- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Langdon, T.
- Articles by King, I. P.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Langdon, T.
- Articles by King, I. P.
A High-Copy-Number CACTA Family Transposon in Temperate Grasses and Cereals
Tim Langdona, Glyn Jenkinsb, Robert Hasterokc, R. Neil Jonesb, and Ian P. Kingaa Institute of Grassland and Environmental Research, Aberystwyth, Ceredigion, SY23 3EB, United Kingdom,
b Institute of Biological Science, University of Wales, Aberystwyth, SY23 3DD, United Kingdom
c Department of Plant Anatomy and Cytology, Silesian University, Jagiellonska 28, PL-40-032 Katowice, Poland
Corresponding author: Tim Langdon, Plas Gogerddan, Aberystwyth, Ceredigion, SY23 3EB, United Kingdom., tlangdon{at}hgmp.mrc.ac.uk (E-mail)
Communicating editor: V. L. CHANDLER
 | ABSTRACT |
|---|
 TOP ABSTRACT MATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
A lineage of CACTA family transposons has been identified in temperate grasses and cereals, and a full-length representative of the subfamily from Lolium perenne has been sequenced. Both the size and internal organization of the L. perenne element are typical of other CACTA family elements but its high copy number and strong conservation are unexpected. Comparison with homologs in other species suggests that this lineage has adopted a distinct and novel evolutionary strategy, which has allowed it to maintain its presence in genomes over long periods of time.
TRANSPOSABLE elements were first discovered in maize >50 years ago, using classical genetic and cytological methods (reviewed by 
Transposons first identified in maize are now known to be members of families with representatives in a wide range of species. Ac belongs to the hAT superfamily (
To date there have been few comparative studies of plant transposons and their evolution as attention has focused on understanding the activity of specific elements and, more recently, in optimizing their use as genetic tools. In addition, a number of characterized elements show very restricted distributions, with homologs being found only in related species. In some cases the elements are even restricted to specific lines within a species, suggesting that they are transient or dynamic genomic components. However, until recently most plant transposons have been identified on the basis of a phenotypic effect, which may have produced a bias for "aggressive" subfamilies that are in the process of colonizing contemporary genomes. Sequencing projects for rice and Arabidopsis indicate that transposons are a significant component even of these small genomes. Given the wide range of effects on chromosome structure and interaction that may be mediated by these elements, it is of interest to use a comparative approach to understand the fate of transposon populations over evolutionarily significant periods. We have identified a CACTA transposon family that has homologs in a wide range of temperate grasses and cereals, and we have begun its characterization with this aim. Surprisingly, the family appears to maintain a high copy number in divergent species, suggesting a successful alternative evolutionary strategy to the "boom-and-bust" pattern implied in previously described distributions.
| MATERIALS AND METHODS |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Genetic and DNA stocks:
Plant stocks are maintained at Aberystwyth. The Lolium perenne Lp10 x L. temulentum hybrid was described previously (
-Libraries were obtained from Stratagene (La Jolla, CA). DNA weight markers are a 1-kb ladder (Life Technologies).
PCR:
The following oligonucleotides were used: TCMK, CCCCCTTGGTTGTGCATGAA; TNC, AAGCCACCTTSGATGYCCCAT; TIR1H, GGCAAAGCTTACACTACTAGGAAAAGGCT; PKW1, GGTTTTAGGGTGGCGCAACCGAARTGGGA; YNL1, GGAATTCAACCAGGGGGGSAGRTTGTA; BTPO3A, GTTCCCGGAGTCTACRACGACTGG; BTPO3B, AACTASCATCACATAGARGAG; BTPO3C, CGATATCGATCATCTAAACTACCATCACAT; and EAR1, TTCGATTCACACTACTAGGAAAA. Conditions used for PCRs described in the text were as follows: initial TnpD-like gene amplification, TCMK/TNC primers, 94° x 1 min, 48° x 2 min, 68° x 3 min followed by 27 cycles of 94° x 30 sec, 50° x 30 sec, 72° x 90 sec; amplification of subterminal regions, TIR1H/YNL1 (5') or TIR1H/PKW1 (3'), (first cycle TIR1H oligo only, 94° x 1 min, 50° x 1 min, 72° x 10 min, subsequent 27 cycles plus YNL1 or PKW1 oligo, 94° x 30 sec, 60° x 30 sec, 68° x 5 min); amplification of RNaseH region, BTPO3A/BTPO3B, BTPO3A/TIR1H, BTPO3C/PKW1, 30–33 cycles of 94° x 30 sec, 60° x 30 sec, 72° x 4 min. Genomic template DNAs were at a final concentration of 5 ng/µl, dNTPs at 1.5 mM, MgCl2 at 5 mM, and Taq DNA polymerase (2.5 units/100-µl reaction) and buffer were as supplied (Roche, Indianapolis).
Fluorescence in situ hybridization (FISH):
Methods were as described previously (
Sequence analysis:
Analysis was carried out using the GCG10 package (Pharmacopeia). Database searches were carried out using BLAST as implemented by the National Center for Biotechnology Information (http://www4.ncbi.nlm.nih.gov/BLAST/index.html). Sequence display was made with GeneDoc (http://www.psc.edu/biomed/genedoc/). Phylogenetic trees were derived by ClustalX (
Hybridization and screening conditions:
Standard (high-stringency) hybridizations were carried out in Church buffer (0.25 M NaCl, 0.25 M phosphate, 10% polyethylene glycol, 7% SDS, 1 mM EDTA, pH 7) at 60° for 4–16 hr. Standard washing conditions were 2 x 20 min, 0.2 x SSC, and 0.5% SDS at 60°. Low-stringency hybridizations and washes were carried out with the same conditions but with the temperature reduced to 50°. The washes correspond to 
Tm - 14° or Tm - 24° for the Tpo1-lp1 TnpD-like probe (high and low stringencies, respectively). -plaques were transferred to Hybond-NX membranes according to the manufacturer's instructions from 9-cm plates containing 1000 plaques each. Probes were made by radiolabeling of PCR products, and filters were stripped before hybridization by washing with 0.2 M NaOH at 60°. Initial screening of the L. perenne library was with the TCMK/TNC PCR product (see above); subsequent sequential screens to estimate deletion frequency were made with probes derived from the TIR1H/YNL1 product [Tpo1-lp1, nucleotides (nts) 1–2362, labeled with TIR1H only or YNL1 only] or TIR1H/PKW1 product (7686–12,485, labeled with BTPO3C only or PKW1 only). The presence of multiple common sequences in -clones was established by probing XbaI-digested DNAs with PCR products derived from the following regions of Tpo1-lp1 (number of positive cross-hybridizing clones indicated in brackets): 850–1250 (10/28), 1500–1900 (15/28), 11,500–11,900 (13/28), and with random-labeled 1.1-kb XbaI fragment (3700–4800, 24/28). Interspecific hybridizations were made with TCMK/TNC PCR probe from L. perenne Tpo1-lp1 (nts 2344–2694) or from Hordeum vulgare genomic DNA; equal amounts of XbaI-digested DNA were loaded for each species.
| RESULTS |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Identification of transposon fragments:
In the course of a project characterizing the rye B chromosome an amplified fragment length polymorphism fragment amplified from Lindstrom wheat was sequenced and found to have significant similarity to the TnpD gene of Spm of maize and its equivalents in Tdc1 (carrot) and Tam1 (snapdragon; TBLASTX P values, 3e-15, 8e-13, and 4e-18, respectively). Oligonucleotides were designed on the basis of the most highly conserved motifs found in these alignments and used for PCR from genomic DNA of a variety of grasses (see MATERIALS AND METHODS). Products of the expected size were amplified, cloned, and sequenced from Lolium, barley, rye, maize, and diploid wheat and oat species (Fig 1). All are closely related and form a distinct lineage of the CACTA superfamily (Fig 2), which we have called Tpo1 (Transposon, Poaceae) to reflect its wide distribution. Species- and lineage-specific polymorphisms are seen in the Tpo1 sequences, indicating that the elements have continued to evolve during recent species divergence. The majority of these polymorphisms either do not alter the predicted peptide sequence or result in conservative amino acid changes, suggesting that the elements are still functional in contemporary genomes and do not represent ancient "fossils."
|
|
Isolation and characterization of a Lolium Tpo1 element:
A genomic library of L. perenne line Lp10, cloned in the FIXII vector, was screened with L. perenne Tpo1 transposase fragments derived by PCR as above (MATERIALS AND METHODS). Numerous positive clones were found (see below), of which 28 were purified and used for further characterization. A candidate full-length element, designated Tpo1-lp1, was identified in 26 following Southern analysis, and the entire insert from this clone was subcloned and sequenced (Fig 3).
|
75% identity indicated by numbers above). Three reading frames have been identified (cross-hatched boxes: homologies indicated below, orientation above). Repeated regions are indicated [27- and 32-bp tandem repeats (nts 1409–1489 and nts 6347–6466) indicated by vertical lines, 200-bp tandem repeat (nts 10,981–11,372) indicated by diagonal hatched boxes]. (Bottom) TnpA-like DBD homologies. Sequence key is as for
In this clone, TIR sequences are present some 12.5 kb apart; the TIR itself is 17 bp long (CACTACTAGGAAAAGGC) and is highly similar to those of sorghum Candystripe and maize Spm (CACTATGTGAAAAAAGCTTA and CACTACAAGAAAA), while the transposon sequences flanking the TIR at either end contain multiple repeats of a 16-bp motif (TAGCAGTGGCGCACCA) distributed in both orientations over regions of several hundred base pairs, an organization typical of "cut-and-paste" transposons. The TIRs appear to be flanked by 3-bp duplications of host DNA, as seen at other CACTA family insertion sites. An open reading frame that is highly similar to Spm TnpD is found in the 5' half of the element, while a second gene related to Spm TnpA and Candystripe gene 2 appears to be present downstream of this in the same orientation. The putative second gene contains a region similar to the TnpA DBD (Fig 3); similarities outside of this region are weak, however. Between the two genes lies a central noncoding region that contains a complex arrangement of repeated motifs, including the only other occurrences of the 16-bp motif outside of the flanking regions; three repeats are found between nucleotides 5038 and 5111. As the 16-bp motif is likely to be bound by the TnpA-like protein, assuming similar behavior to Spm, these central repeats may be involved in autoregulation of TnpA-like gene expression. Three other notable duplications are seen. Both upstream and downstream of the TnpD-like gene are regions containing three short (27 and 32 bp, respectively) direct repeats, while downstream of the second gene lies a larger (200 bp) direct repeat. Finally, a short region at the 3' end of the element is derived from an RNaseH-like gene. Such genes are typically found in retroelements and have not previously been described in DNA transposons. This region was characterized further and is described in more detail below.
Tpo1 is present at high copy number in L. perenne:
Screens of the Lolium -library with the Tpo1 transposase PCR products yielded positive clones at a rate of 1/50, potentially equivalent to 1 element/Mb or 5000 elements/genome. This number is well in excess of the tens of copies seen for maize elements such as Ac/Ds and En/Spm and even of the hundreds seen for "high copy" lines of Mutator. We therefore confirmed this number with further experiments. First, we confirmed that positive plaques represented bona fide transposon sequences by probing Southerns of the 28 purified clone DNAs. All of the clones hybridized to two or more nonoverlapping Tpo1-lp1 probes and 23 of the clones showed significant cross-hybridization to more than one region of the Tpo1-lp1 element (MATERIALS AND METHODS); moreover, the same prominent genomic restriction fragment (which does not overlap with the probe used for clone identification) is also found in most clones (Fig 4, details below). Second, we confirmed that library complexity had not been reduced during amplification. Restriction of clones with XbaI and NciI indicated that while some common fragments were present, no two clones were identical (Fig 4). Third, we confirmed that elements contained within the clones were also distinct by direct sequencing of PCR products of the transposase region; each of 12 clones analyzed was unique (not shown). Finally, we carried out FISH with the TnpD probe on a L. perenne x L. temulentum hybrid (Fig 5). Approximately 2500 discrete signals are seen to be distributed relatively evenly across both genomes (see below), indicating that the high copy number does not result from passive amplification within any particular chromosomal domain.
|
|
Conservation of the Tpo1 family in L. perenne:
At the resolution provided by the extended meiotic prophase chromosomes used for the FISH analysis, there often appear to be conserved patterns of Tpo1 signals in the two Lolium genomes (Fig 5, bottom). These two species are sufficiently divergent that genomic in situ hybridization may be used to distinguish each chromosome set (
10-4/element/generation, it is surprising that such patterns should have been preserved. The most obvious explanation for this observation is that many elements are ancient and inactive. However, if only TIRs and a subset of subterminal repeats are required in cis, nonautonomous elements undergoing inactivation by gradual sequence degeneration may be expected to continue to show movement mediated by autonomous elements for long periods of time. Open reading frames may therefore be expected to show considerable divergence in a population of "fixed" transposons that have been inactivated by sequence degeneration. This does not appear to be the case. Our preliminary characterization of the L. perenne -clones indicated that not only were the Tpo1 sequences sufficiently well conserved to allow cross-hybridization under stringent conditions, but also some restriction sites were also maintained in the majority of clones. This is most strikingly demonstrated by the conservation of a 1.1-kb XbaI fragment found within the TnpD-like gene (Fig 4). Of 24 cross-hybridizing clones, 15 maintain both XbaI sites.
An alternative mechanism that could rapidly generate a population of inert elements stems from the susceptibility of transposons to deletion during gap repair of abortive transposition events. Deletions occur frequently in the Ac/Ds system, for example, and account for the large excess of nonautonomous Ds elements over the intact Ac parent. We therefore screened -clones for the presence of significant numbers of deletion derivatives. To avoid the bias inherent in using clones preselected to contain a specific Tpo1 region, we probed filters of a sample of the unpurified genomic library directly. A total of 137 plaques cross-hybridized to one or more Tpo1-lp1 fragments (Fig 6). Only 15 of these (11%) gave a pattern that was unambiguously derived from a rearranged or divergent genomic element. A single plaque displayed the pattern expected for the largest internal deletion detectable with these probes, whereas two plaques hybridized only to the TnpD-like probe, a pattern that is not generated by internal deletion, suggesting that random processes may be as important as gap repair in generating Tpo1 derivatives. As there may be some bias in library representation of genomic sequences and/or rearrangement of clones, we also carried out FISH with TnpA-like and right-hand subterminal probes from Tpo1-lp1 (Fig 7). The majority of targets showed coincident labeling with both probes, with a minority (10%) labeled with the subterminal region only. Occasionally only TnpA-like hybridization was seen; as with the -screens, this suggests that a low level of random rearrangement or divergence acts on the elements. Again, there was no evidence for a significant excess of deletion derivatives, and it seems unlikely that the proportion seen is abundant enough to inactivate the full-length elements by a simple titration mechanism.
|
|
We also used PCR to specifically amplify Tpo1 subterminal regions from L. perenne, using a TIR-specific oligonucleotide in combination with oligonucleotides based on conserved peptide motifs within the TnpD- and TnpA-like reading frames. Products recovered were predominantly of the size predicted for Tpo1-lp1, despite the large size of these products (2.2 and 4 kb, respectively), which would have allowed preferential amplification of deletion templates. It therefore appears unlikely that small deletions of essential subterminal sequences occurred at significant levels. No products representing large internal deletions (i.e., having TIRs at both ends) were recovered.
Tpo1 conservation in other genomes:
The distribution of Tpo1 elements in other genomes was examined by Southern hybridization. Under standard conditions, a probe derived from the Tpo1-lp1 1.1-kb XbaI fragment hybridizes predominantly to a single XbaI fragment in the L. perenne genome (Fig 8A), although a small number of minor bands are also present. Some cross-hybridization to barley, rye, wheat, and oat is seen. In these species the signal is predominantly "smeared" but relatively strong bands are visible in oat and, to a lesser extent, in rye. Reducing the stringency of hybridization enhanced the relative strength of these signals but did not generate significant additional bands (Fig 8B). Bands became detectable in the maize DNA, however. "Universal" fragments of 10 kb, seen in all genomes, including Arabidopsis, probably represent spurious hybridization to the rDNA repeat unit, as their positions correspond to bands visible in the ethidium-stained gel (Fig 8C). As the region of Tpo1-lp1 used in these experiments may not be highly conserved, the filter was rehybridized with PCR product amplified from the barley genome, using the oligonucleotides and conditions first employed to define the Tpo1 family. Again, multiple bands were seen (Fig 8D) but cross-hybridization was predominantly concentrated in a small number of bands, particularly in oat and wheat, where a single major band is found. In barley itself, one band is significantly stronger although at least eight other bands are seen, while in rye multiple bands of an equivalent intensity are seen. These patterns, and the strength of the cross-hybridization, suggest that Tpo1 elements are present at high copy number in other large-genome Poaceae species and that these may be organized into relatively homogeneous subfamilies in at least some species.
|
The number of potential Tpo1 elements present in the barley genome was estimated by screening a representative genomic library (Stratagene) with a TnpD-like probe. Cross-hybridizing clones were present at a frequency of 1/100. This is comparable with the density of Tpo1 elements identified in the L. perenne library (see above) and indicates that Tpo1 copy number in barley is also >1000 copies per haploid genome.
Finally, the hybridization experiments suggest that rye contains more Tpo1-related sequences and a greater variety of subfamilies than do other Triticeae species. Rye is unusual in containing more heterochromatin than related species; it also frequently supports the presence of a supernumerary, or B, chromosome, which we have previously shown to be likely to have arisen by rapid evolution from A genome components (
|
An RNaseH domain in the Tpo family:
An interrupted reading frame at the 3' end of Tpo1-lp1 shows significant homology with a conserved motif of RNaseH genes (-clones, and PCRs with oligonucleotides anchored within the motif region and the downstream TIR or TnpA-like gene amplify products of the predicted size from Tpo1 homologs in barley (MATERIALS AND METHODS). In addition, a number of expressed sequence tag (EST) database entries for barley have significant similarity to this region. These entries fall into two classes: the first is highly similar to the Tpo1-lp1 clone from 11,258 to 11,522 (88% consensus identity) but is unrelated upstream of this region (accession nos. AW982961, AW983166, and BE216619), while the second has a shorter region of similarity to Tpo1-lp1 but in addition shares an upstream region of 180 bp, which is highly similar to a barley Tpo1-related genomic database entry (EST accession nos. AW983299 and BE060537; genomic accession no. U76261). Downstream of the region of common similarity with the ESTs, the barley genomic sequence and Tpo1-lp1 show extensive colinearity of sequence motifs and TIRs, indicating that the barley sequence contains the 3' end of a Tpo1-like element (Fig 11; see DISCUSSION). The simplest interpretation of the EST similarities is that each class represents a processed transcript from one or another of two Tpo1 subfamilies; alternatively, the junctions between common and unrelated sequences may result from further genomic rearrangements. The ESTs are unlikely to produce functional peptides as key codons are mutated in some clones, while translation would need to be initiated within the unrelated upstream regions. The probability that the motif represents a vestige of a historical rearrangement is supported by the presence of polyadenine stretches in the two genomic clones at positions similar to the 3' ends of the ESTs, suggesting that an RNaseH pseudogene may have been inserted in an ancestral Tpo1 element prior to Lolium barley divergence.
|
|
| DISCUSSION |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
The Tpo1 family described here represents a new branch of the plant CACTA transposon superfamily. Its members are unusual in consistently having a high copy number in species with large genomes, although the L. perenne subfamily, which has been most extensively characterized, appears to be conventional in its internal organization and coding content. The single anomalous feature identified so far, an RNaseH-like peptide motif, appears to represent a historical accident without current functional significance, although its presence in elements from divergent species provides evidence of common descent. Here, we discuss some of the properties of the Tpo1 family that may have led to its abundance.
One of the most striking aspects of the L. perenne Tpo1 elements is the lack of the deletion derivatives that are a common feature of other transposon families. These derivatives appear to be created during repair of the double-strand breaks (DSBs) caused by element excision by a pathway involving extension of the DSB free ends on homologous templates provided by sister chromatids and/or sequences on other chromosomes (
Tpo1-lp1 is predicted to have relatively strong subterminal secondary structures, comparable with those of Tam3 (-81 kcal and -79 kcal for first 5' and last 3' 300 bp, compared to -127 kcal and -83 kcal, respectively) and higher than those of Spm (-47 kcal and -70 kcal) or other families analyzed by
The two sequences are colinear over a 1-kb region, extending from the putative RNaseH motif to the downstream TIR, and are clearly related but show interesting patterns of divergence. In particular, a symmetrical core region of the Tpo1-lp1 subterminal motifs (TGGTGCGCCA) shows strong conservation of both sequence and organization, leading to similar secondary structure predictions for each sequence, while the remaining part of the Tpo1-lp1 motif (TAGCAG) has been largely replaced by the sequence ATACTAA in the barley entry. This last replacement represents not only a divergent sequence but also a change in the motif's size (i.e., 7 rather than 6 bases). Such a radical change at each of 13 motifs implies a strong selection, which has, moreover, maintained a very similar organization despite the obvious potential for replication slippage or aberrant recombination to act at the repeated motifs. As the motifs are expected to provide binding sites for protein(s) involved in generating the transposition complex, we cannot rule out the possibility that selection is entirely directed by the constraints of the complex's architecture, but it appears highly likely that, as with Tam3, Tpo1 elements are protected against the most significant cause of structural rearrangement. Tam3, however, has a low copy number (60;
Another striking aspect of the Tpo1 distribution is that it appears to have a relatively even copy number across divergent species, whereas the majority of transposon families described to date shows great variation even within a species. In the most extreme cases (for example, Mutator or P), this variation may be ascribed to a recent aggressive colonization coupled with an almost replicative mode of transposition, which rapidly generates large numbers of nonautonomous elements. Both the damage caused to the host genome by transposition events and the load imposed on autonomous elements by the increasing number of derivatives are expected to create an unstable situation in which either the transposon family or the active host lines may become extinct, leading to a continuous boom-and-bust pattern of colonization. However, while evolution of strong subterminal secondary structures may have allowed the Tpo1 ancestor to reduce the rates of both processes and hence to adopt a less erratic but more persistent method of colonization, if the current copy numbers reflect a slow increase since a common ancestor, then multiple subfamilies forming a star phylogeny might be expected, with many inactive and degenerate elements blurring the distinction between groups. While our analysis of TnpD divergence provides some evidence for such a phylogeny within the Triticeae, it is clear that there are distinct lineages for Lolium and oat. In addition, the presence of high-copy and lineage-specific subgroups within such divergent species as oat, wheat, and Lolium suggests, rather, that the majority of Tpo1 elements are in some way generated from relatively recent progenitors, whether by active transposition or by a more passive process such as gene conversion. The conservation of copy number could then reflect a genome's capacity to support the family, with subfamilies competing for available sites. Such a competitive scenario would also seem to be supported by the degree of selection implied by the Tpo1-lp1/barley subterminal divergence.
It is tempting to speculate that the Tpo1 family has acquired a mechanism to direct transposition to specific sites within the genome, as this could account for both the host's ability to tolerate large numbers of elements (assuming nongenic or redundant sites are occupied) and competition between elements (assuming a limited number of sites are available). Examples in a wide range of species of mobile elements target particular genomic niches to minimize host disruption, and we have described elsewhere evidence that a family of retrotransposons has successfully adopted this strategy in grasses and cereals by active colonization of centromeres (
One resolution to this problem would be if Tpo1 elements are now at a sufficiently high density in the host genomes that they interact via complexes assembled at their subterminal motifs before excision occurs (i.e., if interelement interactions frequently replace the intraelement interactions seen in conventional transposition). Such interactions have been found occasionally in other systems and can lead to hybrid element insertion, element replacement, and compound movements (reviewed in
| FOOTNOTES |
|---|
Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under accession nos.
AY089999 and
AF492361,
AF492362,
AF492363,
AF492364,
AF492365,
AF492366,
AF492367,
AF492368,
AF492369,
AF492370,
AF492371,
AF492372,
AF492373,
AF492374,
AF492375,
AF492376,
AF492377,
AF492378,
AF492379,
AF492380,
AF492381,
AF492382,
AF492383. 
| ACKNOWLEDGMENTS |
|---|
We thank Joe Gallagher for providing the L. perenne library, Chris Pollock for helpful discussions, and Steve Taylor for help with microscopy. This work was supported by BBSRC AFD grant D10173 to I.P.K., G.J. and R.N.J.
Manuscript received January 26, 2001; Accepted for publication November 21, 2002.
| LITERATURE CITED |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
ATKINSON, P. W., W. D. WARREN, and D. A. OBROCHTA, 1993 The Hobo transposable element of Drosophila can be cross-mobilized in houseflies and excises like the Ac element of maize. Proc. Natl. Acad. Sci. USA 90:9693-9697.
AVRAMOVA, Z., A. TIKHONOV, M. S. CHEN, and J. L. BENNETZEN, 1998 Matrix attachment regions and structural colinearity in the genomes of two grass species. Nucleic Acids Res. 26:761-767.
BENNETT, M. D., A. V. COX and I. J. LEITCH, 2000 Angiosperm DNA C-values database. http://www.rbgkew.org.uk/cval/database1.html.
CERRITELLI, S. M., O. Y. FEDOROFF, B. R. REID, and R. J. CROUCH, 1998 A common 40 amino acid motif in eukaryotic RNases H1 and caulimovirus ORF VI proteins binds to duplex RNAs. Nucleic Acids Res. 26:1834-1840.
CHOPRA, S., V. BRENDEL, J. B. ZHANG, J. D. AXTELL, and T. PETERSON, 1999 Molecular characterization of a mutable pigmentation phenotype and isolation of the first active transposable element from Sorghum bicolor. Proc. Natl. Acad. Sci. USA 96:15330-15335.
CRESSE, A. D., S. H. HULBERT, W. E. BROWN, J. R. LUCAS, and J. L. BENNETZEN, 1995 Mu1-related transposable elements of maize preferentially insert into low copy number DNA. Genetics 140:315-324.[Abstract]
FEDOROFF, N., M. SCHLAPPI, and R. RAINA, 1995 Epigenetic regulation of the maize Spm transposon. Bioessays 17:291-297.[Medline]
GIERL, A., H. SAEDLER, and P. A. PETERSON, 1989 Maize transposable elements. Annu. Rev. Genet. 23:71-85.[Medline]
GRAY, Y. H. M., 2000 It takes two transposons to tango—transposable-element-mediated chromosomal rearrangements. Trends Genet. 16:461-468.[Medline]
INGRAM, G. C., S. DOYLE, R. CARPENTER, E. A. SCHULTZ, and R. SIMON et al., 1997 Dual role for fimbriata in regulating floral homeotic genes and cell division in Antirrhinum. EMBO J. 16:6521-6534.[Medline]
JENKINS, G., J. HEAD, and J. W. FORSTER, 2000 Probing meiosis in hybrids of Lolium (Poaceae) with a discriminatory repetitive genomic sequence. Chromosoma 109:280-286.[Medline]
KUMAR, A. and J. L. BENNETZEN, 1999 Plant retrotransposons. Annu. Rev. Genet. 33:479-532.[Medline]
LANGDON, T., C. SEAGO, R. N. JONES, H. OUGHAM, and H. THOMAS et al., 2000a De novo evolution of satellite DNA on the rye B chromosome. Genetics 154:869-884.
LANGDON, T., C. SEAGO, M. MENDE, M. LEGGETT, and H. THOMAS et al., 2000b Retrotransposon evolution in diverse plant genomes. Genetics 156:313-325.
MARTIN, C. and C. LISTER, 1989 Genome juggling by transposons: Tam3-induced rearrangements in Antirrhinum majus. Dev. Genet. 10:438-451.[Medline]
MASSON, P., M. STREM, and N. FEDOROFF, 1991 The Tnpa and Tnpd gene-products of the Spm element are required for transposition in tobacco. Plant Cell 3:73-85.
NACKEN, W. K., R. PIOTROWIAK, H. SAEDLER, and H. SOMMER, 1991 The transposable element Tam1 from Antirrhinum majus shows structural homology to the maize transposon En/Spm and has no sequence specificity of insertion. Mol. Gen. Genet. 228:201-208.[Medline]
OZEKI, Y., E. DAVIES, and J. TAKEDA, 1997 Somatic variation during long term subculturing of plant cells caused by insertion of a transposable element in a phenylalanine ammonia-lyase (PAL) gene. Mol. Gen. Genet. 254:407-416.[Medline]
PANAVAS, T., J. WEIR, and E. L. WALKER, 1999 The structure and paramutagenicity of the R-marbled haplotype of Zea mays. Genetics 153:979-991.
PARDUE, M. L., O. N. DANILEVSKAYA, K. LOWENHAUPT, F. SLOT, and K. L. TRAVERSE, 1996 Drosophila telomeres: new views on chromosome evolution. Trends Genet. 12:48-52.[Medline]
RAINA, R., M. SCHLAPPI, B. KARUNANANDAA, A. ELHOFY, and N. FEDOROFF, 1998 Concerted formation of macromolecular suppressor-mutator transposition complexes. Proc. Natl. Acad. Sci. USA 95:8526-8531.
RHODES, P. R. and L. O. VODKIN, 1988 Organization of the Tgm family of transposable elements in soybean. Genetics 120:597-604.
RUBIN, E. and A. A. LEVY, 1997 Abortive gap repair: underlying mechanism for Ds element formation. Mol. Cell. Biol. 17:6294-6302.[Abstract]
SANMIGUEL, P., A. TIKHONOV, Y. K. JIN, N. MOTCHOULSKAIA, and D. ZAKHAROV et al., 1996 Nested retrotransposons in the intergenic regions of the maize genome. Science 274:765-768.
SANMIGUEL, P., B. S. GAUT, A. TIKHONOV, Y. NAKAJIMA, and J. L. BENNETZEN, 1998 The paleontology of intergene retrotransposons of maize. Nat. Genet. 20:43-45.[Medline]
SUONIEMI, A., D. SCHMIDT, and A. H. SCHULMAN, 1997 BARE-1 insertion site preferences and evolutionary conservation of RNA and cDNA processing sites. Genetica 100:219-230.[Medline]
TAKAHASHI, S., Y. INAGAKI, H. SATOH, A. HOSHINO, and S. IIDA, 1999 Capture of a genomic HMG domain sequence by the En/Spm-related transposable element Tpn1 in the Japanese morning glory. Mol. Gen. Genet. 261:447-451.[Medline]
THOMPSON, J. D., T. J. GIBSON, F. PLEWNIAK, F. JEANMOUGIN, and D. G. HIGGINS, 1997 The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25:4876-4882.
TIKHONOV, A. P., J. L. BENNETZEN, and Z. V. AVRAMOVA, 2000 Structural domains and matrix attachment regions along colinear chromosomal segments of maize and sorghum. Plant Cell 12:249-264.
TRENTMANN, S. M., H. SAEDLER, and A. GIERL, 1993 The transposable element En/Spm-encoded TNPA protein contains a DNA binding and a dimerization domain. Mol. Gen. Genet. 238:201-208.[Medline]
UPADHYAYA, K. C., H. SOMMER, E. KREBBERS, and H. SAEDLER, 1985 The paramutagenic line Niv-44 has a 5 kb insert, Tam-2, in the chalcone synthase gene of Antirrhinum-Majus. Mol. Gen. Genet. 199:201-207.
YAMASHITA, S., T. MIKAMI, and Y. KISHIMA, 1998 Tam3 in Antirrhinum majus is exceptional transposon in resistance to alteration by abortive gap repair: identification of nested transposons. Mol. Gen. Genet. 259:468-474.[Medline]
YAMASHITA, S., T. TAKANO-SHIMIZU, K. KITAMURA, T. MIKAMI, and Y. KISHIMA, 1999 Resistance to gap repair of the transposon Tam3 in Antirrhinum majus: a role of the end regions. Genetics 153:1899-1908.
ZHANG, Q., J. ARBUCKLE, and S. R. WESSLER, 2000 Recent, extensive, and preferential insertion of members of the miniature inverted-repeat transposable element family Heartbreaker into genic regions of maize. Proc. Natl. Acad. Sci. USA 97:1160-1165.
This article has been cited by other articles:
 |
|
 |
|
  M. Tomita, K. Shinohara, and M. Morimoto Revolver is a New Class of Transposon-like Gene Composing the Triticeae Genome DNA Res, February 1, 2008; 15(1): 49 - 62. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. M. Devos, J. Ma, A. C. Pontaroli, L. H. Pratt, and J. L. Bennetzen Analysis and mapping of randomly chosen bacterial artificial chromosome clones from hexaploid bread wheat PNAS, December 27, 2005; 102(52): 19243 - 19248. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Zhang and S. R. Wessler Genome-wide comparative analysis of the transposable elements in the related species Arabidopsis thaliana and Brassica oleracea PNAS, April 13, 2004; 101(15): 5589 - 5594. [Abstract] [Full Text] [PDF]
|
|
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Langdon, T.
- Articles by King, I. P.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Langdon, T.
- Articles by King, I. P.