any of the deletions can confer TBC2 dependence. More probably, however, the main TBC2 target sequence could be within an essential region (223–320 or 519–532) so that there is insufficient translation from these mutant 5' leaders to assay for TBC2 independence. The presence of major TBC2 targets in the translation initiation region was excluded by the ability of the rest of the psbC 5' leader to confer TBC2 dependence on translation from the atpA translation initiation region (Fig 4). It is intriguing that this effect occurs over the 57 3'-terminal nt of the atpA 5' leader.

Our current model proposes that psbC translation requires interactions between TBC1 and the predicted secondary structure (positions 223–320) and sequences immediately 5' to the initiation codon. Whether TBC3 functions in conjunction with TBC1, probably through sequences in the 95–222 region and the SD-like sequence, or whether it is involved in other functions remains to be explored. Because TBC3 is defined by a single dominant allele that suppresses the effects of two different cis-acting mutations within the psbC leader as well as the effects of the nuclear tbc1-F34 mutation, we cannot exclude the possibility that tbc3-rb1 represents a gain-of-function mutation that confers a new RNA-binding specificity to a protein that normally binds elsewhere and is not involved in psbC mRNA translation. TBC2 appears to function independently of these components, possibly in a distinct pathway. Translation of psbC mRNA requires both pathways.

Most studies of translational control have used reconstituted systems in vitro, and few have taken genetic approaches. Of eubacterial systems, predominantly Escherichia coli has been used in these studies. Thus, an understanding of the translational control by the direct or indirect interactions of the Tbc1, Tbc2, and Tbc3 products and the psbC 5' leader could lead to new insights into the general mechanisms of translational control and reveal the signal transduction pathways and genetic regulatory systems that control translation in plastids. A class of mRNA-specific translational regulators has been identified for mRNAs encoding central subunits of the oxidoreductase complexes of the electron transport chains in both chloroplasts of land plants and C. reinhardtii (GOLDSCHMIDT-CLERMONT 1998 Down; BARKAN and GOLDSCHMIDT-CLERMONT 2000 Down; ZERGES 2000 Down) and the mitochondria of Saccharomyces cerevisiae (FOX 1996 Down). These regulatory functions have been proposed to control the assembly of the polypeptide products of the target organelle mRNA into an integral membrane complex (ZERGES 2000 Down, ZERGES 2002 Down; CHOQUET et al. 2001 Down).


*  FOOTNOTES

1 Present address: SWISS-PROT Group, Swiss Institute of Bioinformatics, CH 1211 Geneva 4, Switzerland. Back


*  ACKNOWLEDGMENTS

We thank the members of our laboratories for stimulating discussions and helpful comments, M. Goldschmidt-Clermont for critical reading of the manuscript, and N. Roggli for preparing the figures. This work was supported by grant 3100-050895.97 from the Swiss National Fund to J.-D.R. and a Canadian National Science and Engineering Research Council operating grant to W.Z.

Manuscript received October 28, 2002; Accepted for publication December 16, 2002.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

AUCHINCLOSS, A. H., W. ZERGES, K. PERRON, J. GIRARD-BASCOU, and J. D. ROCHAIX, 2002  Characterization of Tbc2, a nucleus-encoded factor specifically required for translation of the chloroplast psbC mRNA in Chlamydomonas reinhardtii. J. Cell Biol. 10:953-962.

BARKAN, A. and M. GOLDSCHMIDT-CLERMONT, 2000  Participation of nuclear genes in chloroplast gene expression. Biochimie 82:559-572.[Medline]

BENNOUN, P. and D. BEAL, 1997  Screening algal mutant colonies with altered thylakoid electronchemical gradient through fluorescence and delayed luminescence digital imaging. Photosynth. Res. 51:161-165.

BRUICK, R. K. and S. P. MAYFIELD, 1999  Light-activated translation of chloroplast mRNAs. Trends Plant Sci. 4:190-195.[Medline]

CHOQUET, Y., K. WOSTRIKOFF, B. RIMBAULT, F. ZITO, and J. GIRARD-BASCOU et al., 2001  Assembly-controlled regulation of chloroplast gene translation. Biochem. Soc. Trans. 29:421-426.[Medline]

DANON, A., 1997  Translational regulation in the chloroplast. Plant Physiol. 115:1293-1298.[Medline]

DRON, M., M. RAHIRE, and J. D. ROCHAIX, 1982  Sequence of the chloroplast DNA region of Chlamydomonas reinhardii containing the gene of the large subunit of ribulose bisphosphate carboxylase and parts of its flanking genes. J. Mol. Biol. 162:775-793.[Medline]

EIBL, C., Z. ZOU, A. BECK, M. KIM, and J. MULLET et al., 1999  In vivo analysis of plastid psbA, rbcL and rpl32 UTR elements by chloroplast transformation: tobacco plastid gene expression is controlled by modulation of transcript levels and translation efficiency. Plant J. 19:333-345.[Medline]

ESPOSITO, D., A. J. HICKS, and D. B. STERN, 2001  A role for initiation codon context in chloroplast translation. Plant Cell 13:2373-2384.[Abstract/Free Full Text]

FARGO, D. C., M. ZHANG, N. W. GILLHAM, and J. E. BOYNTON, 1998  Shine-Dalgarno-like sequences are not required for translation of chloroplast mRNAs in Chlamydomonas reinhardtii chloroplasts or in Escherichia coli. Mol. Gen. Genet. 257:271-282.[Medline]

FARGO, D. C., J. E. BOYNTON, and N. W. GILLHAM, 1999  Mutations altering the predicted secondary structure of a chloroplast 5' untranslated region affect its physical and biochemical properties as well as its ability to promote translation of reporter mRNAs both in the Chlamydomonas reinhardtii chloroplast and in Escherichia coli. Mol. Cell. Biol. 19:6980-6990.[Abstract/Free Full Text]

FARGO, D., J. BOYNTON, and N. GILLHAM, 2001  Chloroplast ribosomal protein S7 of Chlamydomonas binds to chloroplast mRNA leader sequences and may be involved in translation initiation. Plant Cell 13:207-218.[Abstract/Free Full Text]

FOX, T. D., 1996 Genetics of mitochondrial translation, pp. 733–758 in Translational Regulation, edited by J. W. B. HERSHEY, M. B. MATHEWS and N. SONENBERG. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

GOLD, L., 1988  Posttranscriptional regulatory mechanisms in Escherichia coli. Annu. Rev. Biochem. 57:199-233.[Medline]

GOLDSCHMIDT-CLERMONT, M., 1991  Transgenic expression of aminoglycoside adenine transferase in the chloroplast: a selectable marker of site-directed transformation of chlamydomonas. Nucleic Acids Res. 19:4083-4089.[Abstract/Free Full Text]

GOLDSCHMIDT-CLERMONT, M., 1998  Coordination of nuclear and chloroplast gene expression in plant cells. Int. Rev. Cytol. 177:115-180.[Medline]

GOLDSCHMIDT-CLERMONT, M. and M. RAHIRE, 1986  Sequence, evolution and differential expression of the two genes encoding variant small subunits of ribulose bisphosphate carboxylase/oxygenase in Chlamydomonas reinhardtii. J. Mol. Biol. 191:421-432.[Medline]

GOLDSCHMIDT-CLERMONT, M., J. GIRARD-BASCOU, Y. CHOQUET, and J. D. ROCHAIX, 1990  Trans-splicing mutants of Chlamydomonas reinhardtii. Mol. Gen. Genet. 223:417-425.[Medline]

GORMAN, D. S. and R. P. LEVINE, 1965  Cytochrome f and plastocyanin: their sequence in the photosynthetic electron transport chain of Chlamydomonas reinhardi. Proc. Natl. Acad. Sci. USA 54:1665-1669.[Free Full Text]

GUO, L. H. and R. WU, 1983  Exonuclease III: use for DNA sequence analysis and in specific deletions of nucleotides. Methods Enzymol. 100:60-96.[Medline]

HARRIS, E. H., J. E. BOYNTON, and N. W. GILLHAM, 1994  Chloroplast ribosomes and protein synthesis. Microbiol. Rev. 58:700-754.[Abstract/Free Full Text]

HIGGS, D. C., R. S. SHAPIRO, K. L. KINDLE, and D. B. STERN, 1999  Small cis-acting sequences that specify secondary structures in a chloroplast mRNA are essential for RNA stability and translation. Mol. Cell. Biol. 19:8479-8491.[Abstract/Free Full Text]

KOZAK, M., 1999  Initiation of translation in prokaryotes and eukaryotes. Gene 234:187-208.[Medline]

LEU, S., J. SCHLESINGER, A. MICHAELS, and N. SHAVIT, 1992  Complete DNA sequence of the Chlamydomonas reinhardtii chloroplast atpA gene. Plant Mol. Biol. 18:613-616.[Medline]

MAYFIELD, S. P., A. COHEN, A. DANON, and C. B. YOHN, 1994  Translation of the psbA mRNA of Chlamydomonas reinhardtii requires a structured RNA element contained within the 5' untranslated region. J. Cell Biol. 127:1537-1545.[Abstract/Free Full Text]

NICKELSEN, J., 1998 Chloroplast mRNA stability, pp. 151–163 in The Molecular Biology of Chloroplasts and Mitochondria in Chlamydomonas, edited by M. GOLDSCHMIDT-CLERMONT, J.-D. ROCHAIX and S. MERCHANT. Kluwer Academic, Norwell, MA/Dordrecht, The Netherlands.

NICKELSEN, J., J. VAN DILLEWIJN, M. RAHIRE, and J. D. ROCHAIX, 1994  Determinants for stability of the chloroplast psbD RNA are located within its short leader region in Chlamydomonas reinhardtii. EMBO J. 13:3182-3191.[Medline]

NICKELSEN, J., M. FLEISCHMANN, E. BOUDREAU, M. RAHIRE, and J. D. ROCHAIX, 1999  Identification of cis-acting RNA leader elements required for chloroplast psbD gene expression in Chlamydomonas. Plant Cell 11:957-970.[Abstract/Free Full Text]

OSADA, Y., R. SAITO, and M. TOMITA, 1999  Analysis of base-pairing potentials between 16S rRNA and 5' UTR for translation initiation in various prokaryotes. Bioinformatics 15:578-581.[Abstract/Free Full Text]

ROCHAIX, J. D., 1978  Restriction endonuclease map of the chloroplast DNA of Chlamydomonas reinhardii. J. Mol. Biol. 126:597-617.[Medline]

ROCHAIX, J. D., 1996  Post-transcriptional regulation of chloroplast gene expression in Chlamydomonas reinhardtii. Plant Mol. Biol. 32:327-341.[Medline]

ROCHAIX, J. D., M. KUCHKA, S. MAYFIELD, M. SCHIRMER-RAHIRE, and J. GIRARD-BASCOU et al., 1989  Nuclear and chloroplast mutations affect the synthesis or stability of the chloroplast psbC gene product in Chlamydomonas reinhardtii. EMBO J. 8:1013-1021.[Medline]

ROTT, R., H. LEVY, R. G. DRAGER, D. B. STERN, and G. SCHUSTER, 1998  3'-Processed mRNA is preferentially translated in Chlamydomonas reinhardtii chloroplasts. Mol. Cell. Biol. 18:4605-4611.[Abstract/Free Full Text]

SAKAMOTO, W., X. CHEN, K. L. KINDLE, and D. B. STERN, 1994  Function of the Chlamydomonas reinhardtii petd 5' untranslated region in regulating the accumulation of subunit IV of the cytochrome b6/f complex. Plant J. 6:503-512.[Medline]

SAMBROOK, J., and D. W. RUSSELL, 2001 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

STAMPACCHIA, O., J. GIRARD-BASCOU, J.-L. ZANASCO, W. ZERGES, and P. BENNOUN et al., 1997  A nuclear-encoded function essential for translation of the chloroplast psaB mRNA in Chlamydomonas reinhardtii. Plant Cell 9:773-782.[Abstract]

STAUB, J. M. and P. MALIGA, 1993  Accumulation of D1 polypeptide in tobacco plastids is regulated via the untranslated region of the psbA mRNA. EMBO J. 12:601-606.[Medline]

STERN, D. B., D. C. HIGGS, and J. YANG, 1997  Transcription and translation in chloroplasts. Trends Plant Sci. 2:308-315.

SUGIURA, M., T. HIROSE, and M. SUGITA, 1998  Evolution and mechanism of translation in chloroplasts. Annu. Rev. Genet. 32:437-459.[Medline]

WOESSNER, J. P., N. W. GILLHAM, and J. E. BOYNTON, 1986  The sequence of the chloroplast atpB gene and its flanking regions in Chlamydomonas reinhardtii. Gene 44:17-28.[Medline]

YOHN, C. B., A. COHEN, A. DANON, and S. P. MAYFIELD, 1996  Altered mRNA binding activity and decreased translational initiation in a nuclear mutant lacking translation of the chloroplast psbA mRNA. Mol. Cell. Biol. 16:3560-3566.[Abstract/Free Full Text]

YOHN, C. B., A. COHEN, C. ROSCH, M. R. KUCHKA, and S. P. MAYFIELD, 1998  Translation of the chloroplast psbA mRNA requires the nuclear-encoded poly(A)-binding protein, RB47. J. Cell Biol. 142:435-442.[Abstract/Free Full Text]

ZERGES, W., 2000  Translation in chloroplasts. Biochimie 82:583-601.[Medline]

ZERGES, W., 2002  Does complexity constrain organelle evolution? Trends Plant Sci. 7:175-182.[Medline]

ZERGES, W. and J. D. ROCHAIX, 1994  The 5' leader of a chloroplast mRNA mediates the translational requirements for two nucleus-encoded functions in Chlamydomonas reinhardtii. Mol. Cell. Biol. 14:5268-5277.[Abstract/Free Full Text]

ZERGES, W., J. GIRARD-BASCOU, and J. D. ROCHAIX, 1997  Translation of the chloroplast psbC mRNA is controlled by interactions between its 5' leader and the nuclear loci TBC1 and TBC3 in Chlamydomonas reinhardtii. Mol. Cell. Biol. 17:3440-3448.[Abstract/Free Full Text]

ZUMBRUNN, G., M. SCHNEIDER, and J.-D. ROCHAIX, 1989  A simple particle gun for DNA-mediated cell transformation. Technique 1:204-216.




This article has been cited by other articles:


Home page
Plant Cell PhysiolHome page
H. Kuroda, H. Suzuki, T. Kusumegi, T. Hirose, Y. Yukawa, and M. Sugiura
Translation of psbC mRNAs Starts from the Downstream GUG, not the Upstream AUG, and Requires the Extended Shine Dalgarno Sequence in Tobacco Chloroplasts
Plant Cell Physiol., September 1, 2007; 48(9): 1374 - 1378.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
B. Klinkert, I. Elles, and J. Nickelsen
Translation of chloroplast psbD mRNA in Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start codon
Nucleic Acids Res., January 12, 2006; 34(1): 386 - 394.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
L. Suay, M. L. Salvador, E. Abesha, and U. Klein
Specific roles of 5' RNA secondary structures in stabilizing transcripts in chloroplasts
Nucleic Acids Res., August 22, 2005; 33(15): 4754 - 4761.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
A. R. Grossman, E. E. Harris, C. Hauser, P. A. Lefebvre, D. Martinez, D. Rokhsar, J. Shrager, C. D. Silflow, D. Stern, O. Vallon, et al.
Chlamydomonas reinhardtii at the Crossroads of Genomics
Eukaryot. Cell, December 1, 2003; 2(6): 1137 - 1150.
[Full Text] [PDF]